Altered Endosome Biogenesis in Prostate Cancer Has Biomarker Potential

Published OnlineFirst July 30, 2014; DOI: 10.1158/1541-7786.MCR-14-0074

Molecular Cancer Oncogenes and Tumor Suppressors Research

Ian R.D. Johnson1, Emma J. Parkinson-Lawrence1, Tetyana Shandala1, Roberto Weigert2, Lisa M. Butler3,4, and Doug A. Brooks1

Abstract Prostate cancer is the second most common form of cancer in males, affecting one in eight men by the time they reach the age of 70 years. Current diagnostic tests for prostate cancer have significant problems with both false negatives and false positives, necessitating the search for new molecular markers. A recent investigation of endosomal and lysosomal proteins revealed that the critical process of endosomal biogenesis might be altered in prostate cancer. Here, a panel of endosomal markers was evaluated in prostate cancer and nonmalignant cells and a significant increase in gene and protein expression was found for early, but not late endosomal proteins. There was also a differential distribution of early endosomes, and altered endosomal traffic and signaling of the transferrin receptors (TFRC and TFR2) in prostate cancer cells. These findings support the concept that endosome biogenesis and function are altered in prostate cancer. Microarray analysis of a clinical cohort confirmed the altered endosomal gene expression observed in cultured prostate cancer cells. Furthermore, in prostate cancer patient tissue specimens, the early endosomal marker and adaptor protein APPL1 showed consistently altered basement membrane histology in the vicinity of tumors and concentrated staining within tumor masses. These novel observations on altered early endosome biogenesis provide a new avenue for prostate cancer biomarker investigation and suggest new methods for the early diagnosis and accurate prognosis of prostate cancer.

Implications: This discovery of altered endosome biogenesis in prostate cancer may lead to novel biomarkers for more precise cancer detection and patient prognosis. Mol Cancer Res; 12(12); 1851–62. 2014 AACR.

Introduction ref. 2), and recently, there have been recommendations to Prostate cancer is the most common form of cancer in abandon this procedure, particularly in older men (3). In males from developed countries, and the incidence of this addition, the digital rectal examination, which manually disease is predicted to double globally by 2030 (World checks the prostate for abnormalities, is limited by the Cancer Research Fund prostate cancer statistics; http:// inability to assess the entire gland and to some degree the globocan.iarc.fr). Prostate cancer affects approximately 1 in size of the tumor. Understanding the cell biology of prostate 8 men globally by the time they reach the age of 70 years (1). cancer is important to develop new biomarkers for the early The prostate-specific antigen test is currently used for diagnosis and accurate prognosis of prostate cancer. There is mounting evidence for a central role of endo- prostate cancer screening; however, this assay suffers from – a high percentage of false-positive results (see for example some lysosome compartments in cancer cell biology (see refs. 4–6). Endosomes and lysosomes are directly involved in the critical processes of energy metabolism (7), cell division 1Mechanisms in Cell Biology and Disease Research Group, School of (8) and intracellular signaling (see for example ref. 9) and Pharmacy and Medical Sciences, Sansom Institute for Health Research, would therefore have a direct role in cancer pathogenesis. University of South Australia, Adelaide, South Australia, Australia. 2NIDCR, – fi NIH, Bethesda, Maryland. 3Dame Roma Mitchell Cancer Research Labo- The endosome lysosome system has a speci c capacity to ratories, School of Medicine, University of Adelaide, Adelaide, South respond to environmental change, acting as an indicator of Australia, Australia. 4Adelaide Prostate Cancer Research Centre, School cellular function and will consequently be altered in cancer of Medicine, University of Adelaide, Adelaide, South Australia, Australia. (10). Moreover, the endosome–lysosome system has a crit- Note: Supplementary data for this article are available at Molecular Cancer ical role in controlling the secretion of proteins into extra- Research Online (http://mcr.aacrjournals.org/). cellular fluids (see for example ref. 11), making it an ideal Corresponding Author: Doug A. Brooks, Mechanisms in Cell Biology and system to identify new biomarkers that are released from Disease Research Group Leader, School of Pharmacy and Medical Sciences, Sansom Institute for Health Research, University of South cancer cells. Cumulative evidence from patient data and cell Australia, GPO Box 2471, Adelaide, SA 5001, Australia. Phone: 61-8- lines suggested that the process of lysosomal biogenesis 83021229; Fax: 61-883021087; E-mail: [email protected] might be altered in prostate cancer (see for example refs. 12, doi: 10.1158/1541-7786.MCR-14-0074 13). However, we recently demonstrated that a panel of 2014 American Association for Cancer Research. lysosomal proteins was unable to effectively discriminate

www.aacrjournals.org 1851

Johnson et al.

