The Loss of TET2 Promotes CD8+ T Cell Memory Differentiation Shannon A

Total Page:16

File Type:pdf, Size:1020Kb

Load more

The Loss of TET2 Promotes CD8+ T Cell Memory Differentiation Shannon A. Carty, Mercy Gohil, Lauren B. Banks, Renee M. Cotton, Matthew E. Johnson, Erietta Stelekati, Andrew D. This information is current as Wells, E. John Wherry, Gary A. Koretzky and Martha S. of September 29, 2021. Jordan J Immunol published online 17 November 2017 http://www.jimmunol.org/content/early/2017/11/17/jimmun ol.1700559 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2017/11/17/jimmunol.170055 Material 9.DCSupplemental http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 29, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2017 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published November 17, 2017, doi:10.4049/jimmunol.1700559 The Journal of Immunology The Loss of TET2 Promotes CD8+ T Cell Memory Differentiation Shannon A. Carty,*,1 Mercy Gohil,† Lauren B. Banks,† Renee M. Cotton,‡ Matthew E. Johnson,x Erietta Stelekati,{,‖ Andrew D. Wells,‡,x,‖ E. John Wherry,{,‖ Gary A. Koretzky,†,# and Martha S. Jordan‡,‖ T cell differentiation requires appropriate regulation of DNA methylation. In this article, we demonstrate that the methylcytosine dioxygenase ten-eleven translocation (TET)2 regulates CD8+ T cell differentiation. In a murine model of acute viral infection, TET2 loss promotes early acquisition of a memory CD8+ T cell fate in a cell-intrinsic manner without disrupting Ag-driven cell expansion or effector function. Upon secondary recall, TET2-deficient memory CD8+ T cells demonstrate superior pathogen control. Genome-wide methylation analysis identified a number of differentially methylated regions in TET2-deficient versus wild- type CD8+ T cells. These differentially methylated regions did not occur at the loci of differentially expressed memory markers; Downloaded from rather, several hypermethylated regions were identified in known transcriptional regulators of CD8+ T cell memory fate. Together, these data demonstrate that TET2 is an important regulator of CD8+ T cell fate decisions. The Journal of Immunology, 2018, 200: 000–000. n response to infection, naive CD8+ T cells proliferate and Several cell surface proteins can be used to identify cells with differentiate into a heterogeneous pool of Ag-specific cells differing memory potential. Ag-specific CD8+ T cells that are http://www.jimmunol.org/ having divergent cell fates. Following pathogen clearance, most CD127hi and KLRG1lo preferentially differentiate into long-lived I + Ag-specific CD8 T cells die, but a subset persists to become long- memory cells, whereas CD127lo and KLRG1hi cells are largely lived memory cells, which are able to rapidly respond to rechallenge. short-lived terminally differentiated effector cells (1–3). This program of CD8+ T cell differentiation is regulated through the integration of signals from the TCR, costimulatory/coinhibitory *Department of Medicine, Perelman School of Medicine, University of Pennsylvania, receptors, and inflammatory cytokines, which direct transcrip- Philadelphia, PA 19104; †Abramson Family Cancer Research Institute, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA 19104; tional changes that control cell fate. Although it is evident that ‡ Department of Pathology and Laboratory Medicine, Perelman School of Medicine, particular transcription factors, such as T-bet, eomesodermin by guest on September 29, 2021 University of Pennsylvania, Philadelphia, PA 19104; xThe Children’s Hospital of { (Eomes), Blimp-1, Bcl-6, IRF4, and Runx3, are important in de- Philadelphia, Philadelphia, PA 19104; Department of Microbiology, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA 19104; ‖Institute termining the fate of activated cells (4–11), it is also becoming for Immunology, Perelman School of Medicine, University of Pennsylvania, clear that epigenetic programming plays a crucial role in T cell Philadelphia, PA 19104; and #Department of Medicine, Weill Cornell Medicine, New York, NY 10065 fate determination. DNA methylation is one epigenetic mechanism by which T cell 1Current address: Department of Medicine and University of Michigan Comprehen- sive Cancer Center, University of Michigan, Ann Arbor, MI. differentiation is regulated, and recent genome-wide studies have ORCIDs: 0000-0002-8727-9723 (M.G.); 0000-0003-4521-8911 (R.M.C.); 0000- identified coordinated epigenetic changes associated with tran- 0002-8684-5359 (M.E.J.); 0000-0003-4155-3202 (G.A.K.); 0000-0003-2359- scriptional programs during CD4+ or CD8+ T cell differentiation 3227 (M.S.J.). (12–19). It is now appreciated that DNA undergoes regulated Received for publication April 19, 2017. Accepted for publication October 10, 2017. demethylation. Recently, the ten-eleven translocation (TET) This work was supported by National Institutes of Health Grants K08 AI101008 (to family of methylcytosine dioxygenases was shown to mediate this S.A.C.), R37 GM053256 (to G.A.K.), AI105343, AI112521, AI082630, and AI115712 (to E.J.W.) and other support from R01AI082292. process by catalyzing the conversion of 5-methylcytosine (5mC) The sequencing data presented in this article have been submitted to the National to 5-hydroxymethylcytosine (5hmC) and, subsequently, to 5-for- Center for Biotechnology Gene Expression Omnibus (https://www.ncbi.nlm.nih.gov/ mylcytosine and 5-carboxylcytosine, critical enzymatic steps geo/query/acc.cgi?acc=GSE105176) under accession number GSE105176. necessary for generating unmodified cytosines (20–22). The TET Address correspondence and reprint requests to Dr. Martha S. Jordan or Dr. Gary A. family member TET2 is widely expressed in the hematopoietic Koretzky, University of Pennsylvania, BRB II/III, Room 507, 421 Curie Boulevard, Philadelphia, PA 19104 (M.S.J.) or 1300 York Avenue, A125, New York, NY 10065 system, and murine models reveal that TET2 loss leads to ex- (G.A.K.). E-mail addresses: [email protected] (M.S.J.) or pansion of hematopoietic stem cells (HSCs) and myeloid com- [email protected] (G.A.K.) partments (23–26). In T cells, TET2 contributes to CD4+ Th cell The online version of this article contains supplemental material. differentiation (27) and cooperates with TET3 to stabilize Foxp3 Abbreviations used in this article: AF, Alexa Fluor; DMC, differentially methylated expression in regulatory T cells (28). cytosine; DMR, differentially methylated region; Eomes, eomesodermin; ERRBS, + enhanced reduced representation bisulfite sequencing; 5hmC, 5-hydroxymethylcyto- However, the function of TET2 in CD8 T cell differentiation is sine; HSC, hematopoietic stem cell; IPA, Ingenuity Pathway Analysis; LCMV, lym- unknown. In this study, we investigated TET2’s role in directing phocytic choriomeningitis virus; Lm-gp33, Listeria monocytogenes that expresses the + LCMV gp33 epitope; 5mC, 5-methylcytosine; MPEC, memory precursor effector CD8 T cell fate following acute lymphocytic choriomeningitis cell; p.i., postinfection; SLEC, short-lived effector cell; TCM, central memory virus (LCMV) infection. We found that TCR signaling rapidly CD8+ T cell; TET, ten-eleven translocation; TET2cKO, TET2 conditional knockout; and dynamically regulates TET2 expression and TET activity. WT, wild-type. Although mice with selective loss of TET2 in T cells have no overt Copyright Ó 2017 by The American Association of Immunologists, Inc. 0022-1767/17/$35.00 thymic or peripheral T cell phenotypes at steady-state, following www.jimmunol.org/cgi/doi/10.4049/jimmunol.1700559 2 TET2 REGULATES CD8+ T CELL MEMORY acute viral infection, CD8+ T cells preferentially adopt a memory performed using a Cytofix/Cytoperm kit (BD Biosciences) or a Foxp3/ phenotype in a cell-intrinsic manner and demonstrate superior Transcription Factor Staining Buffer Set (eBioscience), according to the pathogen control upon rechallenge. Methylation analysis of LCMV- manufacturer’s instructions. Discrimination of live cell populations was per- + formed using LIVE/DEAD Aqua stain (Invitrogen), according to the manu- specific CD8 T cells identified genomic loci that gained 5mC/5hmC facturer’s instructions. in TET2-deficient cells, including several transcriptional regulators For experiments involving measurement of intracellular 5hmC, T cells known to direct CD8+ T cell effector versus memory differentiation. were surface stained prior to fixation/permeabilization with a Cytofix/ Together, these data demonstrate a novel role for TET2 in directing Cytoperm kit (BD Biosciences), treated with DNase I (300 mg/ml in + PBS) at 37˚C for 1 h, and intracellularly stained with isotype or anti–5hmC CD8 T cell fates. (catalog number 39791; 1 mg/ml; Active Motif) Ab for 30 min, followed by fluorochrome-conjugated goat anti-rabbit secondary Ab (Invitrogen). Materials and Methods For experiments involving ex vivo stimulation,
Recommended publications
  • Autism Multiplex Family with 16P11.2P12.2 Microduplication Syndrome in Monozygotic Twins and Distal 16P11.2 Deletion in Their Brother

