DOCSLIB.ORG

Table S1 List of 159 Deafness Genes ACTG1 ADGRV1 ALX3 BSND

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Table S1 List of 159 Deafness Genes ACTG1 ADGRV1 ALX3 BSND BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Med Genet Table S1 List of 159 deafness genes ACTG1 ADGRV1 ALX3 BSND CABP2 CCDC50 CDH23 CEACAM16 CHD7 CIB2 CLDN14 CLPP CLRN1 COCH COL11A1 COL11A2 COL1A1 COL1A2 COL2A1 COL4A3 COL4A4 COL4A5 COL4A6 COL9A1 COL9A2 CRYM DFNA5 WHRN DFNB59 DIABLO DIAPH1 DIAPH3 DSPP ECM1 EDN3 EDNRB ELMOD3 ESPN ESRRB EYA1 EYA4 FGF3 FGF8 FGFR1 FGFR3 FLNA FOXI1 FREM1 FXN GATA3 GIPC3 GJB1 GJB2 GJB3 GJB6 GLYAT GPSM2 GRHL2 GRXCR1 HARS HARS2 HGF HMX1 HOXA2 HSD17B4 IL13 ILDR1 KARS KCNE1 KCNJ10 KCNQ1 KCNQ4 KITLG KRT9 LAMA3 LARS2 LHFPL5 LOXHD1 LRTOMT MARVELD2 MIR96 MITF MPZ MSRB3 MYH14 MYH9 MYO15A MYO1A MYO1E MYO3A MYO6 MYO7A NDP NDRG1 NEFL NELL2 NF2 OPA1 OTOA OTOF OTOG OTOGL P2RX2 PABPN1 PAX3 PCDH15 PCDH9 PDZD7 PMP22 PNPT1 POLR1C POLR1D POU3F4 POU4F3 PROK2 PROKR2 PRPS1 PTPN11 PTPRQ PTPRR RDX RPGR SALL1 SALL4 SEC23A SEMA3E SERPINB6 SIX1 SIX5 SLC17A8 SLC19A2 SLC26A4 SLC26A5 SMAD4 SMPX SNAI2 SOX10 STRC TBC1D24 TCIRG1 TCOF1 TECTA TIMM8A TJP2 TMC1 TMEM126A TMIE TMPRSS3 TMPRSS4 TNC TPRN TRIOBP TRMU TSPEAR TYR USH1C USH1G USH2A WFS1 Table S2 Six mitochondrial deafness-related regions Locus Location (RefSeq: NC_012920.1) MT-RNR1 chrM:648-1601 MT-TL1 chrM:3230-3304 MT-CO1 chrM:5904-7445 MT-TS1 chrM:7446-7514 MT-TK chrM:8295-8364 MT-TE chrM:14674-14742 Table S3 Three deafness-related miRNAs Name Chromosome Position (hg19) miR-96 chr7: 129414532-129414609 miR-182 chr7: 129410223-129410332 miR-183 chr7: 129414745-129414854 Gao X, et al. J Med Genet 2021; 58:465–474. doi: 10.1136/jmedgenet-2020-106892 BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Med Genet Table S4. Primers of PTPN11 Variants for PCR chromosome Location Variants Forward Primers Reverse Primers chr12-112926851 c.1471C>T GTAGCCATTGCAACATGCTC CCTGCGCTGTAGTGTTTCAA chr12-112888163 c.179G>C CGTTCCTTGGGTTTCTTTCA TTAATTGCCCGTGATGTTCC chr12-112910827 c.836A>G AATGCTGATCCAGGCTTTTT CCGATGTGCTAACAAGAGCA chr12-112888172 c.188A>G AAAATCCGACGTGGAAGATG TTCTCTTTTAATTGCCCGTGA chr12-112891083 c.417G>C TGATCAATCCCTTGGAGGAA TTTAGACTTGCCGTCATTGC chr12-112926851 c.1471G>C GTAGCCATTGCAACATGCTC CCTGCGCTGTAGTGTTTCAA Gao X, et al. J Med Genet 2021; 58:465–474. doi: 10.1136/jmedgenet-2020-106892 BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Med Genet Table S5 Summary of the candidate variants identified in the NGS test Nucleotide Amino acid hom/ Allele ACMG code Inheritance Origin of Co-segre Patient ID Gene Transcript change change het Frequency* Pathogenicity mode variant gation PTPN11 NM_002834 c.179G>C p.(Gly60Ala) het - Pathogenic PS1+PS2+ PM2+PP3 AD de novo Yes MYO7A NM_000260 c.3602G>C p.(Cys1201Ser) het 0.004 Likely benign BS2+BP5 AD /AR paternal No 2301 II:1 NDRG1 NM_006096 c.874C>A p.(Leu292Ile) het 0.0008 Likely benign BS2+BP5 AD paternal No SALL1 NM_002968 c.3322G>A p.(Val1108Ile) het 0.0001 Likely benign BS2+BP5 AD paternal No TNC NM_002160 c.2340G>T p.(Glu780Asp) het 0.0001 Likely benign BS2+BP5 AD maternal No PTPN11 NM_002834 c.188A>G p.(Tyr63Cys) het 0.0001 Pathogenic PS1+PS2+ PM2+PP3 AD de novo Yes 2901 II:1 SIX1 NM_005982 c.705G>T p.