between a set of nonmalignant and prostate cancer cells (14). Alexa Fluor 488 (1:250), Alexa Fluor 633 (1:250), Trans- In contrast, the endosomal-related proteins cathepsin B and ferrin-633 (1:1,000), Phalloidin-488 (1:100), and Lyso- acid ceramidase displayed increased gene and protein expres- Tracker (5 mmol/L); all from Life Technologies Pty. Ltd. sion in prostate cancer cells and demonstrated some dis- criminatory capacity when compared to nonmalignant cells. Cell lines and culture conditions Acid ceramidase was previously shown to be upregulated in The nonmalignant cell lines PNT1a and PNT2 and prostate cancer tissues, and the overexpression of this enzyme prostate cancer cell lines 22RV1 and LNCaP (clone FCG) has been implicated in advanced and chemoresistant prostate were obtained from the European Collection of Cell Cul- cancer (15). Importantly, we also showed that LIMP-2, a tures via CellBank Australia (Children's Medical Research critical regulator of endosome biogenesis (16), had increased Institute, Westmead, NSW, Australia). These cell lines were gene and protein expression in prostate cancer cells (14), absent from the list of cross-contaminated or misidentified leading us to postulate that endosome biogenesis is altered in cell lines, version 6.8 (March 9, 2012; ref. 20). prostate cancer. Cell lines were cultured in 75-cm2 tissue culture flasks and Endosome biogenesis involves the synthesis and organi- maintained in RPMI-1640 culture medium (Gibco, Life zation of structural elements of the endosome system to form Technologies), supplemented with 10% fetal calf serum (In an integrated set of functional organelles that eventually Vitro Technologies Pty. Ltd.) and 2 mmol/L L-glutamine interact with lysosomes (see for example ref. 17). There are (Sigma-Aldrich Pty. Ltd.). Cells were incubated at 37C fi fi two main endosomal pathways: rst, from the biosynthetic with 5% CO2 in a Sanyo MCO-17AI humidi ed incubator compartments (endoplasmic reticulum and Golgi apparatus) (Sanyo Electric Biomedical Co., Ltd.). Cells were cultured to via specific vesicular traffic toward distal elements of the approximately 90% confluence before passage, by washing endosomal network, including early endosomes, late endo- with sterile PBS (Sigma-Aldrich), trypsin treatment (Tryp- somes, and multivesicular bodies; and from the cell surface sin–EDTA solution containing 0.12% trypsin, 0.02% through early endosomes to either recycling endosomes or EDTA; SAFC; Sigma-Aldrich) to dissociate the cells from toward late endosomes. In each case, the formation the culture surface and then resuspension in supplemented and movement of these dynamic vesicular compartments culture medium. is controlled by specific targeting signals and trafficking machinery (see for example refs. 17, 18). This vesicular Preparation of cell extracts and conditioned culture machinery can be used to define individual compartments; media for protein detection including, for example, the small GTPase Rab5 on The culture medium was aspirated from cultures at 80% early endosomes and the small GTPase Rab7 on late endo- to 90% confluence, the cells washed once with PBS, and somes (18, 19). Here, we have investigated the gene expres- then incubated with 800 mL of a 20 mmol/L Tris (pH 7.0) sion, amount of protein, and intracellular distribution of a containing 500 mmol/L sodium chloride and 2% (w/v) panel of endosomal proteins in prostate cancer and nonma- SDS. Cells were harvested and an extract prepared by lignant cell lines, to determine whether endosome biogenesis heating at 95C and sonication for 1 minute. The lysate is altered in prostate cancer cells and to identify potential new was then passaged six times through a 25-guage needle. biomarkers. Total protein in the cell extracts was quantified using a bicinchoninic acid assay according to the manufacturer's instructions (Micro BCA Kit; Pierce). Samples were Materials and Methods quantified using a Wallac Victor optical plate-reader and Antibody reagents Workout software v2.0 (PerkinElmer Pty. Ltd.), using a A LIMP-2 sheep polyclonal antibody was generated five-point parameter standard curve. Cell extracts were against the peptide sequence CKKLDDFVETG- stored at 20C. DIRTMVFP (Mimotopes Pty. Ltd.). Rabbit polyclonal Protein was recovered from conditioned culture media, antibodies (Abcam PLC) were against Appl1 (0.4 mg/mL), collected at the time of cell harvesting, using trichloroacetic Appl2 (0.4 mg/mL), Rab4 (1 mg/mL), TGN46 (10 mg/mL), acid precipitation. Briefly, cell debris was removed from the TfR1 (1 mg/mL), and TfR2 (1 mg/mL). Akt (1:1,000) and culture media by centrifugation (1,000 g for 10 minutes), phospho-Akt (Thr308; 1:1,000) from Cell Signaling Tech- sodium deoxycholate (Sigma-Aldrich) added to a final con- nology Inc., and horseradish peroxidase (HRP)–conjugated centration of 0.02% (v/v) and incubated on ice for 30 anti-GAPDH (1:20,000; Sigma-Aldrich Pty. Ltd.). Goat minutes. Trichloroacetic acid (Sigma-Aldrich) was then polyclonal antibodies (Santa Cruz Biotechnology) were added to a final concentration of 15% (v/v) and incubated against Rab5 (1 mg/mL), Rab7 (1 mg/mL), and EEA1 on ice for 2 hours. Protein was collected by centrifugation at (1 mg/mL). A LAMP-1 (1 mg/mL) mouse monoclonal BB6 4C (5,500 g for 30 minutes), washed twice with ice-cold was provided by Prof. Sven Carlsson (Umea University, acetone and resuspended in SDS-sample buffer/PBS solu- Umea, Sweden). HRP-conjugated secondary antibodies for tion, and stored at 20C. Western blot analysis included anti-goat/sheep (1:2,000; Merck Millipore Pty. Ltd.), anti-rabbit (1:2,000), and anti- Gene expression mouse (1:2,000; Sigma-Aldrich). The secondary and other Relative amounts of mRNA from nonmalignant and antibody-conjugated fluorophores that were used included prostate cancer cell lines were defined by quantitative PCR

