DOCSLIB.ORG

Mitochondrial DNA Polymorphisms in Andersen–Tawil Syndrome

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mitochondrial DNA Polymorphisms in Andersen–Tawil Syndrome SHORT COMMUNICATION Mitochondrial DNA polymorphisms in Andersen–Tawil syndrome Armando Totomoch ‑Serra1,2, Cesar A. Brito ‑Carreón1, Maria de L. Muñoz1, David Cervantes ‑Barragan3, Manlio F. Márquez4 1 Department of Genetics and Molecular Biology, Center for Research and Advanced Studies of the National Polytechnic Institute (CINVESTAV-IPN), Mexico City, Mexico 2 PhD Program in Medical Sciences, University of the Frontier (UFRO), Temuco, Chile 3 Department of Genetics, South Central High Specialty Hospital of Mexican Petroleum (PEMEX), Mexico City, Mexico 4 Department of Cardiac Electrophysiology, National Institute of Cardiology “Ignacio Chávez,” Mexico City, Mexico Introduction Andersen–Tawil syndrome (ATS) genomes, suggested that a large number of poly‑ is a heart rhythm disorder classified as type 7 morphisms in mtDNA may be associated with long QT syndrome and characterized by mus‑ more severe Brugada syndrome. cular, neurological, and skeletal involvement. So Considering that the heart, skeletal muscles, far, mutations in the KCNJ2 (60% of cases) and and the brain use a high number of mitochon‑ KCNJ5 (<1% of cases) genes have been reported dria and that these tissues are essential compo‑ to be the underlying cause of the disease. nents affected in the ATS triad, mtDNA poly‑ In addition to the classic triad of periodic pa‑ morphisms can be expected to partially influ‑ ralysis, ventricular arrhythmias, and mild ‑to‑ ence the disease phenotype. ‑moderate dysmorphism, some case reports also In this article, we present results of our study noted deficits in executive functioning skills, ab‑ aimed to identify higher mtDNA polymorphisms stract reasoning,1 and seizures,2 which indicates in HVR ‑I in 5 patients with ATS. that ATS affects the central nervous system. The clinical variability observed in the heart, Methods Recruitment of participants Five skeletal muscles, and the brain could be a result study subjects together with their 4 mothers and of incomplete penetrance or interaction of mod‑ 3 fathers were enrolled. Based on clinical eval‑ ifier genes, as seen in epilepsy.3 Given the back‑ uation and electrocardiographic examination, ground, mitochondrial DNA (mtDNA) polymor‑ all study participants met the diagnostic crite‑ phisms can influence the phenotype by alter‑ ria for ATS and were inhabitants of the states ing the energy demand of the tissues affected of the central and north central regions of Mex‑ in the triad of ATS. ico. Patients 1, 2, and 3 were included owing The human mitochondrial genome includes to the presence of arrhythmia, history of limb 16 569 base pairs (bps). They form a maternally weakness, facial features, and no history of sud‑ Correspondence to: inherited, double ‑stranded, circular DNA chain, den cardiac death. Patient 4 was enrolled be‑ Manlio F. Márquez, MD, Department of Cardiac which encodes 13 polypeptides—components cause of sudden death of her twin sister and Electrophysiology, National of the respiratory chain complexes I, III, IV, and referred to the National Institute of Cardiolo‑ Institute of Cardiology “Ignacio V. This genome is characterized by a high rate of gy (Instituto Nacional de Cardiologia) because Chávez,” Juan Badiano 1, 2 Sección XVI. Tlalpan 14010, mutations, which regularly affect coding sequences. of suspicion of fatal arrhythmia. The ATS phe‑ Ciudad de México, Mexico, The hypervariable sites I and II (HVR ‑I and HVR‑ notype was identified based on the presence of phone: +52 55 55133740, email: ‑II, respectively) are part of the D ‑loop, a triple‑ arrhythmia and long QT syndrome, the analy‑ [email protected] ‑helix structure consisting of 1100 bps, which is sis of the facial phenotype, and history of sud‑ Received: December 10, 2019. Revision