DOCSLIB.ORG

United States Patent (19) 11 Patent Number: 5,338,683 Paoletti (45) Date of Patent: "Aug

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
United States Patent (19) 11 Patent Number: 5,338,683 Paoletti (45) Date of Patent: USOO5338683A United States Patent (19) 11 Patent Number: 5,338,683 Paoletti (45) Date of Patent: "Aug. 16, 1994 54 VACCINIAVIRUS CONTAINING DNA SEQUENCES ENCODING HERPESVIRUS FOREIGN PATENT DOCUMENTS GLY COPROTEINS 0261940 3/1988 European Pat. Off. 9001546 2/1990 PCT Int'l Appl. 75) Inventor: Enzo Paoletti, Albany, N.Y. OTHER PUBLICATIONS 73) Assignee: Health Research Incorporated, Muller et al (1977) J. Gen. Virol. 38, 135-147. Albany, N.Y. Piccini et al (1987) Meth. Enzymol 153, 545-563. Taylor et al (1988) Vaccine 6, 497-507. * Notice: The portion of the term of this patent Perkus et al (1985) Science 229, 981-984. subsequent to Jul. 29, 2003 has been Allen et al. (1987) J. Virol. 61,2454-2461. disclaimed. Piccini et al., Bioessays (Jun. 1986) vol. 5, No. 6, 248-52, at 248. 21 Appl. No.: 502,834 Elliot et al., J. Gen. Virol. (1991), 72, 1762–79, at 1763. Boyle, D. B. et al., J. Gen. Virol. (1986), 67, 1591-1600. 22 Filed: Apr. 4, 1990 Guo et al., J. of Virology, vol. 64, No. 5, pp. 2399-2406 (1990). Related U.S. Application Data Guo et al., J. of Virology, vol. 63, No. 10, pp. 4189-4198 60 Continuation-in-part of Ser. No. 394,488, Aug. 16, (1989). 1989, abandoned, and Ser. No. 90,209, Aug. 27, 1987, Primary Examiner-Elizabeth C. Weimar abandoned, which is a division of Ser. No. 622,135, Assistant Examiner-Deborah Crouch Jun. 9, 1984, Pat. No. 4,722,848, which is a continua Attorney, Agent, or Firm-Curtis, Morris & Safford tion-in-part of Ser. No. 446,824, Dec. 8, 1982, Pat. No. 4,603,112, which is a continuation-in-part of Ser. No. 57 ABSTRACT 334,456, Dec. 24, 1981, Pat. No. 4,769,330, said Ser. What is described is a recombinant poxvirus, such as No. 394,488, is a continuation-in-part of Ser. No. vaccinia virus, fowlpox virus and canarypox virus, con 339,004, Apr. 17, 1989, abandoned. taining foreign DNA from herpesvirus. In one embodi ment, the foreign DNA is expressed in a host by the 51) Int. Cli.............................................. C12N 15/00 production of a herpesvirus glycoprotein. In another 52 U.S. C. .............................. 435/320.1; 435/172.3; embodiment, the foreign DNA is expressed in a host by 135/32 the production of at least two, particularly two or three, 58) Field of Search ................... 435/320.1, 69.1, 76.1, herpesvirus glycoproteins. What is also described is a 435/76.3 vaccine containing the recombinant poxvirus for induc ing an immunological response in a host animal inocu 56 References Cited lated with the vaccine. By the present invention, the U.S. PATENT DOCUMENTS barrier of maternal immunity in a newborn offspring 4,603,112 7/1986 Paoletti et al. can be overcome or avoided. 