DOCSLIB.ORG

A Novel Epigenetic Regulation of Circfoxp1 on Foxp1 in Colon Cancer Cells Yanwei Luo1, Fengxia Liu1,Jinqima1,Yunfengfu1 and Rong Gui1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A Novel Epigenetic Regulation of Circfoxp1 on Foxp1 in Colon Cancer Cells Yanwei Luo1, Fengxia Liu1,Jinqima1,Yunfengfu1 and Rong Gui1 Luo et al. Cell Death and Disease (2020) 11:782 https://doi.org/10.1038/s41419-020-03007-6 Cell Death & Disease ARTICLE Open Access A novel epigenetic regulation of circFoxp1 on Foxp1 in colon cancer cells Yanwei Luo1, Fengxia Liu1,JinqiMa1,YunfengFu1 and Rong Gui1 Abstract Foxp1 is a tumor suppressor in colon cancer. However, circFoxp1 derived from Foxp1 is an oncogene. In this study, we aim to investigate the role of circFoxp1 in colon cancer and the regulatory mechanism between circFoxp1 and Foxp1. 78 human colon tumor tissues and the matched paracancerous tissues were collected. Quantitative polymerase chain reaction, immunohistochemistry, quantitative methylation-specific PCR, chromatin immunoprecipitation assay, CCK-8 assay, and Tumor xenograft in nude mice were performed. The expression of circFoxp1 was increased and Foxp1 was reduced in colon cancer tissues, which were associated with a poor overall survival rate of the patients with colon cancer. CircFoxp1 recruited DNMT1 to the promoter of Foxp1, leading to promotor hypermethylation, thereby inhibiting Foxp1 transcription. Interfering circFoxp1 by siRNA in SW620 cells significantly inhibited cell viability, while knockdown Foxp1 expression partially restored SW620 cell viability. In addition, knockdown of circFoxp1 significantly sensitized colon cancer cells to Capecitabine in vitro and vivo through regulating Foxp1. We discovered a novel epigenetic pathway that circFoxp1 regulated Foxp1 in colon cancer cells. CircFoxp1 may regulate DNA methylation and demethylation to coordinate colon cancer cell proliferation and participate in chemotherapy drug responses. Therefore, circFoxp1 may be a potential therapeutic target for colon cancer. 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; Introduction function in the development of human tumors. On the The forkhead box protein 1 (Foxp1) belongs to the P one hand, overexpression of Foxp1 induced by chromo- subfamily of the FOX (Forkhead Box) family. These pro- somal translocation causes diffuse large B-cell lymphoma teins functions in embryo development, cell cycle reg- (DLBCL), suggesting that Foxp1 has the role of onco- ulation, metabolism, and immune regulation. The gene4. On the other hand, Foxp1 is located on chromo- abnormal expression of these genes is associated with some 3p14.1, which is a tumor suppressor region; and the tumorigenesis1. Foxp1 is a key transcriptional regulatory high expression of Foxp1 in human primary breast cancer factor in the development of B lymphocytes2. Banham is associated with a good prognosis, suggesting that Foxp1 et al. found for the first time that Foxp1 gene can be is a tumor suppressor in breast cancer5. In addition, in detected in various normal and tumor tissues, including androgen-related prostate cancer, hypoxia, androgen sti- renal cell carcinoma, colon cancer. The expression mulation, and androgen receptor blockers may jointly abundance of Foxp1 in cancer tissues was significantly affect the expression of Foxp16. Takayama K et al. found lower than that in matched normal tissues. Therefore, that Foxp1 was an androgen-responsive factor that Foxp1 may be a tumor suppressor gene3 However, negatively regulated the androgen receptor signaling emerging evidence discovers that Foxp1 may have a dual pathway7. One study found that low expression of Foxp1 in col- orectal cancer tissue was associated with low survival Correspondence: Yunfeng Fu ([email protected])or rates. However, little is known about the molecular Rong Gui ([email protected]) mechanism of Foxp1 loss in colon cancer. Studies have 1Department of Blood Transfusion, the Third Xiangya Hospital of Central South University, 410013 Changsha, Hunan, China found that the exons 8 to 11 of Foxp1 form a circular Edited by S Tait. © The Author(s) 2020 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a linktotheCreativeCommons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/. Official journal of the Cell Death Differentiation Association Luo et al. Cell Death and Disease (2020) 11:782 Page 2 of 9 RNA molecule, circFoxp1. circFoxp1 is an oncogene in then were blocked with normal goat serum (Boster Bio- gallbladder cancer and promotes tumor progression by logical Technology, Wuhan, China) for 60 min at room enhancing the Warburg effect8. It is unclear the regulatory temperature. The tissues were incubated with primary mechanism between circFoxp1 and Foxp1. In this study, we antibody (anti-Foxp1, cat no. Ab16645, 1:200 dilution, found that the expression of circFoxp1 and Foxp1 in colon Abcam; anti-Ki67, cat no. Ab92742, 1:500 dilution, cancer tissues was negatively correlated, and circFoxp1 Abcam) overnight at 4 °C. The tissues were then then with hypermethylated the promoter of Foxp1 by recruiting a horseradish peroxidase (HRP) -conjugated anti-rabbit DNMT1, thereby inhibiting the expression of Foxp1, and secondary antibody for 2 h at 37 °C. Finally, the sections ultimately promoting the colon cancer progress. were counterstained with hematoxylin. The expression of Foxp1 and Ki67 was semi-quantitated Materials and methods by immunoreactivity scoring. The intensity of Human specimen collection Foxp1 staining was scored as 0 (negative), 1 (weak), 2 The study collected tumor tissues from 78 patients with (moderate), and 3 (intense) by two pathologists who were colon cancer and the matched paracancerous tissues from blinded to the experiments. The immunoreactivity score September 2014 to September 2019. All patients with was calculated as the percentage of positive cells multi- colon cancer were confirmed by pathological diagnosis. plied by the intensity of staining. The clinical characteristics of colon cancer patients were obtained through electronic medical records, including Cell culture gender, age, tumor size, tumor metastasis, tumor differ- Human colon cancer cell lines (LOVO, HCT116, entiation, tumor staging, and therapeutic intervention, SW480, SW620) and human normal colon epithelial cells recurrence, and survival time. This study was approved by (HCoEpiC) were purchased from China Type Culture the ethics committee of the Third Xiangya Hospital, Collection (Wuhan). All cells were cultured in RPMI-1640 Central South University. The study methodologies con- medium supplemented with 10% FBS. The culture con- formed to the standards set by the Declaration of Helsinki. ditions were 37 °C, 95% humidity, and 5% CO2 in a con- The experiments were undertaken with the understanding stant temperature incubator. and written consent of each subject. Immunoblotting Quantitative polymerase chain reaction Cell protein was extracted using RIPA lysis buffer. Quantitative polymerase chain reaction (qPCR) was Protein concentration was determined using an Enhanced performed as previously described9. Total RNA was BCA Protein Assay Kit (Beyotime, Shanghai, China). In extracted from tumor tissues or cells using Trizol reagent all, 20 μg protein samples were separated by electro- (Invitrogen). Real-time quantitative PCR was performed phoresis in 10% SDSPAGE, and the proteins were trans- on ABI 7500 Real-Time PCR System (SeqGen, Inc., ferred to polyvinylidene fluoride (PVDF) membrane. The Torrance, CA, USA). SYBR Premix EX Taq ™ II (TaKaRa) transferred PVDF membrane was blocked with 5% skim was used for the reaction. The primers were used as: milk for 2 h at room temperature, and then incubated circFoxp1, forward: CTCCTCTGCACCTTCCAAGA, with the primary antibody (anti-Foxp1, cat no. ab196978, reverse: ATCATAGCCACTGACACGGG; Foxp1, for- 1:1000 dilution, Abcam; anti-GAPDH, cat no. ab181602, ward: AACGGCAAAGAGGGAGCC, reverse: GGCA 1:3000 dilution, Abcam;) at 4 °C overnight. After washing TGCATAATGCCACAGG; E2F1, forward: ACAAGG three times with TBST, the membranes were incubated CCCGATCGATGTTT, reverse: CTGCAGAGACA with secondary antibody goat anti-rabbit IgG antibody AGGTGAGCA; retinoblastoma1 (Rb1), forward: AGAAA (1:4000) for 2 h. Finally, the signal of bands was developed CAAACCAAAATGGGAGGT, reverse: GGGTGTT with an ECL chemiluminescence kit (BeyoECL Plus, CGAGGTGAACCAT; androgen receptor (AR), forward: Beyotime, Shanghai, China). AGGCGACAGAGGGAAAAAGG, reverse: CTCGCAGC CAAAGGGAGTTA; β-catenin, forward: CTGAGGAG Viral constructions and infection CAGCTTCAGTCC, reverse: ATTGCACGTGTGGCAA The plasmid expressing circFoxp1 was synthesized by GTTC; GAPDH: TTCCCGTTCTCAGCCTTGAC. GAP Sangon (Shanghai, China). The target sequence of DH was used as an internal control. circFoxp1 small interfering RNA (siRNA) (siRNA sequence, 5′-TGACACGGGAACTTTAGAAATGATT- Immunohistochemistry 3′) was synthesized by Sangon (Shanghai, China). The The Immunohistochemistry (IHC) experiments were plasmids were packaged into adenoviruses using the performed as our previous reported10. Briefly, the AAVPrime AAV System (GeneCopoeia, Inc.) according to paraffin-embedded tumor
Load more

Recommended publications
  • Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model
    Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A.
    [Show full text]
  • Transcription Factors E2A, FOXO1 and FOXP1 Regulate Recombination Activating Gene Expression in Cancer Cells
    Transcription Factors E2A, FOXO1 and FOXP1 Regulate Recombination Activating Gene Expression in Cancer Cells Zhengshan Chen1, Yanna Xiao1, Junjun Zhang1, Jing Li1, Yuxuan Liu2, Yingying Zhao2, Changchun Ma1, Jin Luo1, Yamei Qiu1, Guowei Huang1, Christine Korteweg1, Jiang Gu1,2* 1 Department of Pathology, Shantou University Medical College, Shantou, China, 2 Department of Pathology, Peking (Beijing) University Health Science Center, Beijing, China Abstract It has long been accepted that immunoglobulins (Igs) were produced by B lymphoid cells only. Recently Igs have been found to be expressed in various human cancer cells and promote tumor growth. Recombination activating gene 1 (RAG1) and RAG2, which are essential enzymes for initiating variable-diversity-joining segment recombination, have also been found to be expressed in cancer cells. However, the mechanism of RAG activation in these cancer cells has not been elucidated. Here, we investigated the regulatory mechanism of RAG expression in four human cancer cell lines by analyzing transcription factors that induce RAG activation in B cells. By RT-PCR, Western blot and immunofluorescence, we found that transcription factors E2A, FOXO1 and FOXP1 were expressed and localized to the nuclei of these cancer cells. Over- expression of E2A, FOXO1 or Foxp1 increased RAG expression, while RNA interference of E2A, FOXO1 or FOXP1 decreased RAG expression in the cancer cells. Chromatin immunoprecipitation experiments showed acetylation of RAG enhancer (Erag) and E2A, FOXO1 or FOXP1 were bound to Erag in vivo. These results indicate that in these cancer cells the transcription factors E2A, FOXO1 and FOXP1 regulate RAG expression, which initiates Ig gene rearrangement much in the way similar to B lymphocytes.