accepted: located in mtDNA. The HVR ‑I site (approximate‑ den death in the family. Patient 5 was includ‑ March 31, 2020. ly 400 bps) is the most polymorphic, informative, ed in the study but showed no cardiac involve‑ Published online: April 2, 2020. and mutational hotspot used previously.4 ment. The institutional review board approved Kardiol Pol. 2020; 78 (6): 581-583 doi:10.33963/KP.15274 Regarding heart rhythm disorders, Stoc‑ the study, and the participants provided writ‑ Copyright by the Author(s), 2020 chi et al,5 who sequenced whole mitochondrial ten informed consent. SHORT COMMUNICATION Mitochondrial DNA in Andersen–Tawil syndrome 581 Genomic DNA extraction Five milliliters of whole Polymorphisms in the HVR ‑I site The polymor‑ blood were obtained from each patient, and DNA phisms identified in 250 bps of the HRV ‑I site was extracted using the salting ‑out method. are shown in Supplementary material, Table S1. The DNA integrity was assessed in a 1% aga‑ In the study patients with ATS, 14 polymor‑ rose gel and quantified with the NanoDrop 2000 phisms were found and compared with the Cam‑ Spectrophotometer (Thermo Fisher Scientific, bridge reference sequence. A significant differ‑ Waltham, Massachusetts, United States) by mea‑ ence (P = 0.04) was found between patients and suring the ratio of absorbance at 260 nm and 280 their healthy fathers after comparing polymor‑ nm (approximately 1.8 accepted as appropriate). phism distribution. Concordance was seen be‑ tween the T16189C polymorphisms in 3 patients Genotyping nuclear DNA Genetic testing for and the C16223T, C16290T, and G16319A poly‑ ATS verification was sponsored in 1 patient and morphisms in 2 individuals. performed with the use of massive parallel se‑ quencing for the KCNJ2, CACNA1C, and KCNQ1 Multidimensional scaling plot A multidimen‑ genes, provided by Sistemas Genómicos (Va‑ sional scaling plot (Supplementary material, lencia, Spain). In the remaining 4 patients with Figure S1) was established to identify an ances‑ ATS, DNA was analyzed by Sanger sequencing tral relationship among patients and fathers in‑ for the KCNJ2 gene, including all exons and in‑ cluded in the study. It showed that the mtDNA tron / exon borders. When ATS was identified, sequences of the study patients and their fathers cascade genetic screening was performed in were dispersed and no relationship was found the relatives who could participate in the study. among them. However, we observed a slight clus‑ tering between Patient 1 (p.Ser136Phe) and Pa‑ Genotyping mitochondrial DNA In order to iden‑ tient 4 (p Arg218Trp). The distance between tify polymorphic positions in patients with ATS, their places of origin was approximately 340 the HVR ‑I region of mtDNA (400 bps) was am‑ kilometers, and the ancestral relationship was plified and sequenced by the Sanger method us‑ unclear owing to lack of longer mitochondri‑ ing the 5’‑ATACACCAGTCTTGTAAACC‑3’ and al DNA sequences. The polymorphisms iden‑ 5’‑CACGGAGGATGGTGGTCAAG‑3’ primers. tified in the mothers were similar to those in All the sequences obtained were aligned, and the study patients. polymorphisms were identified using the DnaSP The prevalence of ATS is unknown because 5.10.1 (Universitat de Barcelona, Barcelona, of the limited number of patients diagnosed Spain) and MEGA 4.0 (Center of Evolutionary worldwide. Fortunately, in the last 10 years, Functional Genomics Biodesign Institute, Ar‑ a growing number of cases with their clinical izona State University, Arizona, United States) characteristics have been reported in the litera‑ software. ture. Considering the high density of mitochon‑ dria in the heart, the brain, and skeletal mus‑ Statistical analysis Genotype frequencies cles, we studied the HVR ‑I site (which is high‑ were estimated by direct counting and distri‑ ly polymorphic) located in the mitochondrial bution. Categorical variables were analyzed us‑ genome to identify mtDNA