(Gln235His) het 0.001 Likely benign BS2+BP5 AD maternal No PTPN11 NM_002834.4 c.417G>C p.(Glu139Asp) het - Pathogenic PS1+PS2+ PM2+PP3 AD de novo Yes 6719 II:1 MYO7A NM_000260 c.3602G>C p.(Cys1201Ser) het 0.004 Likely benign BS2+BP5 AD /AR maternal No TECTA NM_005422 c.5488G>A p.(Val1830Met) het 0.004 Likely benign BS2+BP5 AD /AR maternal No PTPN11 NM_002834 c.836A>G p.(Tyr279Cys) het - Pathogenic PS1+PS2+ PM2+PP3 AD de novo Yes DIAPH1 NM_005219 c.2007G>T p.(Leu669Phe het - Likely benign BS2+BP5 AD /AR paternal No 1485 II:1 MYO15A NM_016239 c.7547C>T p.(Ala2516Val) het 0.002 Uncertain significance PM2+BP5 AR maternal Yes MYO15A NM_016239 c.7633G>T p.(Asp2545Tyr) het 0.0005 Uncertain significance PM2+BP5 AR paternal Yes TECTA NM_005422 c.29G>C p.(Trp10Ser) het - Likely benign BS2+BP5 AD /AR maternal No 8728 II:1 PTPN11 NM_002834.4 c.836A>G p.(Tyr279Cys) het - Pathogenic PS1+PS2+ PM2+PP3 AD de novo Yes COL1A1 NM_000088 c.1241C>T p.(Ala414Val) het - Likely benign BS2+BP5 AD /AR paternal No COL9A2 NM_001852 c.1237C>T p.(Pro413Ser) het 0.0002 Likely benign BS2+BP5 AD /AR paternal No DSPP NM_014208 c.1031C>A p.(Thr344Asn) het 0.0002 Likely benign BS2+BP5 AD paternal No PROKR2 NM_144773 c.991G>A p.(Val331Met) het 0.0122 Likely benign BS2+BP5 AD paternal No TBC1D24 NM_001199107 c.1570C>T p.(Arg524Trp) het 0.0033 Likely benign BS2+BP5 AD /AR maternal No PTPN11 NM_002834 c.1471C>G p.(Pro491Ala) het - Likely Pathogenic PS2+ PM2+ PM5+PP3 AD de novo Yes 3001 II:1 TECTA NM_005422 c.4315C>A p.(Leu1439Ile) het 0.0095 Likely benign BS2+BP5 AD /AR paternal No PTPN11 NM_002834 c.1471C>T p.(Pro491Ser) het - Pathogenic PS1+PS2+ PM2+PP3 AD de novo Yes 2442 II:1 GJB2 NM_004004 c.109G>A p.(Val37Ile) het 0.0154 Pathogenic BS2+BP5 AR maternal No 5420 II:1 PTPN11 NM_002834 c.1472C>T p.(Pro491Leu) het - Pathogenic PS1+PS2+ PM2+PP3 AD de novo Yes 1285 II:1 PTPN11 NM_002834 c.1510A>G p.(Met504Val) het - Pathogenic PS1+PS2+ PM2+ PP1+ PP3 AD de novo Yes PTPN11 NM_002834 c.1529A>G p.(Gln510Arg) het - Pathogenic PS1+PS2+ PM2+PP3 AD de novo Yes COL1A1 NM_000088 c.3538C>A p.(Pro1180Thr) het 0.0001 Likely benign BS2+BP5 AD paternal No 1201 II:1 GJB2 NM_004004 c.571T>C p.(Phe191Leu) het 0.0002 Likely benign BS2+BP5 AD /AR paternal No LOXHD1 NM_144612 c.6413G>A p.(Arg2138Gln) het - Uncertain significance PM2+BP5 AR maternal Yes LOXHD1 NM_144612 c.944A>G p.(Lys315Arg) het - Uncertain significance PM2+BP5 AR paternal Yes *: Allele Frequency in East Asian reported by ExAC; -: no data; Bold, back indicates the candidate pathogenic variants; Red indicates compound heterozygous variants with uncertain significance. Gao X, et al. J Med Genet 2021; 58:465–474. doi: 10.1136/jmedgenet-2020-106892 BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Med Genet Table S6 Summary of PTPN11 variants mosaicism in participants ref/mut Patient ID Variant DNA Source Mutant allele frequency Urine NA c.179G>C 2301 II:1 13444/13802 p.(Gly60Ala) Buccal swab (51%) Urine NA c.188A>G 2901 II:1 37463/34380 p.(Tyr63Cys) Buccal swab (48%) 14383/15003 Urine c.417G>C (51%) 6719 II:1 p.(Glu139Asp) 12063/12400 Buccal swab (51%) 15260/16304 c.836A>G Urine 8728 II:1 (52%) p.(Tyr279Cys) Buccal swab NA 10697/14546 Urine c.1471C>G (58%) 3001 II:1 p.(Pro491Ala) 21148/22087 Buccal swab (51%) 93337/108318 Urine c.1471C>T (54%) 2442 II:1 p.