1852 Mol Cancer Res; 12(12) December 2014 Molecular Cancer Research

Altered Endosome Biogenesis in Prostate Cancer

(qPCR). Briefly, cells were lysed with TRI reagent (Applied Immunofluorescence Biosystems, Life Technologies) and RNA extraction per- Cells were cultured on 22-mm glass coverslips, fixed with formed using RNeasy (Qiagen Pty. Ltd.) according to the 4% (v/v) formaldehyde in PBS for 20 minutes at room manufacturer's instructions. Two micrograms of total RNA temperature, and then permeabilized with 0.1% Triton-X was reverse-transcribed using the High Capacity RNA-to- (v/v) in PBS for 10 minutes. Nonspecific antibody reactivity cDNA Kit (Life Technologies) following the manufacturer's was blocked by incubation with 5% (w/v) bovine serum instructions. qPCR was performed with 2 mL of a 1:25 albumin (BSA) in PBS for 2 hours at room temperature. dilution of cDNA in 10 mL of reaction mixture; containing Cells were incubated with primary antibody in 5% BSA for 2 5 mL Power SYBR Green PCR Master Mix (Life Technol- hours at room temperature, followed by fluorophore-con- ogies) and 0.5 mL of both 10 nmol/L forward and reverse jugated secondary antibody in the dark for 1 hour at room primer. qPCR was performed using a 7500 Fast Real-Time temperature. Unbound antibody was removed by three PBS PCR System (Life Technologies). Each target was assessed in washes and coverslips mounted with ProLong Gold Antifade triplicate on a single plate and quantified relative to GAPDH Reagent containing DAPI nuclear stain (Life Technologies). endogenous control for each plate, with triplicate biologic Confocal microscopy was performed using a Zeiss LSM 710 replicates run independently. Oligonucleotides (Gene- META NLO laser scanning microscope and associated Carl Works Pty. Ltd.) were as follows: Zeiss Zen 2009 software. Laser lines of 370, 488, 543, and GAPDH TGCACCACCAACTGCTTAGC (Fwd) GG- 633 nm were used for DAPI, Alexa Fluor 488, Cy3, and CATGGACTGTGGTCATGAG (Rev; ref. 21); Alexa Fluor 633 fluorescence, respectively. Images were LAMP-1 ACGTTACAGCGTCCAGCTCAT (Fwd) T- exported as grayscale 16-bit TIFF files and processed using CTTTGGAGCTCGCATTGG (Rev; ref. 21); Adobe Photoshop CS5 (Adobe Systems Inc.). LIMP2 AAAGCAGCCAAGAGGTTCC (Fwd) GTCT- CCCGTTTCAACAAAGTC (Rev); Immunohistochemistry APPL1 ACTTGGGTACATGCAAGCTCA (Fwd) TC- Matched human nonmalignant and tumor prostate tissue CCTGCGAACATTCTGAACG (Rev); sections (3 mm) were mounted on Superfrost Ultra Plus APPL2 AGC TGATCGCGCCTGGAACG (Fwd) GG- slides (Menzel-Gl€aser GmbH) and heated overnight at GTTGGTACGCCTGCTCCCT (Rev); 50C. Sections were then dewaxed in xylene, rehydrated EEA1 CCCAACTTGCTACTGAAATTGC (Fwd) TG- in ethanol, and incubated in 0.3% H2O2 in PBS for 15 TCAGACGTGTCACTTTTTGT (Rev); minutes at room temperature. Heat–Induced Epitope RAB5 AGACCCAACGGGCCAAATAC (Fwd) GCC- Retrieval was carried out using 10 mmol/L citrate buffer CCAATGGTACTCTCTTGAA (Rev); (pH 6.5) in a Decloaking Chamber (Biocare Medical LLC) RAB4 GGGGCTCTCCTCGTCTATGAT (Fwd) AG- for 5 minutes at 125C. Slides were blocked first using an CGCATTGTAGGTTTCTCGG (Rev); Invitrogen Avidin/Biotin Kit (as per the manufacturer's RAB7 GTGTTGCTGAAGGTTATCATCCT (Fwd) instructions) and then in 5% blocking serum (Sigma- GCTCCTATTGTGGCTTTGTACTG (Rev). Aldrich) for 30 minutes at room temperature in a humid chamber. Sections were then incubated with primary anti- Western blotting body overnight at 4C in a humid chamber, followed by Ten micrograms of total protein for whole-cell lysates or incubation with the appropriate biotinylated secondary the secreted protein from approximately 3 106 cells was antibody (1:400; Dako Australia Pty. Ltd.) for 1 hour at heat-denatured (5 minutes at 100CinNuPAGELDS room temperature in a humid chamber, then streptavidin– Sample Buffer and reducing agent), then electrophoresed HRP (1:500; Dako Australia Pty. Ltd.) for 1 hour at room at 120 V for 1.5 hours using pre-cast gels in an XCell temperature in a humid chamber and finally with DAB/ SureLock Mini-Cell system (Life Technologies). The H2O2. The tissue sections were then counterstained with protein was then transferred to polyvinylidene difluoride Lillie–Mayer hematoxylin, rinsed in water, rehydrated, and membranes (Polyscreen; PerkinElmer). The transfer mounted on slides with DPX mounting media (Merck membranes were blocked for 1 hour at room temperature Millipore Pty. Ltd.). Images were obtained by scanning using a 5% (w/v) skim milk solution in 0.1% (v/v) TBS- slides using a NanoZoomer (Hamamatsu Photonics K.K.). Tween (blocking solution) and incubated with primary antibody overnight at 4C. The membranes were washed Data analysis in 0.1% (v/v) TBS-Tween and then incubated with the Quantities of target-gene and endogenous-control appropriate HRP-conjugated secondary antibody diluted (GAPDH) were calculated from a standard curve from serial at 1:2,000 in blocking solution. The membranes were dilutions of control material (LNCaP cDNA). Kruskal– developed using a Novex ECL chemiluminescent sub- Wallis nonparametric analysis of variance statistical analyses strate reagent kit (Life Technologies), and proteins were were performed using Stata/SE v11.2 (StataCorp LP) to visualized using an ImageQuant LAS 4000 imager, soft- determine the significance between nonmalignant control ware version 1.2.0.101 (GE Healthcare Pty. Ltd.). Trip- (PNT1a and PNT2) and prostate cancer (22RV1 and licate samples were analyzed and images quantified relative LNCaP) cell lines (95% confidence limit; P 0.05) for to a reference GAPDH loading control using Alpha- intracellular or secreted protein amount, and gene expres- ViewSA software v3.0 (ProteinSimple Pty. Ltd.). sion. The Taylor microarray cohort (GSE21034) consisted

www.aacrjournals.org Mol Cancer Res; 12(12) December 2014 1853

Johnson et al.

of patients treated by radical prostatectomy at the Memorial Sloan-Kettering Cancer Center (MSKCC; New York, NY; ref. 22), proﬁling 150 prostate cancer and 29 nonmalignant tissue samples that was performed using Affymetrix Human Exon 1.0 ST arrays. Statistical analysis of microarray gene expression was performed using a two-tailed unpaired t test with Welch correction using GraphPad Prism 5.03 (Graph- Pad Software Inc.).

Results Increased endosome-related gene and protein expression in prostate cancer cells The expression of endosome- and lysosome-related genes was quantified by qPCR in control and prostate cancer cells and normalized to the expression of GAPDH mRNA. The amounts of LIMP2, APPL1, APPL2, RAB5A, EEA1,and RAB4 mRNA were significantly increased in prostate cancer when compared with nonmalignant control cell lines (P 0.05; Fig. 1). In each case, there was an approximately 2- to 3- fold increase in mRNA expression. There was no significant difference in the amount of either RAB7 or LAMP-1 mRNA detected in prostate cancer cells compared with nonmalignant controls. Western blot analysis (Fig. 2A) demonstrated significant increases in the amount of LIMP-2, Appl1, Appl2, EEA1, and Rab4 protein in extracts from prostate cancer cells when compared with nonmalignant control cells (P 0.05; Fig. 2B). Moreover, for both LIMP-2 and Rab4, the increase was approximately 2- to 4-fold for prostate cancer when compared with nonmalignant cells (Fig. 2B). There was no significant difference in the amount of Rab5, Rab7, and LAMP-1 protein detected in nonmalignant compared with prostate cancer cells (Fig. 2B).

Altered distribution of endosomes and lysosomes in prostate cancer cells Figure 1. Quantiﬁcation of endosomal and lysosomal gene expression in Representative confocal images for the distribution of control and prostate cancer cell lines. Levels of mRNA transcripts in nonmalignant control cell lines (white bars) and prostate cancer cell lines endosomes and lysosome proteins (Fig. 3) show evidence (black bars) were evaluated by qPCR in triplicate experiments. Data were of increased staining and altered distribution in prostate expressed relative to GAPDH endogenous control and analyzed by the cancer compared with the nonmalignant controls. In non- Kruskal–Wallis rank-sum method. Statistical signiﬁcance (P 0.05) is malignant control cells, LIMP-2 was concentrated in the represented by an asterisk. perinuclear region, with some punctuate vesicular staining in the remainder of the cytoplasm. In contrast, prostate cancer trated in the perinuclear region, whereas in prostate cancer cells displayed relatively smaller LIMP-2 compartments, cells the LAMP-1 compartments were distributed away from which had an even distribution throughout the cytoplasm. the perinuclear region and concentrated in cellular exten- Appl1-positive endosomes were detected throughout the cell sions. Consistent with the LAMP-1 staining, LysoTracker cytoplasm of nonmalignant control cells, whereas in prostate positive acidic compartments were concentrated mainly in cancer cells, these compartments were more concentrated at the perinuclear region of nonmalignant control cells, where- the cell periphery, particularly near the plasma membrane in as in prostate cancer cells, these compartments were detected cellular extensions/pseudopodia. In nonmalignant control in both the perinuclear region and in cytoplasmic extensions cells, both Rab5 and its effector EEA1 were concentrated in (Fig. 3). the perinuclear region, whereas in prostate cancer cells, these endosomal compartments were found throughout the cyto- Altered distribution of endocytosed transferrin in plasm, with some compartments located toward the cell prostate cancer cells periphery in cellular extensions. Rab7-positive endosomes Previous studies have reported increased uptake of trans- were located mainly in the perinuclear region of both ferrin in prostate cancer cells, prompting the investigation of nonmalignant control and prostate cancer cells. In nonma- receptor expression and transferrin endocytosis in relation to lignant control cells, LAMP-1 compartments were concen- the observed increase in endosome protein expression and