polymorphisms in ing the Fisher exact or χ2 tests and performed ATS and compare them with mtDNA polymor‑ with the R software, version 3.6.3 (R Founda‑ phisms in patients’ fathers who could take part tion for Statistical Computing, Vienna, Austria). in the study. The results obtained were in line A P value less than 0.05 was considered signif‑ with previous studies, in which complete mito‑ icant. A 2‑dimensional scaling plot was drawn chondrial genomes were sequenced in patients with the RStudio Desktop 1.2.5033 (RStudio, with Brugada syndrome and more polymor‑ Inc., Boston, Massachusetts, United States) phisms were found.5 The difference in the distri‑ software using data from 250 bps of the HVR‑ bution of mtDNA polymorphisms may be indic‑ ‑I region and the Kimura 2‑parameter distance ative of a haplotype having more significant ef‑ values obtained from the sequences (based on fects on the synthesis of mitochondrial proteins. transition and transversion substitution rates), Of note, the diagnosis of ATS without cardi‑ which summarized genetic distances between ac abnormalities remains a challenge. The fam‑ the study patients and their fathers. The Cam‑ ily history of sudden death in some patients bridge Reference Sequence was used as a refer‑ with ATS highlights the need for further stud‑ ence sequence in this study (GenBank number, ies on the KCNJ2 gene mutations in the context NC_012920.1). of modifying factors and the necessity to use cardioverter ‑defibrillators in this population.6,7 Results and discussion Genetic testing Five Altered protein synthesis in mitochondria, be‑ study participants were identified as carrying ing a consequence of polymorphisms in specific the following mutations located in the KCNJ2 sites, may affect mitochondrial biogenesis lead‑ gene: p.Ser136Phe (Patient 1), p.Gly144Ala (Pa‑ ing to the decreased effectiveness
Load more

Recommended publications
  • Towards Mutation-Specific Precision Medicine in Atypical Clinical
    International Journal of Molecular Sciences Review Towards Mutation-Specific Precision Medicine in Atypical Clinical Phenotypes of Inherited Arrhythmia Syndromes Tadashi Nakajima * , Shuntaro Tamura, Masahiko Kurabayashi and Yoshiaki Kaneko Department of Cardiovascular Medicine, Gunma University Graduate School of Medicine, Maebashi 371-8511, Gunma, Japan; [email protected] (S.T.); [email protected] (M.K.); [email protected] (Y.K.) * Correspondence: [email protected]; Tel.: +81-27-220-8145; Fax: +81-27-220-8158 Abstract: Most causal genes for inherited arrhythmia syndromes (IASs) encode cardiac ion channel- related proteins. Genotype-phenotype studies and functional analyses of mutant genes, using heterol- ogous expression systems and animal models, have revealed the pathophysiology of IASs and enabled, in part, the establishment of causal gene-specific precision medicine. Additionally, the utilization of induced pluripotent stem cell (iPSC) technology have provided further insights into the patho- physiology of IASs and novel promising therapeutic strategies, especially in long QT syndrome. It is now known that there are atypical clinical phenotypes of IASs associated with specific mutations that have unique electrophysiological properties, which raises a possibility of mutation-specific precision medicine. In particular, patients with Brugada syndrome harboring an SCN5A R1632C mutation exhibit exercise-induced cardiac events, which may be caused by a marked activity-dependent loss of R1632C-Nav1.5 availability due to a marked delay of recovery from inactivation. This suggests that the use of isoproterenol should be avoided. Conversely, the efficacy of β-blocker needs to be examined. Patients harboring a KCND3 V392I mutation exhibit both cardiac (early repolarization syndrome and Citation: Nakajima, T.; Tamura, S.; paroxysmal atrial fibrillation) and cerebral (epilepsy) phenotypes, which may be associated with a Kurabayashi, M.; Kaneko, Y.
