Expression of a Functional VEGFR-1 in Tumor Cells Is a Major Determinant of Anti-Plgf Antibodies Efficacy
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Functional Analysis of Somatic Mutations Affecting Receptor Tyrosine Kinase Family in Metastatic Colorectal Cancer
Author Manuscript Published OnlineFirst on March 29, 2019; DOI: 10.1158/1535-7163.MCT-18-0582 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Functional analysis of somatic mutations affecting receptor tyrosine kinase family in metastatic colorectal cancer Leslie Duplaquet1, Martin Figeac2, Frédéric Leprêtre2, Charline Frandemiche3,4, Céline Villenet2, Shéhérazade Sebda2, Nasrin Sarafan-Vasseur5, Mélanie Bénozène1, Audrey Vinchent1, Gautier Goormachtigh1, Laurence Wicquart6, Nathalie Rousseau3, Ludivine Beaussire5, Stéphanie Truant7, Pierre Michel8, Jean-Christophe Sabourin9, Françoise Galateau-Sallé10, Marie-Christine Copin1,6, Gérard Zalcman11, Yvan De Launoit1, Véronique Fafeur1 and David Tulasne1 1 Univ. Lille, CNRS, Institut Pasteur de Lille, UMR 8161 - M3T – Mechanisms of Tumorigenesis and Target Therapies, F-59000 Lille, France. 2 Univ. Lille, Plateau de génomique fonctionnelle et structurale, CHU Lille, F-59000 Lille, France 3 TCBN - Tumorothèque Caen Basse-Normandie, F-14000 Caen, France. 4 Réseau Régional de Cancérologie – OncoBasseNormandie – F14000 Caen – France. 5 Normandie Univ, UNIROUEN, Inserm U1245, IRON group, Rouen University Hospital, Normandy Centre for Genomic and Personalized Medicine, F-76000 Rouen, France. 6 Tumorothèque du C2RC de Lille, F-59037 Lille, France. 7 Department of Digestive Surgery and Transplantation, CHU Lille, Univ Lille, 2 Avenue Oscar Lambret, 59037, Lille Cedex, France. 8 Department of hepato-gastroenterology, Rouen University Hospital, Normandie Univ, UNIROUEN, Inserm U1245, IRON group, F-76000 Rouen, France. 9 Department of Pathology, Normandy University, INSERM 1245, Rouen University Hospital, F 76 000 Rouen, France. 10 Department of Pathology, MESOPATH-MESOBANK, Centre León Bérard, Lyon, France. 11 Thoracic Oncology Department, CIC1425/CLIP2 Paris-Nord, Hôpital Bichat-Claude Bernard, Paris, France. -
Supplementary Table 1. in Vitro Side Effect Profiling Study for LDN/OSU-0212320. Neurotransmitter Related Steroids
Supplementary Table 1. In vitro side effect profiling study for LDN/OSU-0212320. Percent Inhibition Receptor 10 µM Neurotransmitter Related Adenosine, Non-selective 7.29% Adrenergic, Alpha 1, Non-selective 24.98% Adrenergic, Alpha 2, Non-selective 27.18% Adrenergic, Beta, Non-selective -20.94% Dopamine Transporter 8.69% Dopamine, D1 (h) 8.48% Dopamine, D2s (h) 4.06% GABA A, Agonist Site -16.15% GABA A, BDZ, alpha 1 site 12.73% GABA-B 13.60% Glutamate, AMPA Site (Ionotropic) 12.06% Glutamate, Kainate Site (Ionotropic) -1.03% Glutamate, NMDA Agonist Site (Ionotropic) 0.12% Glutamate, NMDA, Glycine (Stry-insens Site) 9.84% (Ionotropic) Glycine, Strychnine-sensitive 0.99% Histamine, H1 -5.54% Histamine, H2 16.54% Histamine, H3 4.80% Melatonin, Non-selective -5.54% Muscarinic, M1 (hr) -1.88% Muscarinic, M2 (h) 0.82% Muscarinic, Non-selective, Central 29.04% Muscarinic, Non-selective, Peripheral 0.29% Nicotinic, Neuronal (-BnTx insensitive) 7.85% Norepinephrine Transporter 2.87% Opioid, Non-selective -0.09% Opioid, Orphanin, ORL1 (h) 11.55% Serotonin Transporter -3.02% Serotonin, Non-selective 26.33% Sigma, Non-Selective 10.19% Steroids Estrogen 11.16% 1 Percent Inhibition Receptor 10 µM Testosterone (cytosolic) (h) 12.50% Ion Channels Calcium Channel, Type L (Dihydropyridine Site) 43.18% Calcium Channel, Type N 4.15% Potassium Channel, ATP-Sensitive -4.05% Potassium Channel, Ca2+ Act., VI 17.80% Potassium Channel, I(Kr) (hERG) (h) -6.44% Sodium, Site 2 -0.39% Second Messengers Nitric Oxide, NOS (Neuronal-Binding) -17.09% Prostaglandins Leukotriene, -