4,722,848 2/1988 Paoletti et al. 4,769,330 9/1988 Paoletti et al. 12 Claims, 83 Drawing Sheets U.S. Patent Aug. 16, 1994 Sheet 1 of 83 5,338,683 VACCNA RIGHT TERMINUS pUC8 Sal LIGATE EcoRI. Ecor. pSD49VC HindIII HindII SmaI Hind BamHISmaI r Sal - BalSal Sal (Ø Rsa 2 Eag Real \2 Eag Reg PARTA '" indi Rsa g KNASE 9 MPSYN59-62 Pst NGATE SYNTHETIC Eagi DNA Ban VP425 - he 4- - VC-2 U.S. Patent Aug. 16, 1994 Sheet 4 of 83 5,338,683 m3mpt 9 p SD466VC Nar Ban/EcoRI. EcoRI EcoRIEHVigp3N \ r E.LIGATE Nar anime Hind LIGATE pSD467VC Pst MUTAGENESIS Smal Bg Sail SmaIMHindIII Bg|II/HindII. ISOLATED FRAGMENTs- he promoter EcoRINar É pUC3 LIGATE, EcoRV LIGATE Na r m Hind SYPstI (V BgCO Smal Sal Nsi NKER GATE Pst KY EcoRI Nar (NERy. Nsi Bg Sai F. G. 3 Sal Bg EcoRV vP483 enouilliamsvp425 IN VIVO RECOMBINATION LIGATE pVHA6g 13 U.S. Patent Aug. 16, 1994 Sheet 5 of 83 5,338,683 F. G. 4 pUC8 Pio Hindi Sph I Bg Hindi Hind BamH pMP4O9BVC Bg EcoR LIGATE Hind (WncoR Bi SailH Sph Pst Sphi Hind Ba3 MUTAGENESS pMP4O9DVC Hindi i S-2EcoRI Bg Bgll Smal LIGATE WP458 VP4O U.S. Patent Aug. 16, 1994 Sheet 6 of 83 5,338,683 pUC8 EcoR Barn pUC8 RNBamh AEYBam Barnh LIGATE Konp Pst EcoR V EcoR Barnh ? Barn EcoR pUCCBamHI-D UCCBaraH - Pst N Pt Banh a/EcoRI) lice BLUESCRIPT Kpni SK+ Ness pUCCBamHIMPst \ ) Kpn 2N Nsi pUC- 8 KpniP W t Nsi BLUECKpnM Bamh VAT. EcoRi Bamhi El Barnh) BinhKpn S9, EcoR PMP409DVSR: FRAGMENTpucckoi/BamHis SE LIGATE EcoR Kpn C Nsi Bg NVMO RECOMBINATION -VP458 -o- vP577 U.S. Patent Aug. 16, 1994 Sheet 8 of 83 5,338,683 243 TGGGGTGGATGCCATGGAGGCACTACACGTCAACGTCTGTCAACTGCATCGTCGAGG W G W M P W R H Y T S T S W N C W E 1254 AGGTGGAGGCGCGGTCCGTCTACCCCTACGACTCCTTCGCCCTGTCCACCGGTGATA E W E A R S W Y P Y D S F A L S T G D 28 TTGTGTACGCGTCTCCGTTTTACGGCCTGAGGGCTGCCGCTCGCATAGAGCACAATA W Y A S P F Y G L R A A. A R E H N 1368 GCTACGCGCAGGAGCGTTTCAGGCAAGTTGAAGGGTACAGGCCCCGCGACTTAGACA S Y A Q E R F R Q W E G Y R P R D L D 39 GTAAACTACAAGCCGAAGAGCCGGTTACCAAAAATTTTATCACTACCCCGCATGTCA S K L Q A E E P W T K N F I T T P H. W. 1482 CCGTCAGCTGGAACTGGACCGAGAAGAAAGTCGAGGCGTGTACGCTGACCAAATGGA T W S W N W T E K K W E A C T L T K W 357 k AAGAGGTCGACGAACTCGTCAGGGACGAGTTCCGCGGGTCCTACAGATTTACTATTC K E W D E L W R D E. F. R. G. S Y R F T 1596 GATCCATCTCGTCTACGTTTATCAGTAACACTACTCAATTTAAGTTGGAAAGTGCCC R S I S S T F I S N T T Q F K L E S A 395 CCCTTACTGAATGTGTATCCAAAGAAGCAAAGGAAGCCATAGACTCGATATACAAAA P L T E C W S K E A K E A I D S I Y K 1710 AGCAGTACGAGTCTACGCACGTCTTTAGCGGTGATGTGGAATATTACCTGGCACGCG K Q Y E S T H W F S G D V E Y Y L. A R 433 GGGGGTTCTTAATTGCATTCAGACCTATGCTCTCCAACGAACTCGCCAGGCTGTACC G G F L A F R P M L S N E L A R L. Y 824 TGAACGAGCTTGTGAGATCTAACCGCACCTACGACCTAAAAAATCTATTGAACCCCA L N E L W R S N R T Y D L. K. N. L. L. N. P 47 ATGCAAACAATAACAATAACACCACGCGAAGACGCAGGTCTCTCCTGTCAGTACCAG