    [Show full text]
  • Expanded Genetic Screening Panel for the Ashkenazi Jewish Population B
    Donald and Barbara Zucker School of Medicine Journal Articles Academic Works 2015 Expanded genetic screening panel for the Ashkenazi Jewish population B. Baskovich I. Peter J. H. Cho G. Atzmon L. Clark See next page for additional authors Follow this and additional works at: https://academicworks.medicine.hofstra.edu/articles Part of the Psychiatry Commons Recommended Citation Baskovich B, Peter I, Cho J, Atzmon G, Clark L, Yu J, Lencz T, Pe'er I, Ostrer H, Oddoux C, . Expanded genetic screening panel for the Ashkenazi Jewish population. 2015 Jan 01; 18(5):Article 779 [ p.]. Available from: https://academicworks.medicine.hofstra.edu/ articles/779. Free full text article. This Article is brought to you for free and open access by Donald and Barbara Zucker School of Medicine Academic Works. It has been accepted for inclusion in Journal Articles by an authorized administrator of Donald and Barbara Zucker School of Medicine Academic Works. For more information, please contact [email protected]. Authors B. Baskovich, I. Peter, J. H. Cho, G. Atzmon, L. Clark, J. Yu, T. Lencz, I. Pe'er, H. Ostrer, C. Oddoux, and +7 additional authors This article is available at Donald and Barbara Zucker School of Medicine Academic Works: https://academicworks.medicine.hofstra.edu/articles/779 HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Genet Med Manuscript Author . Author manuscript; Manuscript Author available in PMC 2017 May 01. Published in final edited form as: Genet Med. 2016 May ; 18(5): 522–528. doi:10.1038/gim.2015.123. Expanded Genetic Screening Panel for the Ashkenazi Jewish Population Brett Baskovich, MD1,*, Susan Hiraki, MS, MPH, CGC2,**, Kinnari Upadhyay, MS2,**, Philip Meyer2, Shai Carmi, PhD3, Nir Barzilai, MD2, Ariel Darvasi, PhD4, Laurie Ozelius, PhD5, Inga Peter, PhD5, Judy H.
    [Show full text]
  • Brugada Syndrome
    Brugada Syndrome Begoña Benito, Ramon Brugada, Josep Brugada and Pedro Brugada cular features of the Brugada syndrome, and Since its first description in 1992 as a new clinical entity, the Brugada syndrome has aroused great provides updated information supplied by recent interest among physicians and basic scientists. clinical and basic studies. Two consensus conferences held in 2002 and 2005 helped refine the current accepted definite diag- Diagnostic Criteria and nostic criteria for the syndrome, briefly, the char- General Characteristics acteristic ECG pattern (right bundle branch block and persistent ST segment elevation in right After the initial description of the syndrome, several precordial leads) together with the susceptibility ambiguities appeared in the first years concerning for ventricular fibrillation and sudden death. In the the diagnosis and the specific electrocardiographic last years, clinical and basic research have pro- criteria. Three repolarization patterns were soon vided very valuable knowledge on the genetic identified (Fig 2)14:(a) type-1 electrocardiogram basis, the cellular mechanisms responsible for the typical ECG features and the electrical suscept- (ECG) pattern, the one described in the initial ibility, the clinical particularities and modulators, the report in 1992, in which a coved ST-segment diagnostic value of drug challenge, the risk strati- elevation greater than or equal to 2 mm is followed fication of sudden death (possibly the most con- by a negative T wave, with little or no isoelectric troversial issue) and, finally, the possible separation, this feature being present in more than 1 therapeutic approaches for the disease. Each one right precordial lead (from V1 to V3); (b)type-2 of these points is discussed in this review, which ECG pattern, also characterized by an ST-segment intends to provide updated information supplied by elevation but followed by a positive or biphasic T recent clinical and basic studies.
