USOO9228204B2
(12) United States Patent (10) Patent No.: US 9.228,204 B2 Pulst et al. (45) Date of Patent: Jan. 5, 2016
(54) CONSTRUCTS FOR MAKING INDUCED 2010, O184051 A1 7/2010 Hochedlinger et al. PLURPOTENT STEM CELLS 2010/0279.404 A1 11/2010 Yamanaka et al. 2010.0311171 A1 12/2010 Nakanishi et al. (71) Applicant: University of Utah Research Foundation, Salt Lake City, UT (US) FOREIGN PATENT DOCUMENTS EP 2263705 12/2010 (72) Inventors: Stefan M. Pulst, Salt Lake City, UT KR 2009 OO83761 8, 2009 (US); Sharan Paul, Salt Lake City, UT WO WO 2008,151058 12/2008 (US); Warunee Dansithong, Salt Lake WO WO 2009/007852 1, 2009 City, UT (US) WO WO 2009/092042 T 2009 WO WO 2009,093O22 T 2009 WO WO 2009/096614 8, 2009 (73) Assignee: University of Utah Research WO WO 2009/131262 10/2009 Foundation, Salt Lake City, UT (US) WO WO 2009,133971 11, 2009 WO WO 2009,140655 11, 2009 (*) Notice: Subject to any disclaimer, the term of this WO WO 2009, 149233 12/2009 patent is extended or adjusted under 35 WO WO 2009,152485 12/2009 U.S.C. 154(b) by 0 days. WO WO 2010/017562 2, 2010 WO WO 2010/O19569 2, 2010 WO WO 2010/028O19 3, 2010 (21) Appl. No.: 13/975,004 WO WO 2010/036923 4/2010 (22) Filed: Aug. 23, 2013 OTHER PUBLICATIONS (65) Prior Publication Data Takahashi (Cell, 2006, vol. 126:663-676).* US 2014/O 170752 A1 Jun. 19, 2014 Yu (Science, 2007, vol. 318, p. 1917-1920).* Nakagawa (Nat Biotechnol, Jan. 2008, vol. 26: 101-106; published Related U.S. Application Data online Nov. 11, 2007).* Okita (Science, Nov. 7, 2008, vol. 322, p. 949-953).* (63) Continuation-in-part of application No. 13/960,305, Feng (Cell StemCell, Apr. 3, 2009, vol. 4, p. 301-312).* filed on Aug. 6, 2013, now abandoned, which is a Shao (Expert Opin. Biol. Ther. Feb. 2010, vol. 10, No. 1, p. 231 continuation of application No. PCT/US2012/025117, 242).* filed on Feb. 14, 2012. Aoi (Science, Aug. 1, 2008, vol. 321, No. 5889, p. 699-702, available (60) Provisional application No. 61/442,695, filed on Feb. online Feb. 14, 2008).* 14, 2011. Aasen (Nature Biotech., Nov. 2008, vol. 26, No. 11, p. 1276-1284).* Sugii (PNAS, Feb. 23, 2010, vol. 107, No. 8, p. 3558-3563).* (51) Int. C. Stadtfeld (Cell StemCell, Mar. 6, 2008, vol. 2, p. 230-240; published CI2N IS/00 (2006.01) online Feb. 14, 2008).* CI2N 15/86 (2006.01) Carey (PNAS, 2009, vol. 106, p. 157-162).* CI2N 5/074 (2010.01) Carey (Nature Methods, Jan. 2010, vol. 7, No. 1, p. 46-59).* (52) U.S. C. Sommer (Stem Cells, 2009, 27, 543-549).* CPC ...... CI2N 15/86 (2013.01); C12N5/0696 Kaji (Nature, Apr. 9, 2009, vol. 458, p. 771-776).* (2013.01); C12N 2501/602 (2013.01); C12N Gonzalez (PNAS, Jun. 2, 2009, vol. 106, No. 22, p. 8918-8922).* 2501/603 (2013.01); C12N 2501/604 (2013.01); CI2N 2501/606 (2013.01); C12N 2510/00 Paul, Annals of Neurol., 2012, vol. 72, Suppl. 16, pp. S103).* (2013.01); C12N 27.10/10343 (2013.01) Toes (PNAS, Dec. 1997, vol. 94, p. 14660-14665).* (58) Field of Classification Search (Continued) USPC ...... 435/320.1 See application file for complete search history. Primary Examiner — Michael Wilson (56) References Cited (74) Attorney, Agent, or Firm — Thorpe North & Western U.S. PATENT DOCUMENTS LLP
2009/0047263 A1 2/2009 Yamanaka et al. 2009,019 1159 A1 7/2009 Sakurada et al. (57) ABSTRACT 2009,019 1171 A1 T/2009 Ma 2009/0227032 A1 9/2009 Yamanaka et al. Systems, constructs, and methods for reprogramming cells 2009, O246875 A1 10/2009 Yamanaka et al. 2009,0299763 A1 12/2009 Sakurada are provided. In one aspect, for example, a transformation 20090304646 A1 12/2009 Sakurada et al. construct for generating iPS cells can include an expression 2010.0003757 A1 1/2010 Macket al. vector having a plurality of reprogramming factors, each 2010.0062534 A1 3/2010 Hochedlinger et al. reprogramming factor being under control of a separate pro 2010.0075421 A1 3/2010 Yamanaka et al. 2010/0105100 A1 4/2010 Sakurada et al. moter. 2010, 0120069 A1 5/2010 Sakurada et al. 2010, O150889 A1 6, 2010 Townes et al. 2010.0167291 A1 7/2010 Rosenberg et al. 12 Claims, 15 Drawing Sheets US 9.228,204 B2 Page 2
(56) References Cited Montserrat, et al.; "Generation of Pig iPS Cells: A Model for Cell Therapy; Journal of Cardiovascular Translational Research, 2011; OTHER PUBLICATIONS vol. 4, No. 2, Nov. 19, 2010; pp. 121-130. Okita, et al., “Induced pluripotent stem cells: opportunities and chal Carey, et al., “Reprogramming of murine and human somatic cells lenges”; Phil. Trans. R. Soc. B 2011, 366, pp. 2198-2207. Pourfathollah, et al.; “Generation of Induced Pluripotent Stem (IPS) using a single polycistronic vector'; vol. 106, No. 1; Dec. 24, 2008; Cells with Adenovectors Carrying embryonically Expressed Human pp. 157-162. Genes'; vol. 1, No. Supp. 2, Nov. 19, 2011; 2 pages. Gonzalez, et al., “Generation of mouse-induced pluripotent stem Shao, et al.; "Gene-delivery systems for IPS cell generation'; Feb. 1. cells by transient expression of a single noviral polycistronic vector': 2010; pp. 1-19; PubMed Central (PMC) Author Manuscript Expert vol. 106; No. 22: pp. 8918-8922. Opin. Biol. Ther. Lai, et al., “Advancements in reprogramming strategies for the gen Stadtfeld, et al.: “Induced Pluripotent StemCells Generated Without eration of induced pluripotent stem cells'; Journal of Assisted Repro viral Integration'. Science, American Association for the Advance duction and Genetics, Publishers-Plenum Publishers; vol. 28; No. 4, ment of Science, Washington, DC; vol. 322, No. 5903, Nov. 7, 2008. Mar. 9, 2011. Zhou, et al.; "Adenoviral Gene Delivery Can Reprogram Human Liu, et al.: “Induced Pluripotent Stem (iPS) Cell Research Over Fibroblasts to Induced Pluripotent StemCells'; vol. 27, No. 11, Nov. view”; Cell Transplantation; vol. 20, No. 1; pp. 15-19, 2011. 1, 2009: pp. 2667-2674. Lowry, et al.; "The many ways to make an iPS cell'; vol. 26, No. 11, Nov. 1, 2008, Nature Biotechnology. * cited by examiner U.S. Patent Jan. 5, 2016 Sheet 1 of 15 US 9.228,204 B2
psokciv-Adshuttle vector
xxi-xxy- exix. : ionoiogo as Recottiratio if yies in Bacteria & s 8.33 t :
g:8:Kxxx xxxasy - w8xxx - 08 Wirts Proction
G. U.S. Patent Jan. 5, 2016 Sheet 2 of 15 US 9.228,204 B2
pSOKc citasy- wector
FG. A
s: øbin?spw-woyosd| s:
Actin
Y Acti:
G. 2B U.S. Patent Jan. 5, 2016 Sheet 3 of 15 US 9.228,204 B2
SXC iAxi-Soix
FG, 3A
inefite of experinetta design
Ray RS fircasts sittire Day & Acieao viruses pay 3 Change media every day through ay pays 4-7 k Stem cesis tike E. Ad-sok ... colonies appeared
G. 38 U.S. Patent Jan. 5, 2016 Sheet 4 of 15 US 9.228,204 B2
FG. 4A
iPS lies N Na Y O O O
C e e e e
TER
GDF3
GAPDH
FG. 43 U.S. Patent Jan. 5, 2016 Sheet 5 Of 15 US 9.228,204 B2
ice for assfortation
Rece
As Actin and Associsk SOX oct34 and Act
CYCar Actin
Raf Acis c:R
Wester to F.G. 5C
G 53 U.S. Patent Jan. 5, 2016 Sheet 6 of 15 US 9.228,204 B2
PSCs
kx :. A.
is 8 x: --a Reprogramming efficiency SP 1.2 CH re
HY s 0.8 .5 GAPDH pa2.5X10 - 3& sSg S Actinr i o.2o r& as SS HY As-St. A-ScNK F.G. 6A FG. 88
s Articies s Asixties
G. A
G. 78 U.S. Patent Jan. 5, 2016 Sheet 7 Of 15 US 9.228,204 B2
ES celi-marker genes E : Sao Ad-GFP 3. 8 Ai-Sychik 20 it to a Ais f F.G. 8A
sw ES ceil-marker genes 8 8A-GP S 6 8 Ai-S 4 s 2 s s ( OCT3f4 E. : : F.G. 8C ES ceii-starker geries 48 8sic 8:ASC: S. $ 2.3 s 30 : a lack. a. 33. A 3 G. 8)
ES ceivikarker gets 8:8 ce:ii-retarker gettes &As &ases 3. 3.
8883 S$383 8. k FG 8E G. 8 U.S. Patent Jan. 5, 2016 Sheet 8 of 15 US 9.228,204 B2
Ai assay isis- A.S. s i-Sick
:38; 8
3xy:
: 3 U.S. Patent Jan. 5, 2016 Sheet 9 Of 15 US 9.228,204 B2
is s
f
s
R-R
d fittikkes Asixties
iS s
8Ances ER GABRB3 Notal.
Rec F.G. O. U.S. Patent Jan. 5, 2016 Sheet 10 of 15 US 9.228,204 B2
iss;
8 Y
3.
As
d sixties
Rick G. U.S. Patent Jan. 5, 2016 Sheet 11 of 15 US 9.228,204 B2
F.G. 12 U.S. Patent Jan. 5, 2016 Sheet 12 of 15 US 9.228,204 B2
FG, 3
Erassistics
&s &.8 &.88 & 888& 8888 888
x8 8x: 8:3 8xxx Eise xftraxxistics start: 8:
F.G. 14 U.S. Patent Jan. 5, 2016 Sheet 13 of 15 US 9.228,204 B2
Ac-GFP {x-xxxx
es e m m ha sa A aw W. a is ...... - s r. * r or r a to r to r to sa en err e in . ce es es e er es ess r a to a w is
SSSSSSSSSS
F.G. 58 U.S. Patent Jan. 5, 2016 Sheet 14 of 15 US 9.228,204 B2
{{xx.