N A N N N N N T T R R. R. R S L L S W P 1938 AACCTCAGCCAACCCAAGATGGTGTGCATAGAGAACAAATTCTACATCGCTTGCACA E P Q. P T Q D G W H R E Q I L H R L. H 509 AACGAGCAGTGGAGGCAACGGCAGGTACCGATTCTTCCAACGTCACCGCCAAACAGC K R A V E A T A G T D S S N W T A K Q t 2052 TGGAGCTCATCAAAACCACGTCGTCTATCGAGTTTGCCATGCTACAGTTTGCATACG L. E L I K T T S S I E F A M L Q F A Y 547 ATCACATCCAATCCCACGTCAATGAAATGCTAAGTAGAATAGCAACTGCGTGGTGTA D H I Q S H V N E M L S R I. A T A W C 266 CCCTCCAAAACAAAGAGCGGACCCTATGGAACGAAATGGTGAAGATTAACCCGAGCG T L Q N K E R T L W N E M W K I N P S F.G. 6B U.S. Patent Aug. 16, 1994 Sheet 10 of 83 5,338,683 s3 3. s s RELATIVE HYDROPHILICITY U.S. Patent Aug. 16, 1994 Sheet 11 of 83 5,338,683 Pyu Niru IMHindIIIah -E.---- HindiiTO AEALED 35 35 EATDES HindIII is 5 & 2CE AND CE NiruNr. KIKpn - E. Pyu I : CD NI. Bamh MPst s 4. Bgi Pati Pst 16ATE fift TTTTTTTTT - 2)BIOGESTION b 3)RELIGATE 4)MUMGENTE WITH Pyu I OLIGONUCLEATDES HindIIIMNI FPCV AND FPVC3 HindIII sy Niru pFPEHVBA EcoRI Pyu I HindII/KpnI KpnI 2)BLUNT-END HISS" initi/NKERS ap Nui 29. Pvu 5)SOLATE 20Obp vFP44 - - HindIII/KpnI FRAGMENT N VIVO RECOMBINATION U.S. Patent Aug. 16, 1994 Sheet 12 of 83 5,338,683 Kpn/HpaI 2)BLUNT-END 3)SOLATE FRAGMENT t2OObp U.S. Patent Aug. 16, 1994 Sheet 13 of 83 5,338,683 FIG. O Construction of plasmids containing EHV-1 gp14 odification of the 5' end of EHV-l 4. Nsi. pVM2LH6g14 -> plMP14M MPSYN240 mutagenesis Neil pVM2LH6gl4-1 -> p-P14M-34 MPSYN24l mutagenesis Nae (partial)/NSI pVM2LH6gl4-1 -> pAP14M-63 MPSYN243 mutagenesis Removal of extraneous EHV-1 DNA Drai (partial)/Pst pMPl4M-63 -> pip14M-63P MPSYN247/MPSYN248 Movement of H6 promoter/EHV-1 14 to OEES syst NiruI (partial) /XhoI pHES-4 > pHES-MP63 Niru I (partial) /XhoI pMP14M-63P isolate 2.8 kb fragment Replacement of gp14 leader with different lengths Niru (partial) pHES-MP63 isolate 7.2 kb fragment > pHES-MP1 Niru pMP14M isolate 2.8 kb fragment Niru (partial) pHES-MP63 isolate 7.2 kb fragment > pHES-MP34 NI pMP14M-34 isolate 2.7 kb fragment U.S. Patent Aug. 16, 1994 Sheet 14 of 83 5,338,683 E U.S. Patent Aug. 16, 1994 Sheet 15 of 83 5,338,683 oLoLLooLowÐLLIÐoovewooowowoowowwowowowoLBB????wOLOOÐVI???OJBOJNo.b??voT U.S. Patent Aug. 16, 1994 Sheet 17 of 83 5,338,683 69 28 LZT OST ?MIAVÌXIWCIOJI,?Ãows?ITATATSITIVI ICISHSOWVI(I"IXI?INOWXSAC?H IIIpu?H LT VNK&J."IIJ,XN&Xd.HCIÕ gOT±? I&LVIoaWXIàM.J."IH\'SXJ,ÕVV’ U.S. Patent Aug. 16, 1994 Sheet 19 of 83 5,338,683 ZO? 6 TIE S?iW.(?)SI,"IXIVI IIIpu?IH ?I"IÕL:XXIA.CIàI,SHIL'I?NÕVSX SWHCI?ÀIXI+wg?SOTTIV,W,s«IFIIVÌVI 60TZ LLTZ U.S. Patent Aug. 16, 1994 Sheet 22 of 83 5,338,683 ALZ ZAL 09.* T,‘INQHXI5)INICI?IO"ISHAXI IeTO 1,898 909€. €1,9€. 6088 U.S. Patent Aug. 16, 1994 Sheet 25 of 83 5,338,683 08?y 929 CISSIVÌ"IAICI(IA?ISdi A&ÕX"I?IVÌXI&X"I?ICIS »?l914 Z99 •••XI“IIS 6919 90£9 £1,09 Tyws 6099 ALL99 g?799 U.S.