(Pro491Ser) 7615/7274 Buccal swab (49%) N/A: not available; ref: reference sequence; mut: mutant sequence Gao X, et al. J Med Genet 2021; 58:465–474. doi: 10.1136/jmedgenet-2020-106892 BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Med Genet Table S7 Average number of hair cells/ supporting cells/ proliferating cells per neuromast in wild-type, morphants and mutant PTPN11 overexpression zebrafish zebrafish hair cells supporting cells proliferating cells morphant 2.55 ± 0.998 15.1 ± 2.02 8.0 ± 1.94 Group 1 wild-type 1 7.15 ± 0.988 27.3 ± 2.49 22.6 ± 1.57 mutation 1 5.10±1.197 20.70±3.498 13.50±3.719 Group 2 mutation 2 5.10±1.524 22.30±2.983 13.30±5.579 wild-type 2 7.30±0.949 28.00±5.715 19.70±3.561 The experiments were divided into two groups: group1 (Knockdown group) and group2 (overexpression group). The average number of hair cells, supporting cells and proliferating cells per neuromast in 6 dpf zebrafish were calculated. To determine whether the loss of hair cells and supporting cells was related to decreased cell proliferation, we exposed 4 dpf larvae to BrdU for 48 h and assessed BrdU incorporation by immunolabeling to visualize cell proliferation. Gao X, et al. J Med Genet 2021; 58:465–474. doi: 10.1136/jmedgenet-2020-106892 BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Med Genet Figure S1. Loss of ptpn11a causes morphological defects in a dose-dependent manner. (A) Gross morphology at 5 dpf. Scale bar, 100 μm. (B-C) Quantification of the percentage of embryos with defects/death. Gao X, et al. J Med Genet 2021; 58:465–474. doi: 10.1136/jmedgenet-2020-106892 BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Med Genet Figure S2. Quantification data of number and proportion of embryos with development defects or each phenotype (A) Raw data of quantitative analysis in Figure 3.
Load more

Recommended publications
  • Genes Retina/RPE Choroid Sclera
    Supplementary Materials: Genes Retina/RPE Choroid Sclera Fold Change p-value Fold Change p-value Fold Change p-value PPFIA2 NS NS 2.35 1.3X10-3 1.5 1.6X10-3 PTPRF 1.24 2.65X10-5 6.42 7X10-4 1.11 1X10-4 1.19 2.65X10-5 NS NS 1.11 3.3X10-3 PTPRR 1.44 2.65X10-5 3.04 4.7X10-3 NS NS Supplementary Table S1. Genes Differentially Expressed Related to Candidate Genes from Association. Genes selected for follow up validation by real time quantitative PCR. Multiple values for each gene indicate multiple probes within the same gene. NS indicates the fold change was not statistically significant. Gene/SNP Assay ID rs4764971 C__30866249_10 rs7134216 C__30023434_10 rs17306116 C__33218892_10 rs3803036 C__25749934_20 rs824311 C___8342112_10 PPFIA2 Hs00170308_m1 PTPRF Hs00160858_m1 PTPRR Hs00373136_m1 18S Hs03003631_g1 GAPDH Hs02758991_g1 Supplementary Table S2. Taqman® Genotyping and Gene Expression Assay Identification Numbers. SNP Chimp Orangutan Rhesus Marmoset Mouse Rat Cow Pig Guinea Pig Dog Elephant Opossum Chicken rs3803036 X X X X X X X X X X X X X rs1520562 X X X X X X rs1358228 X X X X X X X X X X X rs17306116 X X X X X X rs790436 X X X X X X X rs1558726 X X X X X X X X rs741525 X X X X X X X X rs7134216 X X X X X X rs4764971 X X X X X X X Supplementary Table S3. Conservation of Top SNPs from Association. X indicates SNP is conserved.