    Autism Multiplex Family with 16P11.2P12.2 Microduplication Syndrome in Monozygotic Twins and Distal 16P11.2 Deletion in Their Brother

    European Journal of Human Genetics (2012) 20, 540–546 & 2012 Macmillan Publishers Limited All rights reserved 1018-4813/12 www.nature.com/ejhg ARTICLE Autism multiplex family with 16p11.2p12.2 microduplication syndrome in monozygotic twins and distal 16p11.2 deletion in their brother Anne-Claude Tabet1,2,3,4, Marion Pilorge2,3,4, Richard Delorme5,6,Fre´de´rique Amsellem5,6, Jean-Marc Pinard7, Marion Leboyer6,8,9, Alain Verloes10, Brigitte Benzacken1,11,12 and Catalina Betancur*,2,3,4 The pericentromeric region of chromosome 16p is rich in segmental duplications that predispose to rearrangements through non-allelic homologous recombination. Several recurrent copy number variations have been described recently in chromosome 16p. 16p11.2 rearrangements (29.5–30.1 Mb) are associated with autism, intellectual disability (ID) and other neurodevelopmental disorders. Another recognizable but less common microdeletion syndrome in 16p11.2p12.2 (21.4 to 28.5–30.1 Mb) has been described in six individuals with ID, whereas apparently reciprocal duplications, studied by standard cytogenetic and fluorescence in situ hybridization techniques, have been reported in three patients with autism spectrum disorders. Here, we report a multiplex family with three boys affected with autism, including two monozygotic twins carrying a de novo 16p11.2p12.2 duplication of 8.95 Mb (21.28–30.23 Mb) characterized by single-nucleotide polymorphism array, encompassing both the 16p11.2 and 16p11.2p12.2 regions. The twins exhibited autism, severe ID, and dysmorphic features, including a triangular face, deep-set eyes, large and prominent nasal bridge, and tall, slender build. The eldest brother presented with autism, mild ID, early-onset obesity and normal craniofacial features, and carried a smaller, overlapping 16p11.2 microdeletion of 847 kb (28.40–29.25 Mb), inherited from his apparently healthy father.
  • Transcriptome-Wide Map of M6a Circrnas Identified in a Rat Model Of

    Transcriptome-Wide Map of M6a Circrnas Identified in a Rat Model Of

    Su et al. BMC Genomics (2020) 21:39 https://doi.org/10.1186/s12864-020-6462-y RESEARCH ARTICLE Open Access Transcriptome-wide map of m6A circRNAs identified in a rat model of hypoxia mediated pulmonary hypertension Hua Su, Guowen Wang, Lingfang Wu, Xiuqing Ma, Kejing Ying and Ruifeng Zhang* Abstract Background: Hypoxia mediated pulmonary hypertension (HPH) is a lethal disease and lacks effective therapy. CircRNAs play significant roles in physiological process. Recently, circRNAs are found to be m6A-modified. The abundance of circRNAs was influenced by m6A. Furthermore, the significance of m6A circRNAs has not been elucidated in HPH yet. Here we aim to investigate the transcriptome-wide map of m6A circRNAs in HPH. Results: Differentially expressed m6A abundance was detected in lungs of HPH rats. M6A abundance in circRNAs was significantly reduced in hypoxia in vitro. M6A circRNAs were mainly from protein-coding genes spanned single exons in control and HPH groups. Moreover, m6A influenced the circRNA–miRNA–mRNA co-expression network in hypoxia. M6A circXpo6 and m6A circTmtc3 were firstly identified to be downregulated in HPH. Conclusion: Our study firstly identified the transcriptome-wide map of m6AcircRNAsinHPH. M6A can influence circRNA–miRNA–mRNA network. Furthermore, we firstly identified two HPH-associated m6AcircRNAs: circXpo6 and circTmtc3. However, the clinical significance of m6A circRNAs for HPH should be further validated. Keywords: m6A circRNAs, Hypoxia mediated pulmonary hypertension, m6A circXpo6, m6A circTmtc3 Background Circular RNAs (circRNAs) were firstly found abundant Pulmonary hypertension (PH) is a lethal disease and defined in eukaryotes using RNA-seq approach [5–7]. Pre-mRNA as an increase in the mean pulmonary arterial pressure ≥ 25 is spliced with the 5′ and 3′ ends, forming a ‘head-to-tail’ mmHg at rest, as measured by right heart catheterization [1].
  • Open Data for Differential Network Analysis in Glioma