Load more

Recommended publications
  • Genetic Snapshots of the Rhizobium Species NGR234 Genome
    Article Genetic snapshots of the Rhizobium species NGR234 genome VIPREY, Virginie, et al. Abstract In nitrate-poor soils, many leguminous plants form nitrogen-fixing symbioses with members of the bacterial family Rhizobiaceae. We selected Rhizobium sp. NGR234 for its exceptionally broad host range, which includes more than I 12 genera of legumes. Unlike the genome of Bradyrhizobium japonicum, which is composed of a single 8.7 Mb chromosome, that of NGR234 is partitioned into three replicons: a chromosome of about 3.5 Mb, a megaplasmid of more than 2 Mb (pNGR234b) and pNGR234a, a 536,165 bp plasmid that carries most of the genes required for symbioses with legumes. Symbiotic loci represent only a small portion of all the genes coded by rhizobial genomes, however. To rapidly characterize the two largest replicons of NGR234, the genome of strain ANU265 (a derivative strain cured of pNGR234a) was analyzed by shotgun sequencing. Reference VIPREY, Virginie, et al. Genetic snapshots of the Rhizobium species NGR234 genome. Genome Biology, 2000, vol. 1, no. 6, p. 1-17 DOI : 10.1186/gb-2000-1-6-research0014 PMID : 11178268 Available at: http://archive-ouverte.unige.ch/unige:84778 Disclaimer: layout of this document may differ from the published version. 1 / 1 http://genomebiology.com/2000/1/6/research/0014.1 Research Genetic snapshots of the Rhizobium species NGR234 genome Virginie Viprey*, André Rosenthal, William J Broughton* and Xavier Perret* Addresses: *Laboratoire de Biologie Moléculaire des Plantes Supérieures, Université de Genève, chemin de lImpératrice, 1292 Chambésy, Genève, Switzerland. Institut für Molekulare Biotechnologie, Abteilung Genomanalyze, Beutenbergstrasse, 07745 Jena, Germany.
    [Show full text]
  • 2.2.3 Generation of Genomic DNA Sequences from Plant Sources
    Copyright Undertaking This thesis is protected by copyright, with all rights reserved. By reading and using the thesis, the reader understands and agrees to the following terms: 1. The reader will abide by the rules and legal ordinances governing copyright regarding the use of the thesis. 2. The reader will use the thesis for the purpose of research or private study only and not for distribution or further reproduction or any other purpose. 3. The reader agrees to indemnify and hold the University harmless from and against any loss, damage, cost, liability or expenses arising from copyright infringement or unauthorized usage. IMPORTANT If you have reasons to believe that any materials in this thesis are deemed not suitable to be distributed in this form, or a copyright owner having difficulty with the material being included in our database, please contact [email protected] providing details. The Library will look into your claim and consider taking remedial action upon receipt of the written requests. Pao Yue-kong Library, The Hong Kong Polytechnic University, Hung Hom, Kowloon, Hong Kong http://www.lib.polyu.edu.hk The Hong Kong Polytechnic University Department of Health Technology and Informatics Isolation and Characterisation of Nucleases from Various Biological Sources for Further Application in Nucleic Acid Analysis By CHEUNG Tsz Shan A thesis submitted in partial fulfilment of the requirements for the degree of Doctor of Philosophy March 2012 CERTIFICATE OF ORIGINALITY I hereby declare that this thesis is my own work and that, to the best of my knowledge and belief, it reproduces no materials previously published or written, nor material that has been accepted for the award of any other degree or diploma, except where due acknowledgment has been made in the text.