Synchronous Overexpression of Epidermal Growth Factor Receptor and HER2-Neu Protein Is a Predictor of Poor Outcome in Patients with Stage I Non-Small Cell Lung Cancer
136 Vol. 10, 136–143, January 1, 2004 Clinical Cancer Research Synchronous Overexpression of Epidermal Growth Factor Receptor and HER2-neu Protein Is a Predictor of Poor Outcome in Patients with Stage I Non-Small Cell Lung Cancer ؍ Amir Onn,1,2 Arlene M. Correa,3 nocarcinomas than in squamous cell carcinomas (P Michael Gilcrease,4 Takeshi Isobe,2 0.035). Synchronous overexpression of EGFR and HER2- 1 2 neu was found in 11 tumors (9.9%). Patients with these ؍ ,Erminia Massarelli, Corazon D. Bucana 2,5 1 tumors had a significantly shorter time to recurrence (P ؍ Michael S. O’Reilly, Waun K. Hong, 0.006) and a trend toward shorter overall survival (P 2 3 Isaiah J. Fidler, Joe B. Putnam, and 0.093). Phosphorylated EGFR and transforming growth fac- Roy S. Herbst1,2 tor ␣ were detected but were not related to prognosis. Departments of 1Thoracic/Head and Neck Medical Oncology, 2Cancer Conclusions: Synchronous overexpression of EGFR Biology, 3Thoracic and Cardiovascular Surgery, 4Pathology, and and HER2-neu at the protein level predicts increased recur- 5 Radiation Oncology, The University of Texas M. D. Anderson rence risk and may predict decreased survival in patients Cancer Center, Houston, Texas with stage I NSCLC. This suggests that important interac- tions take place among the different members of the ErbB ABSTRACT family during tumor development and suggests a method for choosing targeted therapy. A prospective study is planned. Purpose: Despite maximal therapy, surgically treated patients with stage I non-small cell lung cancer (NSCLC) are at risk for developing metastatic disease. Histopathologic INTRODUCTION findings cannot adequately predict disease progression, so The overall 5-year survival rate in patients with lung cancer there is a need to identify molecular factors that serve this is Ͻ15% (1). -
Targeting the Function of the HER2 Oncogene in Human Cancer Therapeutics
Oncogene (2007) 26, 6577–6592 & 2007 Nature Publishing Group All rights reserved 0950-9232/07 $30.00 www.nature.com/onc REVIEW Targeting the function of the HER2 oncogene in human cancer therapeutics MM Moasser Department of Medicine, Comprehensive Cancer Center, University of California, San Francisco, CA, USA The year 2007 marks exactly two decades since human HER3 (erbB3) and HER4 (erbB4). The importance of epidermal growth factor receptor-2 (HER2) was func- HER2 in cancer was realized in the early 1980s when a tionally implicated in the pathogenesis of human breast mutationally activated form of its rodent homolog neu cancer (Slamon et al., 1987). This finding established the was identified in a search for oncogenes in a carcinogen- HER2 oncogene hypothesis for the development of some induced rat tumorigenesis model(Shih et al., 1981). Its human cancers. An abundance of experimental evidence human homologue, HER2 was simultaneously cloned compiled over the past two decades now solidly supports and found to be amplified in a breast cancer cell line the HER2 oncogene hypothesis. A direct consequence (King et al., 1985). The relevance of HER2 to human of this hypothesis was the promise that inhibitors of cancer was established when it was discovered that oncogenic HER2 would be highly effective treatments for approximately 25–30% of breast cancers have amplifi- HER2-driven cancers. This treatment hypothesis has led cation and overexpression of HER2 and these cancers to the development and widespread use of anti-HER2 have worse biologic behavior and prognosis (Slamon antibodies (trastuzumab) in clinical management resulting et al., 1989). -