    [Show full text]
  • TET2 Repression by Androgen Hormone Regulates Global Hydroxymethylation Status and Prostate Cancer Progression
    ARTICLE Received 5 Oct 2014 | Accepted 30 Jul 2015 | Published 25 Sep 2015 DOI: 10.1038/ncomms9219 TET2 repression by androgen hormone regulates global hydroxymethylation status and prostate cancer progression Ken-ichi Takayama1,2,*, Aya Misawa1,*, Takashi Suzuki3, Kiyoshi Takagi3, Yoshihide Hayashizaki4,5, Tetsuya Fujimura6, Yukio Homma6, Satoru Takahashi7, Tomohiko Urano1,2 & Satoshi Inoue1,2,8 Modulation of epigenetic patterns has promising efficacy for treating cancer. 5-Hydro- xymethylated cytosine (5-hmC) is an epigenetic mark potentially important in cancer. Here we report that 5-hmC is an epigenetic hallmark of prostate cancer (PCa) progression. A member of the ten–eleven translocation (TET) proteins, which catalyse the oxidation of methylated cytosine (5-mC) to 5-hmC, TET2, is repressed by androgens in PCa. Androgen receptor (AR)-mediated induction of the miR-29 family, which targets TET2, are markedly enhanced in hormone refractory PCa (HRPC) and its high expression predicts poor outcome of PCa patients. Furthermore, decreased expression of miR-29b results in reduced tumour growth and increased TET2 expression in an animal model of HRPC. Interestingly, global 5-hmC modification regulated by miR-29b represses FOXA1 activity. A reduction in 5-hmC activates PCa-related key pathways such as mTOR and AR. Thus, DNA modification directly links the TET2-dependent epigenetic pathway regulated by AR to 5-hmC-mediated tumour progression. 1 Department of Anti-Aging Medicine, Graduate School of Medicine, The University of Tokyo, Bunkyo-ku, Tokyo 113-8655, Japan. 2 Department of Geriatric Medicine, Graduate School of Medicine, The University of Tokyo, Bunkyo-ku, Tokyo 113-8655, Japan.
    [Show full text]
  • FOXP1 Acts Through a Negative Feedback Loop to Suppress FOXO-Induced Apoptosis
    Cell Death and Differentiation (2013) 20, 1219–1229 & 2013 Macmillan Publishers Limited All rights reserved 1350-9047/13 www.nature.com/cdd FOXP1 acts through a negative feedback loop to suppress FOXO-induced apoptosis R van Boxtel1,5, C Gomez-Puerto1,6, M Mokry2,6, A Eijkelenboom3, KE van der Vos1, EES Nieuwenhuis2, BMT Burgering3, EW-F Lam4 and PJ Coffer*,1,2 Transcriptional activity of Forkhead box transcription factor class O (FOXO) proteins can result in a variety of cellular outcomes depending on cell type and activating stimulus. These transcription factors are negatively regulated by the phosphoinositol 3-kinase (PI3K)–protein kinase B (PKB) signaling pathway, which is thought to have a pivotal role in regulating survival of tumor cells in a variety of cancers. Recently, it has become clear that FOXO proteins can promote resistance to anti-cancer therapeutics, designed to inhibit PI3K–PKB activity, by inducing the expression of proteins that provide feedback at different levels of this pathway. We questioned whether such a feedback mechanism may also exist directly at the level of FOXO-induced transcription. To identify critical modulators of FOXO transcriptional output, we performed gene expression analyses after conditional activation of key components of the PI3K–PKB–FOXO signaling pathway and identified FOXP1 as a direct FOXO transcriptional target. Using chromatin immunoprecipitation followed by next-generation sequencing, we show that FOXP1 binds enhancers that are pre-occupied by FOXO3. By sequencing the transcriptomes of cells in which FOXO is specifically activated in the absence of FOXP1, we demonstrate that FOXP1 can modulate the expression of a specific subset of FOXO target genes, including inhibiting expression of the pro-apoptotic gene BIK.