    [Show full text]
  • Mung Bean Nuclease Product Information
    Certificate of Analysis Mung Bean Nuclease: Part No. Size (units) Part# 9PIM431 M431A 2,000 Revised 4/18 10X Reaction Buffer (M432A): When the Mung Bean Nuclease 10X Reaction Buffer, provided with this enzyme, is diluted 1:10, it has a composition of 0.03M sodium acetate (pH 5.0), 0.05M NaCl and 1mM ZnCl2. Enzyme Storage Buffer: Mung Bean Nuclease is supplied in 10mM Tris-HCl (pH 7.5), 50mM NaCl, 0.01% Triton® X-100 and 50% glycerol. Source: Mung bean sprouts (Phaseolus aureus). Unit Definition: One unit is defined as the amount of enzyme required to produce 1µg of acid-soluble material per minute *AF9PIM431 0418M431* at 37°C. The reaction conditions are: 30mM sodium acetate (pH 5.0), 50mM NaCl, 1mM ZnCl2, 5% glycerol and 0.5mg/ml AF9PIM431 0418M431 denatured calf thymus DNA. See the unit concentration on the Product Information Label. Storage Temperature: Store at –20°C. Avoid multiple freeze-thaw cycles and exposure to frequent temperature changes. See the expiration date on the Product Information Label. Quality Control Assays Contaminant Assay Endonuclease/Nickase Activity: To confirm the absence of contaminating endonuclease/nickase activity, 1µg of lambda DNA/Hind III markers (Cat.# G1711) is incubated with Mung Bean Nuclease for 10 minutes at room temperature. The mark- ers are then separated by electrophoresis on a 1% agarose gel and stained with ethidium bromide. Markers that have been Promega Corporation incubated with ≥60 units of enzyme will remain as intact bands with a minimal amount of smearing. 2800 Woods Hollow Road Madison, WI 53711-5399 USA Telephone 608-274-4330 Toll Free 800-356-9526 Fax 608-277-2516 Internet www.promega.com PRODUCT USE LIMITATIONS, WARRANTY, DISCLAIMER Promega manufactures products for a number of intended uses.
    [Show full text]
  • O-Alkyl Oligoribonucleotides As Antisense Probes (Modified RNA/Afnity Selection/Ribonudeoprotein Couiplexes/Oligonucleotide Synthesis/Biotinylation) ADOLFO M
    Proc. Nail. Acad. Sci. USA Vol. 87, pp, 7747-7751, October 1990 Biochemistry 2'-O-Alkyl oligoribonucleotides as antisense probes (modified RNA/afnity selection/ribonudeoprotein couiplexes/oligonucleotide synthesis/biotinylation) ADOLFO M. IRIBARREN*, BRIAN S. SPROAT, PHILIPPE NEUNER*, INGRID SULSTON, URSULA RYDER, AND ANGUS 1. LAMOND European Molecular Biology Laboratory, Meyerhofstrasse 1, Postfach 102209, D6900 Heidelberg 1, Federal Republic of Germany Communicated by J. A. Steitz, July 3, 1990 (receivedfor review May 1, 1990) ABSTRACT 2'-O-Methyl oligoribonucleotides have re- cently been introduced as antisense probes for studying RNA processing and for affinity purification of RNA-protein com- plexes. To identify RNA analogues with improved properties for antisense analysis, 2'--alkyl oligoribonucleotides were synthesized in which the alkyl moiety was either the three- carbon linear allyl group or the five-carbon branched 3,3- dimethylallyl group. Both these analogues were found to be completely resistant to degradation by either DNA- or RNA- specific nucleases. Use of biotinylated derivatives of the probes to affinity-select ribonucleoprotein particles from crude HeLa cell nuclear extracts showed that the presence of the bulky L i3 3,3-dimethylallyl group significantly reduces affinity selection, -o'r\- .. whereas the allyl derivative binds rapidly and stably to targeted sequences and affinity-selects efficiently. The allyl derivatives also showed an increase in the level of specific binding to targeted sequences compared with 2'-0-methyl probes of iden- tical sequence. These properties indicate that the 2'-0-allyl oligoribonucleotides are particularly well suited for use as HO OR antisense probes. S H Chemically synthesized 2'-O-methyl oligoribonucleotides, as R NH described by Ohtsuka and Morisawa and coworkers (1-6) and by Sproat et al.