    Open Data for Differential Network Analysis in Glioma

    International Journal of Molecular Sciences Article Open Data for Differential Network Analysis in Glioma , Claire Jean-Quartier * y , Fleur Jeanquartier y and Andreas Holzinger Holzinger Group HCI-KDD, Institute for Medical Informatics, Statistics and Documentation, Medical University Graz, Auenbruggerplatz 2/V, 8036 Graz, Austria; [email protected] (F.J.); [email protected] (A.H.) * Correspondence: [email protected] These authors contributed equally to this work. y Received: 27 October 2019; Accepted: 3 January 2020; Published: 15 January 2020 Abstract: The complexity of cancer diseases demands bioinformatic techniques and translational research based on big data and personalized medicine. Open data enables researchers to accelerate cancer studies, save resources and foster collaboration. Several tools and programming approaches are available for analyzing data, including annotation, clustering, comparison and extrapolation, merging, enrichment, functional association and statistics. We exploit openly available data via cancer gene expression analysis, we apply refinement as well as enrichment analysis via gene ontology and conclude with graph-based visualization of involved protein interaction networks as a basis for signaling. The different databases allowed for the construction of huge networks or specified ones consisting of high-confidence interactions only. Several genes associated to glioma were isolated via a network analysis from top hub nodes as well as from an outlier analysis. The latter approach highlights a mitogen-activated protein kinase next to a member of histondeacetylases and a protein phosphatase as genes uncommonly associated with glioma. Cluster analysis from top hub nodes lists several identified glioma-associated gene products to function within protein complexes, including epidermal growth factors as well as cell cycle proteins or RAS proto-oncogenes.
  • Intrinsic Disorder of the BAF Complex: Roles in Chromatin Remodeling and Disease Development

    Intrinsic Disorder of the BAF Complex: Roles in Chromatin Remodeling and Disease Development

    International Journal of Molecular Sciences Article Intrinsic Disorder of the BAF Complex: Roles in Chromatin Remodeling and Disease Development Nashwa El Hadidy 1 and Vladimir N. Uversky 1,2,* 1 Department of Molecular Medicine, Morsani College of Medicine, University of South Florida, 12901 Bruce B. Downs Blvd. MDC07, Tampa, FL 33612, USA; [email protected] 2 Laboratory of New Methods in Biology, Institute for Biological Instrumentation of the Russian Academy of Sciences, Federal Research Center “Pushchino Scientific Center for Biological Research of the Russian Academy of Sciences”, Pushchino, 142290 Moscow Region, Russia * Correspondence: [email protected]; Tel.: +1-813-974-5816; Fax: +1-813-974-7357 Received: 20 September 2019; Accepted: 21 October 2019; Published: 23 October 2019 Abstract: The two-meter-long DNA is compressed into chromatin in the nucleus of every cell, which serves as a significant barrier to transcription. Therefore, for processes such as replication and transcription to occur, the highly compacted chromatin must be relaxed, and the processes required for chromatin reorganization for the aim of replication or transcription are controlled by ATP-dependent nucleosome remodelers. One of the most highly studied remodelers of this kind is the BRG1- or BRM-associated factor complex (BAF complex, also known as SWItch/sucrose non-fermentable (SWI/SNF) complex), which is crucial for the regulation of gene expression and differentiation in eukaryotes. Chromatin remodeling complex BAF is characterized by a highly polymorphic structure, containing from four to 17 subunits encoded by 29 genes. The aim of this paper is to provide an overview of the role of BAF complex in chromatin remodeling and also to use literature mining and a set of computational and bioinformatics tools to analyze structural properties, intrinsic disorder predisposition, and functionalities of its subunits, along with the description of the relations of different BAF complex subunits to the pathogenesis of various human diseases.
  • A High Throughput, Functional Screen of Human Body Mass Index GWAS Loci Using Tissue-Specific Rnai Drosophila Melanogaster Crosses Thomas J