:::::::::::: Enhancer: S3-8s tata box: st-set x: : : :::::::::::::
s s
G. 7 U.S. Patent Jan. 5, 2016 Sheet 15 Of 15 US 9.228,204 B2
Akicksw-888-citx${}
first::$8 if experitxeita tixsig: 38y : : 388 888 &8888
G. 8A-C
pAd-GFP-KcMOS
K: KF4, c8: c-MYC, O: OC314 and S F.G. 19 US 9.228,204 B2 1. 2 CONSTRUCTS FOR MAKING INDUCED aspect, the expression vector can have a sequence that is at PLURPOTENT STEM CELLS least 80% homologous to SEQID 72. In yet another aspect, the expression vector has a sequence that is at least 95% PRIORITY DATA homologous to SEQID 72. In a further aspect, the expression vector has the sequence of SEQID 72. This application is a continuation-in-part of U.S. patent Various promoters and/or sets of promoters are contem application Ser. No. 13/960,305, filed on Aug. 6, 2013, which plated, and any appropriate promoter is considered to be is a continuation of Patent Cooperation Treaty Patent Appli within the present scope. In one aspect, for example, at least cation Serial No. PCT/US2012/0251 17, filed on Feb. 14, one of the reprogramming factors is under the control of a 2012, which claims the benefit of U.S. Provisional Patent 10 CMV promoter. In another aspect, the CMV promoter is a Application Ser. No. 61/442,695, filed on Feb. 14, 2011, all of weak CMV promoter. Furthermore, in various aspects the which are incorporated herein by reference. expression vector can further include a reporter sequence under control of a separate promoter. GOVERNMENT INTEREST The present disclosure additionally provides methods of 15 generating iPS cells. In one aspect Such a method can include This invention was made with government Support under separately cloning a plurality of reprogramming factors grant numbers R01 NS033123 and NS073009 awarded by including OCT3/4, SOX2, and at least one member selected National Institutes of Health. The government has certain from the group consisting of KLF4, c-Myc, NANOG, or rights in this invention. LIN28 into separate vectors, where each reprogramming fac tor is controlled by a separate promoter. The method can BACKGROUND further include consecutively cloning each of the reprogram ming factors including each promoter into a single shuttle Current protocols for the generation of induced pluripotent vector, linearizing the shuttle vector and recombining in bac stem (iPS) cells from somatic cells are slow (e.g. 30-45 days) terial cells to create an expression vector, infecting transform and are inefficient (<0.1% of cells are reprogrammed). Addi 25 able cells with the expression vector, and growing the trans tionally, the generation of iPS cells from somatic cells formable cells for a period of time to generate iPS cells. In one achieved by simultaneous viral transduction of defined repro specific aspect, the reprogramming factors can be cloned into gramming transcription factors using Lenti- or Retro- or separate vectors using bluntend ligation. In some aspects, the Adeno-viruses requires multiple viral vectors for gene deliv present method can further include generating the iPS cells in ery. Lenti- or Retro-viruses can also result in insertional 30 the absence of feeder cells, in the absence of a matrigel mutagenesis and can present significant barriers to research, matrix, or in the absence offeeder cells and a matrigel matrix. clinical, and therapeutic application of iPS cells. A single Furthermore, in one aspect an iPS cell is provided that is gene delivery system does not ensure the infectivity and co generated according to the methods and techniques of the expression of all genes in one cell which is critical for repro present disclosure. In another aspect, a Subsequent generation gramming. Despite the progress in embryonic stem (ES) cells 35 cell ultimately obtained from the iPS cell according to the research in recent years, feeder cells such as inactivated present disclosure is provided. In yet another aspect, the mouse embryonic fibroblasts (iMEF) are still required to differentiated cell derived from the iPS cell according to the generate iPS cells from human or mouse fibroblasts. Feeder present disclosure is provided. Non-limiting examples of cells provide the essential Support and nutrients to allow Such differentiated cell types can include endoderm, ecto ES/iPS cells to grow, attach, and proliferate. The risk of 40 derm, mesoderm, or an appropriate combination thereof. In contamination of viruses or other macromolecules from the Some aspects, the differentiated cell can be a neuron. mouse cells limits the use of such iPS cells for therapeutic purposes. BRIEF DESCRIPTION OF THE DRAWINGS
SUMMARY 45 FIG. 1 is a schematic view of a vector System in accordance with one aspect of the present disclosure; The present disclosure provides systems, constructs, and FIG. 2A is a schematic view of a vector system in accor methods for reprogramming cells. In one aspect, for example, dance with another aspect of the present disclosure; a transformation construct for generating iPS cells can FIG. 2B shows data demonstrating protein expression of include an expression vector having a plurality of reprogram 50 multiple reprogramming factors in accordance with another ming factors, where each reprogramming factor is under con aspect of the present disclosure; trol of a separate promoter. In one aspect, the expression FIG. 3A is a schematic view of an adenoviral construct in vector can be selected from plasmids, viruses, and combina accordance with yet another aspect of the present disclosure; tions thereof. In another aspect, the expression vector can be FIG. 3B shows iPS cells generated with adenoviral con selected from adenoviral vectors, episomal vectors, retroviral 55 structs without feeder cells, IMR90 cells transduced with vectors, and lentiviral vectors. In one specific aspect the Ad-GFP, and iPS cell colonies in IMR90 cells transduced expression vector can be an episomal vector. with Ad-SOK in accordance with another aspect of the Various reprogramming factors are contemplated for use in present disclosure; aspects of the present invention. In one aspect, for example, FIG. 4A shows IMR90 cells transduced with adenoviruses, the plurality of reprogramming factors can include OCT3/4, 60 either Ad-GFP (a) or Ad-SOK (b) in accordance with a further SOX2, and at least one member selected from KLF4, c-Myc, aspect of the present disclosure; and NANOG, or LIN28. In another aspect, the plurality of repro FIG. 4B shows RT-PCR data of EX cell marker genesin gramming factors can include OCT3/4, SOX2, KLF4, and accordance with yet a further aspect of the present disclosure; c-Myc. In yet another aspect, the plurality of reprogramming FIG.5A shows a timeline for transformation inaccordance factors can consist of OCT3/4, SOX2, and KLF4. In a further 65 with another aspect of the present disclosure; aspect, the plurality of reprogramming factors includes FIG. 5B shows cells tested for ALP staining in accordance OCT3/4, SOX2, NANOG, and LIN28. Furthermore, in one with another aspect of the present disclosure; US 9.228,204 B2 3 4 FIG.5C shows a Western blot analyses in accordance with FIG. 13 shows histological data revealing development of another aspect of the present disclosure; muscle and adipose tissues in accordance with another aspect FIG. 6A shows real-time PCR and Western blot data in of the present disclosure; accordance with another aspect of the present disclosure; FIG. 14 shows an illustration of an experimental time line FIG. 6B shows real-time PCR and Western blot data in 5 in accordance with another aspect of the present disclosure; accordance with another aspect of the present disclosure; FIG. 15A shows a heat-map of a gene expression profile in FIG. 7A shows data demonstrating expression of markers accordance with another aspect of the present disclosure; in iPS cells in accordance with another aspect of the present FIG. 15B shows a heat-map of a gene expression profile in disclosure; accordance with another aspect of the present disclosure; FIG. 7B shows data demonstrating expression of markers 10 in iPS cells in accordance with another aspect of the present FIG. 16 shows the construction of a CMV weak promoter disclosure; in accordance with another aspect of the present disclosure; FIG. 8A shows data representing isolated RNA from iPS FIG.17 shows the validation of the CMV weak promoter in cells that demonstrate high expression ofundifferentiated ES accordance with another aspect of the present disclosure; cell-marker genes in accordance with another aspect of the 15 FIG. 18A shows the generation of iPS cells using the CMV present disclosure; weak promoter in accordance with another aspect of the FIG. 8B shows data representing isolated RNA from iPS present disclosure; cells that demonstrate high expression ofundifferentiated ES FIG. 18B shows the generation of iPS cells using the CMV cell-marker genes in accordance with another aspect of the weak promoter in accordance with another aspect of the present disclosure; present disclosure; FIG. 8C shows data representing isolated RNA from iPS FIG. 18C shows the generation of iPS cells using the CMV cells that demonstrate high expression ofundifferentiated ES weak promoter in accordance with another aspect of the cell-marker genes in accordance with another aspect of the present disclosure; and present disclosure; FIG. 19 shows a schematic view of an exemplary expres FIG. 8D shows data representing isolated RNA from iPS 25 sion construct in accordance with another aspect of the cells that demonstrate high expression ofundifferentiated ES present disclosure. cell-marker genes in accordance with another aspect of the present disclosure; DETAILED DESCRIPTION FIG. 8E shows data representing isolated RNA from iPS cells that demonstrate high expression ofundifferentiated ES 30 Before the present disclosure is described herein, it is to be cell-marker genes in accordance with another aspect of the understood that this disclosure is not limited to the particular present disclosure; structures, process steps, or materials disclosed herein, but is FIG. 8F shows data representing isolated RNA from iPS extended to equivalents thereof as would be recognized by cells that demonstrate high expression ofundifferentiated ES those ordinarily skilled in the relevant arts. It should also be cell-marker genes in accordance with another aspect of the 35 present disclosure; understood that terminology employed herein is used for the FIG. 9 shows images of cells undergoing morphological purpose of describing particular embodiments only and is not changes in accordance with another aspect of the present intended to be limiting. disclosure; Definitions FIG. 10A shows data from SkMC-derived iPS cells in 40 The following terminology will be used in accordance with accordance with another aspect of the present disclosure; the definitions set forth below. FIG. 10B shows data from SkMC-derived iPS cells in It should be noted that, as used in this specification and the accordance with another aspect of the present disclosure; appended claims, the singular forms “a” and, “the include FIG. 10C Shows data from SkMC-derived iPS cells in plural referents unless the context clearly dictates otherwise. accordance with another aspect of the present disclosure; 45 Thus, for example, reference to “a cell' includes one or more FIG. 10D shows data from SkMC-derived iPS cells in of such cells and reference to “the flask” includes reference to accordance with another aspect of the present disclosure; one or more of Such flasks. FIG. 10E shows data from SkMC-derived iPS cells in As used herein, the term “substantially” refers to the com accordance with another aspect of the present disclosure; plete or nearly complete extent or degree of an action, char FIG. 11A shows data from SCA2 skin fibroblast-derived 50 acteristic, property, state, structure, item, or result. For iPS cells in accordance with another aspect of the present example, an object that is “substantially enclosed would disclosure; mean that the object is either completely enclosed or nearly FIG. 11B shows data from SCA2 skin fibroblast-derived completely enclosed. The exact allowable degree of deviation iPS cells in accordance with another aspect of the present from absolute completeness may in Some cases depend on the disclosure; 55 specific context. However, generally speaking the nearness of FIG. 11C shows data from SCA2 skin fibroblast-derived completion will be so as to have the same overall result as if iPS cells in accordance with another aspect of the present absolute and total completion were obtained. The use of “sub disclosure; stantially' is equally applicable when used in a negative con FIG. 11D shows data from SCA2 skin fibroblast-derived notation to refer to the complete or near complete lack of an iPS cells in accordance with another aspect of the present 60 action, characteristic, property, State, structure, item, or disclosure; result. For example, a composition that is “substantially free FIG. 11E shows data from SCA2 skin fibroblast-derived of particles would either completely lack particles, or so iPS cells in accordance with another aspect of the present nearly completely lack particles that the effect would be the disclosure; same as if it completely lacked particles. In other words, a FIG. 12 shows immunohistochemistry data from differen 65 composition that is “substantially free of an ingredient or tiated iPS cells in accordance with another aspect of the element may still actually contain Such item as long as there present disclosure; is no measurable effect thereof. US 9.228,204 B2 5 6 As used herein, the term “about is used to provide flex ticularly true for those proteins and linckNAs that show over ibility to a numerical range endpoint by providing that a given all little expression changes between the initial and final time value may be “a little above' or “a little below the endpoint. points, but actually experience a change in betweenthese time As used herein, a plurality of items, structural elements, points. Initial pathway analysis highlights the importance of compositional elements, and/or materials may be presented 5 genes involved in cytokine-receptor pathways, with later in a common list for convenience. However, these lists should upregulation of genes involved in hedgehog signaling, be construed as though each member of the list is individually whereas genes involved in cell cycle and DNA replication are identified as a separate