    [Show full text]
  • Research Doctorate School in Biomolecular Sciences Doctorate
    BIOS Research Doctorate School in BIOmolecular Sciences Doctorate Course in Molecular Biotechnology PhD Thesis Programmed cell death in the megagametophyte of Araucaria bidwillii Hook. post-germinated seeds Student: Dr. SIMONE CASANI Supervisor: Prof. Luciano Galleschi - TABLE OF CONTENTS - ABSTRACT ...............................................................................................................................................5 LIST OF ABBREVIATIONS ...................................................................................................................8 1. INTRODUCTION ................................................................................................................................9 1.1. PROGRAMMED CELL DEATH ....................................................................................... 9 1.2. THE SIGNIFICANCE OF PROGRAMMED CELL DEATH ........................................ 11 1.3. MOLECULAR MECHANISMS OF APOPTOSIS .......................................................... 12 1.4. CASPASES (CYSTEINE ASPARTATE-SPECIFIC PROTEASES) .............................. 17 1.5. MORPHOLOGICAL AND BIOCHEMICAL FEATURES OF APOPTOSIS ............... 20 1.6. PROGRAMMED CELL DEATH IN PLANTS ................................................................ 22 1.6.1. Defence PCD ............................................................................................................... 23 1.6.2. Developmental PCD ...................................................................................................
    [Show full text]
  • DU Msc Microbiology
    DU MSc Microbiology Topic:‐ MICRO MSC S2 1) The virus which was used in the Hershey‐Chase experiment to prove that DNA is the genetic material, belong to the genus: [Question ID = 3392] 1. T1 virus [Option ID = 13562] 2. T2 virus [Option ID = 13563] 3. T3 virus [Option ID = 13564] 4. T4 virus [Option ID = 13565] Correct Answer :‐ T4 virus [Option ID = 13565] 2) High partition coefficient during the liquid‐liquid extraction process for product recovery implicates: [Question ID = 3393] 1. Difficulty in the extraction process [Option ID = 13566] 2. Higher product degradation [Option ID = 13567] 3. No effect on the extraction process [Option ID = 13568] 4. Ease of extraction [Option ID = 13569] Correct Answer :‐ Ease of extraction [Option ID = 13569] 3) Numerical aperture of an oil immersion objective lens is around: [Question ID = 3394] 1. 0.65 [Option ID = 13570] 2. 0.85 [Option ID = 13571] 3. 1.33 [Option ID = 13572] 4. 1.03 [Option ID = 13573] Correct Answer :‐ 1.33 [Option ID = 13572] 4) Which one of the following statements is incorrect? [Question ID = 3395] 1. RNA polymerase III uses internal promoters located within the transcription unit [Option ID = 13574] 2. RNA polymerase II synthesizes mRNAs [Option ID = 13575] 3. RNA polymerase I synthesizes tRNAs [Option ID = 13576] 4. RNA polymerase III synthesizes small RNAs [Option ID = 13577] Correct Answer :‐ RNA polymerase I synthesizes tRNAs [Option ID = 13576] 5) An icosahedron structure of virus particle is made of: [Question ID = 3396] 1. 20 vertices, 12 edges, 30 faces [Option ID = 13578] 2. 20 edges, 12 faces, 30 vertices [Option ID = 13579] 3.