    [Show full text]
  • Pancreatic Beta Cells Express a Diverse Set Ofhomeobox Genes
    Proc. Nati. Acad. Sci. USA Vol. 91, pp. 12203-12207, December 1994 Biochemistry Pancreatic beta cells express a diverse set of homeobox genes (Lim motif/Lmx gene/Nkx gene/Alx gene/Vdx homeobox) ABRAHAM RUDNICK*t, THAI YEN LING*, HIROKI ODAGIRI*, WILLIAM J. RUTTER*t, AND MICHAEL S. GERMAN*t§ *Hormone Research Institute and Departments of tMedicine and tBiochemistry and Biophysics, University of California, San Francisco, CA 94143-0534 Contributed by William J. Rutter, August 22, 1994 ABSTRACT Homeobox genes, which are found in all RIPE3B element (16) and the P1 element (8) [also called CT1 eukaryotic organisms, encode transcriptional regulators in- (9)] lie on either side of the IEB1 element. The A/T elements volved in cell-type differentiation and development. Several and the E boxes function synergistically: none of the ele- homeobox genes encoding homeodomain proteins that bind and ments can function in isolation, but combination of an E box activate the insulin gene promoter have been described. In an and an A/T element results in dramatic activation of tran- attempt to identify additional beta-cell homeodomain proteins, scription (11, 16, 19). A number of complexes from beta-cell we designed primers based on the sequences of beta-cell nuclei bind to the A/T elements (6, 8-11, 16, 19). Some homeobox genes cdx3 and lmxl and the Drosophia homeodo- proteins in these complexes have been cloned, and they all main protein Antennapedia and used these primers to amplffy contain homeodomains. The A/T-binding proteins that have inserts by PCR from an insulinoma cDNA library.
    [Show full text]
  • Supplementary Materials
    Supplementary materials Supplementary Table S1: MGNC compound library Ingredien Molecule Caco- Mol ID MW AlogP OB (%) BBB DL FASA- HL t Name Name 2 shengdi MOL012254 campesterol 400.8 7.63 37.58 1.34 0.98 0.7 0.21 20.2 shengdi MOL000519 coniferin 314.4 3.16 31.11 0.42 -0.2 0.3 0.27 74.6 beta- shengdi MOL000359 414.8 8.08 36.91 1.32 0.99 0.8 0.23 20.2 sitosterol pachymic shengdi MOL000289 528.9 6.54 33.63 0.1 -0.6 0.8 0 9.27 acid Poricoic acid shengdi MOL000291 484.7 5.64 30.52 -0.08 -0.9 0.8 0 8.67 B Chrysanthem shengdi MOL004492 585 8.24 38.72 0.51 -1 0.6 0.3 17.5 axanthin 20- shengdi MOL011455 Hexadecano 418.6 1.91 32.7 -0.24 -0.4 0.7 0.29 104 ylingenol huanglian MOL001454 berberine 336.4 3.45 36.86 1.24 0.57 0.8 0.19 6.57 huanglian MOL013352 Obacunone 454.6 2.68 43.29 0.01 -0.4 0.8 0.31 -13 huanglian MOL002894 berberrubine 322.4 3.2 35.74 1.07 0.17 0.7 0.24 6.46 huanglian MOL002897 epiberberine 336.4 3.45 43.09 1.17 0.4 0.8 0.19 6.1 huanglian MOL002903 (R)-Canadine 339.4 3.4 55.37 1.04 0.57 0.8 0.2 6.41 huanglian MOL002904 Berlambine 351.4 2.49 36.68 0.97 0.17 0.8 0.28 7.33 Corchorosid huanglian MOL002907 404.6 1.34 105 -0.91 -1.3 0.8 0.29 6.68 e A_qt Magnogrand huanglian MOL000622 266.4 1.18 63.71 0.02 -0.2 0.2 0.3 3.17 iolide huanglian MOL000762 Palmidin A 510.5 4.52 35.36 -0.38 -1.5 0.7 0.39 33.2 huanglian MOL000785 palmatine 352.4 3.65 64.6 1.33 0.37 0.7 0.13 2.25 huanglian MOL000098 quercetin 302.3 1.5 46.43 0.05 -0.8 0.3 0.38 14.4 huanglian MOL001458 coptisine 320.3 3.25 30.67 1.21 0.32 0.9 0.26 9.33 huanglian MOL002668 Worenine
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2003/0082511 A1 Brown Et Al