    A High Throughput, Functional Screen of Human Body Mass Index GWAS Loci Using Tissue-Specific Rnai Drosophila Melanogaster Crosses Thomas J

    Washington University School of Medicine Digital Commons@Becker Open Access Publications 2018 A high throughput, functional screen of human Body Mass Index GWAS loci using tissue-specific RNAi Drosophila melanogaster crosses Thomas J. Baranski Washington University School of Medicine in St. Louis Aldi T. Kraja Washington University School of Medicine in St. Louis Jill L. Fink Washington University School of Medicine in St. Louis Mary Feitosa Washington University School of Medicine in St. Louis Petra A. Lenzini Washington University School of Medicine in St. Louis See next page for additional authors Follow this and additional works at: https://digitalcommons.wustl.edu/open_access_pubs Recommended Citation Baranski, Thomas J.; Kraja, Aldi T.; Fink, Jill L.; Feitosa, Mary; Lenzini, Petra A.; Borecki, Ingrid B.; Liu, Ching-Ti; Cupples, L. Adrienne; North, Kari E.; and Province, Michael A., ,"A high throughput, functional screen of human Body Mass Index GWAS loci using tissue-specific RNAi Drosophila melanogaster crosses." PLoS Genetics.14,4. e1007222. (2018). https://digitalcommons.wustl.edu/open_access_pubs/6820 This Open Access Publication is brought to you for free and open access by Digital Commons@Becker. It has been accepted for inclusion in Open Access Publications by an authorized administrator of Digital Commons@Becker. For more information, please contact [email protected]. Authors Thomas J. Baranski, Aldi T. Kraja, Jill L. Fink, Mary Feitosa, Petra A. Lenzini, Ingrid B. Borecki, Ching-Ti Liu, L. Adrienne Cupples, Kari E. North, and Michael A. Province This open access publication is available at Digital Commons@Becker: https://digitalcommons.wustl.edu/open_access_pubs/6820 RESEARCH ARTICLE A high throughput, functional screen of human Body Mass Index GWAS loci using tissue-specific RNAi Drosophila melanogaster crosses Thomas J.
  • Mapping of M6a and Its Regulatory Targets in Prostate Cancer Reveals a METTL3-Low Induction of Therapy Resistance

    Mapping of M6a and Its Regulatory Targets in Prostate Cancer Reveals a METTL3-Low Induction of Therapy Resistance

    Author Manuscript Published OnlineFirst on June 4, 2021; DOI: 10.1158/1541-7786.MCR-21-0014 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Mapping of m6A and Its Regulatory Targets in Prostate Cancer Reveals a METTL3-low Induction of Therapy Resistance Kellie A. Cotter1, John Gallon2, Nadine Uebersax1, Philip Rubin1, Kate D. Meyer3,4, Salvatore Piscuoglio2,5,6, Samie R. Jaffrey7*, Mark A. Rubin1,8,9,* 1 Department for BioMedical Research, University of Bern, Bern, Switzerland 2 Visceral surgery and Precision Medicine research laboratory, Department of Biomedicine, University of Basel, Basel, Switzerland 3 Department of Biochemisty, Duke University School of Medicine, Durham, NC, USA 4 Department of Neurobiology, Duke University School of Medicine, Durham, NC, USA 5 Institute of Medical Genetics and Pathology, University Hospital Basel, Basel, Switzerland 6 Clarunis, Department of Visceral Surgery, University Centre for Gastrointestinal and Liver Diseases, St. Clara Hospital and University Hospital Basel, Switzerland 7 Department of Pharmacology, Weill Cornell Medicine, New York, NY, USA 8 Inselspital, Bern, Switzerland 9 Bern Center for Precision Medicine, Bern, Switzerland * Co-senior and corresponding authors: [email protected] [email protected] RUNNING TITLE m6A targets in PCa: low METTL3 induces therapy resistance KEYWORDS m6A, epitranscriptomics, prostate cancer, METTL3, castration resistance FINANCIAL SUPPORT This project was supported by funding from the Prostate Cancer Foundation (18YOUN06, K.A.C.), the Weill Cornell Medicine SPORE in Prostate Cancer (Developmental Research Project, S.R.J. and M.A.R.), the Swiss Cancer League (KFS-4988-02-2020-R, S.P.), and the NIH (R01CA186702, S.R.J.).
  • Proteomics of Nucleocytoplasmic Partitioning