    [Show full text]
  • Brugada Syndrome: Clinical Care Amidst Pathophysiological Uncertainty
    Heart, Lung and Circulation (2020) 29, 538–546 REVIEW 1443-9506/19/$36.00 https://doi.org/10.1016/j.hlc.2019.11.016 Brugada Syndrome: Clinical Care Amidst Pathophysiological Uncertainty Julia C. Isbister, MBBS a,b,c, Andrew D. Krahn, MD d, Christopher Semsarian, MBBS, PhD, MPH a,b,c, Raymond W. Sy, MBBS, PhD b,c,* aAgnes Ginges Centre for Molecular Cardiology at Centenary Institute, University of Sydney, Sydney, NSW, Australia bFaculty of Medicine and Health, University of Sydney, Sydney, NSW, Australia cDepartment of Cardiology, Royal Prince Alfred Hospital, Sydney, NSW, Australia dDivision of Cardiology, University of British Columbia, Vancouver, Canada Received 16 August 2019; received in revised form 14 November 2019; accepted 25 November 2019; online published-ahead-of-print 17 December 2019 Brugada syndrome (BrS) is a complex clinical entity with ongoing conjecture regarding its genetic basis, underlying pathophysiology, and clinical management. Within this paradigm of uncertainty, clinicians are faced with the challenge of caring for patients with this uncommon but potentially fatal condition. This article reviews the current understanding of BrS and highlights the “known unknowns” to reinforce the need for flexible clinical practice in parallel with ongoing scientific discovery. Keywords Brugada syndrome Risk stratification Sudden death Arrhythmogenesis Implantable cardioverter- defibrillator Non-device management Introduction more commonly affected than females, and the average age at diagnosis is in the fourth decade [5]. Brugada syndrome (BrS) is an inherited arrhythmogenic heart disease defined by the classic electrocardiographic feature of coved ST-segment elevation in the right precordial leads and an increased risk of sudden death. Although some Pathophysiology of BrS suspicion of an association of right bundle branch block, A schema of our current understanding of the pathophysi- early repolarisation and idiopathic VF had been raised by ology of BrS is summarised in Figure 1.
    [Show full text]
  • Recurrent Syncope in the Andersen Tawil Syndrome E Cardiac Or Neurological?
    indian pacing and electrophysiology journal 15 (2015) 158e161 HOSTED BY Available online at www.sciencedirect.com ScienceDirect journal homepage: www.elsevier.com/locate/IPEJ Recurrent syncope in the Andersen Tawil syndrome e Cardiac or neurological? Michael David Fryer a,*, Gerald Kaye a, Susan Tomlinson b a Department of Cardiology, Princess Alexandra Hospital, University of Queensland, Australia b St Vincent's Clinic, University of Sydney, Australia article info EEG and MRI brain were normal. A further episode of tran- sient loss of consciousness, documented in the hospital re- Article history: cord as ‘consistent with seizure activity’ occurred; cardiac Available online 20 October 2015 monitoring did not reveal an arrhythmia. A clinical diagnosis of epilepsy was made based on the description of the epi- sodes and lack of a symptom rhythm correlation. The patient Keywords: was commenced on sodium valproate, which prevented Andersen-Tawil syndrome further episodes. Bidirectional ventricular tachy- Surface electrocardiograms recorded during the admission cardia documented asymptomatic, frequent polymorphic ectopy Channelopathy Fig. 1. Syncope ' The QTc was marginally prolonged at 465ms (Bazett s for- mula). Echocardiogram showed no evidence of structural heart disease. An outpatient Holter monitor confirmed the background rhythm was sinus, with episodes of non- sustained bidirectional ventricular tachycardia and frequent multimorphological ventricular ectopy with a 25% ectopic burden. Ectopy was suppressed completely during treadmill Case presentation exercise testing. The effect of exercise on the QT interval was not recorded. Metoprolol, verapamil, sotalol and flecainide An 8-year-old female patient was referred to a paediatrician were sequentially tried, but were either ineffective or pro- for assessment of an episode of global muscle weakness after duced intolerable side effects.