and unique member. Thus, no indi down-regulated at intermediate and late stages, as is vidual member of such list should be construed as a de facto described more fully herein. The more complete and coordi equivalent of any other member of the same list solely based 10 nated activation of reprogramming pathways as a result of on their presentation in a common group without indications balanced expression of reprogramming factors can allow fur to the contrary. ther detailed dissection of these pathways and their timing as Concentrations, amounts, and other numerical data may be well as analysis of the role of linc- and other non-coding expressed or presented herein in a range format. It is to be RNAS in human reprogramming. understood that Such a range format is used merely for con 15 It should also be noted that the methods for vector con venience and brevity and thus should be interpreted flexibly struction, gene expression, generation of iPS cells, cell lines to include not only the numerical values explicitly recited as utilized, and other specific protocol details are shown as non the limits of the range, but also to include all the individual limiting examples in the following discussion. Furthermore, numerical values or Sub-ranges encompassed within that the techniques described herein can be utilized in a variety of range as if each numerical value and Sub-range is explicitly contemplated transformation systems, and should not be seen recited. As an illustration, a numerical range of “about 1 to as being limited to the iPS transformation system disclosed about 5” should be interpreted to include not only the explic herein. Variation in the number of reprogramming factors itly recited values of about 1 to about 5, but also include included in the cassette and the specific types of reprogram individual values and Sub-ranges within the indicated range. ming factors can vary, both within the iPS system and in other Thus, included in this numerical range are individual values 25 transformation systems. Such as 2, 3, and 4 and Sub-ranges such as from 1-3, from 2-4, A variety of promoters are contemplated, and any promoter and from 3-5, etc., as well as 1, 2, 3, 4, and 5, individually. that can be utilized as described herein is considered to be This same principle applies to ranges reciting only one within the present scope. In some cases the selection of a numerical value as a minimum or a maximum. Furthermore, given promoter or set of promoters can be a design choice that Such an interpretation should apply regardless of the breadth 30 takes into account the particular expression vector utilized, of the range or the characteristics being described. any size requirements or limitations established by the pro The Disclosure moter/vector combination, and the like. In one non-limiting The inventors have developed a non-integrating vector sys aspect, however, the promoter can be a cytomegalovirus tem where multiple reprogramming factors are cloned in a (CMV) promoter, and in some aspects a human CMV pro single cassette in an expression vector. In some aspects, all 35 moter. Additionally, in Some aspects each reprogramming defined reprogramming factors that are Sufficient for the gen factor in the expression vector can have a separate promoter eration of iPS cells are cloned in a single cassette in an of the same promoter type, e.g. each reprogramming factor expression vector. Additionally, each gene corresponding to can have a separate CMV promoter. In other aspects, each each reprogramming factor is expressed under the control of reprogramming factor can have a separate promoter, but all of its own independent promoter that allows the balanced 40 the promoters in the expression vector may not be of the same expression of all genes in one cell. In contrast to single promoter type. Thus, in some cases different promoters can expression of reprogramming factors in individual vectors, be utilized to affect the balance of expression of the repro cells are reprogrammed into iPS cells in about 2-14 days with gramming factors in a cell. In some aspects, each reprogram greater than about 80% efficiency without the need for feeder ming factor may have a different type of promoter. It is also cells. These iPS cells show human ES cell morphology, and 45 noted that a promoter can be modified to increase or decrease express ES cell surface markers and pluripotent cell-specific expression of a reprogramming factor if desired. genes. The iPS cells can also be differentiated into cells of the In some aspects it is contemplated that a promoter-driven three germ layers. Furthermore, iPS cells can be generated reporter can be included in the cassette to, among other from a variety of cells, including, without limitation, human things, track transgene expression. Any reporter that can be skeletal muscle cells and skin fibroblasts. 50 loaded into the cassette with the reprogramming factors is Several different standards to demonstrate pluripotency considered to be within the present scope. In one specific have traditionally been used. Except for the ability to generate example, the reporter can be a promoter driven GFP marker. normal embryos, iPS cells generated by the present invention Thus in Some aspects a reporter can be expressed using a in as little as 2-3 days without feeder cells meet all the dedicated reporter promoter, while in other aspects a reporter reported criteria seen in iPS cells generated by other methods. 55 can be expressed using one or more of the reprogramming Cells reprogrammed using the present techniques display factor promoters. features typical of human ES cells, including the presence of Furthermore, numerous expression vectors are contem an unmethylated NANOG promoter, early initiation of mes plated, and any such vector that is capable of receiving and enchymal to epithelial transition, expression of ES cell expressing multiple reprogramming factors each from dedi marker genes and cell Surface markers, as well as differentia 60 cated promoters is considered to be within the present scope. tion into germ layers in vitro and in Vivo, including neurons. Non-limiting examples can include adenoviral vectors, epi Balanced expression of reprogramming factors under the somal vectors, retroviral vectors, lentiviral vectors, and the control of individual promoters leads to a qualitative change like. in reprogramming and obviates the use of feeder cells. The AS has been described, in one aspect the present disclosure short and reproducible time course of reprogramming can 65 provides a transformation construct for generating iPS cells facilitate the study of these pathways and identify novel pro that can include a vector backbone having a plurality of teins important in the reprogramming process. This is par reprogramming factors, where each reprogramming factor is US 9.228,204 B2 7 8 under control of a separate promoter. The vector backbone examples can include the CAG-promoter, a combination of can be contained in a suitable delivery package such as, for CMV early enhancer elements, chicken beta-actin promoter, example, an adenovirus particle, an episomal expression and the like. Additionally, a mutated promoter, Such as a vehicle, etc. mutated CMV promoter, can be utilized to alter the expres As one specific example, and without using feeder cells sion of the associated reprogramming factor. and/or matrigel systems, the inventors have successfully cre Subsequently, multiple reprogramming factors along with ated human induced pluripotent stem (iPS) cells from human the associated promoters can be consecutively Subcloned into embryonic fibroblast IMR90 cells by producing an adenovi a shuttle vector. One non-limiting example can be using blunt ral vector containing multi-reprogramming factors in a single end ligation. Any number of reprogramming factors can be cassette. It is noted that the use of IMR90 fibroblasts should 10 Subcloned into the shuttle vector. In one aspect, at least two not be seen as limiting, and any cell type capable of repro reprogramming factors can be subcloned therein. In another gramming is considered to be within the present scope. Non aspect, at least three reprogramming factors can be subcloned limiting examples of cells and cell-types can include human therein. In another aspect, at least four reprogramming factors fibroblasts, human fibroblasts from patients with SCA2, skel can be subcloned therein. etal muscle (e.g. SKMC), and the like. Additionally, the 15 A variety of reprogramming factors and reprogramming present scope includes all fibroblast cell lines as well as other factor combinations are contemplated, and any Such factor or cells Such as muscle and blood cells, as well as cell lines factor combination capable of generating iPS cells is consid derived therefrom. ered to be within the present scope. Non-liming examples of This adenoviral construct allows balanced expression of all reprogramming factors include OCT3/4, SOX2, KLF4. reprogramming factors in single cell, and greatly speeds up c-Myc, NANOG, LIN28, and the like, including combina the reprogramming efficiency of cells in a short period of time tions thereof. In one aspect, the reprogramming factors can over conventional iPS cell generation methods. For example, include OCT3/4, SOX2 and at least one factor selected from traditional iPS cell generation methods can take about 30-45 KLF4, c-Myc, NANOG, or LIN28. In another aspect, the days, whereas the present methods can generate iPS cells in reprogramming factors can include OCT3/4, SOX2, and at 10 days or less. In one aspect, iPS cells can be generated in 25 least two factors selected from, KLF4, c-Myc, NANOG, or from about 2 to about 10 days. In another aspect, iPS cells can LIN28. In one specific aspect, the reprogramming factors be generated in from about 2 to about 6 days. In yet another include OCT3/4, SOX2, KLF4, and c-Myc. In one aspect, one aspect, iPS cells can be generated in from about 2 to about 3 example of an OCT3/4, SOX2, KLF4, and c-Myc construct is days. The time period for the generation of iPS cells is mea at least 80% homologous to SEQID 1. In another aspect, the sured from the time of transfection with a viral cassette until 30 construct can be at least 95% homologous, or 100% homolo the observable appearance of stem cell-like colonies. gous to SEQID 1. Furthermore, in one aspect, the expression As has been described, the current methods allow iPS cells vector can have a sequence that is at least 80% homologous to to be generated without the use offeeder cells and/or matrigel SEQID 72. In yet another aspect, the expression vector has a systems. While not intending to be bound to any scientific sequence that is at least 95% homologous to SEQID 72. In a theory, this may be due to a more rapid transformation of the 35 further aspect, the expression vector has the sequence of SEQ cells into iPS cells. Because the multiple reprogramming ID 72. In some aspects, SEQID 72 may be otherwise referred factors are introduced simultaneously into recipient cells to as pAd-GFP-KcMOS. It should be noted that the order of under the control of separate promoters, regardless of the the reprogramming factors as recited herein may not be lim expression vector utilized, this may allow a more rapid trans iting, but can be used in specific order when so specified. For formation into iPS cells that more quickly forms colonies of 40 example, pAd-GFP-KcMOS can be referred to in some cells that have increased surface area compared to, for aspects as pAd-SocMK. As such, the present scope includes example, adhered fibroblasts. Such increased surface area sequences similar to SEQ ID 72 where the reprogramming also results in increased access to nutrients in the culture factors have been inserted in a different order. A schematic medium, thus rendering feeder cells unnecessary. Further representation of an exemplary expression construct pAd more, the simultaneous or near simultaneous transformation 45 GFP-KcMOS is shown in FIG. 19. into iPS cells may promote survival of iPS cells through In another specific aspect, the reprogramming factors secreted factors. Additionally, cells that are just about to include or consist of OCT3/4, SOX2, and KLF4. In one transform into iPS cells, or that have just undergone this aspect, one example of an OCT3/4, SOX2, and KLF4 con transition, begin to migrate towards each other to form colo struct is at least 80% homologous to SEQID 4. In another nies. This also suggests the presence of Secretable factors to 50 aspect, the construct can be at least 95% homologous, or indicate location and initiate locomotion toward iPS cell colo 100% homologous to SEQ ID 4. In yet another specific nies. Various classes of Such secretable factors are contem aspect, the reprogramming factors include or consist of plated, including, without limitation, peptides, proteins, lipo OCT3/4, SOX2, NANOG, and LIN28. In a further specific proteins, glycoproteins, glycolipids, and the like, and may be aspect, the reprogramming factors include OCT3/4, SOX2, co-expressed with receptor molecules at the cell Surface. 55 NANOG, and LIN28. In yet another aspect, other members of Numerous methods and techniques for generating an the OCT, SOC, NANOG, and LIN families can be utilized. expression vector are contemplated, and can vary depending In another aspect, at least one reprogramming factor can be on the vector utilized, the cell system, the preferences of the selected from AIRE, CBFA2T3, CEBPE, CRABP2, EGR4, technician, etc. As such, the following description is not con HIC2, IRX4, IRF7, KCNH2, KLF3, KLF4, KLF9, LIN28B, sidered to be limiting. In one aspect, reprogramming factors 60 LHX6, LHX1, NFATC1, NFATC2, PEG3, POLR3G, PAX8, can be cloned separately into separate vectors, where each RAX2, RUNX3, SFRS17A, SOX8, TAF4B, ZNF57, and the reprogramming factor is under the control of a separate pro like. In yet another aspect, at least one reprogramming factor moter, such as, for example, a cytomegalovirus (CMV) pro can be selected from ETS1, FOXM1, HEY1, HOXA4, moter. One example of such a vector is padTrack-CMV. It is HOXA3, KLF6, KLF2, LZTS1, LBX2, MYBL1, MYBL2, noted that the present scope includes any promoter that is 65 MITF, POGK, RUNX1, SALL2, SOX6, SP140, SMAD6, capable of being separately associated with a set of repro SMAD9, TCF19, TOP2A, VGLL3, ZNF641, ZNF671, gramming factors and loaded into a vector. Non-limiting ZNF70, and the like.