    [Show full text]
  • The NANOG Transcription Factor Induces Type 2 Deiodinase Expression and Regulates the Intracellular Activation of Thyroid Hormone in Keratinocyte Carcinomas
    Cancers 2020, 12 S1 of S18 Supplementary Materials: The NANOG Transcription Factor Induces Type 2 Deiodinase Expression and Regulates the Intracellular Activation of Thyroid Hormone in Keratinocyte Carcinomas Annarita Nappi, Emery Di Cicco, Caterina Miro, Annunziata Gaetana Cicatiello, Serena Sagliocchi, Giuseppina Mancino, Raffaele Ambrosio, Cristina Luongo, Daniela Di Girolamo, Maria Angela De Stefano, Tommaso Porcelli, Mariano Stornaiuolo and Monica Dentice Figure S1. Strategy for the mutagenesis of Dio2 promoter. (A) Schematic representation of NANOG Binding Site within the Dio2 promoter region. (B) Schematic diagram for site‐directed mutagenesis of NANOG Binding Site on Dio2 promoter region by Recombinant PCR. (C) Representation of the mutated NANOG Binding Site on Dio2 promoter region. (D) Electropherogram of the NANOG Binding Site mutation within the Dio2 promoter. Cancers 2020, 12 S2 of S18 Figure S2. Strategy for the silencing of NANOG expression. (A) Cloning strategies for the generation of NANOG shRNA expression vectors. (B) Electropherograms of the NANOG shRNA sequences cloned into pcDNA3.1 vector. (C) Validation of effective NANOG down-modulation by two different NANOG shRNA vectors was assessed by Western Blot analysis of NANOG expression in BCC cells. (D) Quantification of NANOG protein levels versus Tubulin levels in the same experiment as in C is represented by histograms. Cancers 2020, 12 S3 of S18 Figure S3. The CD34+ cells are characterized by the expression of typical epithelial stemness genes. The mRNA levels of a panel of indicated stemness markers of epidermis were measured by Real Time PCR in the same experiment indicated in figure 3F and G. Cancers 2020, 12 S4 of S18 Figure S4.
    [Show full text]
  • Role of Estrogen Receptor in Breast Cancer Cell Gene Expression
    4046 MOLECULAR MEDICINE REPORTS 13: 4046-4050, 2016 Role of estrogen receptor in breast cancer cell gene expression YABING ZHENG1, XIYING SHAO1, YUAN HUANG1, LEI SHI1, BO CHEN2, XIAOJIA WANG1, HONGJIAN YANG3, ZHANHONG CHEN1 and XIPING ZHANG3 Departments of 1Medical Oncology (Breast), 2Pathology and 3Breast Surgery, Zhejiang Cancer Hospital, Hangzhou, Zhejiang 310022, P.R. China Received April 28, 2015; Accepted February 23, 2016 DOI: 10.3892/mmr.2016.5018 Abstract. The aim of the present study was to establish the Europe in 2012, and the number of breast cancer-associated underlying regulatory mechanism of estrogen receptor (ER) mortalities is 131,000 (6). Furthermore, breast cancer is in breast cancer cell gene expression. A gene expression the most common cause of cancer-associated mortality in profile accession( no. GSE11324) was downloaded from the females. Therefore, it is essential to understand its molecular Gene Expression Omnibus (GEO) database. Differentially mechanism and develop more effective therapeutic methods expressed genes (DEGs) from an estrogen treatment group and for breast cancer treatment. a control group were identified. Chromatin immunoprecipita- The estrogen receptor (ER) is critical in determining the tion with high-throughput sequencing data (series GSE25710) phenotype of human breast cancers and is one of the most was obtained from the GEO for the ER binding sites, and important therapeutic targets (7). Furthermore, certain studies binding and expression target analysis was performed. A total have suggested that activation of ER is responsible for various of 3,122 DEGs were obtained and ER was demonstrated to biological processes, including cell growth and differentia- exhibit inhibition and activation roles during the regulation tion, and programmed cell death (8,9).