    US 20030082511A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2003/0082511 A1 Brown et al. (43) Pub. Date: May 1, 2003 (54) IDENTIFICATION OF MODULATORY Publication Classification MOLECULES USING INDUCIBLE PROMOTERS (51) Int. Cl." ............................... C12O 1/00; C12O 1/68 (52) U.S. Cl. ..................................................... 435/4; 435/6 (76) Inventors: Steven J. Brown, San Diego, CA (US); Damien J. Dunnington, San Diego, CA (US); Imran Clark, San Diego, CA (57) ABSTRACT (US) Correspondence Address: Methods for identifying an ion channel modulator, a target David B. Waller & Associates membrane receptor modulator molecule, and other modula 5677 Oberlin Drive tory molecules are disclosed, as well as cells and vectors for Suit 214 use in those methods. A polynucleotide encoding target is San Diego, CA 92121 (US) provided in a cell under control of an inducible promoter, and candidate modulatory molecules are contacted with the (21) Appl. No.: 09/965,201 cell after induction of the promoter to ascertain whether a change in a measurable physiological parameter occurs as a (22) Filed: Sep. 25, 2001 result of the candidate modulatory molecule. Patent Application Publication May 1, 2003 Sheet 1 of 8 US 2003/0082511 A1 KCNC1 cDNA F.G. 1 Patent Application Publication May 1, 2003 Sheet 2 of 8 US 2003/0082511 A1 49 - -9 G C EH H EH N t R M h so as se W M M MP N FIG.2 Patent Application Publication May 1, 2003 Sheet 3 of 8 US 2003/0082511 A1 FG. 3 Patent Application Publication May 1, 2003 Sheet 4 of 8 US 2003/0082511 A1 KCNC1 ITREXCHO KC 150 mM KC 2000000 so 100 mM induced Uninduced Steady state O 100 200 300 400 500 600 700 Time (seconds) FIG.
    [Show full text]
  • Mouse Alx3: an Aristaless-Like Homeobox Gene Expressed During Embryogenesis in Ectomesenchyme and Lateral Plate Mesoderm
    DEVELOPMENTAL BIOLOGY 199, 11–25 (1998) ARTICLE NO. DB988921 View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Mouse Alx3: An aristaless-like Homeobox Gene Expressed during Embryogenesis in Ectomesenchyme and Lateral Plate Mesoderm Derk ten Berge, Antje Brouwer, Sophia El Bahi,* Jean-Louis Gue´net,† Benoıˆt Robert,* and Frits Meijlink Hubrecht Laboratory, Netherlands Institute for Developmental Biology, Uppsalalaan 8, 3584CT Utrecht, The Netherlands; *Institut Pasteur, De´partement de Biologie Mole´culaireGe´ne´tique Mole´culaire du De´veloppement, 28, rue du Dr. Roux, 75724 Paris Cedex 15, France; and †Institut Pasteur, Ge´ne´tique des Mammife`res, De´partement d’ Immunologie, 28, rue du Dr. Roux, 75724 Paris Cedex 15, France Mouse Alx3 is a homeobox gene that is related to the Drosophila aristaless gene and to a group of vertebrate genes including Prx1, Prx2, Cart1, and Alx4. The protein encoded contains a diverged variant of a conserved peptide sequence present near the carboxyl terminus of at least 15 different paired-class-homeodomain proteins. Alx3 is expressed in mouse embryos from 8 days of gestation onward in a characteristic pattern, predominantly in neural crest-derived mesenchyme and in lateral plate mesoderm. We detected prominent expression in frontonasal head mesenchyme and in the first and second pharyngeal arches and some of their derivatives. High expression was also seen in the tail and in many derivatives of the lateral plate mesoderm including the limbs, the body wall, and the genital tubercle. aristaless-related genes like Alx3, Cart1, and Prx2 are expressed in overlapping proximodistal patterns in the pharyngeal arches.