1854 Mol Cancer Res; 12(12) December 2014 Molecular Cancer Research

Altered Endosome Biogenesis in Prostate Cancer

Figure 2. Detection and quantification of intracellular lysosomal proteins in nonmalignant control and prostate cancer cell lines. A, representative images from Western blot analysis of 10 mg whole-cell lysate from nonmalignant control cell lines PNT1a and PNT2, and cancer cell lines 22RV1 and LNCaP, examined in triplicate. B, protein amount was quantified by densitometry relative to a GAPDH endogenous control. Data were analyzed by the Kruskal– Wallis rank-sum method with statistical significance represented by an asterisk. (, P 0.05; , P 0.01).

altered endosome distribution. In nonmalignant control malignant control cell lines within the ﬁrst 5 minutes cells, endocytosed transferrin was observed in punctate of incubation and at the 30-minute incubation point. In intracellular structures after 5 minutes and in the perinuclear nonmalignant cells at 30 (Fig. 4) and 20 minutes (Fig. 5), region at 15 and 30 minutes (Fig. 4). The prostate cancer this transferrin was tightly concentrated in close proximity to cells endocytosed relatively more transferrin than the non- the nucleus. After 15 minutes of incubation, the internalized

www.aacrjournals.org Mol Cancer Res; 12(12) December 2014 1855

Johnson et al.

Figure 3. Confocal micrographs of endosomal markers in prostate cancer cell lines compared with nonmalignant control cell lines. Fixed cells were probed for endosome markers (green) and counterstained with DAPI nuclear stain (blue) and visualized by laser-scanning confocal microscopy. Cell outlines were visualized by transmitted light illumination and cell periphery depicted by white dotted line. Antibody labeling was performed in triplicate experiments and a minimum of 5 cells were visualized in each cell line for each assay. Similar ﬂuorescence staining was observed in all cells for each cell line/antibody label. An additional confocal micrograph from an independent labeling assay is presented in Supplementary Fig. S1.

transferrin was not as concentrated in the perinuclear region in the LNCaP cancer cell line (Fig. 6A). Colocalization of TfR1 of prostate cancer cells, with more transferrin-labeled com- and transferrin was observed in all cell lines, and was in a partments in the cell periphery and distributed throughout perinuclear location in nonmalignant cell lines PNT1a and the cytoplasm when compared with the nonmalignant cells PNT2 compared with a broader cytoplasmic distribution in (Fig. 4). There was also a marked reduction in actin staining the cancer cell lines 22RV1 and LNCaP. Conversely, there for the prostate cancer compared with the nonmalignant appeared to be no colocalization of transferrin with TfR2 in control cell lines (Fig. 4). In the nonmalignant control cells, nonmalignant cells and limited colocalization of transferrin transferrin was clustered mainly in LIMP-2- and Rab7- with TfR2 compartments in the prostate cancer cells (Fig. 6C). positive endosomes localized in the perinuclear region (Fig. 5). Although the prostate cancer cells had some LIMP-2- and Altered Akt signaling in prostate cancer cells transferring-positive staining in the perinuclear region and The total amount of Akt protein detected in nonmalignant some colocalization of transferrin with the Golgi marker control cells was similar to that detected in prostate cancer TGN46 (yellow colocalization), the majority of transferrin cells (Fig. 6D and E). There were, however, differences in the was localized in different endosomal compartments (i.e., amount of phosphorylated Akt in the prostate cancer lines, Appl1, Rab5, and EEA1) distributed throughout the cyto- with 22RV1 showing a marked reduction in the amount of plasm and in cellular extensions (Fig. 5). The Rab4 recycling phosphorylated Akt, whereas LNCaP had an increased endosomes and LAMP-1–positive lysosomes had similar amount of phosphorylated Akt (Fig. 6D), a phenomenon patterns of transferrin staining for the prostate cancer and previously observed by Shukla and colleagues (23) and nonmalignant control cell lines (Fig. 5). Further analysis of related to mutations of PTEN in LNCaP. More importantly, the transferrin receptors revealed variable gene and protein following the addition of transferrin, there was a significant expression for TfR1 (TFRC) and TfR2 (TFR2; Fig. 6A and increase in the amount of phosphorylated Akt in the non- B). There was a significant increase in TFRC gene expression malignant control cell lines, but no change in the amount of (P 0.05) in prostate cancer cells when compared with phosphorylated Akt in either of the cancer cells (Fig. 6E). nonmalignant controls (Fig. 6A), but only a qualitative increase in TfR1 protein in the prostate cancer cell line LAMP-1and APPL1 mRNA expression in a prostate 22RV1 and not for LNCaP (Fig. 6B). Although there was cancer microarray cohort and distribution of LAMP-1 significantly more TfR2 protein detected in prostate cancer and Appl1 in prostate tissue cells when compared with the nonmalignant cells (P To support the hypothesis of altered endosome biogen- 0.05), there was only an increase in TFR2 gene expression esis in prostate cancer, the percentage change of mRNA