    [Show full text]
  • Overview of Research on Fusion Genes in Prostate Cancer
    2011 Review Article Overview of research on fusion genes in prostate cancer Chunjiao Song1,2, Huan Chen3 1Medical Research Center, Shaoxing People’s Hospital, Shaoxing University School of Medicine, Shaoxing 312000, China; 2Shaoxing Hospital, Zhejiang University School of Medicine, Shaoxing 312000, China; 3Key Laboratory of Microorganism Technology and Bioinformatics Research of Zhejiang Province, Zhejiang Institute of Microbiology, Hangzhou 310000, China Contributions: (I) Conception and design: C Song; (II) Administrative support: Shaoxing Municipal Health and Family Planning Science and Technology Innovation Project (2017CX004) and Shaoxing Public Welfare Applied Research Project (2018C30058); (III) Provision of study materials or patients: None; (IV) Collection and assembly of data: C Song; (V) Data analysis and interpretation: H Chen; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors. Correspondence to: Chunjiao Song. No. 568 Zhongxing Bei Road, Shaoxing 312000, China. Email: [email protected]. Abstract: Fusion genes are known to drive and promote carcinogenesis and cancer progression. In recent years, the rapid development of biotechnologies has led to the discovery of a large number of fusion genes in prostate cancer specimens. To further investigate them, we summarized the fusion genes. We searched related articles in PubMed, CNKI (Chinese National Knowledge Infrastructure) and other databases, and the data of 92 literatures were summarized after preliminary screening. In this review, we summarized approximated 400 fusion genes since the first specific fusion TMPRSS2-ERG was discovered in prostate cancer in 2005. Some of these are prostate cancer specific, some are high-frequency in the prostate cancer of a certain ethnic group. This is a summary of scientific research in related fields and suggests that some fusion genes may become biomarkers or the targets for individualized therapies.
    [Show full text]
  • Characterization of Human-Ipscs Derived Spinal Motor Neurons by Single
    bioRxiv preprint doi: https://doi.org/10.1101/2019.12.28.889972; this version posted December 28, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Characterization of human-iPSCs derived spinal motor neurons by single- cell RNA sequencing Louise Thiry1, Regan Hamel2, Stefano Pluchino2, Thomas Durcan1,3, Stefano Stifani1* 1Department of Neurology and Neurosurgery, Montreal Neurological Institute-Hospital, McGill University, 3801, rue University, Montreal (Quebec) H3A 2B4, Canada 2Department of Clinical Neurosciences, Clifford Allbutt Building - Cambridge Biosciences Campus and NIHR Biomedical Research Centre, University of Cambridge, Hills Road, CB2 0HA Cambridge, UK 3Early Drug Discovery Unit, Montreal Neurological Institute-Hospital *Corresponding author: [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/2019.12.28.889972; this version posted December 28, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Human induced pluripotent stem cells (iPSCs) offer the opportunity to generate specific cell types from healthy and diseased individuals, allowing the study of mechanisms of early human development, modelling a variety of human diseases, and facilitating the development of new therapeutics. Human iPSC-based applications are often limited by the variability among iPSC lines originating from a single donor, as well as the heterogeneity among specific cell types that can be derived from iPSCs. The ability to deeply phenotype different iPSC-derived cell types is therefore of primary importance to the successful and informative application of this technology.