Systems-Level Analysis of Erbb4 Signaling in Breast Cancer: a Laboratory to Clinical Perspective
Subject Review Systems-Level Analysis of ErbB4 Signaling in Breast Cancer: A Laboratory to Clinical Perspective Chih-Pin Chuu,1 Rou-Yu Chen,3 John L. Barkinge,1 Mark F. Ciaccio,1,2 and Richard B. Jones1 1The Ben May Department for Cancer Research and The Institute for Genomics and Systems Biology and 2The Committee on Cell Physiology, Gordon Center for Integrative Science, The University of Chicago; and 3Division of Immunotherapy, Department of Medicine, FeinbergSchool of Medicine, Northwestern University, Chicago, Illinois Abstract account the pregnancy history, lactation status, and Although expression of the ErbB4 receptor tyrosine hormone supplementation or ablation history of the kinase in breast cancer is generally regarded as a marker patient from whom the tumor or tumor cells are derived. for favorable patient prognosis, controversial (Mol Cancer Res 2008;6(6):885–91) exceptions have been reported. Alternative splicing of ErbB4 pre-mRNAs results in the expression of distinct Introduction receptor isoforms with differential susceptibility to Four receptors comprise the ErbB receptor tyrosine kinase enzymatic cleavage and different downstream signaling family: ErbB1 (epidermal growth factor receptor, HER1, c-erb- protein recruitment potential that could affect tumor B1), ErbB2 (HER2, neu, c-erb-B2), ErbB3 (HER3, c-erb-B3), progression in different ways. ErbB4 protein expression and ErbB4 (HER4, c-erb-B4). Whereas ErbB1 and ErbB2 are from nontransfected cells is generally low compared frequently overexpressed in breast cancer and correlate with a with ErbB1 in most cell lines, and much of our poor prognosis, ErbB4 expression in breast cancers actually knowledge of the role of ErbB4 in breast cancer is correlates with a favorable prognosis. -
Beyond Traditional Morphological Characterization of Lung
Cancers 2020 S1 of S15 Beyond Traditional Morphological Characterization of Lung Neuroendocrine Neoplasms: In Silico Study of Next-Generation Sequencing Mutations Analysis across the Four World Health Organization Defined Groups Giovanni Centonze, Davide Biganzoli, Natalie Prinzi, Sara Pusceddu, Alessandro Mangogna, Elena Tamborini, Federica Perrone, Adele Busico, Vincenzo Lagano, Laura Cattaneo, Gabriella Sozzi, Luca Roz, Elia Biganzoli and Massimo Milione Table S1. Genes Frequently mutated in Typical Carcinoids (TCs). Mutation Original Entrez Gene Gene Rate % eukaryotic translation initiation factor 1A X-linked [Source: HGNC 4.84 EIF1AX 1964 EIF1AX Symbol; Acc: HGNC: 3250] AT-rich interaction domain 1A [Source: HGNC Symbol;Acc: HGNC: 4.71 ARID1A 8289 ARID1A 11110] LDL receptor related protein 1B [Source: HGNC Symbol; Acc: 4.35 LRP1B 53353 LRP1B HGNC: 6693] 3.53 NF1 4763 NF1 neurofibromin 1 [Source: HGNC Symbol;Acc: HGNC: 7765] DS cell adhesion molecule like 1 [Source: HGNC Symbol; Acc: 2.90 DSCAML1 57453 DSCAML1 HGNC: 14656] 2.90 DST 667 DST dystonin [Source: HGNC Symbol;Acc: HGNC: 1090] FA complementation group D2 [Source: HGNC Symbol; Acc: 2.90 FANCD2 2177 FANCD2 HGNC: 3585] piccolo presynaptic cytomatrix protein [Source: HGNC Symbol; Acc: 2.90 PCLO 27445 PCLO HGNC: 13406] erb-b2 receptor tyrosine kinase 2 [Source: HGNC Symbol; Acc: 2.44 ERBB2 2064 ERBB2 HGNC: 3430] BRCA1 associated protein 1 [Source: HGNC Symbol; Acc: HGNC: 2.35 BAP1 8314 BAP1 950] capicua transcriptional repressor [Source: HGNC Symbol; Acc: 2.35 CIC 23152 CIC HGNC: -