    [Show full text]
  • Test Requisition MOLECULAR DIAGNOSTICS LABORATORY
    FOR LAB USE ONLY TEST #____________________________________ Test Requisition DATE REC’D________________________________ MOLECULAR DIAGNOSTICS LABORATORY Phone: (440) 632-1668 TIME REC’D ___________ ______________ DDC CLINIC – CENTER FOR SPECIAL NEEDS CHILDREN Fax: (440) 632 -1697 14567 Madison Rd. www.ddcclinic.org Middlefield, OH 44062 Please complete all fields below. Missing or incomplete information may dela y specimen processing. PATIENT INFORMATION / / Name (Last) (First) (Middle) Date of Birth (MM/DD/YYYY) Address (Street) ( ) - (City) (State) (Zip) (Phone) RACE/ETHNICITY: ☐ African American ☐ Caucasian ☐ Amish ☐ Other GENDER: ☐ Female ☐ Male ☐ Unknown/Not Reported SPECIMEN INFORMATION - SPECIMEN SOURCE: ☐ Peripheral Blood ☐ Cord Blood ☐ DNA ☐ Other / / Please specify Date Collected: (MM/DD/YYYY) INDICATIONS FOR TESTING (Required) ------------- REASONS FOR TEST (family history, clinical symptoms, etc.) AND ICD9 CODES: RELEVANT CLINICAL AND LABORATORY INFORMATION: REFERRING PHYSICIAN, CERTIFIED NURSE MIDWIFE, GENETIC COUNSELOR / Name Title NPI# (Required for insurance billing) Address (Institution, Practice, Organization) (Street) ( ) - ( ) - (City) (State) (Zip) (Phone) (Fax) Name and phone of contact person regarding this sample: REPORT RESULTS TO ADDITIONAL PHYSICIAN, MIDWIFE, GENETIC COUNSELOR (IF APPLICABLE) Name Title Address (Institution, Practice, Organization) (Street) ( ) - ( ) - (City) (State) (Zip) (Phone) (Fax) BILLING INFORMATION (Required) Bill: ☐ Insurance Relationship of Patient to Insurance Holder: ☐ Self ☐ Child
    [Show full text]
  • Relevance of Electrolytic Balance in Channelopathies
    SCUOLA DI DOTTORATO UNIVERSITÀ DEGLI STUDI DI MILANO-BICOCCA University of Milano-Bicocca School of Medicine and Surgery PhD Program in Translational and Molecular Medicine XXIX PhD course Relevance of electrolytic balance in channelopathies. Dr. Anna BINDA Matr. 708721 Tutor: Dr.ssa Ilaria RIVOLTA Coordinator: prof. Andrea BIONDI Academic year 2015-2016 2 Table of contents Chapter 1: introduction Channelopathies…………………………..…………………….….p. 7 Skeletal muscle channelopathies………………………….….…...p. 10 Neuromuscular junction channelopathies………………….……..p. 16 Neurological channelopathies……………………………….……p. 17 Cardiac channelopathies………………………………………..…p. 26 Channelopathies of non-excitable tissue………………………….p. 35 Scope of the thesis…………………………………………..…….p. 44 References………………………………………………….……..p. 45 Chapter 2: SCN4A mutation as modifying factor of Myotonic Dystrophy Type 2 phenotype…………………………..………..p. 51 Chapter 3: Functional characterization of a novel KCNJ2 mutation identified in an Autistic proband.…………………....p. 79 Chapter 4: A Novel Copy Number Variant of GSTM3 in Patients with Brugada Syndrome……………………………...………..p. 105 Chapter 5: Functional characterization of a mutation in KCNT1 gene related to non-familial Brugada Syndrome…………….p. 143 Chapter 6: summary, conclusions and future perspectives….p.175 3 4 Chapter 1: introduction 5 6 Channelopathies. The term “electrolyte” defines every substance that dissociates into ions in an aqueous solution and acquires the capacity to conduct electricity. Electrolytes have a central role in cellular physiology, in particular their correct balance between the intracellular compartment and the extracellular environment regulates physiological functions of both excitable and non-excitable cells, acting on cellular excitability, muscle contraction, neurotransmission and hormone release, signal transduction, ion and water homeostasis [1]. The most important electrolytes in the human organism are sodium, potassium, magnesium, phosphate, calcium and chloride.
    [Show full text]
  • GENETIC TESTING REQUISITION Please Ship All
    GENETIC TESTING REQUISITION 1-844-363-4357· [email protected] Schillingallee 68 · 18057 Rostock Germany Attention Patient: Please visit your nearest LifeLabs or CML Healthcare Patient Service Centre for sample collection CONTRACT # LL: K012-01/ CML: CEN Report to Physician Billing # LifeLabs Demographic Label Ordering Physician Name Physician Signature: Ordering Physician Address: Tel: Fax: Address & Contact Info: Copy to (name & contact info): Name: Contact: Bill to Contract # K012-01 (patient does not pay at time of collection) Patient Gender: (M/F) Patient Name (Last, First): Patient DOB: (YYYY/MM/DD) Patient Address: Patient Health Card: Patient Telephone: Please ship all NON-PRENATAL samples to: LifeLabs · Attn CDS Department • 100 International Boulevard• Toronto ON• M9W6J6 TEST REQUESTED LL TR # / CML TC# □ Genetic Test - Blood Sample 2 x 4mL EDTA 4005 □ Genetic Test (Pediatric) - Blood Sample 1 x 2mL EDTA 4008 □ Genetic Test - Other Sample Type 4014 PRENATAL SAMPLES: Please ship directly to CENTOGENE. Date Blood Collected (YYYY/MM/DD): ___________ Time Blood Collected (HH:MM)) :________ Collector Name: ___________________ GENETIC TESTING CONSENT I understand that a DNA specimen will be sent to LifeLabs for genetic testing. My physician has told me about the condition(s) being tested and its genetic basis. I am aware that correct information about the relationships between my family members is important. I agree that my specimen and personal health information may be sent to Centogene AG at their lab in Germany (address below). To ensure accurate testing, I agree that the results of any genetic testing that I have had previously completed by Centogene AG may be shared with LifeLabs.