US 9.228,204 B2 11 12 ESRRB, HSF2, HOXC4, PROP1, ZNF33A, ZSCAN2, colonies showing ES cell-like morphology emerged and all SHOX, HOXA3, NR4A3, MESP2, and the like. colonies looked identical. The resultant colonies (iPS cells) Additionally, it should be noted that any one or more of the can be further expanded or Subjected to characterization. above reprogramming factors can be utilized with any other Following generation, iPS cells can be further character reprogramming factor described herein or in any combination 5 ized. The undifferentiated state of human ES cells/iPS cells with any other reprogramming factor described herein. express high levels of membrane alkaline phosphatase (AP), Turning now to FIG. 1, a schematic outline of one non and AP staining can be used to characterize Such stem cells. limiting example of an expression system (e.g. AdEasy-1) is For AP staining, iPS cells are generated from iMR90 cells in provided. Reprogramming factors of interest, Such as, and 24 well plates using the methods as described. At day 7, iPS without limitation, OCT3/4, SOX2, KLF4, and c-Myc, can be 10 cells are fixed with 4% paraformaldehyde for 2 minutes, first cloned separately into a vector under separate promoters followed by 15-minute incubation with staining solution (Al 102 (e.g. p AdTrack-CMV). Then, each reprogramming fac kaline Phosphatase Detection Kit; Millipore). AP staining tor along with the promoter can be consecutively Subcloned data demonstrate the positive staining for iPS cells, as shown into a shuttle vector 104 (e.g. pAdTrack) using a technique in FIG. 4A. In this case, IMR90 cells are transduced with Such as, for example, bluntend ligation. The resultant plasmid 15 adenoviruses, Ad-GFP or Ad-SOK for 7 days. Human iPS can be linearized by digesting with a restriction endonuclease cells generated from Ad-SOK are positive for alkaline phos Such as PmeI, and recombination can be carried out using phatase (AP) staining. FIG. 4B shows RT-PCR analyses ofES high competence bacterial cells, such as E. coli BJ5183 cells, cell marker genes, IMR90 cells are transduced with adenovi by homologous recombination. In some cases, high compe ruses. Ad-GFP or Ad-SOK for 7 days. Total RNA is isolated tence bacterial cells can allow for more efficient recombina from harvested cells and synthesized cDNAs (150 ng) are tion. In cases where an adenoviral vector is to be used, the used for RT-PCR analyses. Human iPS cells express many recombinant adenoviral plasmid 106 (e.g. pSOKcM undifferentiated ES cell marker genes including telomerase AdEasy-1) can then be linearized 108 with an enzyme such as reverse transcriptase (hTERT) and growth and differentiation Pad and transfected into an adenovirus packaging cell line for factor 3 (GDF3). FIG. 4B shows an expression profile by virus production. One non-limiting example of Such a cell 25 RT-PCR analyses, demonstrating that iPS cells derived from line is HEK 293A. The “left arm” and “right arm’ shown in IMR90 cells highly express the hTERT and GDF3 genes. FIG. 1 represent the regions mediating homologous recom In another aspect of the present disclosure, Somatic cell bination between the shuttle vector 104 and the adenoviral reprogramming was tested using the adenovirus containing backbone vector 106. The recombination can be confirmed by OCT3/4, SOX2, KLF4, and c-Myc (Ad-SOcMK) shown in multiple restriction endonuclease analyses, and the produc 30 FIG. 1. IMR90 cells were transduced with the adenovirus, tion of recombinant adenoviruses can be followed by GFP and the timeline for transformation is shown in FIG. 5A. expression. Briefly, the IMR90 cells were transduced with Ad-SOcMKor Validation of protein expression can be accomplished Ad-GFP for 12 or 21 hrs, after which the medium was using any of a number of known methods, such as western replaced with human ES cell medium. Within 1 day, Ad blotting, and the like. As one example, FIG. 2A shows a 35 SOcMK-transduced cells took on a different appearance and schematic representation of an adenoviral vector containing began to form small cell clusters. By day 2 or 3, several multi-reprogramming factors in a single cassette, pSOKcM colonies of cells showing ES cell-like morphology emerged AdEAsy-1 102. FIG. 2B shows SH5Y cells that were tran in the dish (FIG. 1B, top right and middle right). Cells were siently transfected with pSOKcM-AdEasy-1 and pSOKcM also tested for ALP staining, as is shown in FIG. 5B, bottom AdShuttle constructs. Protein extracts from harvested cells at 40 right. The ALP assay reveals strong staining of IMR90-de 40-54 hrs post-transfection were probed by Western blot rived iPS cells indicating pluripotency, while no ALP staining analysis using the antibodies indicated. Blots were re-probed is observed in the GFP-transduced cells (FIG.5B, lower left). for Actin as an internal loading control. These results indicate The expression of exogenous individual protein factors in that the recombinant adenoviral construct expresses all pro protein extracts from harvested cells was also investigated by teins from the adenoviral vector in cells tested. 45 Western blot analyses, as is shown in FIG. 5C. The results iPS cells can thus be generated using an expression vector demonstrate that all RFs in the adenovirus are highly containing multi-reprogramming factors. iPS cells can be expressed in transduced IMR90 cells but not in Ad-GFP generated from a variety of transfectable cell types, and any transduced cells. type of cell capable of transfection is considered to be within Gene expression changes during the reprogramming pro the present scope. One specific example of Such a transfect 50 cess have traditionally been difficult to study. One reason for able cell type includes IMR90 human fetal fibroblasts. As is this difficulty in human cells may be due to the fact that shown in FIG.3, iPS cells can be generated with an adenoviral currently known methods of reprogramming occur at low vector without feeder cells or a matrigel matrix. In FIG. 3A, frequency and take Such long periods of time to occur. This is adenoviral constructs (AdEasy-1): Ad-GFP or Ad-SOK are particularly true for a new class of regulatory RNAs, called shown. In FIG. 3B a timeline of experimental design is 55 long inter-spersed non-coding (line) RNAS. The short and shown. IMR90 cells were transduced with adenoviruses, Ad synchronized reprogramming process of the present disclo GFP or Ad-SOK on day 2. Culture medium was changed Sure can facilitate the study of global transcription changes. every day with regular cell culture medium. Colonies To pursue these issues, the inventors have studied global gene appeared at days 4-7 in culture dishes. The top of FIG. 3B expression changes during reprogramming to determine the shows photomicrographs of IMR90 cells transduced with 60 correlation between gene expression changes and reprogram Ad-GFP on day 7: phase contrast in the top left image and ming. Using singular value decomposition, for example, GFP expression in the top right image. FIG. 3B middle and regulated functional pathways in early and intermediate bottom images show iPS cell-like colonies appearing in stages of reprogramming of human cells have been identified, IMR90 cells transduced with Ad-SOK on days 4-7, as shown including a set of novel linckNAs. by phase contrast (FIG. 3B middle and bottom left). GFP 65 Without intending to be bound to any scientific theory, expression in fluorescence microscopy of the same colony is mesenchymal-to-epithelial transition (MET) is a key regula shown in FIG. 3B bottom right. Thus by days 4-7, several tory event during reprogramming of somatic cells to the pluri US 9.228,204 B2 13 14 potent state. Expression of exogenous reprogramming factors to evaluate the methylation status of cytosine guanine effectively activate the epithelial program and shut down key dinucleotides (CpGs) in the NANOG promoter. CpGs are mesenchymal genes to favor the MET transition of somatic highly unmethylated iPS cells when compared with the cells toward induced pluripotency. These events are associ highly methylated CpGs in parent IMR90 cells. This indi ated with depletion of the mesenchymal marker THY 1, and cates that the NANOG promoter is active in iPS cells derived upregulation of the epithelial marker CDH122-24. To inves from IMR90 cells resulting in increased steady-state levels tigate this, the steady-state levels of THY 1 and CDH1 in iPS (FIG. 8B, lower panel). In order to exclude the possibility of cells generated with Ad-SOcMK are measured, RT PCR and viral DNA integration into genomic DNA, Southern blot Western blot analyses reveals upregulation of CDH1 and analysis can be performed by digesting genomic DNA from concomitant reduction of THY1 in iPSCs when compared 10 iPS cells generated with Ad-SOcMk with BamHI and AscI with control (See FIG. 6A). As THY1 is exclusively for KLF4 and c-MYC probes, respectively. Notably, South expressed in fibroblasts and fibroblast cells dramatically ern blot analyses does not detect genomic integration of the switched the state in a short period of time, the expression adenoviral transgene into iPS cells derived from IMR90 cells level of THY 1 by real-time PCR can be determined as a (data not shown). In addition, chromosomal G-band analyses function of reprogramming efficiency, Real-time PCR and 15 showed that iPS cells generated with Ad-SOcMK had a nor Western blot data reveals a decrease in levels of THY 1 by mal karyotype of 46XX (data not shown). ~80% in Ad-SOcMK transduced cells as cells are repro As has been described, a variety of cell types can be utilized grammed (See FIG. 6A lower panel, and FIG. 6B). to generate iPS cells according to aspects of the present dis It was next examined whether iPS cells generated with closure, and any such capable cell is considered to be within Ad-SOcMK express human ES cell-marker genes such as the present scope. As examples, human skeletal muscle cells NANOG, Telomerase reverse transcriptase (TERT), LIN28, (SkMCs) and spinocerebellar ataxia 2 (SCA2) patient skin stage specific embryonic antigens (SSEA-1, -3, and -4), and fibroblasts can be used. When SkMCs and SCA2 skin fibro tumor-related antigens (TRA1-60 and -81). Expression of blasts are transduced, several iPS cell colonies resembling ES each marker in iPS cells was studied by immunofluorescence cell-like morphology emerge in the dishes as early as day 3. using antibodies against endogenous proteins (FIGS. 7A-B). 25 The SkMC and SCA2 skin fibroblast-derived iPS cells posi The corresponding secondary antibodies were conjugated tively stain for ALP and immunofluorescence and RT-PCR with Dylight variants. Immunostaining data revealed expres analysis data reveals that these iPS cells express many undif sion of ES cell markers in iPS cells generated with ferentiated ES cell-marker genes and followed the MET pro Ad-SOcMK from IMR90 cells. cess (For SkMCs see FIG. 10, panelsa-e: for SCA2 see FIG. To measure steady state levels of undifferentiated ES cell 30 11, panels a-e). These findings demonstrate that the expres marker genes, real-time RT-PCR, semi-quantitative PCR, and sion vectors of the present disclosure can be used to generate Western blot analyses can be performed. Real-time and semi iPS cells rapidly and efficiently from a number of somatic quantitative PCR analysis of isolated RNA from iPS cells cells in a short period of time. demonstrate high expression of undifferentiated ES cell One of the useful characteristics of pluripotency is the marker genes, including NANOG, TERT, L1N28, ALPL, 35 ability of iPS cells to differentiate into all three germ layers. growth and differentiation factor 3 (GDF3), fibroblast growth The following non-limiting example is provided to show Such factor 4 (FGF4), developmental pluripotency-associated 5 differentiation. For example, for in vitro differentiation, (DPPA5), interferon induced transmembrane protein 1 (IF freshly prepared iPS cells with Ad-SOcMK as have been ITM1), galanin prepropeptide (GAL), gamma-aminobutyric described were cultured in ES cell medium without basic acid (GABA) A receptor, beta 3 (GABRB3), teratocarci 40 fibroblast growth factor (bFGF) for 8-9 days. The resultant noma-derived growth factor 1 (TDGF1), Nodal homolog embryoid bodies (EBs) in suspension cultures (see FIG. 12, (NODAL) and podocalyxin-like 2 (PODXL2) (See FIGS. panels c-) are allowed to differentiate further in chamber 8A-F). Western blot analyses in protein extracts from har slides. After 9-10 days in adherent culture, attached cells vested iPS cells confirmed protein expression of NANOG in show various types of morphologies. Immunocytochemistry iPS cells generated with Ad-SOcMK (FIG. 8B, bottom 45 reveals the detection of Nestin (ectoderm, FIG. 12, panel d), panel). smooth muscle actin (SMA) (mesoderm, FIG. 12, panel e), One of the prominent morphological changes during MET and alpha-fetoprotein (AFP) (endoderm, FIG. 12, panelf). To is the transformation of elongated fibroblasts into tightly test whether iPS cells could be differentiated into neurons, packed clusters of rounded cells. Ad-SOcMK transduced iPS cells are seeded on inactivated MEF cells and cultured for cells undergo progressive epithelial-like morphological 50 22-25 days. Morphological and