1856 Mol Cancer Res; 12(12) December 2014 Molecular Cancer Research

Altered Endosome Biogenesis in Prostate Cancer

Discussion Prostate cancer is one of the most frequently diagnosed cancers in men and a leading cause of cancer-related deaths worldwide, particularly, in the United States and Australa- sian populations (24, 25). The prostate-specific antigen is still commonly used to detect prostate cancer, but has significant problems in terms of miss-diagnosis and prognostic prediction (see for example ref. 26). Some promising adjunct tests have recently been developed, including prostate cancer antigen 3 (PCA3; ref. 27), the analysis of cholesterol sulfate (28), and a novel sequence of the gene protein kinase C-zeta (PRKCZ), which is translated to the z protein PRKC- -PrC (29). However, these biomarkers do not provide early and accurate detection of prostate cancer, which is needed to enable the selection of the most appropriate therapeutic intervention and to avoid potential over- treatment (2). On the basis of our observations of altered LIMP-2 expression (14), we investigated altered endosomal biogenesis in prostate cancer to help provide more sensitive and specific markers for early detection and disease prediction. There have been extensive protein and proteomic studies undertaken to identify potential new prostate cancer biomarkers (see for example ref. 26); however, the ideal marker with appropriate sensitivity and specificity is yet to be established. Interestingly, many of the early biomarkers investigated, and some of the recent proteins identified in Figure 4. Time-course of transferrin uptake in prostate cell lines. proteomic studies, are either lysosomal hydrolases (e.g., Representative confocal micrographs from triplicate staining lysosomal cathepsins, acid ceramidase, and acid phospha- experiments showing increased uptake and altered distribution of tase), lysosomal membrane proteins (e.g., LAMP-1-3 also transferrin in prostate cancer cell lines compared with nonmalignant called CD107a, b, and CD63) or proteins that are deliv- control cell lines. Cell cultures were incubated with transferrin Alexa Fluor – 633 conjugate (red) for a period of 5, 15, and 30 minutes before cell ered from the cell surface into the endosome lysosome fixation and F-actin labeled with phalloidin Alexa Fluor 488 (green). system (e.g., sialomucin/CD164, CD1, CD47, and Arrows in the control cells depict transferrin that was concentrated in CD75). Additional evidence supports the concept that close proximity to the nucleus at 30 minutes. Additional confocal endosomal–lysosomal biogenesis is altered in prostate micrographs of transferrin uptake are presented in Supplementary cancer, including the altered distribution of lysosomes Fig. S2. that has been reported in prostate cancer cells (30). Despite these indications on lysosomal biogenesis, a set expression for LAMP-1 and APPL1 was analyzed from the of optimal prostate cancer biomarkers have yet to be Taylor microarray cohort (Fig. 7A). LAMP-1 gene expres- defined. In a recent study of endosome and lysosome sion was significantly decreased (P 0.01) in prostate markers in prostate cancer cell lines, we also found that cancer tissue compared with nonmalignant prostate tissue. lysosomal markers were unable to discriminate prostate APPL1 gene expression was significantly increased (P cancer from nonmalignant cell lines, but there was evi- 0.05) in prostate cancer tissue compared with nonmalig- dence suggesting that endosome biogenesis may be altered nant tissue. Immunohistochemistry was used to investi- in prostate cancer cells (14). gate the distribution of LAMP-1 and Appl1 in prostate Here, we observed altered distribution of specific endo- cancer patient tissue samples (Fig. 7B). The lysosomal some subsets and lysosomes into the cellular periphery of marker LAMP-1 showed tumor-specific staining in some prostate cancer cells, which could have important implica- patient samples, but consistent with previous studies, tions for cancer cell biomarker release and intracellular there were variable results with some patient samples signaling. Acidic extracellular pH has been shown to enhance having little or no LAMP-1 staining (data not shown for organelle redistribution, stimulating the traffic of endo- the latter). In nonmalignant tissue, Appl1 clearly delin- some–lysosome–related organelles to the periphery of cancer eated basement membranes, whereas in the malignant cells (10, 31). This altered endosome–lysosome traffic has tissue there was no evidence of basement membrane been linked with the release of cathepsin B and tumor staining (Fig. 7B). In addition, Appl1 specifically delin- invasiveness (32), presumably due to the hydrolysis of eated the cancer margins and showed increased staining extracellular matrix after the exocytosis of this enzyme within the tumor mass (Fig. 7B). (33). However, cathepsin B has been reported to be more

www.aacrjournals.org Mol Cancer Res; 12(12) December 2014 1857

Johnson et al.

Figure 5. Transferrin and endosome/lysosome marker coﬂuorescence. Confocal micrographs and enlargements showing transferrin (red; endocytosed for 20 minutes) and endosome/lysosome marker (green) in nonmalignant control cell lines PNT1a and PNT2, and prostate cancer cell lines 22RV1 and LNCaP. Colocalization of markers is depicted by yellow ﬂuorescence.

enriched in endosomes (34) rather than lysosomes, whereas bution of endosomes via ERK signaling (36). Increases in þ þ the reverse is true for another proposed prostate cancer Na /H exchange activity (acidiﬁcation), RhoA GTPase biomarker cathepsin D (35). The movement of lysosom- activity, and PI3K activation have been shown to result in al-related vesicles to the periphery of prostate cancer cells has exocytosis from prostate cancer cells (31). The increased been shown to be dependent on GTPases (e.g., RhoA), endosomal-associated gene and protein expression observed microtubules, the molecular motor protein KIF5b, and to here, together with the previously observed cathepsin B involve PI3K, Akt/Erk1/2 phosphorylation, and MAPK release, suggested that endosome-related proteins may pro- signaling (32). Moreover, a component of the MAPK vide an important new focus for prostate cancer disease signaling pathway, the endosome-localized MAPK/Erk biomarker studies. kinase (MEK1) p14–MP1 scaffolding complex, has been Increased expression of the endosomal protein LIMP-2 shown to speciﬁcally interact with and regulate the distri- has been shown in oral squamous cell carcinoma and was

1858 Mol Cancer Res; 12(12) December 2014 Molecular Cancer Research

Altered Endosome Biogenesis in Prostate Cancer

Figure 6. Analysis of transferrin receptor expression and localization with transferrin. A, quantification of transferrin receptor 1 (TFRC) and transferrin receptor 2 (TFR2) gene expression in nonmalignant and prostate cancer cell lines. B, Western blot analysis and protein quantification of transferrin receptor 1 (TfR1) and transferrin receptor 2 (TfR2). Quantification of gene and protein expression was relative to GAPDH gene and protein, respectively. C, confocal micrographs and enlargements showing transferrin (red) and transferrin receptor (green) in nonmalignant cell lines PNT1a and PNT2, and prostate cancer cell lines 22RV1 and LNCaP. Colocalization of transferrin receptor and transferrin is represented by yellow fluorescence. D, Western blot analysis and quantification (E) of AKT phosphorylation relative to total AKT, prior and subsequent to treatment of nonmalignant (PNT1a and PNT2) and prostate cancer cells (22RV1 and LNCaP) with transferrin for 20 minutes. , P 0.05.

associated with tumor metastasis (37). LIMP-2 has been observed in cell lines. Furthermore, the each EEA1 and Appl1 reported to have a role in endosome biogenesis and its over- endosome subpopulations displayed altered intracellular dis- expression evoked the enlargement of both early and late tribution consistent with altered endosome traffic and poten- endosomes (16). We observed increased gene and protein tially function. Interestingly, while Rab7 expression was expression of the endosomal protein LIMP-2 in prostate unaltered, Rab7-positive compartments displayed differential cancer cell lines (14), prompting us to investigate other distribution in prostate cancer compared with nonmalignant endosomal proteins in prostate cancer cells. The early endo- cells. Changes in subcellular localization may affect signaling some-associated proteins Appl1, Appl2, EEA1, and recycling in a similar manner to that which transpires through down- endosome protein Rab4 were significantly upregulated (gene regulated gene/protein expression that affects prostate cancer and protein) in prostate cancer cells, supporting the hypoth- progression through enhanced signaling (38). Thus, the esis of altered endosome biogenesis in prostate cancer. APPL1 analysis of compartment distribution may distinguish cancer expression was significantly increased in the Taylor prostate cell phenotypes independently of altered gene and protein cancer tissue microarray, supporting the expression profiles expression.