    [Show full text]
  • Supplementary Table 2
    Supplementary Table 2. Differentially Expressed Genes following Sham treatment relative to Untreated Controls Fold Change Accession Name Symbol 3 h 12 h NM_013121 CD28 antigen Cd28 12.82 BG665360 FMS-like tyrosine kinase 1 Flt1 9.63 NM_012701 Adrenergic receptor, beta 1 Adrb1 8.24 0.46 U20796 Nuclear receptor subfamily 1, group D, member 2 Nr1d2 7.22 NM_017116 Calpain 2 Capn2 6.41 BE097282 Guanine nucleotide binding protein, alpha 12 Gna12 6.21 NM_053328 Basic helix-loop-helix domain containing, class B2 Bhlhb2 5.79 NM_053831 Guanylate cyclase 2f Gucy2f 5.71 AW251703 Tumor necrosis factor receptor superfamily, member 12a Tnfrsf12a 5.57 NM_021691 Twist homolog 2 (Drosophila) Twist2 5.42 NM_133550 Fc receptor, IgE, low affinity II, alpha polypeptide Fcer2a 4.93 NM_031120 Signal sequence receptor, gamma Ssr3 4.84 NM_053544 Secreted frizzled-related protein 4 Sfrp4 4.73 NM_053910 Pleckstrin homology, Sec7 and coiled/coil domains 1 Pscd1 4.69 BE113233 Suppressor of cytokine signaling 2 Socs2 4.68 NM_053949 Potassium voltage-gated channel, subfamily H (eag- Kcnh2 4.60 related), member 2 NM_017305 Glutamate cysteine ligase, modifier subunit Gclm 4.59 NM_017309 Protein phospatase 3, regulatory subunit B, alpha Ppp3r1 4.54 isoform,type 1 NM_012765 5-hydroxytryptamine (serotonin) receptor 2C Htr2c 4.46 NM_017218 V-erb-b2 erythroblastic leukemia viral oncogene homolog Erbb3 4.42 3 (avian) AW918369 Zinc finger protein 191 Zfp191 4.38 NM_031034 Guanine nucleotide binding protein, alpha 12 Gna12 4.38 NM_017020 Interleukin 6 receptor Il6r 4.37 AJ002942
    [Show full text]
  • RT² Profiler PCR Array (96-Well Format and 384-Well [4 X 96] Format)
    RT² Profiler PCR Array (96-Well Format and 384-Well [4 x 96] Format) Human Protein Phosphatases Cat. no. 330231 PAHS-045ZA For pathway expression analysis Format For use with the following real-time cyclers RT² Profiler PCR Array, Applied Biosystems® models 5700, 7000, 7300, 7500, Format A 7700, 7900HT, ViiA™ 7 (96-well block); Bio-Rad® models iCycler®, iQ™5, MyiQ™, MyiQ2; Bio-Rad/MJ Research Chromo4™; Eppendorf® Mastercycler® ep realplex models 2, 2s, 4, 4s; Stratagene® models Mx3005P®, Mx3000P®; Takara TP-800 RT² Profiler PCR Array, Applied Biosystems models 7500 (Fast block), 7900HT (Fast Format C block), StepOnePlus™, ViiA 7 (Fast block) RT² Profiler PCR Array, Bio-Rad CFX96™; Bio-Rad/MJ Research models DNA Format D Engine Opticon®, DNA Engine Opticon 2; Stratagene Mx4000® RT² Profiler PCR Array, Applied Biosystems models 7900HT (384-well block), ViiA 7 Format E (384-well block); Bio-Rad CFX384™ RT² Profiler PCR Array, Roche® LightCycler® 480 (96-well block) Format F RT² Profiler PCR Array, Roche LightCycler 480 (384-well block) Format G RT² Profiler PCR Array, Fluidigm® BioMark™ Format H Sample & Assay Technologies Description The Human Protein Phosphatases RT² Profiler PCR Array profiles the gene expression of the 84 most important and well-studied phosphatases in the mammalian genome. By reversing the phosphorylation of key regulatory proteins mediated by protein kinases, phosphatases serve as a very important complement to kinases and attenuate activated signal transduction pathways. The gene classes on this array include both receptor and non-receptor tyrosine phosphatases, catalytic subunits of the three major protein phosphatase gene families, the dual specificity phosphatases, as well as cell cycle regulatory and other protein phosphatases.