A Selective Inhibitor of Vascular Endothelial Growth Factor Receptor-2 Tyrosine Kinase That Suppresses Tumor Angiogenesis and Growth
Molecular Cancer Therapeutics 1639 KRN633: A selective inhibitor of vascular endothelial growth factor receptor-2 tyrosine kinase that suppresses tumor angiogenesis and growth Kazuhide Nakamura,1 Atsushi Yamamoto,1 permeability. These data suggest that KRN633 might be Masaru Kamishohara,1 Kazumi Takahashi,1 useful in the treatment of solid tumors and other diseases Eri Taguchi,1 Toru Miura,1 Kazuo Kubo,1 that depend on pathologic angiogenesis. [Mol Cancer Ther Masabumi Shibuya,2 and Toshiyuki Isoe1 2004;3(12):1639–49] 1Pharmaceutical Development Laboratories, Kirin Brewery Co. Ltd., Takasaki, Gunma and 2Division of Genetics, Institute of Medical Science, University of Tokyo, Tokyo, Japan Introduction The formation of new blood vessels (angiogenesis) is es- sential for tumor progression and metastasis (1). This Abstract process is strictly controlled by positive angiogenic factors Vascular endothelial growth factor (VEGF) and its receptor and negative regulators; therefore, tumors without an VEGFR-2 play a central role in angiogenesis, which is angiogenic phenotype cannot grow beyond a certain size necessary for solid tumors to expand and metastasize. and remain in a state of dormancy. However, once tumors Specific inhibitors of VEGFR-2 tyrosine kinase are therefore become capable of angiogenesis due to somatic mutations thought to be useful for treating cancer. We showed that that alter the balance between angiogenic factors and neg- the quinazoline urea derivative KRN633 inhibited tyrosine ative regulators, they can grow rapidly and metastasize (2). Vascular endothelial growth factor (VEGF) is the an- phosphorylation of VEGFR-2 (IC50 = 1.16 nmol/L) in human umbilical vein endothelial cells. Selectivity profiling giogenic factor that is most closely associated with ag- with recombinant tyrosine kinases showed that KRN633 gressive disease in numerous solid tumors. -
And Vascular Endothelial Growth Factor Receptor (VEGFR)
molecules Review Molecular Targeting of Epidermal Growth Factor Receptor (EGFR) and Vascular Endothelial Growth Factor Receptor (VEGFR) Nichole E. M. Kaufman 1, Simran Dhingra 1 , Seetharama D. Jois 2,* and Maria da Graça H. Vicente 1,* 1 Department of Chemistry, Louisiana State University, Baton Rouge, LA 70803, USA; [email protected] (N.E.M.K.); [email protected] (S.D.) 2 School of Basic Pharmaceutical and Toxicological Sciences, College of Pharmacy, University of Louisiana at Monroe, Monroe, LA 71201, USA * Correspondence: [email protected] (S.D.J.); [email protected] (M.d.G.H.V.); Tel.: +1-225-578-7405 (M.d.G.H.V.); Fax: +1-225-578-3458 (M.d.G.H.V.) Abstract: Epidermal growth factor receptor (EGFR) and vascular endothelial growth factor receptor (VEGFR) are two extensively studied membrane-bound receptor tyrosine kinase proteins that are frequently overexpressed in many cancers. As a result, these receptor families constitute attractive targets for imaging and therapeutic applications in the detection and treatment of cancer. This review explores the dynamic structure and structure-function relationships of these two growth factor receptors and their significance as it relates to theranostics of cancer, followed by some of the common inhibition modalities frequently employed to target EGFR and VEGFR, such as tyrosine kinase inhibitors (TKIs), antibodies, nanobodies, and peptides. A summary of the recent advances Citation: Kaufman, N.E.M.; Dhingra, in molecular imaging techniques, including positron emission tomography (PET), single-photon S.; Jois, S.D.; Vicente, M.d.G.H. emission computerized tomography (SPECT), computed tomography (CT), magnetic resonance Molecular Targeting of Epidermal imaging (MRI), and optical imaging (OI), and in particular, near-IR fluorescence imaging using Growth Factor Receptor (EGFR) and tetrapyrrolic-based fluorophores, concludes this review. -