www.aacrjournals.org Mol Cancer Res; 12(12) December 2014 1859

Johnson et al.

receptor has previously been observed to colocalize with Rab5 and the motor protein myosin VI; the latter of which is involved in retrograde transport to the plasma membrane (42). This was consistent with our observations of endosome populations costaining with labeled transferrin in the cellular periphery of prostate cancer cells. There also appeared to be a deregulation of Akt signaling in prostate cancer cells, with control cells being responsive to transferrin endocytosis, but prostate cancer cells being unresponsive, despite having variable high or low amounts of Phospho-Akt/Akt. This altered signaling may be related to the intracellular location of the transferrin receptor that can be disturbed through changes in localization or depletion of PtdIns3P (43) or affected through variable internalization resulting from altered Appl1 or Rab5 expression (as is the case with epidermal growth factor receptor; ref. (44), affecting receptor trafficking and signal modulation. Appl1 has been shown to be directly involved in insulin signaling and the translocation of the glucose transporter GLUT-4, which is mediated by direct binding of Appl1 to PI3K and Akt (45), inducing endosome relocalization. In prostate cancer cells, Appl1-potentiated Akt activity has also been shown to suppress androgen receptor transactivation (46). The increased gene and protein expression of Appl1 that we observed in prostate cancer cells might be expected to cause increased glucose uptake, due to its effect on GLUT-4 and this could have implications for energy metabolism in these cancer cells. Indeed, Appl1 also regulates other aspects of both lipid and glucose metabolism, activating AMP-activated kinase, p38 MAPK, and PPARa (see for example ref. 45). Appl2 has beenshowntofunctionasanegativeregulatorofadipo- nectin signaling, by competitive binding with Appl1 for Figure 7. Analysis of gene expression and protein distribution in prostate cancer compared with nonmalignant tissue.A,box-and- interaction with the adiponectin receptor, again regulating whisker graphs showing percentage change of LAMP1 and APPL1 energy metabolism. The increased expression of both mRNA expression in normal (n ¼ 29) and prostate cancer tissue (n ¼ Appl1 and Appl2 could therefore impact heavily on 150) from metanalysis of the cohort by Taylor and colleagues (22). prostate cancer cell metabolism with direct significance Box-and-whisker graphs were plotted with Tukey outliers (black for increased energy utilization and prostate cancer cell points). Statistical significance is represented by an asterisk ( , P 0.05; , P 0.01). B, LAMP-1 (a and b) and Appl1 (d and e) expression survival. The altered Appl1 expression and effect on Akt in matched human normal (a and d) and malignant (b; Gleason grade signaling in prostate cancer cells would be expected to also 3þ3, e; Gleason grade 3þ4) prostate tissue. Both normal and have significant consequence for other aspects of prostate malignant mixed-tissue is stained for LAMP-1 (c; Gleason grade 3þ3) cancer biology, due to the importance of the Appl1/PI3K/ and Appl1 (f; Gleason grade 3þ4). The arrows in d and f show Appl1 staining the basement membrane in nonmalignant prostate tissue. Akt signaling pathway in leading cell adhesion and cell Scale bar, 100 mmina,b,anddand200mminc,e,andf. migration (47). Notably, Appl1 also acts as a mediator of other signaling pathways, by interaction with the cytosolic face of integral or membrane-associated proteins either at The significant changes that we observed in endosome- the cell surface or in the endosome pathway; where it is associated gene and protein expression, together with the directly involved in endosome traffic. altered distribution of endosome populations prompted us Rab GTPases are integrally involved in the control of to investigate transferrin receptor expression together with endosome traffic, cycling between the cytoplasmic GDP- transferrin endocytosis, sorting, and Akt signaling as mea- bound state and the active membrane–associated GTP- sures of endosome function. Significant increases in the bound state. Rab5 and Rab7 respectively define early- and amount of transferrin receptor have previously been reported late-endosome compartments and during endosome matu- in prostate cancer cells (39), and this has been linked to c- ration Rab5 recruits the HOPS complex as a mechanism to Myc activation, which alters proliferation and tumorigenesis activate and be replaced by Rab7. Although mVps39 is (40). Akt signaling is also essential for regulating cell growth known to be a guanine nucleotide exchange factor (GEF) and survival; and this controls the cell surface expression of that promotes the GTP-bound state on endosomal Rabs, transferrin and growth factor receptors (41). The transferrin TBC-2/TBC1D2 is a Rab GTPase-activating protein (GAP)

1860 Mol Cancer Res; 12(12) December 2014 Molecular Cancer Research

Altered Endosome Biogenesis in Prostate Cancer

that promotes the GDP-bound state; and in combination is here, may increase the amount of endocytosis in prostate used to regulate the membrane localization of Rab proteins. cancer cells, which could increase nutrient uptake/availabil- TBC-2/TBC1D2 is therefore thought to act as a regulator of ity, provide additional membrane for cell division (9), and endosome to lysosome traffic and is required to maintain the alter intracellular signaling (10); which are all hallmarks of correct size and distribution of endosomes (48). The altered cancer cell biology. There appeared to be a specific discon- distribution of endosome populations that we observed in nect between the cellular location of early endosomes (and prostate cancer cells suggests that TBC-2/TBC1D2 (GAP) lysosomes) in the cell periphery and late endosomes in the and or mVps39 (GEF) might be functionally impaired; perinuclear region, which could affect degradative and particularly, as the early endosomes were routed mainly signaling processes in prostate cancer cells. We concluded toward the cell periphery, whereas late endosomes remained that endosome biogenesis and function is altered in prostate in a perinuclear location. Interestingly, microarray analysis has cancer cells, opening a potentially new avenue to investigate detected increased expression of TBC-2/TBC1D2 and biomarkers that aid in the diagnosis and prognosis of prostate reduced Vps39 mRNA in relation to altered endosomal– cancer. Endosomes are directly involved in the processes of lysosomal traffic (49). This altered GEF and GAP function cellular secretion and exosome release, making these newly has been shown to be critical for endosomal traffic of integrins identified endosomal proteins potentially available for detec- and there have been direct links established between altered tion in patient samples, such as blood and urine. Rab GTPase activity and cancer progression (50). The expression of endosome markers has not previously Disclosure of Potential Conflicts of Interest been investigated thoroughly in prostate cancer, although No potential conflicts of interest were disclosed. some lysosomal-related cell surface CD (cell differentiation) markers and LAMP-1/LAMP-2 have been used in tissue Authors' Contributions biopsy analysis. The Gleason grading system is used to define Conception and design: I.R.D. Johnson, E.J. Parkinson-Lawrence, T. Shandala, R. Weigert, L.M. Butler, D.A. Brooks histologic differentiation in conjunction with marker anal- Development of methodology: I.R.D. Johnson, E.J. Parkinson-Lawrence, ysis to predict the course of disease in patients with prostate T. Shandala cancer. The lysosomal membrane proteins LAMP-1-3 and Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): I.R.D. Johnson, E.J. Parkinson-Lawrence CD markers CD164, CD1, CD47, and CD75 are often Analysis and interpretation of data (e.g., statistical analysis, biostatistics, compu- evident in primary and metastatic cancer biopsies (51), but tational analysis): I.R.D. Johnson, E.J. Parkinson-Lawrence, T. Shandala, L.M. Butler, D.A. Brooks their consistency and predictive capacity for disease progres- Writing, review, and/or revision of the manuscript: I.R.D. Johnson, E.J. Parkinson- sion is limited. We observed increased amounts of Appl1 Lawrence, L.M. Butler, D.A. Brooks protein in malignant tissue from biopsies of patients with Administrative, technical, or material support (i.e., reporting or organizing data, fi constructing databases): E.J. Parkinson-Lawrence, D.A. Brooks prostate cancer, con rming the increased gene and protein Study supervision: E.J. Parkinson-Lawrence, D.A. Brooks expression of Appl1 in prostate cancer cell lines. Appl1 appeared more concentrated in the basement membranes Acknowledgments in nonmalignant tissue, whereas in the malignant tissue, The authors thank Dr. Shalini Jindal and Ms. Marie Pickering (Dame Roma there was no basement membrane staining, indicating diag- Mitchell Cancer Research Laboratories, University of Adelaide, South Australia) for expert assistance with the immunohistochemistry and pathology of human prostate nostic/prognostic potential for this biomarker. Further tissue samples. immunohistochemical and patient tissue analysis of Appl1 and other endosomal proteins is required to establish the Grant Support validity and predictive value of these proteins as prognostic This project was funded by a University of South Australia Presidents Scholarship biomarkers in prostate cancer. and a University of South Australia Postgraduate Award, together with additional In summary, we have demonstrated increased expression support from University of South Australia Research SA Seeding Funds. of early endosome markers and altered localization of endo- The costs of publication of this article were defrayed in part by the payment of page some and lysosome compartments in prostate cancer cells, charges. This article must therefore be hereby marked advertisement in accordance with which was associated with altered endocytosis and recycling 18 U.S.C. Section 1734 solely to indicate this fact. of the transferrin receptor and aberrant Akt signaling. The Received February 10, 2014; revised July 9, 2014; accepted July 10, 2014; alterations to the endocytic machinery that we have observed published OnlineFirst July 30, 2014.