    Proteomics of Nucleocytoplasmic Partitioning

    Available online at www.sciencedirect.com ScienceDirect Proteomics of nucleocytoplasmic partitioning Thao Nguyen, Nishant Pappireddi and Martin Wu¨ hr The partitioning of the proteome between nucleus and activation. Kinase activity can also be regulated via sub- cytoplasm affects nearly every aspect of eukaryotic biology. cellular localization: cyclin B needs to relocalize into the Despite this central role, we still have a poor understanding of nucleus to induce NE breakdown, which is required for which proteins localize in the nucleus and how this varies in the transition from G2 to mitosis [3]. Considering the different cell types and conditions. Recent advances in importance of subcellular localization in encoding impor- quantitative proteomics and high-throughput imaging are tant cellular information, it is not surprising that mis- starting to close this knowledge gap. Studies on protein regulation of nuclear transport has been associated with interaction are beginning to reveal the spectrum of cargos of multiple diseases, including developmental defects and nuclear import and export receptors.We anticipate that it will cancer [4–6]. Targeting mis-regulation of NC partitioning soon be possible to predict each protein’s nucleocytoplasmic has emerged as a promising therapeutic approach, partic- localization based on its importin/exportin interactions and its ularly for cancer treatment [7–11]. estimated diffusion rate through the nuclear pore. This insight is likely to provide us with a fundamental understanding of Many previous studies have reported this subcellular how cells use nucleocytoplasmic partitioning to encode and localization of individual proteins. Recent technological relay information. advances in methods such as mass spectrometry (MS) now allow us to look at the entire proteome at once.
  • Tepzz 8Z6z54a T

    Tepzz 8Z6z54a T

    (19) TZZ ZZ_T (11) EP 2 806 054 A1 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: (51) Int Cl.: 26.11.2014 Bulletin 2014/48 C40B 40/06 (2006.01) C12Q 1/68 (2006.01) C40B 30/04 (2006.01) C07H 21/00 (2006.01) (21) Application number: 14175049.7 (22) Date of filing: 28.05.2009 (84) Designated Contracting States: (74) Representative: Irvine, Jonquil Claire AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HGF Limited HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL 140 London Wall PT RO SE SI SK TR London EC2Y 5DN (GB) (30) Priority: 28.05.2008 US 56827 P Remarks: •Thecomplete document including Reference Tables (62) Document number(s) of the earlier application(s) in and the Sequence Listing can be downloaded from accordance with Art. 76 EPC: the EPO website 09753364.0 / 2 291 553 •This application was filed on 30-06-2014 as a divisional application to the application mentioned (71) Applicant: Genomedx Biosciences Inc. under INID code 62. Vancouver, British Columbia V6J 1J8 (CA) •Claims filed after the date of filing of the application/ after the date of receipt of the divisional application (72) Inventor: Davicioni, Elai R.68(4) EPC). Vancouver British Columbia V6J 1J8 (CA) (54) Systems and methods for expression- based discrimination of distinct clinical disease states in prostate cancer (57) A system for expression-based discrimination of distinct clinical disease states in prostate cancer is provided that is based on the identification of sets of gene transcripts, which are characterized in that changes in expression of each gene transcript within a set of gene transcripts can be correlated with recurrent or non- recur- rent prostate cancer.
  • Supplementary Table I. Morpholino Oligonucleotides and Primer Sequences Used in This Study

    Supplementary Table I. Morpholino Oligonucleotides and Primer Sequences Used in This Study

