Luo et al. Cell Death and Disease (2020) 11:782 https://doi.org/10.1038/s41419-020-03007-6 Cell Death & Disease ARTICLE Open Access A novel epigenetic regulation of circFoxp1 on Foxp1 in colon cancer cells Yanwei Luo1, Fengxia Liu1,JinqiMa1,YunfengFu1 and Rong Gui1 Abstract Foxp1 is a tumor suppressor in colon cancer. However, circFoxp1 derived from Foxp1 is an oncogene. In this study, we aim to investigate the role of circFoxp1 in colon cancer and the regulatory mechanism between circFoxp1 and Foxp1. 78 human colon tumor tissues and the matched paracancerous tissues were collected. Quantitative polymerase chain reaction, immunohistochemistry, quantitative methylation-specific PCR, chromatin immunoprecipitation assay, CCK-8 assay, and Tumor xenograft in nude mice were performed. The expression of circFoxp1 was increased and Foxp1 was reduced in colon cancer tissues, which were associated with a poor overall survival rate of the patients with colon cancer. CircFoxp1 recruited DNMT1 to the promoter of Foxp1, leading to promotor hypermethylation, thereby inhibiting Foxp1 transcription. Interfering circFoxp1 by siRNA in SW620 cells significantly inhibited cell viability, while knockdown Foxp1 expression partially restored SW620 cell viability. In addition, knockdown of circFoxp1 significantly sensitized colon cancer cells to Capecitabine in vitro and vivo through regulating Foxp1. We discovered a novel epigenetic pathway that circFoxp1 regulated Foxp1 in colon cancer cells. CircFoxp1 may regulate DNA methylation and demethylation to coordinate colon cancer cell proliferation and participate in chemotherapy drug responses. Therefore, circFoxp1 may be a potential therapeutic target for colon cancer. 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; Introduction function in the development of human tumors. On the The forkhead box protein 1 (Foxp1) belongs to the P one hand, overexpression of Foxp1 induced by chromo- subfamily of the FOX (Forkhead Box) family. These pro- somal translocation causes diffuse large B-cell lymphoma teins functions in embryo development, cell cycle reg- (DLBCL), suggesting that Foxp1 has the role of onco- ulation, metabolism, and immune regulation. The gene4. On the other hand, Foxp1 is located on chromo- abnormal expression of these genes is associated with some 3p14.1, which is a tumor suppressor region; and the tumorigenesis1. Foxp1 is a key transcriptional regulatory high expression of Foxp1 in human primary breast cancer factor in the development of B lymphocytes2. Banham is associated with a good prognosis, suggesting that Foxp1 et al. found for the first time that Foxp1 gene can be is a tumor suppressor in breast cancer5. In addition, in detected in various normal and tumor tissues, including androgen-related prostate cancer, hypoxia, androgen sti- renal cell carcinoma, colon cancer. The expression mulation, and androgen receptor blockers may jointly abundance of Foxp1 in cancer tissues was significantly affect the expression of Foxp16. Takayama K et al. found lower than that in matched normal tissues. Therefore, that Foxp1 was an androgen-responsive factor that Foxp1 may be a tumor suppressor gene3 However, negatively regulated the androgen receptor signaling emerging evidence discovers that Foxp1 may have a dual pathway7. One study found that low expression of Foxp1 in col- orectal cancer tissue was associated with low survival Correspondence: Yunfeng Fu ([email protected])or rates. However, little is known about the molecular Rong Gui ([email protected]) mechanism of Foxp1 loss in colon cancer. Studies have 1Department of Blood Transfusion, the Third Xiangya Hospital of Central South University, 410013 Changsha, Hunan, China found that the exons 8 to 11 of Foxp1 form a circular Edited by S Tait. © The Author(s) 2020 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a linktotheCreativeCommons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/. Official journal of the Cell Death Differentiation Association Luo et al. Cell Death and Disease (2020) 11:782 Page 2 of 9 RNA molecule, circFoxp1. circFoxp1 is an oncogene in then were blocked with normal goat serum (Boster Bio- gallbladder cancer and promotes tumor progression by logical Technology, Wuhan, China) for 60 min at room enhancing the Warburg effect8. It is unclear the regulatory temperature. The tissues were incubated with primary mechanism between circFoxp1 and Foxp1. In