References 1. Siegel R, Naishadham D, Jemal A. Cancer statistics, 2013. CA Cancer 5. Hurley JH, Odorizzi G. Get on the exosome bus with ALIX. Trends Cell J Clin 2013;63:11–30. Biol 2012;14:654–5. 2. Schroder FH, Hugosson J, Roobol MJ, Tammela TL, Ciatto S, Nelen V, 6. Hu CT, Wu JR, Wu WS. The role of endosomal signaling triggered by et al. Screening and prostate-cancer mortality in a randomized Euro- metastatic growth factors in tumor progression. Cell Signal 2013;25: pean study. N Engl J Med 2009;360:1320–8. 1539–45. 3. Moyer VA. Screening for prostate cancer: U.S. preventive services 7. Settembre C, Fraldi A, Medina DL, Ballabio A. Signals from the task force recommendation statement. Ann Intern Med 2012;157: lysosome: a control centre for cellular clearance and energy metab- 120–34. olism. Nat Rev Mol Cell Biol 2013;14:283–96. 4. Parachoniak CA, Park M. Dynamics of receptor trafﬁcking in tumor- 8. Boucrot E, Kirchhausen T. Endosomal recycling controls plasma mem- igenicity. Trends Cell Biol 2012;22:231–40. brane area during mitosis. Proc Natl Acad Sci U S A 2007;104:7939–44.

www.aacrjournals.org Mol Cancer Res; 12(12) December 2014 1861

Johnson et al.