Implications for Combining Anti–VEGF and Anti–EGFR Agents
Subject Review The Role of VEGF and EGFR Inhibition: Implications for Combining Anti–VEGF and Anti–EGFR Agents Josep Tabernero Medical Oncology Service, Vall d’Hebron University Hospital, Barcelona, Spain Abstract faceted approach involving targeted inhibition of multiple Multiple cellular pathways influence the growth and signaling pathways may be more effective than inhibition of metastatic potential of tumors. This creates a single target and may help overcome tumor resistance by heterogeneity, redundancy, and the potential for tumors blocking potential ‘‘escape routes.’’ to bypass signaling pathway blockade, resulting in Two key elements in the growth and dissemination of tumors primary or acquired resistance. Combining therapies that are the vascular endothelial growth factor (VEGF) and the inhibit different signaling pathways has the potential to epidermal growth factor (EGF) receptor (EGFR). The VEGF be more effective than inhibition of a single pathway and and EGFR pathways are closely related, sharing common down- to overcome tumor resistance. Vascular endothelial stream signaling pathways (1). Furthermore, EGF, a key EGFR growth factor (VEGF) and epidermal growth factor ligand, is one of the many growth factors that drive VEGF receptor (EGFR) inhibitors have become key therapies in expression (2). VEGF and EGFR play important roles in tumor several tumor types. Close relationships between these growth and progression through the exertion of both indirect and factors exist: VEGF signaling is up-regulated by EGFR direct effects on tumor cells (1). Biological agents targeting the expression and, conversely, VEGF up-regulation VEGF and EGFR pathways have shown clinical benefit in independent of EGFR signaling seems to contribute to several human cancers, either alone or in combination with resistance to EGFR inhibition. -
The Oncogene HER2: Its Signaling and Transforming Functions and Its Role in Human Cancer Pathogenesis
Oncogene (2007) 26, 6469–6487 & 2007 Nature Publishing Group All rights reserved 0950-9232/07 $30.00 www.nature.com/onc REVIEW The oncogene HER2: its signaling and transforming functions and its role in human cancer pathogenesis MM Moasser Department of Medicine and Comprehensive Cancer Center, University of California, San Francisco, CA, USA The year 2007 marks exactly two decades since Human homologous to the v-erbB (avian erythroblastosis virus) Epidermal Growth Factor Receptor-2 (HER2) was viral oncogene and the cellular epidermal growth factor functionally implicated in the pathogenesis of human receptor (EGFR) gene (Schechter et al., 1984; Schechter breast cancer. This finding established the HER2 et al., 1985). In independent studies, an EGFR-related oncogene hypothesis for the development of some human gene was found to be amplified in a human breast cancer cancers. The subsequent two decades have brought about cell line and named HER2 (King et al., 1985). The an explosion of information about the biology of HER2 HER2 protein product was related to and had tyrosine and the HER family. An abundance of experimental kinase activity similar to EGFR (Akiyama et al., 1986). evidence nowsolidly supports the HER2 oncogene Subsequent cloning of two other related human genes hypothesis and etiologically links amplification of the and the post-genome characterization of the human HER2 gene locus with human cancer pathogenesis. The kinome completed the description of this family of molecular mechanisms underlying HER2 tumorigenesis four members (Kraus et al., 1989; Plowman et al., appear to be complex and a unified mechanistic model of 1993; Manning et al., 2002). -