    [Show full text]
  • Dynamic Regulatory Module Networks for Inference of Cell Type
    bioRxiv preprint doi: https://doi.org/10.1101/2020.07.18.210328; this version posted July 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Dynamic regulatory module networks for inference of cell type specific transcriptional networks Alireza Fotuhi Siahpirani1,2,+, Deborah Chasman1,8,+, Morten Seirup3,4, Sara Knaack1, Rupa Sridharan1,5, Ron Stewart3, James Thomson3,5,6, and Sushmita Roy1,2,7* 1Wisconsin Institute for Discovery, University of Wisconsin-Madison 2Department of Computer Sciences, University of Wisconsin-Madison 3Morgridge Institute for Research 4Molecular and Environmental Toxicology Program, University of Wisconsin-Madison 5Department of Cell and Regenerative Biology, University of Wisconsin-Madison 6Department of Molecular, Cellular, & Developmental Biology, University of California Santa Barbara 7Department of Biostatistics and Medical Informatics, University of Wisconsin-Madison 8Present address: Division of Reproductive Sciences, Department of Obstetrics and Gynecology, University of Wisconsin-Madison +These authors contributed equally. *To whom correspondence should be addressed. 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.18.210328; this version posted July 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Abstract Changes in transcriptional regulatory networks can significantly alter cell fate. To gain insight into transcriptional dynamics, several studies have profiled transcriptomes and epigenomes at different stages of a developmental process.
    [Show full text]
  • Transcriptome Profiling of Cleft Palate Intgf-Beta3 Knockout Mice Alleles: RNA-SEQ Analysis of TGF-Beta3 Mice" (2017)
    University of Nebraska Medical Center DigitalCommons@UNMC Theses & Dissertations Graduate Studies Fall 12-15-2017 Transcriptome Profiling of Cleft alateP inTGF-beta3 Knockout Mice Alleles: RNA-SEQ Analysis of TGF-beta3 Mice Kelsey White University of Nebraska Medical Center Follow this and additional works at: https://digitalcommons.unmc.edu/etd Part of the Bioinformatics Commons, and the Developmental Biology Commons Recommended Citation White, Kelsey, "Transcriptome Profiling of Cleft Palate inTGF-beta3 Knockout Mice Alleles: RNA-SEQ Analysis of TGF-beta3 Mice" (2017). Theses & Dissertations. 239. https://digitalcommons.unmc.edu/etd/239 This Thesis is brought to you for free and open access by the Graduate Studies at DigitalCommons@UNMC. It has been accepted for inclusion in Theses & Dissertations by an authorized administrator of DigitalCommons@UNMC. For more information, please contact [email protected]. TRANSCRIPTOME PROFILING OF CLEFT PALATE IN TGF-3 KNOCKOUT MICE ALLELES: RNA-SEQ ANALYSIS OF TGF-3 MICE By Kelsey Marie White, D.D.S. A THESIS Presented to the Faculty of the University of Nebraska Graduate College in Partial Fulfillment of Requirements for the Degree of Master of Science Medical Sciences Interdepartmental Area Graduate Program (Oral Biology) Under the Supervision of Ali Nawshad, Ph.D. University of Nebraska Medical Center Omaha, Nebraska December, 2017 Advisory Committee: Peter Giannini, D.D.S., M.S Ali Nawshad, Ph.D. S. Prem Premaraj, B.D.S., M.S., Ph. D. FRCD(C) Hasan Otu, Ph.D. i ACKNOWLEDGEMENTS First, I would like to sincerely thank my leader and mentor, Dr. Ali Nawshad, for the opportunity to work with and learn from him.
    [Show full text]
  • 1 Novel Expression Signatures Identified by Transcriptional Analysis
    ARD Online First, published on October 7, 2009 as 10.1136/ard.2009.108043 Ann Rheum Dis: first published as 10.1136/ard.2009.108043 on 7 October 2009. Downloaded from Novel expression signatures identified by transcriptional analysis of separated leukocyte subsets in SLE and vasculitis 1Paul A Lyons, 1Eoin F McKinney, 1Tim F Rayner, 1Alexander Hatton, 1Hayley B Woffendin, 1Maria Koukoulaki, 2Thomas C Freeman, 1David RW Jayne, 1Afzal N Chaudhry, and 1Kenneth GC Smith. 1Cambridge Institute for Medical Research and Department of Medicine, Addenbrooke’s Hospital, Hills Road, Cambridge, CB2 0XY, UK 2Roslin Institute, University of Edinburgh, Roslin, Midlothian, EH25 9PS, UK Correspondence should be addressed to Dr Paul Lyons or Prof Kenneth Smith, Department of Medicine, Cambridge Institute for Medical Research, Addenbrooke’s Hospital, Hills Road, Cambridge, CB2 0XY, UK. Telephone: +44 1223 762642, Fax: +44 1223 762640, E-mail: [email protected] or [email protected] Key words: Gene expression, autoimmune disease, SLE, vasculitis Word count: 2,906 The Corresponding Author has the right to grant on behalf of all authors and does grant on behalf of all authors, an exclusive licence (or non-exclusive for government employees) on a worldwide basis to the BMJ Publishing Group Ltd and its Licensees to permit this article (if accepted) to be published in Annals of the Rheumatic Diseases and any other BMJPGL products to exploit all subsidiary rights, as set out in their licence (http://ard.bmj.com/ifora/licence.pdf). http://ard.bmj.com/ on September 29, 2021 by guest. Protected copyright. 1 Copyright Article author (or their employer) 2009.