    Supplementary Table I. Morpholino oligonucleotides and primer sequences used in this study Oligonucleotide Name Accession Sequence Morpholinos tlr5a AY389449 5'-AAAGTGTATGTAGCTGCCATTCTGG tlr5b AY389450 5'-TGAATGTATATCCCATTCTGTGAGC myd88 AY388401 5'-TAGCAAAACCTCTGTTATCCAGCGA myd88 5bp mismatch AY388401 5'-TAcCAtAACCTgTGTTATCgAGgGA standard control morpholino 5'-CCTCTTACCTCAGTTACAATTTATA qRT-PCR ppial-qP1-Fw AY391451 5’- ACACTGAAACACGGAGGCAAAG ppial-qP2-Rev 5’- CATCCACAACCTTCCCGAACAC irak3-qP1-Fw CK026195 5’- TGAGGTCTACTGTGGACGATGG irak3-qP2-Rev 5’- ATGTTAGGATGCTGGTTGAGTTGG tlr5a-qP1-Fw AY389449 5’-ATTCTGGTGGTGCTTGTTGTAG tlr5a-qP2-Rev 5’-ACGAGGTAACTTCTGTTCTCAATG tlr5b-qP3-Fw AY389450 5’-GCGTTGTTGAAGAGGCTGGAC tlr5b-qP4-Rev 5’-TTCTGGATGGCCACTTCTCATATTGG mmp9-qP3-Fw NM_213123 5’-CATTAAAGATGCCCTGATGTATCCC mmp9-qP4-Rev 5’-AGTGGTGGTCCGTGGTTGAG il1b-qP1-Fw NM_212844 5’-GAACAGAATGAAGCACATCAAACC il1b-qP2-Rev 5’-ACGGCACTGAATCCACCAC il8-qP1-Fw XM_001342570 5’-TGTGTTATTGTTTTCCTGGCATTTC il8-qP2-Rev 5’-GCGACAGCGTGGATCTACAG ifn1-qP3-Fw NM_207640 5’- TTAATACACGCAAAGATGAGAACTC ifn1-qP4-Rev 5’- GCCAAGCCATTCGCAAGTAG tnfa-qP5-Fw NM_212829 5’- AGACCTTAGACTGGAGAGATGAC tnfa-qP6-Rev 5’- CAAAGACACCTGGCTGTAGAC cxcl-C1c-qP1-Fw NM_001115060 5’- GGCATTCACACCCAAAGCG cxcl-C1c-qP2_Rev 5’- GCGAGCACGATTCACGAGAG * In situ ccl-C5a-Fw NM_001082906 5’- CATCACTAGGAAAGGATTGAAC ccl-C5a-Rev-T7 5’- TAATACGACTCACTATAGGGGATGTCAAAGACTTTATTCAC cxcl-C1c-Fw NM_001115060 5’- GTTAAACATAAATAACACCGACTC cxcl-C1c-Rev-T7 5’- TAATACGACTCACTATAGGGACACCCTATAAAACTGAGTA irak3-Fw CK026195 5’- CAGTGAGAGAGGCATGAAACATC
  • Signatures of Adverse Pathological Features, Androgen Insensitivity and Metastatic Potential in Prostate Cancer

    Signatures of Adverse Pathological Features, Androgen Insensitivity and Metastatic Potential in Prostate Cancer

    ANTICANCER RESEARCH 35: 5443-5452 (2015) Signatures of Adverse Pathological Features, Androgen Insensitivity and Metastatic Potential in Prostate Cancer YURI TOLKACH, AXEL MERSEBURGER, THOMAS HERRMANN, MARKUS KUCZYK, JÜRGEN SERTH and FLORIAN IMKAMP Clinic for Urology and Urologic Oncology, Hannover Medical School, Hannover, Germany Abstract. Background/Aim: The genetic characterization of The natural course of prostate cancer, its aggressiveness, prostate tumors is important for personalized therapy. The invasiveness and metastatic potential cannot be determined aim of the present study was to investigate the role of and predicted by clinical parameters alone (1, 2). Thus, genetic previously described prostate cancer-related genes in the characterization of prostate tumours is considered an essential genetic characterization of prostate tumors. Materials and step in the development of individualized therapy (3). All Methods: Forty-two genes were selected for expression tumors are separate entities, which, nevertheless, share some analysis (real time-quantitative polymerase chain reaction). common genetic changes (4). The identification of these One normal prostatic epithelial cell line and three would have a major clinical impact on everyday practice. standardized prostate cancer cell lines were used. Twenty- In recent years, multiple gene expression analysis (mRNA eight patients treated with radical prostatectomy were expression) of prostate cancer has been the focus of intensive included in the study. Results: The following genes appeared study. Previous attempts led to the identification of genes to be possibly related to the metastatic potential of the tumor: specific for high-grade tumours (5), aggressive prostate ELOVL fatty acid elongase 7 (ELOVL7), enhancer of zeste 2 cancer with a tendency towards recurrence (6-12), lethal polycomb repressive complex 2 subunit (EZH2), gastrulation tumours (10, 13) and hormone-refractory (14, 15) and brain homeobox 2 (GBX2), golgi membrane protein 1 metastatic prostate cancer (10, 16).
  • A Deep Proteomics Perspective on CRM1-Mediated Nuclear Export and Nucleocytoplasmic Partitioning