immunostaining data changes from elongated fibroblasts (FIG. 9, panels a, h) to revealed that the iPS cells were differentiated into neurons packed clusters of rounded cells as visualized by phase con with a subpopulation of neurons staining with the dopamin trast microscopy (FIG. 9, panels d, f, h), Morphological ergic marker tyrosine hydroxylase (TH) (FIG. 12, panels g, changes occur in close association with expression of ALP. h). ALP-positive cells appeared as early as day 1 in Ad-SOcMK 55 To examine developmental potential in vivo, iPS cells gen transduced cells and ALP positive cells progressively erated with Ad-SOcMK are injected into NOD/SCID mice increased as reprogramming time increased (FIG. 9, panels 1. subcutaneously. After 9-10 weeks, teratomas develop and n, p). Cells transduced with Ad-GFP showed neither morpho histological data reveals development of muscle and adipose logical changes (FIG. 9, panels c, e.g) nor staining for ALP tissues (mesoderm) (FIG. 13, panels I, j). Thus, iPS cells (FIG.9, panelsk, m, o). Thus, reprogramming of IMR90 cells 60 generated according to aspects of the present disclosure show by Ad-SOcMK results in rapid and specific mesenchymal to pluripotency with the potential of differentiating into germ epithelial transition with very high efficiency. layers in vitro and in vivo. Such reprogramming of Somatic cells is also accompanied AS has been described, traditional methods for reprogram by significant epigenetic changes. As one example, the ming of human primary Somatic cells have low efficiency, NANOG promoter changes from a highly methylated state in 65 making the molecular characterization of reprogramming dif somatic cells to being unmethylated and active in iPS cells. In ficult. Given the rapid time course and absence offeeder cell one aspect, bisulfite genomic sequence analysis can be used contamination, the techniques according to aspects of the US 9.228,204 B2 15 16 present disclosure can allow monitoring of expression TABLE 1-continued changes at multiple time points during the reprogramming process as compared to just the beginning (fibroblasts) and KEGG pathway genes final (iPS cells) time points. In one aspect, therefore, RNAs Number Number are isolated from Ad-SOcMK and Ad-GFP transduced of of Z- Z IMR90 cells at 0, 24, 48 and 72 hrs post-transduction and Gene Genes Genes score score queried for global gene expression changes by hybridization Wave KEGG Pathway Set Up Down (Up) (Down) to oligonucleotide arrays representing 27.958 protein coding Late Cytokine-cytokine 26S 57 5.87 genes and 7,419 linckNAs. Differential expression analyses receptor interaction 10 Gastric acid 74 2O 4.6 (>2 fold change) shows changes in 6,852 genes for 0/24 hr, secretion 12,945 for 0/48 hr, and 14,158 for 0/72 hr (data not shown). Malaria 49 15 4.SS Based on the significant and rapid changes in global gene Hedgehog signaling 56 16 4.37 expression, the experiment is repeated and RNA expression is pathway analyzed at 6 hr intervals for 84 hrs after Ad-SOcMK trans Neuroactive ligand- 311 55 4.14 15 receptor interaction duction, FIG. 14 shows an illustration of the experimental Inter- Cell cycle 122 27 7.21 time line. To identify temporal waves of gene expression mediate DNA replication 35 12 6.78 across time points, the entire data set is analyzed, including Oocyte meiosis 111 19 4.68 TGF-beta signaling 83 15 4.4 Ad-GFP-transduced control cells (>1.5-fold differential pathway expression) by using singular value decomposition (SVD)25. Late DNA replication 35 16 6.98 FIG. 15A shows a heat-map of the gene expression profile Cell cycle 122 33 6.23 for this data set including linckNAs (21.372 genes). As can be Homologous 27 11 5.27 recombination seen in FIG.15A, a large class of RNAs is highly expressed in Systemic lupus 122 27 4.42 IMR90 cells with rapid reduction in the following 12-24 hrs. erythematosus A second class of RNAs shows little change initially, and then Pathways in cancer 325 56 4.34 exhibits increased expression with a return to or below initial 25 Pancreatic cancer 70 18 4.33 levels by 72-84 hrs. Additionally, genes in a third group have TGF-beta signaling 83 2O 4.23 low expression in the first 24–48 hrs, but then become highly pathway expressed from that time on. Similar clustering of linckNA expression can be observed (>four-fold differential expres AS has been described, in some aspects an altered promoter sion, 1059 linckNAs, FIG. 15B). Of note, changes in a large 30 can be utilized to alter the expression of a particular repro number of genes would have remained undetectable as the gramming factor. The expression of the reprogramming fac expression levels were similar at 0712 hrs compared with tor can be increased or decreased, depending on the desired 74/82 hrs, while expression greatly changed at the interven results. In one specific aspect, a weakened CMV promoter ing time points. (CMV) can be utilized. It should be understood that the Gene ontology and KEGG annotation can then be used to 35 discussion of the CMV should not be seen as limiting, and examine pathway-wide changes (Table 1). To do this, the is merely exemplary. Because of strong promoter activity, heat-map of gene expression (FIG.15A) is broken down into CMV promoter (589 bp) has previously been used in mam an early wave: 10%-40% percentile genes, an intermediate malian system to express a protein in order to study protein wave: 40%-75% percentile genes, and a late wave: 75%-95% functionality. Decreasing the expression of a reprogramming percentile genes: Genes related to cytokine-cytokine receptor 40 interactions are up-regulated in the early wave and remain no factor can be beneficial in the reprogramming process. In through 72 hrs (Z-score >4.1 at all time points). Genes related Some cases, overexpression of a protein may actually hamper to hedgehog signaling show increased expression in the inter the reprogramming process. As such, in Some cases factors mediate and late waves (Z-score >4.3). Genes involved in can be tuned to more beneficial rates of expression. Addition DNA replication and cell cycle genes are down-regulated in 45 ally, by decreasing the size of the CMV promoter without the intermediate and late wave (Z-score >6.2). Additionally, it interruption of promoter activity, a greater sequence size can was validated that various randomly selected genes are spe be loaded into the expression vector. To this end, CMV has cifically enriched or down regulated in ES cells from the two been developed to, among other reasons, regulate protein microarray data sets by real-time PCR. For all genes, expres expression and allow a higher amount of genetic material to sion changes are in the same direction within the same order 50 be cloned into a single cassette. of magnitude (data not shown). The inventors have constructed a series of mutant CMV promoters by deleting 200 or 322 bp from original CMV TABLE 1. promoter (CMVsso) sequence of pEGFPN1 (Clontech Inc., USA) plasmid using either PCR or restriction digestion meth KEGG pathway genes 55 ods. The resultant mutant CMV promoters are tested for promoter activity by Western blot analyses expressing in Number Number of of Z- Z HEK293 or SH-SYSY cells. Of these, CMVallas-GFP Gene Genes Genes score score construct, designated as CMV weak promoter-GFP (CM Wave KEGG Pathway Set Up Down (Up) (Down) V-GFP) results in the significant reduction of the GFP Early Cytokine-cytokine 26S 13 4.14 60 protein expression by >60% when compared with CMVsso receptor interaction GFP or CMValo-GFP. As is shown in FIG. 16, con Inter- Hedgehog signaling 56 14 4.89 struction of CMV promoter variants is shown. 200 bp deleted mediate pathway Cytokine-cytokine 26S 41 4.88 from the 5' end through PCR or 322 bp deleted by Aati I receptor interaction digestion from the CMV promoter region of plGFPN1 is Protein digestion 78 16 4.29 65 shown in the upper panel of FIG. 16. Validation of promoter and absorption activity is shown in the lower panel of FIG. 16. Protein extracts from HEK293 or SH-SY5Y cells transfected with US 9.228,204 B2 17 18 CMV promoter variants were subjected to Western blot All enzymes related to cloning experiments are purchased analyses using the antibodies indicated. The blots were re from New England Biolabs Inc., USA. probed for Actin as an internal loading control. CMVA 12 Human embryonic fibroblast IMR90 cells were obtained 443)bp promoter CMV weak promoter (CMV) results in from the AmericanType Culture Collection (ATCC), Catalog significant reduction of GFP protein expression. 5 No. CCL-186. IMR90 cells were maintained in DMEM In order to validate this CMV activity further, repro medium containing 10% fetal bovine serum (FBS). gramming factors OCT3/4, SOX2, KLF4 and c-MYC genes Human skeletal muscle cells (SkMCs) were obtained from were cloned separately into pre-GFP deleted CMV-GFP Lonza Inc., USA, Catalog NO. CC-2661. SkMCs were main plasmid at Nhe site and tested for promoteractivity by West tained in SkGM medium (catalog #3160, Lonza Inc., USA), ern blot analyses expressing in HEK293 or SH-SY5Y cells. 10 containing 10% FBS. The Western blot data revealed the reduction of promoter Human spinocerebellar ataxia 2 (SCA2) skin fibroblasts activity of CMV, by >70% when compared with CMVsso containing (CAG).57 were obtained from Coriell Cell Reposi promoter (See FIG. 17). tories, USA Catalog No. # GMO4319. SCA2 skin fibroblasts iPS cells are then generated using the CMV in the viral 15 were cultured in MEM medium containing 15% FBS. cassette as has previously been disclosed for the CMV pro DMEM (Invitrogen, cat. no. 11965-092) moter. In short, IMR90 cells are plated at a density of Fetal bovine serum, FBS (Hyclone. Thermo Scientific) 1.5-2.5x10° cells per 10 cm tissue culture dish without feeder KO serum replacement (KOSR: Invitrogen, cat. no. 10828 cells. The next day (day 2), IMR90 cells are about 60-70% 028) confluent and the cells are transduced with medium (DMEM, PBS without Ca/Mg (Hyclone, Thermo Scientific) 5% FBS, 1% NEAA, 0.5% penicillin-streptomycin) contain L-Gin, 100x (Invitrogen Inc..) ing adenoviruses, Ad-GFP (control) or Ad(CMV)-GFP Nonessential amino acid solution (NEAA) (Invitrogen cMKSO viruses. From day 3 onward, the culture medium is Inc..) replaced with human ES cell medium including DMEM/F12, 2-Mercaptoethanol, 1000x. 55 mM (Invitrogen Inc..) 20% Knockout Serum Replacement (KSR), 1x nonessential 25 Sodium Pyruvate, 100x (Invitrogen Inc..) amino acids, lx sodium pyruvate, 1x L-glutamine, 0.1 mM Basic fibroblast growth factor (bFGF: Invitrogen, cat. no. b-mercaptoethanol, 25 ng/ml basic fibroblast growth factor 13256-029) (bFGF), and 0.5% penicillin-streptomycin. The medium is 7.5% BSA solution (wt/vol; Invitrogen, cat. no. 15260 changed every day and incubated for 7-8 days. By days 4-7, 037) several colonies showing ES cell-like morphology emerge 30 Penicillin/streptomycin, 100x (Invitrogen Inc..) and all colonies look identical, as shown in FIG. 18B. The 0.25% Trypsin/EDTA (Invitrogen, cat. no. 25200-056) resultant colonies (iPSCs) can be further expanded or sub 0.05% Trypsin/EDTA (Invitrogen, cat. no. 253.00-054) jected to characterization. SEQID 2, SEQ ID3, and SEQID Collagenase type IV (Invitrogen, cat. no. 17104-019) 4 are examples of adenovirus cassettes utilizing CMV. Attachment factor, AF 1x. (Invitrogen, cat. no. 17104-019) Additionally, as has been described, the undifferentiated 35 Equipment state of human ES/iPS cells express high levels of membrane Inverted tissue culture microscope with phase contrast alkaline phosphatase (ALP) and ALP staining can be used to microscope, Nikon Eclipse, TS100 (5x, 10x, 20x, 40x objec characterize the stem cells. For ALP staining, iPS cells are tives) generated from iMR90 cells in 12 wells plate using the meth Stereomicroscope (Nikon: SMZ-1500 or similar) ods described. An experimental timeline is shown in FIG. 40 Incubator, Hera cell 240i, Thermo Scientific 18A. At day 4, iPS cells are fixed with 4% paraformaldehyde Biosafety cabinet with aspirator for tissue culture for 2 minutes, followed by 15-minute incubation with stain Biosafety cabinet with aspirator for tissue culture, fitted for ing solution (Alkaline Phosphatase Detection Kit; Millipore). Stereomicroscope ALP staining data demonstrates the positive staining for iPS Tissue culture centrifuge, Sorvall, Legend X1 Centrifuge, cells, as is shown in FIG. 18C. As such, the CMV promoter 45 Thermo Scientific. can be utilized to generate iPS cells according to the methods Tissue culture dishes and Flasks, 100 mm, 150 mm and and techniques described herein. T-25 Tissue culture plates, 4, 6 and 12-well EXAMPLES Filter unit: Millex-HV, PVDF, 0.45 nm, 33 mm, Millipore 50 Inc., Materials Conical tubes, 15 and 50 ml Reprogramming factors: OCT3/4, SOX2, GKLF4 and Water bath Isotemp (Fisher Scientific, USA) c-Myc. Plasmids containing the reprogramming factors Plastic disposable transfer pipettes, 1, 5, 10 and 25 ml (pEP4 E02S ET2K, pCEP4-M2L, pEP4 E02SEN2K, pEP4 Glass disposable transfer pipettes, 5 ml E02S CK2MEN2L) are purchased from Addgene Inc., USA. 55 Disposable sterile filter system (0.22 um, 250 ml and 500 Each of the reprogramming factors was PCR amplified ml) from the plasmids with NheI restriction sites. The authentic Disposable syringes, 60, 30, 10 and 1 ml ity of each gene was verified by Nhe restriction digestion Hypodermic needle, 27-30G analyses and DNA sequencing. Freezing container (Nalgene Labware, cat. no. 5100) Plasmid, pEGP-N1 (4.7 kb) is purchased from Clontech 60 Cell lifter (Corning, cat. no. 3008) Inc., USA. Reagent Setup Adenoviral plasmid (pAdEasy-1, 33.4 kb), Shuttle vectors Culture medium 1 (CM-1): DMEM, 10% FBS, and 1% (pAdTrack and pAdTrack-CMV), Competent cells penicillin-streptomycin (AdEasier cells: E. coli BJ5183 containing padEasy-1 back Transduction medium: culture medium 2 (CM-2): DMEM, bone), and Packaging cells (HEK 293A) were generous gift 65 5% FBS, 1% NEAA, and 0.5% penicillin-streptomycin. from CoraliePoizet, Larry Kedes Lab, University of Southern Culture medium 3 (CM-3): DMEM, 10% FBS, 1% NEAA, California, Los Angeles, Calif., USA. and 0.5% penicillin-streptomycin. US 9.228,204 B2 19 20 Mouse embryo fibroblast (MEF) medium: DMEM, 10% nated as padSOcMK shuttle vector, as is shown in FIG. 1. FBS, 1% NEAA, and 0.5% penicillin-streptomycin. The ligation reaction mix is as follows: hiPS cell medium: DMEM/F12 containing 20% KOSR (vol/vol), 50 ng/ml bFGF, 1x L-GIn, 1xNEAA, 1.x Sodium Pyruvate, 100LM2-mercaptoethanol, 50U/ml penicillin, and pShuttle Vector DNA (10 ngul) 1 Il Insert DNA (CMV-SOX2-SV40PA) (10 ngul) 5 ul 50 mg/ml streptomycin. 