    [Show full text]
  • Specific Inhibitors of the Protein Tyrosine Phosphatase Shp2 Identified by High-Throughput Docking
    Specific inhibitors of the protein tyrosine phosphatase Shp2 identified by high-throughput docking Klaus Hellmuth*, Stefanie Grosskopf†, Ching Tung Lum*, Martin Wu¨ rtele*‡, Nadine Ro¨ der*§, Jens Peter von Kries†, Marta Rosario*, Jo¨ rg Rademann†¶, and Walter Birchmeier*ʈ *Max Delbru¨ck Center for Molecular Medicine, Robert Ro¨ssle Strasse 10, D-13125 Berlin, Germany; †Leibniz Institute for Molecular Pharmacology, Robert Ro¨ssle Strasse 10, D-13125 Berlin, Germany; and ¶Institute for Chemistry and Biochemistry, Free University Berlin, Takustrasse 3, D-14195 Berlin, Germany Edited by Axel Ullrich, Max Planck Institute, Martinsried, Germany, and accepted by the Editorial Board February 20, 2008 (received for review November 2, 2007) The protein tyrosine phosphatase Shp2 is a positive regulator of and is both essential and sufficient for Met function (18, 19). growth factor signaling. Gain-of-function mutations in several types Signaling through Met and its ligand, HGF/SF, has been implicated of leukemia define Shp2 as a bona fide oncogene. We performed a in high frequency in human cancer. Dysregulated Met signaling, high-throughput in silico screen for small-molecular-weight com- through mutation or up-regulation of Met, has been associated with pounds that bind the catalytic site of Shp2. We have identified the tumor progression, metastasis, and poor prognosis of survival (20). phenylhydrazonopyrazolone sulfonate PHPS1 as a potent and cell- Inhibitors of Shp2 may thus be useful for the treatment of these permeable inhibitor, which is specific for Shp2 over the closely human cancers and in limiting metastasis. related tyrosine phosphatases Shp1 and PTP1B. PHPS1 inhibits Shp2- The identification of specific small-molecular-weight inhibi- dependent cellular events such as hepatocyte growth factor/scatter tors of tyrosine phosphatases is a challenging endeavor, because factor (HGF/SF)-induced epithelial cell scattering and branching mor- the base of the catalytic cleft, the signature motif, is highly phogenesis.
    [Show full text]
  • Supporting Information
    Supporting Information Li et al. 10.1073/pnas.1617802113 SI Materials and Methods transfection. Cells were transfected with reporter constructs TOP- Plasmids. Mutant Tet3 (H950D and Y952A) was generated by or FOP-Flash using Lipofectamine 2000 (Invitrogen). Cell extracts PCR using Pfu polymerase, Dpn I treatment, and transformation were prepared 48 h after transfection. The luciferase activity was (Stratagene). The ORF of mouse Tet3, mutant Tet3 (H950D and evaluated by using the Dual-Luciferase Reporter Assay System ’ Y952A), Sfpr4, Pcdha4, and Pcdha7 were cloned into pPyCAGIP (Promega) according to the manufacturer s recommendations. vector (60). qRT-PCR. qRT-PCR was performed by using Universal SYBR Green Generation of Tet3 KO and Tet1/2/3 TKO mESCs. Tet3 KO and Tet1/2/3 Master Mix (Roche) and analyzed by a StepOne Plus real-time PCR ’ TKO mouse ESCs were generated from mice (C57BL/6 back- system (Applied Biosystems), according to the manufacturer sin- ground) bearing the individual floxed alleles (Fig. S1C) (14, 18), structions, and the data were normalized for Gapdh expression. followed by excision of the floxed exon by transient expression of The primers used for qRT-PCR are listed in Dataset S4. Cre recombinase. Immunohistochemistry. Immunohistochemistry was performed as mESC Culture and Differentiation. mESCs were maintained on mi- described (61) with the primary antibodies described below. For ∼ tomycin C-treated mouse embryonic fibroblasts (MEFs; feeders) in statistical analysis, 300 cells were examined for each experiment, standard medium (61). Neural differentiation in SFEB culture was which was repeated four times. Mouse embryos were fixed over- night in 4% (wt/vol) paraformaldehyde, saturated with 20% (wt/vol) performed as described (31) with a minor modification.
    [Show full text]