9. Palfy M, Remenyi A, Korcsmaros T. Endosomal crosstalk: meeting 32. Steffan JJ, Cardelli JA. Thiazolidinediones induce Rab7–RILP–MAPK– points for signaling pathways. Trends Cell Biol 2012;22:447–56. dependent juxtanuclear lysosome aggregation and reduce tumor cell 10. Glunde K, Guggino SE, Solaiyappan M, Pathak AP, Ichikawa Y, invasion. Traffic 2010;11:274–86. Bhujwalla ZM. Extracellular acidification alters lysosomal trafficking 33. Roshy S, Sloane BF, Moin K. Pericellular cathepsin B and malignant in human breast cancer cells. Neoplasia 2003;5:533–45. progression. Cancer Metastasis Rev 2003;22:271–86. 11. Stow JL, Murray RZ. Intracellular trafficking and secretion of inflam- 34. Authier F, Kouach M, Briand G. Endosomal proteolysis of insulin-like matory cytokines. Cytokine Growth Factor Rev 2013;24:227–39. growth factor-I at its C-terminal D-domain by cathepsin B. FEBS Lett 12. Henneberry MO, Engel G, Grayhack JT. Acid phosphatase. Urol Clin 2005;579:4309–16. North Am 1979;6:629–41. 35. Zaidi N, Maurer A, Nieke S, Kalbacher H. Cathepsin D: a cellular 13. Quintero IB, Araujo CL, Pulkka AE, Wirkkala RS, Herrala AM, Eskelinen roadmap. Biochem Biophys Res Commun 2008;376:5–9. EL, et al. Prostatic acid phosphatase is not a prostate specifictarget. 36. Deacon SW, Nascimento A, Serpinskaya AS, Gelfand VI. Regulation of Cancer Res 2007;67:6549–54. bidirectional melanosome transport by organelle bound MAP kinase. 14. Johnson IR, Parkinson-Lawrence EJ, Butler LM, Brooks DA. Prostate Curr Biol 2005;15:459–63. cell lines as models for biomarker discovery: Performance of current 37. Pasini FS, Maistro S, Snitcovsky I, Barbeta LP, Rotea Mangone FR, markers and the search for new biomarkers. Prostate 2014;74:547–60. Lehn CN, et al. Four-gene expression model predictive of lymph node 15. Camacho L, Meca-Cortes O, Abad JL, Garcia S, Rubio N, Diaz A, et al. metastases in oral squamous cell carcinoma. Acta Oncol 2012;51: Acid ceramidase as a therapeutic target in metastatic prostate cancer. 77–85. J Lipid Res 2013;54:1207–20. 38. Steffan JJ, Dykes SS, Coleman DT, Adams LK, Rogers D, Carroll JL, 16. Kuronita T, Eskelinen EL, Fujita H, Saftig P, Himeno M, Tanaka Y. A role et al. Supporting a role for the GTPase Rab7 in prostate cancer for the lysosomal membrane protein LGP85 in the biogenesis and progression. PLoS ONE 2014;9:e87882. maintenance of endosomal and lysosomal morphology. J Cell Sci 39. Keer HN, Kozlowski JM, Tsai YC, Lee C, McEwan RN, Grayhack JT. 2002;115:4117–31. Elevated transferrin receptor content in human prostate cancer cell 17. Huotari J, Helenius A. Endosome maturation. EMBO J 2011;30: lines assessed in vitro and in vivo. J Urol 1990;143:381–5. 3481–500. 40. O'Donnell KA, Yu D, Zeller KI, Kim JW, Racke F, Thomas-Tikhonenko 18. Zerial M, McBride H. Rab proteins as membrane organizers. Nat Rev A, et al. Activation of transferrin receptor 1 by c-Myc enhances cellular Mol Cell Biol 2001;2:107–17. proliferation and tumorigenesis. Mol Cell Biol 2006;26:2373–86. 19. Jordens I, Marsman M, Kuijl C, Neefjes J. Rab proteins, connecting 41. Edinger AL, Thompson CB. Akt maintains cell size and survival by transport and vesicle fusion. Traffic 2005;6:1070–7. increasing mTOR-dependent nutrient uptake. Mol Biol Cell 2002; 20. Capes-Davis A, Theodosopoulos G, Atkin I, Drexler HG, Kohara A, 13:2276–88. MacLeod RA, et al. Check your cultures! A list of cross-contaminated 42. Puri C, Chibalina MV, Arden SD, Kruppa AJ, Kendrick-Jones J, Buss F. or misidentified cell lines. Int J Cancer 2010;127:1–8. Overexpression of myosin VI in prostate cancer cells enhances PSA 21. Sardiello M, Palmieri M, di Ronza A, Medina DL, Valenza M, Gennarino and VEGF secretion, but has no effect on endocytosis. Oncogene VA, et al. A gene network regulating lysosomal biogenesis and func- 2010;29:188–200. tion. Science 2009;325:473–7. 43. Fili N, Calleja V, Woscholski R, Parker PJ, Larijani B. Compartmental 22. Taylor BS, Schultz N, Hieronymus H, Gopalan A, Xiao Y, Carver BS, signal modulation: endosomal phosphatidylinositol 3-phosphate con- et al. Integrative genomic profiling of human prostate cancer. Cancer trols endosome morphology and selective cargo sorting. Proc Natl Cell 2010;18:11–22. Acad Sci U S A 2006;103:15473–8. 23. Shukla S, Maclennan GT, Hartman DJ, Fu P, Resnick MI, Gupta S. 44. Lee JR, Hahn HS, Kim YH, Nguyen HH, Yang JM, Kang JS, et al. Activation of PI3K-Akt signaling pathway promotes prostate cancer Adaptor protein containing PH domain, PTB domain and leucine zipper cell invasion. Int J Cancer 2007;121:1424–32. (APPL1) regulates the protein level of EGFR by modulating its traffick- 24. Parkin DM, Bray F, Ferlay J, Pisani P. Global cancer statistics, 2002. CA ing. Biochem Biophys Res Commun 2011;415:206–11. Cancer J Clin 2005;55:74–108. 45. Wang C, Xin X, Xiang R, Ramos FJ, Liu M, Lee HJ, et al. Yin-Yang 25. Australian Institute of Health and Welfare (AIHW). Cancer in Australia regulation of adiponectin signaling by APPL isoforms in muscle cells. 2010: an overview. Cancer series no. 60. Cat. no. CAN 56. Canberra: J Biol Chem 2009;284:31608–15. AIHW; 2010 Jan 1. 46. Yang L, Lin HK, Altuwaijri S, Xie S, Wang L, Chang C. APPL suppresses 26. Roobol MJ, Haese A, Bjartell A. Tumour markers in prostate cancer III: androgen receptor transactivation via potentiating Akt activity. J Biol biomarkers in urine. Acta Oncol 2011;50(Suppl 1):85–9. Chem 2003;278:16820–7. 27. Ploussard G, de laTaille A. Urine biomarkers in prostate cancer. Nat 47. Broussard JA, Lin WH, Majumdar D, Anderson B, Eason B, Brown CM, Rev Urol 2010;7:101–9. et al. The endosomal adaptor protein APPL1 impairs the turnover of 28. Eberlin LS, Dill AL, Costa AB, Ifa DR, Cheng L, Masterson T, et al. leading edge adhesions to regulate cell migration. Mol Biol Cell Cholesterol sulfate imaging in human prostate cancer tissue by 2012;23:1486–99. desorption electrospray ionization mass spectrometry. Anal Chem 48. Chotard L, Mishra AK, Sylvain MA, Tuck S, Lambright DG, Rocheleau 2010;82:3430–4. CE. TBC-2 regulates RAB-5/RAB-7–mediated endosomal trafficking 29. Yao S, Ireland SJ, Bee A, Beesley C, Forootan SS, Dodson A, et al. in Caenorhabditis elegans. Mol Biol Cell 2010;21:2285–96. Splice variant PRKC-zeta(-PrC) is a novel biomarker of human prostate 49. Peralta ER, Martin BC, Edinger AL. Differential effects of TBC1D15 cancer. Br J Cancer 2012;107:388–99. and mammalian Vps39 on Rab7 activation state, lysosomal mor- 30. Sloane BF, Moin K, Sameni M, Tait LR, Rozhin J, Ziegler G. Membrane phology, and growth factor dependence. J Biol Chem 2010;285: association of cathepsin B can be induced by transfection of human 16814–21. breast epithelial cells with c-Ha-ras oncogene. J Cell Sci 1994;107: 50. Subramani D, Alahari SK. Integrin-mediated function of Rab GTPases 373–84. in cancer progression. Mol Cancer 2010;9:312. 31. Steffan JJ, Snider JL, Skalli O, Welbourne T, Cardelli JA. Naþ/Hþ 51. Liu AY, Roudier MP, True LD. Heterogeneity in primary and metastatic Exchangers and RhoA regulate acidic extracellular pH-induced lyso- prostate cancer as defined by cell surface CD profile. Am J Pathol some trafficking in prostate cancer cells. Traffic 2009;10:737–53. 2004;165:1543–56.

1862 Mol Cancer Res; 12(12) December 2014 Molecular Cancer Research

Altered Endosome Biogenesis in Prostate Cancer Has Biomarker Potential

Ian R.D. Johnson, Emma J. Parkinson-Lawrence, Tetyana Shandala, et al.

Mol Cancer Res 2014;12:1851-1862. Published OnlineFirst July 30, 2014.

Updated version Access the most recent version of this article at: doi:10.1158/1541-7786.MCR-14-0074

Supplementary Access the most recent supplemental material at: Material http://mcr.aacrjournals.org/content/suppl/2014/07/31/1541-7786.MCR-14-0074.DC1

Cited articles This article cites 50 articles, 15 of which you can access for free at: http://mcr.aacrjournals.org/content/12/12/1851.full#ref-list-1

Citing articles This article has been cited by 2 HighWire-hosted articles. Access the articles at: http://mcr.aacrjournals.org/content/12/12/1851.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at Subscriptions [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://mcr.aacrjournals.org/content/12/12/1851. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.