    [Show full text]
  • An Integrated Approach to Dissecting Oncogene Addiction Implicates a Myb-Coordinated Self-Renewal Program As Essential for Leukemia Maintenance
    Downloaded from genesdev.cshlp.org on September 25, 2021 - Published by Cold Spring Harbor Laboratory Press An integrated approach to dissecting oncogene addiction implicates a Myb-coordinated self-renewal program as essential for leukemia maintenance Johannes Zuber,1,2,8 Amy R. Rappaport,1,3,8 Weijun Luo,1 Eric Wang,1 Chong Chen,1 Angelina V. Vaseva,1,4 Junwei Shi,1,4 Susann Weissmueller,1,3 Christof Fellmann,1 Meredith J. Taylor,1 Martina Weissenboeck,2 Thomas G. Graeber,5 Scott C. Kogan,6 Christopher R. Vakoc,1 and Scott W. Lowe1,3,7,9 1Cold Spring Harbor Laboratory, Cold Spring Harbor, New York 11724, USA; 2Research Institute of Molecular Pathology (IMP), A-1030 Vienna, Austria; 3Watson School of Biological Sciences, Cold Spring Harbor, New York 11724, USA; 4Genetics Program, Stony Brook University, Stony Brook, New York 11794, USA; 5Crump Institute for Molecular Imaging, Department of Molecular and Medical Pharmacology, University of California at Los Angeles, California 90095, USA; 6Department of Laboratory Medicine, University of California at San Francisco, California 94143, USA; 7Howard Hughes Medical Institute, Cold Spring Harbor, New York 11724, USA Although human cancers have complex genotypes and are genomically unstable, they often remain dependent on the continued presence of single-driver mutations—a phenomenon dubbed ‘‘oncogene addiction.’’ Such de- pendencies have been demonstrated in mouse models, where conditional expression systems have revealed that oncogenes able to initiate cancer are often required for tumor maintenance and progression, thus validating the pathways they control as therapeutic targets. Here, we implement an integrative approach that combines genetically defined mouse models, transcriptional profiling, and a novel inducible RNAi platform to characterize cellular programs that underlie addiction to MLL-AF9—a fusion oncoprotein involved in aggressive forms of acute myeloid leukemia (AML).
    [Show full text]
  • T Follicular Helper Cells Restricted by IRF8 Contribute to T Cell-Mediated Inflammation T
    Journal of Autoimmunity 96 (2019) 113–122 Contents lists available at ScienceDirect Journal of Autoimmunity journal homepage: www.elsevier.com/locate/jautimm T follicular helper cells restricted by IRF8 contribute to T cell-mediated inflammation T Ruihua Zhanga, Chen-feng Qib, Yuan Hua, Yanhong Shana, Yuan-Pang Hsiehc, Feihong Xua, Geming Lua, Jun Daia, Monica Guptad, Miao Cuia, Liang Penga, Jianjun Yanga, Qingjie Xuea, Ray Chen-Lianga, Kang Chene, Yeyunfei Zhanga, Wai-Ping Fung-Leungf, J. Rodrigo Morag, ∗∗ ∗ Liwu Lic, Herbert C. Morse IIIb, Keiko Ozatod, Peter S. Heegerh, , Huabao Xionga, a Department of Medicine, Precision Immunology Institute, Icahn School of Medicine at Mount Sinai, New York, NY 10029, USA b Laboratory of Immunogenetics, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892, USA c Department of Biological Sciences, College of Science, Virginia Tech, USA d Programs in Genomics of Differentiation, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD 20892, USA e Department of Obstetrics and Gynecology, Wayne State University, Detroit, MI 48201, USA f Janssen Research & Development, LLC., CA 92121, USA g Janssen R&D, Spring House, PA 19477, USA h Department of Medicine, Translational Transplant Research Center, Icahn School of Medicine at Mount Sinai, New York, NY 10029, USA ARTICLE INFO ABSTRACT Keywords: The follicular helper T cell (TFH) are established regulators of germinal center (GC) B cells, whether TFH have IRF8 pathogenic potential independent of B cells is unknown. Based on in vitro TFH cell differentiation, in vivo T cell TFH transfer animal colitis model, and intestinal tissues of inflammatory bowel disease (IBD) patients, TFH and its Colitis functions in colitis development were analyzed by FACS, ChIP, ChIP-sequencing, WB, ELISA and PCR.