1OX Buffer 2 Jul 2x cell-freezing medium: DMEM, 20% DMSO (vol/vol), T4 DNA ligase (3 U/ul) 1 Il 40% FBS (vol/vol), and 1% penicillin-streptomycin H2O 11 Il 2x iPS cell-freezing medium: DMEM/F12, 20% DMSO Total 20 ul (vol/vol), 60% FBS (vol/vol), and 20% hiPS medium (vol/ 10 vol). The ligation reaction mix is incubated at 16°C. for 18-24 Example 1 hrs. The DNA is mixed with DH5C. competent cells and the transformation is performed. The cell Suspension is inocu Cloning of Reprogramming Factors 15 lated onto 10 cm petri dishes containing LB-agar plus 50 ug/ml of kanamycin. The agar plates are incubated at 37°C. Cloning techniques follow methods published in Molecu for 20-24 hrs. The positive clones of each gene are verified by lar cloning (A laboratory manual by Tom Maniatis, J. Sam restriction digestion analyses and DNA sequencing. brook, and E. F. Fritsch), which is incorporated herein by reference. Example 2 pEGFP-N1 plasmid (4.7 kb; purchased from Clontech Inc., USA.) is digested with BglII and NotI to remove the GFP Generation of Recombinant Adenoviral Plasmids by open reading frame (ORF) from the plasmid backbone. The Homologous Recombination in E. Coli (FIG. 1) digestion reaction mix is as follows: 25 High competence bacterial cells (E. coli BJ5183) are uti lized in the following methods to achieve efficient recombi pEGFP-N1 Plasmid DNA (1 g/ul) 10 ul nation. 1OX Buffer 5 ul BglII (10 U?ul) 1 Il Recombinant pAdShuttle plasmid clones containing the NotI(10 U?ul) 1 Il reprogramming factors (pAdSOcMK) from Example 1 are H2O 33 ul 30 grown in 4.0 ml LB/kanamycin in a 5-ml conical tube, and shaken overnight in a 37°C. orbital shaker. The plasmid DNA Total 50 ul is purified by an alkaline lysis procedure. It has been found that efficient homologous recombination in AdEasiercells is The digestion reaction mix is incubated at 37° C. for 3-4 improved by maintaining the integrity of the shuttle vector hrs. Heat inactivation is performed at 65° C. for 30 min. The 35 DNAs. Plasmids purified with commercial DNA miniprepa digested product is then electrophoresed on a 0.8% agarose ration kits can contain significant numbers of nicked DNA gel and the plasmid backbone (3.9 kb) is purified using a gel molecules that may be detrimental to efficient and faithful extraction kit (Qiagen). recombination. The conventional alkaline lysis procedure can Each of the reprogramming factors (OCT3/4, SOX2, provide consistent and reliable results. GKLF4 and c-Myc) are PCR amplified from pEP4 E02S 40 The recombinant shuttle vector plasmid is linearized by ET2K or pCEP4-M2L or pEP4 E02SEN2K or pEP4 E02S digesting with the restriction endonuclease PmeI, and puri CK2MEN2L plasmids (Addgene) with NheI restriction sites. fied using agel extraction kit (Qiagen). The digestion reaction The PCR products are cloned into pEGFP N1 (GFP deletion) mix is as follows: at Nhe site from the above digestion reaction. The ligation reaction mix is as follows: 45 Recombinant shuttle vector DNA (1 lugul) 10 ul 1OX Buffer 5 ul Vector DNA (10 ngul) 1 Il PmeI (10 U?ul) 1 Il Insert DNA (PCR product) 5 ul 1 OOXBSA 0.5 ul 1OX Buffer 2 Jul H2O 33.5 ul T4 DNA ligase (3 U/ul) 1 Il 50 H2O 11 Il Total 50 ul Total 20 ul The digestion reaction is incubated at 37° C. for 3-4 hrs. Heat inactivation is performed at 65° C. for 30 min. The The ligation reaction mix is incubated at 16°C. for 18-24 55 digested product is electrophoresed on a 0.8% agarose geland hrs. The DNA is mixed with DH5C. competent cells (New the plasmid backbone is purified using a gel extraction kit England Biolabs Inc.) and the transformation is performed. (Qiagen). The cell suspension is inoculated onto 10 cm petri dishes 10 ul (100 ng/ul) of the linearized plasmid is mixed with containing LB-agar plus 50 ug/ml of kanamycin. The agar 50-100 ul of E. coli BJ5183 cells and incubated on ice for plates are incubated at 37° C. for 20-24 hrs. The positive 60 40-60 min. The bacteria/DNA mix is then heat shocked at 42° clones of each gene are verified by NheI restriction digestion C. for 1.5-2 min and immediately incubated on ice for 0.5-1 analyses and DNA sequencing. min. The cells are immediately placed in 250-300 ul of LB In order to clone the four reprogramming factors into the Broth and grown at 37° C. for 1.5-2 hrs. pAdTrack shuttle vector, each cassette from the above reac 100 ul of the cell suspension is inoculated onto each of tion is consecutively subcloned into the shuttle vector (Sox2 65 three 10 cm petri dishes containing LB-agar plus 50 ug/ml of cassette at HindIII site, OCT3/4 cassette at EcoRV site, KLF4 kanamycin. The agar plates are incubated at 24–30°C. for 2-3 cassette at Sal site, and c-Myc cassette at Not site), desig days until colonies appear. Each colony is isolated and grown US 9.228,204 B2 21 22 in 4 ml LB medium containing 50 g/ml of kanamycin at monitored by GFP expression. When >90% of the cells die, 24-30°C. for 2 days in an orbital shaker. the cells are scraped off and adenoviral Supernatant is pre Plasmid DNA is isolated using the conventional alkaline pared as described in Example 3. Authenticity of recombinant lysis method. Pact restriction digestion is performed on can adenovirus can be confirmed by infecting the viral Superna didate clones. Correct recombinants usually yield a large tant to any infectable cells and Western blot and/or PCR fragment (~30 kb) and a smaller fragment of 4.5 kb. 1-3 ul of analyses of target genes. Multiple rounds of infection cycles correct recombinant plasmids (pAdSOcMK adenoviral vec in HEK 293A cells can be carried out to harvest adenoviral tor) are retransformed into DH 10B competent cells. The cor particles. rect clones are subjected to restriction enzyme and/or PCR analysis to verify authenticity. The plasmids are purified with 10 Example 5 Pure Link Maxi Kit (Invitrogen Inc.) in order to transfect into the packaging cells (HEK 293A cells) for virus production. Generation of iPS Cells by Adenoviral Vector Containing Multi-Reprogramming Factors from Example 3 15 IMR90 Human Fetal Fibroblasts without Using Adenovirus Production in Packaging Cells (HEK Feeder Cells 293A) Human embryonic fibroblast IMR90 cells are purchased Day 1: HEK 293A cells (E1-transformed human embry from the AmericanType Culture Collection (ATCC) (Manas onic kidney cells) are plated at a density of 1-2x10 cells per sas, Va., http://www.atcc.org: Catalog No. CCL-186). IMR90 T-25 flask in cell culture medium containing DMEM, 10% cells are cultured and maintained in culture medium 1 (CM-1) FBS, and 1% penicillin-streptomycin. The cells are incubated containing DMEM, 10% FBS, and 1% penicillin-streptomy at 37° C., 5% CO, for 24 hr. cin according to manufacturers protocol. Day 2: The confluency can be about 50-70% at the time of The fibroblasts IMR90 are thawed as follows: transfection. The recombinant adenoviral plasmids (pAd 25 1. Prepare 9 ml of CM-1 in a 15 ml conical tube. SOcMK) are digested with PacI (often 5ug DNA is needed 2. A vial of frozen fibroblasts is removed from the liquid for one transfection). The digested plasmids are ethanol pre nitrogen tank and placed into a 37°C. water bath until cipitated and resuspended in 25-30 ul of sterile H.0. A stan most (but not all) cells are thawed. dard lipofectamine transfection is performed according to 3. The vial is wiped with ethanol, the cap is opened, and the manufacturer's protocol (Invitrogen Inc.). Mix 5ug of PacI 30 cell Suspension is transferred to the tube prepared in Step digested plasmid and 25 ul of Lipofectamine in 500 ul of 1. OptiMem I medium, and incubate at room temperature for 4. The tube is centrifuged at 1100 rpm for 3 minutes, and 15-30 min. While waiting, medium from the recipient cells the Supernatant is discarded. can be removed and the cells can be wash once with a serum 5. The cells are re-suspended in 10 ml of CM-1, and trans free medium (DMEM).2.5-3.0 ml Opti-Mem I is added to a 35 ferred to a 100 mm dish (0.5-1x105 cells/dish). The cells T-25 flask containing the cells. Incubate the cells (37°C., 5% are incubated in a 37° C., 5% CO2 incubator until the CO2) for 10-15 min. The lipofectamine-DNA mix is added to cells become 80-90% confluent. The medium is the flasks with the cells and returned to the incubator for 5-6 changed every other day. hrs. The lipofectamine/DNA medium is removed and 5-7 ml The fibroblasts are passaged as follows: of fresh cell culture medium is added, and the cells are incu 40 1. The medium is discarded the cells are washed once with bated at 37° C., 5% CO2. PBS. Incubation continues until ~90% of the cells detach (die) 2. The PBS is aspirated, and 1.5 ml per dish of 0.05% from the flask surface. This often takes approximately 20-30 trypsin/0.53 mM EDTA is added, and the cells are incu days. Transfections and viral production can be monitored by bated for 1-2 minutes at 37° C. GFP expression. The cells are scraped off the flask with a 45 3. 8.5 ml of CM-1 is added, and the cells are separated into scrapper at 20-30 days post-transfection and the medium with a single cell Suspension by pipetting up and down several the cells is collected in 15/50 ml conical tubes. The tubes are times. spun in a benchtop centrifuge, and Supernatant (Sup 1) is 4. The cell suspension is adjusted to 40 ml by the addition collected and the pellet is resuspended in 2-3 ml sterile PBS. of CM-1 medium, and transferred to dishes (10 ml per 10 The cells are frozen in a dry ice/methanol bath or a -80° C. 50 mm dish). Thus the cells are divided up in a 1:4 ratio. The freezer, thawed in a 37° C. water bath, and vortexed vigor cells are incubated at 37° C., 5% CO2 until the cells ously. This procedure of freeze/thaw/vortex is repeated for become 80-90% confluent. This commonly takes 4-5 3-4 more cycles. The samples are spun briefly, and the Super days after passage. natant (Sup 2) is collected. Sup 1 and Sup 2 are mixed (here Adenoviral transduction is accomplished as follows: inafter “adenovirus particles'). The adenovirus particles are 55 Day 1: IMR90 cells are plated at a density of 1.5-2.5x10° filtered with a 0.45um syringe filter and stored at -20/-80°C. cells per 10 cm tissue culture dish in CM-1 without until use. feeder cells and incubated at 37° C., 5% CO, for 24 hr. Day 2: When IMR90 cells are about 60-70% confluent, the Example 4 culture medium is removed and the cells are transduced 60 with culture medium 2 (CM-2) including DMEM, 5% Amplification of Adenoviruses FBS, 1% NEAA, 0.5% penicillin-streptomycin and also containing adenovirus particles as generated in either of Two 50-70% confluent T-25 flasks of HEK 293A cells are Examples 3 and 4, Ad-GFP or Ad-SOK or Ad-SOcMK infected using 40-50% of the viral supernatant containing the at 100-500 pfu/cell. The cells are incubated at 37°C.,5% adenovirus particles from Example 3 for each flask. Cyto 65 CO2 for 24 hr. pathic effect (CPE) or cell lysis should appear at 7-10 days Day 3: The culture medium is changed with culture post infection. Effective production of adenoviruses can be medium 3 (CM-3) including of DMEM, 10% FBS, 1% US 9.228,204 B2 23 24 NEAA, 0.5% penicillin-streptomycin. The cells are changed every day and by days 2-3, several colonies showing incubated at 37°C., 5% CO2 for 24hr. ES cell-like morphology emerged on the dish. The same Day 4: Incubation continues. The medium is changed every protocol is used to generate iPSCs from SkMCs and SCA2 day with CM-3 and incubated for more 3-4 days. patient skin fibroblasts. Feeder cells are not used. By days 4-7, several colonies showing ES cell-like mor- 5 Example 7 phology emerge and all colonies look identical, as shown in FIG. 3. Western Blot Analysis Example 6 10 Protein extracts are resolved by SDS-PAGE and trans ferred to Hybond P membranes (Amersham Bioscience Inc., Adenovirus Transduction and iPSC Generation USA). After blocking with 5% skim milk in 0.1% Tween 20/PBS, the membranes are incubated with primary antibod IMR90 cells (1.0-1.5x106) are cultured overnight on 100 ies in 5% skim milk in 0.1% Tween 20/PBS for 2 hrs at room mm dishes without feeder cells. On the following day, cells 15 temperature or overnight at 4°C. After several washes with are transduced with Ad-SOcMK or Ad-GFP (control). Aden- 0.1% Tween 20/PBS, the membranes are incubated with the oviruses are removed at 24 hrs post-transduction (day 1), and corresponding secondary antibodies conjugated with HRP in replaced with human ES cell medium consisting of DMEM/ 5% skim milk in 0.1% Tween 20/PBS for 2 hrs at room F12 (#11330-32, Invitrogen Inc., USA), 20% Knockout temperature. Following three additional washes with 0.1% Serum Replacement (KSR) (#10828-028, Invitrogen Inc., Tween 20/PBS, signals are detected by using the Immobilon USA), 1x nonessential amino acids, 1x sodium pyruvate, 1 x Western Chemiluminescent HRP Substrate (#WBKLSO100, L-glutamine, 0.1 mM B-mercaptoethanol, 25 ng/ml basic Millipore Inc., USA) according to the manufacturer's proto fibroblast growth factor (bFGF) (#PHG0263, Invitrogen Inc., col. The antibodies with their sources and dilutions are listed USA), and 0.5% penicillin-streptomycin. The medium is in Table 2. TABLE 2