Tie2 and Eph Receptor Tyrosine Kinase Activation and Signaling
Downloaded from http://cshperspectives.cshlp.org/ on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press Tie2 and Eph Receptor Tyrosine Kinase Activation and Signaling William A. Barton1, Annamarie C. Dalton1, Tom C.M. Seegar1, Juha P. Himanen2, and Dimitar B. Nikolov2 1Department of Biochemistry and Molecular Biology, School of Medicine, Virginia Commonwealth University, Richmond, Virginia 23298 2Structural Biology Program, Memorial Sloan-Kettering Cancer Center, New York, New York 10065 Correspondence: [email protected] The Eph and Tie cell surface receptors mediate a variety of signaling events during develop- ment and in the adult organism. As other receptor tyrosine kinases, they are activated on binding of extracellular ligands and their catalytic activity is tightly regulated on multiple levels. The Eph and Tie receptors display some unique characteristics, including the require- ment of ligand-induced receptor clustering for efficient signaling. Interestingly, both Ephs and Ties can mediate different, even opposite, biological effects depending on the specific ligand eliciting the response and on the cellular context. Here we discuss the structural features of these receptors, their interactions with various ligands, as well as functional implications for downstream signaling initiation. The Eph/ephrin structures are already well reviewed and we only provide a brief overview on the initial binding events. We go into more detail discussing the Tie-angiopoietin structures and recognition. ANGIOPOIETINS AND TIE2 In contrast tovasculogenesis, angiogenesis is asculogenesis and angiogenesis are distinct continually required in the adult for wound re- Vcellular processes essential to the creation of pairand remodeling of reproductive tissues dur- the adult vasculature. In early embryonic devel- ing female menstruation. -
Supplemental Tables
Supplemental Tables Supplemental Table I. Clinical Characteristic of Participants in this Study Characteristics Patients with CAD Healthy control P (n = 48) (n = 47) Age (mean ± SD) 60.35 ± 8.45 60.17 ± 7.64 0.534 Gender (male) 25 (52.08%) 24 (51.06%) 0.662 Hypertension 31 (64.58%) 16 (34.04%) 0.011 Diabetes 23 (47.92%) 7 (14.89%) 0.005 Smoking 26 (54.17%) 12 (25.53%) 0.035 Drinking 13 (27.08%) 6 (12.77%) 0.002 Hyperlipidemia 35 (72.82%) 16 (34.04%) 0.024 Systolic BP (mm Hg) 140.50 ± 16.58 130.60 ± 14.26 0.033 Diastolic BP (mm Hg) 77.42 ± 9.25 71.23 ± 6.39 0.046 FPG (mmol) 6.58 ± 1.32 5.45 ± 1.83 0.026 Triglycerides (mmol) 2.16 ± 0.66 1.52 ± 0.47 0.008 Total cholesterol (mmol) 4.54 ± 1.44 4.35 ± 1.35 0.705 HDL cholesterol (mmol) 1.26 ± 0.63 1.38 ± 0.48 0.004 LDL cholesterol (mmol) 3.23 ± 0.54 2.84 ± 0.86 0.018 SD indicates standard deviation; HDL, high-density lipoprotein cholesterol; and LDL, low-density lipoprotein cholesterol. Supplemental Table II. Primer Sequence Used in this Study Gene Forward Reverse MicroRNA-665 5′-GGTCTACAAAGGGAAGC-3′ 5′-TTTGGCACTAGCACATT-3′. U6 5′-CTCGCTTCGGCAGCACA-3′ 5′-AACGCTTCACGAATTTGCGT-3′ TGFBR1 5’- TCTGCATTGCACTTATGCTGA -3’ 5’- AAAGGGCGATCTAGTGATGGA -3’ GAPDH 5′-CACCCACTCCTCCACCTTTG-3′, 5′-CCACCACCCTGTTGCTGTAG-3′ Supplemental Tables Supplemental Table III. Functional Enrichment of Target Genes of miR-665 Category ID Term P value Genes BP GO:0043193 Positive regulation of gene-specific 0.000171 HIF1A, IKZF2, ETS1, RORB, NR2F2, PROX1, SRF, PPARGC1A transcription BP GO:0051272 Positive regulation of cell