    [Show full text]
  • Oct2, BCL6, IRF8, OCAB and PU.1 in the Assessment of Prognosis In
    r Biomar ula ke c rs le o & M D f i a o g l Journal of Molecular Biomarkers n a o n Rojas, J Mol Biomarkers Diagn 2016, 7:2 r s i u s o J DOI: 10.4172/2155-9929.7: 276 ISSN: 2155-9929 & Diagnosis Research Article Open Access Oct2, BCL6, IRF8, OCAB and PU.1 in the Assessment of Prognosis in Diffuse Large B cell Lymphoma Patients Rojas-Bilbao EA1, Knott ME2, Bal de Kier Joffé ED2, Zerga ME3, Nuñez M4, Puricelli LI2 and Ranuncolo SM2,5*,# 1Pathology Department, University of Buenos Aires, Buenos Aires, Argentina 2Research Area, University of Buenos Aires, Buenos Aires, Argentina 3Hematology Department, Institute of Oncology “Angel H. Roffo” University of Buenos Aires 4Pathology Department, Institute of Oncology “Ángel H. Roffo”, University of Buenos Aires 5Research Area, Institute of Oncology “Ángel H. Roffo”, University of Buenos Aires #Members of the Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET) Rec Date: Jan 20, 2016, Acc Date: Feb 06, 2016, Pub Date: Feb 06, 2016 *Corresponding author: Stella Maris Ranuncolo, Av. San Martín 5481, Buenos Aires (C1417DTB), Argentina, Tel: +5411-4580-2800 (281); Fax: +5411-4580-2811; E- mail: [email protected] Copyright: © 2016 Rojas-Bilbao EA, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction H2O in any medium, provided the original author and source are credited Abstract Background: Diffuse Large B-Cell Lymphoma (DLBCL) is the most common type of Non-Hodgkin Lymphoma in adults.
    [Show full text]
  • Cytoplasmic FOXP1 Expression Is Correlated with ER and Calpain II Expression and Predicts a Poor Outcome in Breast Cancer
    Yu et al. Diagnostic Pathology (2018) 13:36 https://doi.org/10.1186/s13000-018-0715-y RESEARCH Open Access Cytoplasmic FOXP1 expression is correlated with ER and calpain II expression and predicts a poor outcome in breast cancer Bao-Hua Yu1,2, Bai-Zhou Li3, Xiao-Yan Zhou1,2*, Da-Ren Shi1,2 and Wen-Tao Yang1,2 Abstract Background: Nuclear forkhead box protein P1 (N-FOXP1) expression in invasive breast cancer has been documented in the literature. However, the FOXP1 expression patterns at different stages of breast cancer progression are largely unknown, and the significance of cytoplasmic FOXP1 (C-FOXP1) expression in breast cancer has not been well illustrated. The aims of this study were to investigate FOXP1 expression patterns in invasive ductal carcinoma (IDC), ductal carcinoma in situ (DCIS), atypical ductal hyperplasia (ADH) and usual ductal hyperplasia (UDH), and to analyze the clinicopathological relevance of C-FOXP1 and its prognostic value in IDC. Methods: N-FOXP1 and C-FOXP1 expression in cases of IDC, DCIS, ADH and UDH was determined using immunohistochemistry. The correlation between C-FOXP1 expression and clinicopathological parameters as well as the overall survival (OS) and disease-free survival (DFS) rates of patients with IDC were analyzed. Results: Exclusive N-FOXP1 expression was found in 85.0% (17/20), 40.0% (8/20), 12.2% (5/41) and 10.8% (9/83) of UDH, ADH, DCIS, and IDC cases, respectively, and exclusive C-FOXP1 expression was observed in 0% (0/20), 0% (0/20), 4.9% (2/41), and 31.3% (26/83) of the cases, respectively.
    [Show full text]