    [Show full text]
  • Update on the Diagnosis and Management of Familial Long QT Syndrome
    Heart, Lung and Circulation (2016) 25, 769–776 POSITION STATEMENT 1443-9506/04/$36.00 http://dx.doi.org/10.1016/j.hlc.2016.01.020 Update on the Diagnosis and Management of Familial Long QT Syndrome Kathryn E Waddell-Smith, FRACP a,b, Jonathan R Skinner, FRACP, FCSANZ, FHRS, MD a,b*, members of the CSANZ Genetics Council Writing Group aGreen Lane Paediatric and Congenital Cardiac Services, Starship Children’s Hospital, Auckland New Zealand bDepartment[5_TD$IF] of Paediatrics,[6_TD$IF] Child[7_TD$IF] and[8_TD$IF] Youth[9_TD$IF] Health,[10_TD$IF] University of Auckland, Auckland, New Zealand Received 17 December 2015; accepted 20 January 2016; online published-ahead-of-print 5 March 2016 This update was reviewed by the CSANZ Continuing Education and Recertification Committee and ratified by the CSANZ board in August 2015. Since the CSANZ 2011 guidelines, adjunctive clinical tests have proven useful in the diagnosis of LQTS and are discussed in this update. Understanding of the diagnostic and risk stratifying role of LQTS genetics is also discussed. At least 14 LQTS genes are now thought to be responsible for the disease. High-risk individuals may have multiple mutations, large gene rearrangements, C-loop mutations in KCNQ1, transmembrane mutations in KCNH2, or have certain gene modifiers present, particularly NOS1AP polymorphisms. In regards to treatment, nadolol is preferred, particularly for long QT type 2, and short acting metoprolol should not be used. Thoracoscopic left cardiac sympathectomy is valuable in those who cannot adhere to beta blocker therapy, particularly in long QT type 1. Indications for ICD therapies have been refined; and a primary indication for ICD in post-pubertal females with long QT type 2 and a very long QT interval is emerging.
    [Show full text]
  • Brugada Syndrome Versus ARVC/D Dr
    Brugada syndrome versus ARVC/D Dr. Andrés R. Pérez Riera Increasing evidence suggests the presence of structural changes affecting the right ventricular outflow tract (RVOT) in patients with Brugada Syndrome (BrS). Patients with BrS frequently exhibit structural abnormalities localized to the RVOT and these changes may be age- and gene- dependent. The BrS may represent a heterogeneous group of disorders with a unifying ECG abnormality (Gray B, Semsarian C, Sy RW.Brugada syndrome: a heterogeneous disease with a common ECG phenotype? J Cardiovasc Electrophysiol. 2014;25(4):450–6.). Mutations or loss of expression of plakophilin-2; (PKP2) leads to reduced sodium current (INa), the PKP2- INa+relation could be partly consequent to the fact that PKP2 facilitates proper trafficking of proteins to the intercalated disc, and additionally, PKP2 mutations can be present in patients diagnosed with BrS (BrS type 12) (Ishikawa T, Sato A, Marcou CA, Tester DJ, Ackerman MJ, Crotti L, et al. A novel disease gene for Brugada syndrome: sarcolemmal membrane- associated protein gene mutations impair intracellular trafficking of hNav1.5. Circulation Arrhythmia and electrophysiology. 2012;5(6):1098-107)., thus supporting the previously proposed notion that ARVC and BrS are not two completely separate entities, but "bookends" in a continuum of variable Na+current deficiency and structural disease. An overlapping disease state of BrS12 and ARVC can change phenotypically during its clinical course. Therefore, careful examination and attentive follow-up are required for patients with BrS or ARVC. Gray et al. demonstrated a high incidence of RVOT morphologic abnormalities in BrS as well as important relations between such abnormalities and clinical, genetic and electrical manifestations of disease.