    A Deep Proteomics Perspective on CRM1-Mediated Nuclear Export and Nucleocytoplasmic Partitioning

    A deep proteomics perspective on CRM1-mediated nuclear export and nucleocytoplasmic partitioning Koray Kırlı 1#, Samir Karaca1,2#, Heinz-Jürgen Dehne 1, Matthias Samwer 1,4, Kuan- Ting Pan 2, Christof Lenz 2,3, Henning Urlaub2,3* and Dirk Görlich1* 1 Department of Cellular Logistics and 2 Bioanalytical Mass Spectrometry Group, Max Planck Institute for Biophysical Chemistry, Göttingen, Germany; 3 Bioanalytics, Institute for Clinical Chemistry, University Medical Center Göttingen, Göttingen, Germany. 4 Current address: Institute of Molecular Biotechnology of the Austrian Academy of Sciences (IMBA), Vienna, Austria. # Joint first authors; *Joint corresponding authors; E-mail: [email protected]; [email protected] Abstract CRM1 is a highly conserved, RanGTPase-driven exportin that carries proteins and RNPs from the nucleus to the cytoplasm. We now explored the cargo-spectrum of CRM1 in depth and identified surprisingly large numbers, namely >700 export substrates from the yeast S. cerevisiae, ≈ 1000 from Xenopus oocytes and >1050 from human cells. In addition, we quantified the partitioning of ≈5000 unique proteins between nucleus and cytoplasm of Xenopus oocytes. The data suggest new CRM1 functions in spatial control of vesicle coat-assembly, centrosomes, autophagy, peroxisome biogenesis, cytoskeleton, ribosome maturation, translation, mRNA degradation, and more generally in precluding a potentially detrimental action of cytoplasmic pathways within the nuclear interior. There are also numerous new instances where CRM1 appears to act in regulatory circuits. Altogether, our dataset allows unprecedented insights into the nucleocytoplasmic organisation of eukaryotic cells, into the contributions of an exceedingly promiscuous exportin and it provides a new basis for NES prediction. 2 Introduction The nuclear envelope (NE) separates the cell nucleus from the cytoplasm.
  • Identification of Transcripts Overexpressed During Airway

    Identification of Transcripts Overexpressed During Airway

    ERJ Express. Published on March 5, 2008 as doi: 10.1183/09031936.00172107 IDENTIFICATION OF TRANSCRIPTS OVEREXPRESSED DURING AIRWAY EPITHELIUM DIFFERENTIATION Brigitte CHHIN (1, 2)*, Jacqueline PHAM (1, 2)*, Loubna EL ZEIN (1, 2), Karine KAISER (3), Olivier MERROT (4), Patrice BOUVAGNET (1, 2, 5) Laboratoire Cardiogénétique, EA 4171, Université Lyon 1, Lyon, France (1); Laboratoire Cardiogénétique, ERM 0107, INSERM, Lyon, France (2); Laboratoire de Parasitologie, Université Lyon 1, Lyon, France (3); Service ORL, Hôpital de la Croix-Rousse, Hospices Civils de Lyon, Lyon, France (4); Laboratoire Cardiogénétique, CBPE, Groupe Hospitalier Est, Hospices Civils de Lyon, Lyon, France (5). * These authors contributed equally to this study. Address for correspondence : Patrice BOUVAGNET Laboratoire Cardiogénétique, CBPE, Groupe Hospitalier Est 59, boulevard Pinel 69677 Bron, France Tel.: +33 472 12 96 76; Fax: +33 427 85 59 00 Mail: [email protected] Short title: AIRWAY EPITHELIUM SPECIFIC TRANSCRIPTS Copyright 2008 by the European Respiratory Society. ABSTRACT Human airway epithelium, the forefront defence protecting the respiratory tract, evacuates inhaled particles by a permanent beating of epithelial cells cilia. When deficient, this organelle causes Primary Ciliary Dyskinesia (PCD), and despite numerous studies, data regarding ciliated cells gene expression are still incomplete. To identify genes specifically expressed in human ciliated respiratory cells, we performed a transcriptional analysis. The transcriptome of de-differentiated epithelial cells was subtracted from fully re- differentiated cells using cDNA Representational Difference Analysis (RDA). To validate our results, gene overexpression in ciliated cells was confirmed by real-time PCR (RT-PCR), and by comparing our list of ciliated cell overexpressed genes to list obtained in previous studies.