Antibodies
Dilutions Dilutions (Western (Immuno- Catalog Antibodies blot) fluorescence) Vendors name i Primary Antibodies: Monoclonal antibodies (mAb): OCT-3/4 (C-10) 1:SOOO Santa Cruz Inc., USA sc-5279 GKLF (B-9) 1:7OOO Sc-1661OO c-MYC (9E10) 1:SOOO sc-40 SSEA-1 1:500 Millipore Inc., USA MAB4301-20 SSEA-3 1:500 MAB43O3-2O SSEA-4 1:500 MAB4304-20 TRA-1-60 1:500 MAB4360-2O TRA-1-81 1:500 MAB4381-2O Smooth Muscle Actin (SMA) 1:500 CBL171 Alpha Feto Protein (AFP) 1:500 2004189 Polyclonal antibodies (pAb): Host: Rabbit
SOX-2 (H-65) 1:4OOO Santa Cruz Inc., USA sc-20088 LIN-28 (H-44) 1:500 Sc-67266 TERT (H-231) 1:500 sc-7212 NANOG 1:3OOO 1:500 Cell Signaling Tech., 358O USA THY1 1:4OOO Cell Signaling Tech., 97.98 USA Nestin 1:500 Millipore Inc., USA ABS922 mAb conjugated with HRP:
Beta-Actin (AC-15) 1:1OOOO Sigma Inc., USA A3854 Secondary Antibodies: Conjugation: HRP Sigma Inc., USA A2304
anti-mouse IgG 1:SOOO anti-rabbit IgG 1:SOOO Santa Cruz Inc., USA Sc-2O77 Conjugation: Dylight 549
anti-mouse IgG 1:2OOO Fisher Scientific, USA 35507 anti-rabbit IgG 1:2OOO 355.57 US 9.228,204 B2 25 26 Example 8 TABLE 3 - continued
Primers Alkaline Phosphatase Staining and Immunocytochemistry GABRB3 Forward: SEQ ID 11 ALP staining was performed using the Alkaline Phos s' - CCTTGCCCAAAATCCCCTATGTCAAAGC-3' phatase Detection Kit (HSCR004, Millipore Inc., USA). Reverse: SEQ ID 12 Briefly, iPS cells are fixed with 4% paraformaldehyde/PBS s' - GTATCGCCAATGCCGCCTGAGACCTC-3' 10 for 2 min, followed by 15 min incubation with staining solu NANOG tion according to the manufacturer's protocol. For immuno cytochemistry, cells are fixed in 4% paraformaldehyde/PBS Forward: SEQ ID 13 5-ATTATAAATCTAGAGACTCCAGG-3 for 20 min at room temperature. The cells are then permeabi Reverse: SEQ ID 14 lized with 70% ethanol and stored at 4°C. After washing with 5 - CATGGAGGAAGGAAGAGGAGAGAC-3' PBS, cells were blocked with 10% BSA/PBS for 2 hrs at room 15 temperature. Slides were incubated with primary antibodies in 10% BSA/PBS for 2 hrs at room temperature or overnight Forward: SEQ ID 15 at 4°C., washed three times with PBS and incubated with the 5 - CTGCTGCCTGAATGGGGGAACCTGC-3 corresponding secondary antibodies conjugated with Dylight Reverse: SEQ ID 16 variants. Following incubation, cells are washed three times 5 - GCCACGAGGTGCTCATCCATCACAAGG-3 with PBS and nuclei stained with 4,6-diamidino-2-phenylin dole (DAPI) (Sigma Inc., USA). The slides are mounted with ALPL mounting medium, Vectashield (Vector Inc., USA) and cells 25 Forward: SEQ ID 17 visualized using confocal microscopy (Nikon Eclipse Ti 5'-TTATAAGGCGGCGGGGGTGGTGGC-3' microscopy). The antibodies with their sources and dilutions Reverse: SEQ ID 18 are listed in Table 2. 5 - CGAAGGGGAACTTGTCCATCTCCAG-3
NODAL Example 9 30 Forward: SEQ ID 19 5 - ATCATCCGCAGCCTACAGGCAG-3 PCR Analysis Reverse: SEQ ID 20 s' - CTGTCCCTCCTGGGCCCGCCAGG-3' Total RNA is prepared from harvested cells using the 35 RNAeasy Kit (Qiagen Inc., USA). cDNA is synthesized from TERT 5 lug of total RNA using MMLV reverse transcriptase and Forward: SEQ ID 21 random hexanucleotide primers (New England Biolab Inc., s' - CCTGCTCAAGCTGACTCGACACCGTG-3' USA) according to the manufacturer's protocol. To study Reverse: SEQ ID 22 gene expression of iPS cells, cDNAs (150 ng for semi-quan 40 5 " - GGAAAAGCTGGCCCTGGGGTGGAGC-3' titative and 5 ng for real-time PCR) derived from the total RNA is subjected to PCR analysis. In regular PCR, the PCR PODXL2 products are cloned and Verified by sequencing. Primer sequences used for semi-quantitative and real-time PCR are Forward: SEQ ID 23 listed in Tables 3 and 4. 5 - CTCAACCAGCAGCTCCTAGAAGGG-3 45 Reverse: SEQ ID 24 s' - GCTGGCCCGCGCCTGGCAGCTGC-3' TABL E 3 GDF3 Primers
CDH1 50 Forward: SEQ ID 25 5 - CTTATGCTACGTAAAGGAGCTGGG-3 Forward: SEQ ID 5 Reverse: SEQ ID 26 5'-AGCCATGGGCCCTTGGAGCCGCAG-3 5 - GTGCCAACCCAGGTCCCGGAAGTT-3' Reverse: SEQ ID 6 s' - GGAATAACCCAGTCTCTCTTCTGTC-3' GAPDH 55 GAL Forward: SEQ ID 27 Forward: SEQ ID 7 5'-TGAAGGTCGGAGTCAACGGATTTGG-3 5-TGCGGCCCGAAGATGACATGAAACC-3' Reverse: SEQ ID 28 Forward: SEQ ID 8 5 " - GGAGGCCATGTGGGCCATGAG-3 5 - CCCAGGAGGCTCTCAGGACCGCTC-3 60 THY1
Forward: SEQ ID 9 Forward: SEQ ID 29 5 - GAGGAGGCTGCAGCAGCGGAAGAC-3' 5 - CTACAACGCCTACGAGTCCTACAAG-3 Forward: SEQ ID 10 Reverse: SEQ ID 30 5 - GAGCCAGCAGGCTGATGCCCT CAC-3 65 5 GTTGCACCAGAAAAGTCAGAGTTG-3
US 9.228,204 B2 29 30 TABLE 4 - continued
Primers
GAL GAPDH
Forward: SEQ ID 68 Forward: SEQ ID 70 s' - GCGCACAATCATTGAGTTTCTG-3' 5 - GAAGGTGAAGGTCGGAGTCAACG-3 Reverse: SEQ ID 69 Reverse: SEQ ID 71 5'-AGACAAACATGCCCAGGAGG-3 5 - GAAGATGGTGATGGGATTTCC-3
Example 10 Comparative Oncology Resource Core at the University of Utah. Samples are embedded in paraffin and stained with Bisulfite Sequencing hematoxylin and eosin in the Tissue Resource and Applica 15 tion Core (TRAC) at the University of Utah. All procedures To assess the methylation status of CpGs in the promoter are performed in accordance with protocols approved by the region of NANOG, genomic DNA is purified from IMR90 University of Utah Animal Research Committee guidelines. cells transduced with Ad-GFP or Ad-SOcMK using the DNeasy Kit (Qiagen Inc., USA). Purified genomic DNA (1 Example 12 ug) is used to convert unmethylated cytosines (C) to uracil (U) using EZ DNA methylation kit (#D5001, Zymo Research Inc., USA), according to the manufacturer's protocol. Treated Microarray Analyses DNA is purified with QIAquick column (Qiagen Inc., USA) and purified DNA (150 ng) from each sample is subjected to 25 IMR90 cells are transduced with Ad-SOcMK or Ad-GFP. PCR analyses for the promoter region of NANOG using the Adenoviruses are removed at 12 hrs post-transduction and following primers: forward 5'-CACCATGCGTG cells are sampled at every 6 hrs. Total RNA is prepared from GCTAATTTTTGTA-3', reverse 5'-TTAAAATCCTG each sample using Qiagen RNeasy kit according to manufac GAGTCTCTAGATTT-3'. The resulting PCR products are 30 turer's protocol. Human genome SurePrintG3 8x60K carry subcloned into the pCR2.1-TOPO vector (Invitrogen Inc., ing 27.958 genes and 7,419 LincRNA targets (Agilent Tech USA). Ten clones of each sample are verified by sequencing. nologies, Inc.) are used for microarray hybridization to examine the global gene expression. Approximately 1 ug of Example 11 35 RNA from each sample is labeled using Agilent Two-Color In Vitro Differentiation Quick Amp Labeling Kit following manufacturers instruc tions. All arrays are hybridized at 65° C. for 17 hrs and scanned using an Agilent Scanner G2505C. The gene expres To determine the differentiation ability of iPS cells in vitro, sion raw data is extracted using Agilent Feature Extraction the floating culture method is used to form Embryoid bodies 40 (EBs). Briefly, IMR90 cells are transduced with Ad-SOcMK. Software version 10.5. Quality control is done on the basis of On day 3, the resultant iPS cells are mechanically dissociated Agilent quality control metrics. Singular value decomposi and cultured in ES cell medium (without bFGF) in non tion (SVD) of the qualified data, with gene expression cen coated T25 flasks. The medium is changed every other day. tered at its time average, identified several "eigengenes, i.e., 45 significant patterns of expression variation across time. Sort After 7 days in floating culture, ball-shaped structures typical ing the data according to the two most significant eigengenes for EBs are formed. EBs are then transferred to 0.1% gelatin gives a global picture of the dynamics of gene expression, in coated chamber slides using the same medium. The medium which individual genes appear to be classified into groups of is changed every other day once EBs are attached to the slide. similar regulation and function25. Array experiments are per Differentiated cells are fixed after 8 days in adherent culture 50 and stained with antibodies recognizing marker proteins for formed in Microarray Core Facility at the University of Utah. each germ layer. Of course, it is to be understood that the above-described arrangements are only illustrative of the application of the Example 12 principles of the present disclosure. Numerous modifications 55 and alternative arrangements may be devised by those skilled Teratoma Formation in the art without departing from the spirit and scope of the present disclosure and the appended claims are intended to To examine the in vivo development potential of iPS cells, cover Such modifications and arrangements. Thus, while the IMR90 cells are transduced with Ad-SOcMK. On day 3, the present disclosure has been described above with particular resultant iPSCs are injected subcutaneously to 4 of 6-week 60 ity and detail in connection with what is presently deemed to old male nonobese diabetic severe combined immunodefi be the most practical embodiments of the disclosure, it will be cient (NOD/SCID) mice (Charles River Laboratories) apparent to those of ordinary skill in the art that numerous (3x 106 iPSCs for each mouse). For control experiment, modifications, including, but not limited to, variations in size, IMR90 cells (3x106 cells) are also injected into one mouse. 65 materials, shape, form, function and manner of operation, After 9-10 weeks, tumors are dissected and fixed in 4% assembly and use may be made without departing from the paraformaldehyde. Teratoma experiments are conducted in principles and concepts set forth herein. US 9.228,204 B2 31 32
S EQUENCE LISTING
<16O is NUMBER OF SEO ID NOS: 72
<210s, SEQ ID NO 1 &211s LENGTH: 16309 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: The adeno shuttle vector containing multi reprogramming factors has been provided as complementary sequence (pAd-kcMOS) . In the text, it should be read as pAd-SOcMK (S; SOX2, O; OCT3/4, cM; c-MYC, K. KLF4) 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) ... (3) <223> OTHER INFORMATION: n is a 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (12) ... (14) <223> OTHER INFORMATION: n is a 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (355) ... (357) <223> OTHER INFORMATION: n is a 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1945) . . (1947) <223> OTHER INFORMATION: n is a 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (7317) . . (7317) <223> OTHER INFORMATION: n is a 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (10202) ... (10204) <223> OTHER INFORMATION: n is a 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (12445) . . (12447) <223> OTHER INFORMATION: n is a 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (12462) ... (12464) <223> OTHER INFORMATION: n is a 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (13447) . . (13449) <223> OTHER INFORMATION: n is a 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (13464) . . (13466) <223> OTHER INFORMATION: n is a 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (14767) . . (14772) <223> OTHER INFORMATION: n is a
<4 OOs, SEQUENCE: 1 nnnttaatta annint ccctt cca.gct ct ct gcc ccttittggattgaa.gc.c aatatgataa 6 O tgagggggtg gagtttgttga C9tgg.cgcgg gacgtag tag 12 O tgtggcggaa gtgttgatgtt gcaagtgtgg cggalacacat gtaag.cgacg gatgtggcaa. 18O aagtgacgtt tttggtgtgc gcc.ggtgtac acaggaagtg acaattitt.cg cgcggittitta 24 O ggcggatgtt gtagtaaatt togcgtaac cgagtaagat ttggc cattt tcgcgggaaa 3OO actgaataag aggaagtgaa atctgaataa ttttgttgtta ct catagcgc gtaannincgc 360 gttalagatac attgatgagt ttgga caaac Cacaactaga atgcagtgaa aaaaatgctt tatttgttgaa atttgttgatg c tattgctitt atttgta acc attataagct gcaataaaca agittaacaac aacaattgca tt catttitat gttt Caggitt Cagggggagg tgttgggaggt 54 O tttittaaag.c aagtaaaacc tictacaaatg tgg tatggct gattatgat C agittatc tag