    [Show full text]
  • Diagnosis, Management and Therapeutic Strategies for Congenital
    Review Diagnosis, management and therapeutic Heart: first published as 10.1136/heartjnl-2020-318259 on 26 May 2021. Downloaded from strategies for congenital long QT syndrome Arthur A M Wilde , Ahmad S Amin, Pieter G Postema Heart Centre, Department ABSTRACT Diagnosis of Cardiology, Amsterdam Congenital long QT syndrome (LQTS) is characterised The diagnosis of LQTS relies on the heart rate Universitair Medische Centra, Amsterdam, The Netherlands by heart rate corrected QT interval prolongation and corrected QT interval (QTc) and on a number of life- threatening arrhythmias, leading to syncope and other electrocardiographic parameters as well as Correspondence to sudden death. Variations in genes encoding for cardiac elements obtained by history taking (eg, symptoms Professor Arthur A M Wilde, ion channels, accessory ion channel subunits or proteins and family history). Together they form the LQTS Amsterdam Universitair modulating the function of the ion channel have been probability or Schwartz score, where a score of Medische Centra, Amsterdam, identified as disease-causing mutations in up to 75% of ≥3.5 points indicates a high probability of LQTS The Netherlands; 2 3 a. a. wilde@ amsterdamumc. nl all LQTS cases. Based on the underlying genetic defect, (figures 1 and 2). Genetic information is not LQTS has been subdivided into different subtypes. part of the Schwartz score but an individual with Received 25 January 2021 Growing insights into the genetic background and a pathogenic variant also fulfills the current diag- Revised 12 April
    [Show full text]
  • Brugada Syndrome Genetic Testing
    Lab Management Guidelines v2.0.2019 Brugada Syndrome Genetic Testing MOL.TS.261.P v2.0.2019 Introduction Brugada syndrome genetic testing is addressed by this guideline. Procedures addressed The inclusion of any procedure code in this table does not imply that the code is under management or requires prior authorization. Refer to the specific Health Plan's procedure code list for management requirements. Procedures address by this guideline Procedure codes Brugada Syndrome Known Familial 81403 Mutation Analysis SCN5A Sequencing 81407 SCN5A Deletion/Duplication Analysis 81479 Brugada Syndrome Sequencing Multigene 81413 Panel Brugada Syndrome Deletion/Duplication 81414 Panel What is Brugada syndrome Definition Brugada syndrome (BrS) is an inherited channelopathy characterized by right precordial ST elevation. This can result in cardiac conduction delays at different levels, syncope, or a lethal arrhythmia resulting in sudden cardiac death. Onset Although the typical presentation of BrS is sudden death in a male in his 40s with a previous history of syncope, BrS has been seen in individuals between the ages of 2 days and 85 years,1 as well as females.2 Diagnosis The diagnosis of BrS is based on ECG results, clinical presentation and family history. A diagnosis of either type 1, 2, or 3 ECG results with a personal history of fainting spells, ventricular fibrillation, self-terminating polymorphic ventricular tachycardia, or electrophysiologic inducibility can help identify those at risk for BrS. A family history of © eviCore healthcare. All Rights Reserved. 1 of 7 400 Buckwalter Place Boulevard, Bluffton, SC 29910 (800) 918-8924 www.eviCore.com Lab Management Guidelines v2.0.2019 syncope, coved-type ECGs, or sudden cardiac death, especially in an autosomal dominant inheritance pattern, can help aid in the diagnosis.3,4 Cause BrS has been associated with at least 16 different genes and >400 mutations,3,5-7 and is estimated to be seen in about 1 in 2000 individuals.
    [Show full text]