this study, we antibody (anti-Foxp1, cat no. Ab16645, 1:200 dilution, found that the expression of circFoxp1 and Foxp1 in colon Abcam; anti-Ki67, cat no. Ab92742, 1:500 dilution, cancer tissues was negatively correlated, and circFoxp1 Abcam) overnight at 4 °C. The tissues were then then with hypermethylated the promoter of Foxp1 by recruiting a horseradish peroxidase (HRP) -conjugated anti-rabbit DNMT1, thereby inhibiting the expression of Foxp1, and secondary antibody for 2 h at 37 °C. Finally, the sections ultimately promoting the colon cancer progress. were counterstained with hematoxylin. The expression of Foxp1 and Ki67 was semi-quantitated Materials and methods by immunoreactivity scoring. The intensity of Human specimen collection Foxp1 staining was scored as 0 (negative), 1 (weak), 2 The study collected tumor tissues from 78 patients with (moderate), and 3 (intense) by two pathologists who were colon cancer and the matched paracancerous tissues from blinded to the experiments. The immunoreactivity score September 2014 to September 2019. All patients with was calculated as the percentage of positive cells multi- colon cancer were confirmed by pathological diagnosis. plied by the intensity of staining. The clinical characteristics of colon cancer patients were obtained through electronic medical records, including Cell culture gender, age, tumor size, tumor metastasis, tumor differ- Human colon cancer cell lines (LOVO, HCT116, entiation, tumor staging, and therapeutic intervention, SW480, SW620) and human normal colon epithelial cells recurrence, and survival time. This study was approved by (HCoEpiC) were purchased from China Type Culture the ethics committee of the Third Xiangya Hospital, Collection (Wuhan). All cells were cultured in RPMI-1640 Central South University. The study methodologies con- medium supplemented with 10% FBS. The culture con- formed to the standards set by the Declaration of Helsinki. ditions were 37 °C, 95% humidity, and 5% CO2 in a con- The experiments were undertaken with the understanding stant temperature incubator. and written consent of each subject. Immunoblotting Quantitative polymerase chain reaction Cell protein was extracted using RIPA lysis buffer. Quantitative polymerase chain reaction (qPCR) was Protein concentration was determined using an Enhanced performed as previously described9. Total RNA was BCA Protein Assay Kit (Beyotime, Shanghai, China). In extracted from tumor tissues or cells using Trizol reagent all, 20 μg protein samples were separated by electro- (Invitrogen). Real-time quantitative PCR was performed phoresis in 10% SDSPAGE, and the proteins were trans- on ABI 7500 Real-Time PCR System (SeqGen, Inc., ferred to polyvinylidene fluoride (PVDF) membrane. The Torrance, CA, USA). SYBR Premix EX Taq ™ II (TaKaRa) transferred PVDF membrane was blocked with 5% skim was used for the reaction. The primers were used as: milk for 2 h at room temperature, and then incubated circFoxp1, forward: CTCCTCTGCACCTTCCAAGA, with the primary antibody (anti-Foxp1, cat no. ab196978, reverse: ATCATAGCCACTGACACGGG; Foxp1, for- 1:1000 dilution, Abcam; anti-GAPDH, cat no. ab181602, ward: AACGGCAAAGAGGGAGCC, reverse: GGCA 1:3000 dilution, Abcam;) at 4 °C overnight. After washing TGCATAATGCCACAGG; E2F1, forward: ACAAGG three times with TBST, the membranes were incubated CCCGATCGATGTTT, reverse: CTGCAGAGACA with secondary antibody goat anti-rabbit IgG antibody AGGTGAGCA; retinoblastoma1 (Rb1), forward: AGAAA (1:4000) for 2 h. Finally, the signal of bands was developed CAAACCAAAATGGGAGGT, reverse: GGGTGTT with an ECL chemiluminescence kit (BeyoECL Plus, CGAGGTGAACCAT; androgen receptor (AR), forward: Beyotime, Shanghai, China). AGGCGACAGAGGGAAAAAGG, reverse: CTCGCAGC CAAAGGGAGTTA; β-catenin, forward: CTGAGGAG Viral constructions and infection CAGCTTCAGTCC, reverse: ATTGCACGTGTGGCAA The plasmid expressing circFoxp1 was synthesized by GTTC; GAPDH: TTCCCGTTCTCAGCCTTGAC. GAP Sangon (Shanghai, China). The target sequence of DH was used as an internal control. circFoxp1 small interfering RNA (siRNA) (siRNA sequence, 5′-TGACACGGGAACTTTAGAAATGATT- Immunohistochemistry 3′) was synthesized by Sangon (Shanghai, China). The The Immunohistochemistry (IHC) experiments were plasmids were packaged into adenoviruses using the performed as our previous reported10. Briefly, the AAVPrime AAV System (GeneCopoeia, Inc.) according to paraffin-embedded tumor