US 9.228,204 B2 73 74 - Continued <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: The adeno shuttle vector containing multi-RFs under CMV weak promoter (CMVWP) has been provided as pAd (CMVWP) - GFP KSO (K; KLF4 S; SOX2, O; OCT3/4) . 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) . . (3) 223 OTHER INFORMAT ON: n is a 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (12). . (14) 223 OTHER INFORMAT ON: n is a 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (355) ... (357) 223 OTHER INFORMAT ON: n is a 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (5715 ) . . (5715) 223 OTHER INFORMAT ON: n is a 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (6773 ) . . (6775) 223 OTHER INFORMAT ON: n is a 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (9016 ) ... (90.18) 223 OTHER INFORMAT ON: n is a 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (9033 ) ... (9035) 223 OTHER INFORMAT ON: n is a 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (100 8) ... (10O2O) 223 OTHER INFORMAT ON; n is a 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1003 5) . . (1 OO37) 223 OTHER INFORMAT ON: n is a 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1133 8) ... (11343) 223 OTHER INFORMAT ON: n is a 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1288 1) ... (12887) 223 OTHER INFORMAT ON: n is a
<4 OOs, SEQUENCE: 4 nint taatta annintCCCtt c cagotct ct gcc ccttittg gattgaa.gc.c aatatgataa 6 O tgagggggtg gagtttgttga cgtgg.cgcgg ggcgtgggaa cgggg.cgggt gacgtag tag 12 O tgtggcggaa gtgttgatgtt gCaagttgttgg cggalacacat gtaag.cgacg gatgtggcaa. 18O aagtgacgtt tttggtgtgc gcc.ggtgtac acaggaagtg acaattitt.cg cgcggittitta 24 O ggcggatgtt gtagtaaatt tgggcgtaac cgagtaagat ttggc cattt tcgcgggaaa 3OO actgaataag aggaagtgaa atctgaataa ttttgttgtta ct catagogic gtaanninggit 360 accocq goct aatagtaatc aattacgggg t cattagttc atagoccata tatggagttc cgcgttacat aacttacggit aaatggc.ccg Cctggctgac cgc.ccaacga cc.ccc.gc.cca 48O ttgacgtcaa tiggagtttg ttittggcacc aaaat caacg ggactitt coa aaatgtcgta 54 O acaact cogc cccattgacg caaatgggcg gtagg.cgtgt acggtgggag gtctatataa gcagagctgg tttagtgaac cgt cagat.co gctagogcta ccggact cag atctogagct 660 caagctitcga attctgcagt cgacggtacc gatccaccgg tcqccaccat 72 O ggtgagcaag gC9aggagc tgttcaccgg ggtggtgcCC atcCtggtcg agctggacgg cgacgtaaac ggccacaagt t cagcgtgtc. cgg.cgagggc gaggg.cgatg ccaccitacgg 84 O
US 9.228,204 B2 85 86 - Continued tacgtgaacc at cacc caaa t caagtttitt toggtcgag gtgcc.gtaaa gCtctaaatc 1272 O ggalacc ctaa agggagcc cc cgatttagag Cttgacgggg aaa.gc.cggcg aacgtggcga 12780 gaaaggalagg galagaaag.cg aaaggagcgg gC9ct agggc gctggcaagt gtagcggtca 1284 O cgctg.cgc.gt aaccaccaca ccc.gc.gc.gct taatgcgc.cg nnnnnnn 12887
<210s, SEQ ID NO 5 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely synthesized
<4 OOs, SEQUENCE: 5 agc.catgggc ccttggagcc gcag 24
<210s, SEQ ID NO 6 &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 6 ggaataac cc agt ct citctt citgtc 25
<210s, SEQ ID NO 7 &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OO > SEQUENCE: 7 tgcggc.ccga agatgacatgaaacc 25
<210s, SEQ ID NO 8 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 8 cc.caggaggc tict Caggacc gctic 24
<210s, SEQ ID NO 9 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 9 gaggaggctg. Cagcagcgga agaC 24
<210s, SEQ ID NO 10 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 10 gagg cagcag gctgatgc cc ticac 24 US 9.228,204 B2 87 88 - Continued
<210s, SEQ ID NO 11 &211s LENGTH: 28 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 11 ccttgcc.caa aatcc.cct at gttcaaag.c 28
<210s, SEQ ID NO 12 &211s LENGTH: 26 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 12 gtat cqccaa to cqcctga gacct c 26
<210s, SEQ ID NO 13 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 13 attataaatc tagagactico agg 23
<210s, SEQ ID NO 14 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 14
Catggaggala galagaggag agaC 24
<210s, SEQ ID NO 15 &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 15
Ctgctgcctgaatgggggaa cctgc 25
<210s, SEQ ID NO 16 &211s LENGTH: 27 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 16 gccacgaggit gct catcCat Cacaagg 27
<210s, SEQ ID NO 17 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: US 9.228,204 B2 89 90 - Continued <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 17 ttatalagg.cg gC9ggggtgg tagc 24
<210s, SEQ ID NO 18 &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 18 cgaaggggala Cttgtc. catc. tccag 25
<210s, SEQ ID NO 19 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 19 atcatc.cgca gcctacaggc ag 22
<210s, SEQ ID NO 2 O &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 2O
Ctgtcc ct co tdgc.ccgcc agg 23
<210s, SEQ ID NO 21 &211s LENGTH: 26 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 21
Cctgct Caag Ctgact cac accgtg 26
<210s, SEQ ID NO 22 &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 22 ggaaaagctg gCCCtggggt gagc 25
<210s, SEQ ID NO 23 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 23
Ctcaiaccagc agcticcitaga aggg 24 US 9.228,204 B2 91 92 - Continued
<210s, SEQ ID NO 24 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 24 gctggc.ccgc gcc tdgcagc tigc 23
<210s, SEQ ID NO 25 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 25
Cttatgctac gitalaaggagc tiggg 24
<210s, SEQ ID NO 26 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 26 gtgc.ca accc aggtoccgga agtt 24
<210 SEQ ID NO 27 &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 27 tgaagg togg agt caacgga tittgg 25
<210s, SEQ ID NO 28 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 28 ggaggcCatg tdggcCatga g 21
<210s, SEQ ID NO 29 &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 29 ctacaacgcc tacgagtic ct acaag 25
<210s, SEQ ID NO 3 O &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized US 9.228,204 B2 93 94 - Continued
<4 OOs, SEQUENCE: 30 gttgcaccag aaaagt caga gttg 24
<210s, SEQ ID NO 31 &211s LENGTH: 26 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 31 aggagt ccca gga catcaaa gCtctg 26
<210s, SEQ ID NO 32 &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 32
CC9g.cggcaa tag catgg.cg agcgg 25
<210s, SEQ ID NO 33 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized < 4 OO SEQUENCE: 33 at atcc.cgcc gtgggtgaaa gttc 24
<210s, SEQ ID NO 34 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 34 acticagdcat ggactggagc at CC 24
<210s, SEQ ID NO 35 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 35 tcca attcgc tigacccatcc ticcg 24
<210s, SEQ ID NO 36 &211s LENGTH: 28 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 36
CCC caaagcc agaagatgca Caaggagg 28
<210s, SEQ ID NO 37 &211s LENGTH: 27 US 9.228,204 B2 95 96 - Continued
&212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OO > SEQUENCE: 37 cgt.cgc.caac catct tcc td tocctag 27
<210s, SEQ ID NO 38 &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 38 atggtgaccg agctgctggg aggag 25
<210s, SEQ ID NO 39 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 39 atacattgat gagtttggac aaac 24
<210s, SEQ ID NO 4 O &211s LENGTH: 24 & 212 TYPE DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 4 O gaggaggctg. Cagcagcgga agaC 24
<210s, SEQ ID NO 41 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 41
C Cactaggca ggc.cgittagg Ctgg 24
<210s, SEQ ID NO 42 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 42 ggatacagca cagtaaggag C 21
<210s, SEQ ID NO 43 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 43 US 9.228,204 B2 97 98 - Continued gcacagaccc acagttctic 19
<210s, SEQ ID NO 44 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 44 tctic ccatgc attcaaactgag 22
<210s, SEQ ID NO 45 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 45 cctttgttgtt cocaattic ct tc 22
<210s, SEQ ID NO 46 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 46
CCCsagacitt atgctacgta aag 23
<210s, SEQ ID NO 47 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 47 ggcaga Cagg ttaaagtaga gg 22
<210s, SEQ ID NO 48 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 48 agct acaaac aggtgaagac C 21
<210s, SEQ ID NO 49 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 49 gtgg taggaa gagtaaaggc tig 22
<210s, SEQ ID NO 50 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence US 9.228,204 B2 99 100 - Continued
22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 50 gatgtggagt atgaga.gtga C9 22
<210s, SEQ ID NO 51 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 51 ggtcaagggit Caggagttc 19
<210s, SEQ ID NO 52 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 52 gcacggcttt titt Cagatg
<210s, SEQ ID NO 53 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence & 22 O FEATURE; <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 53 cggttgaagg tag actggc
<210s, SEQ ID NO 54 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 54
Caaggcaaag aatgaccgtt C 21
<210s, SEQ ID NO 55 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OO > SEQUENCE: 55 tgctgaattic ctdgitat cqc
<210s, SEQ ID NO 56 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 56 gCagaa.gc.gc agatcaaaag US 9.228,204 B2 101 102 - Continued
<210s, SEQ ID NO 57 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OO > SEQUENCE: 57 cgga catgag gctaccatat g 21
<210s, SEQ ID NO 58 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 58 aggagttt catcc gaccaac
<210s, SEQ ID NO 59 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OO > SEQUENCE: 59 tctgcc atta t coacataca gc 22
<210s, SEQ ID NO 60 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 60 atcaac atco acago.gagac
<210s, SEQ ID NO 61 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 61 caac catctt cotgtc.ccta g 21
<210s, SEQ ID NO 62 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 62 c catgaaggt cacccactitc
<210s, SEQ ID NO 63 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized US 9.228,204 B2 103 104 - Continued
<4 OOs, SEQUENCE: 63 citcttgcatt aaactic titca to cq 24
<210s, SEQ ID NO 64 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 64 cc.ca.gcgaag agaatgaaga g 21
<210s, SEQ ID NO 65 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 65 aatggaacct gcc ttcticag
<210s, SEQ ID NO 66 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 66 cc caatacat citc cct tcac ag 22
<210s, SEQ ID NO 67 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OO > SEQUENCE: 67 ccacct citaa gogo catctitt g 21
<210s, SEQ ID NO 68 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 68 gcqcacaatc attgagtttic td 22
<210s, SEQ ID NO 69 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 69 agacaaac at gcc caggagg
<210s, SEQ ID NO 70 US 9.228,204 B2 105 106 - Continued
&211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OO > SEQUENCE: 7 O gaaggtgaag gtcggagt ca acg 23
<210s, SEQ ID NO 71 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Entirely Synthesized
<4 OOs, SEQUENCE: 71 gaagatggtg atgggatttic C 21
<210s, SEQ ID NO 72 &211s LENGTH: 16309 &212s. TYPE: DNA <213> ORGANISM: artificial sequence 22 Os. FEATURE: <223> OTHER INFORMATION: The pAdTrack adeno shuttle vector containing multi-reprogramming factors sequence has been provided as pAd-KcMOS. 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) ... (3) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221> NAME/KEY: misc feature <222s. LOCATION: (12) ... (14) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (355) ... (357) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1945) . . (1947) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (7317) . . (7317) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (10202) ... (10204) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (12445) . . (12447) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (12462) ... (12464) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (13447) (13449) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (13464) . . (13466) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (14767) . . (14772) <223> OTHER INFORMATION: n is a, c, g, or t
<4 OOs, SEQUENCE: 72 nnnttaatta annint ccctt cca.gct ct cit gcc ccttittg gattgaagcc aatatgataa 6 O
US 9.228,204 B2 121 122 What is claimed is: 6. The construct of claim 1, wherein the plurality of repro 1. A transformation construct for generating induced pluri- gramming factors consists of OCT3/4, SOX2, and KLF4. potentan expression stem (iPS) vectorcells, comprising:including a plurality of reprogram 7. The construct of claim 1, wherein the plurality of repro ming factors, each reprogramming factor being under 5 gramming factors includes OCT3/4, SOX2, NANOG, and control of a separate promoter, wherein the plurality of LIN28. reprogramming factors includes OCT3/4, SOX2, and at 8. The construct of claim 1, wherein the expression vector least one member selected from the group consisting of has a sequence that is at least 80% homologous to SEQID 72. 2. TheKLF4, construct c-Myc, of NANOG, claim 1, andwherein LIN28. the expression vector 9.. ThThe construct off claim 1, whereinthwherein the expression vector is selected from the group consisting of plasmids, viruses, and 10 has a sequence that is at least 95%O homologous to SEQID 72. combinations thereof. 10. The construct of claim 1, wherein at least one of repro 3. The construct of claim 1, wherein the expression vector gramming factor is under the control of a CMV promoter. 1S selected from the group consisting of adenoviral Vectors, 11. The construct of claim 10, wherein the CMV promoter episomal vectors, retroviral Vectors, and lentiviral vectors. is is a weak CMV promoter. 4. The construct of claim 1, wherein the expression vector is an episomal vector. 12. The construct of claim 1, wherein the expression vector 5. The construct of claim 1, wherein the plurality of repro further includes a reporter sequence under control of a sepa gramming factors includes OCT3/4, SOX2, KLF4, and rate promoter. c-Myc. k . . . .