    [Show full text]
  • POLSKIE TOWARZYSTWO BIOCHEMICZNE Postępy Biochemii
    POLSKIE TOWARZYSTWO BIOCHEMICZNE Postępy Biochemii http://rcin.org.pl WSKAZÓWKI DLA AUTORÓW Kwartalnik „Postępy Biochemii” publikuje artykuły monograficzne omawiające wąskie tematy, oraz artykuły przeglądowe referujące szersze zagadnienia z biochemii i nauk pokrewnych. Artykuły pierwszego typu winny w sposób syntetyczny omawiać wybrany temat na podstawie możliwie pełnego piśmiennictwa z kilku ostatnich lat, a artykuły drugiego typu na podstawie piśmiennictwa z ostatnich dwu lat. Objętość takich artykułów nie powinna przekraczać 25 stron maszynopisu (nie licząc ilustracji i piśmiennictwa). Kwartalnik publikuje także artykuły typu minireviews, do 10 stron maszynopisu, z dziedziny zainteresowań autora, opracowane na podstawie najnow­ szego piśmiennictwa, wystarczającego dla zilustrowania problemu. Ponadto kwartalnik publikuje krótkie noty, do 5 stron maszynopisu, informujące o nowych, interesujących osiągnięciach biochemii i nauk pokrewnych, oraz noty przybliżające historię badań w zakresie różnych dziedzin biochemii. Przekazanie artykułu do Redakcji jest równoznaczne z oświadczeniem, że nadesłana praca nie była i nie będzie publikowana w innym czasopiśmie, jeżeli zostanie ogłoszona w „Postępach Biochemii”. Autorzy artykułu odpowiadają za prawidłowość i ścisłość podanych informacji. Autorów obowiązuje korekta autorska. Koszty zmian tekstu w korekcie (poza poprawieniem błędów drukarskich) ponoszą autorzy. Artykuły honoruje się według obowiązujących stawek. Autorzy otrzymują bezpłatnie 25 odbitek swego artykułu; zamówienia na dodatkowe odbitki (płatne) należy zgłosić pisemnie odsyłając pracę po korekcie autorskiej. Redakcja prosi autorów o przestrzeganie następujących wskazówek: Forma maszynopisu: maszynopis pracy i wszelkie załączniki należy nadsyłać w dwu egzem­ plarzach. Maszynopis powinien być napisany jednostronnie, z podwójną interlinią, z marginesem ok. 4 cm po lewej i ok. 1 cm po prawej stronie; nie może zawierać więcej niż 60 znaków w jednym wierszu nie więcej niż 30 wierszy na stronie zgodnie z Normą Polską.
    [Show full text]
  • Role of Cytosolic, Tyrosine‐Insensitive Prephenate Dehydrogenase in Medicago Truncatula
    Received: 13 September 2019 | Revised: 21 March 2020 | Accepted: 25 March 2020 DOI: 10.1002/pld3.218 ORIGINAL RESEARCH Role of cytosolic, tyrosine-insensitive prephenate dehydrogenase in Medicago truncatula Craig A. Schenck1 | Josh Westphal1 | Dhileepkumar Jayaraman2 | Kevin Garcia2,3 | Jiangqi Wen4 | Kirankumar S. Mysore4 | Jean-Michel Ané2,5 | Lloyd W. Sumner6,7 | Hiroshi A. Maeda1 1Department of Botany, University of Wisconsin-Madison, Madison, WI, USA Abstract 2Department of Bacteriology, University of L-Tyrosine (Tyr) is an aromatic amino acid synthesized de novo in plants and microbes Wisconsin-Madison, Madison, WI, USA downstream of the shikimate pathway. In plants, Tyr and a Tyr pathway interme- 3Department of Crop and Soil Sciences, North Carolina State University, Raleigh, diate, 4-hydroxyphenylpyruvate (HPP), are precursors to numerous specialized me- NC, USA tabolites, which are crucial for plant and human health. Tyr is synthesized in the 4 Noble Research Institute, LLC., Ardmore, plastids by a TyrA family enzyme, arogenate dehydrogenase (ADH/TyrA ), which is OK, USA a feedback inhibited by Tyr. Additionally, many legumes possess prephenate dehydro- 5Department of Agronomy, University of Wisconsin-Madison, Madison, WI, USA genases (PDH/TyrAp), which are insensitive to Tyr and localized to the cytosol. Yet 6 Department of Biochemistry, University of the role of PDH enzymes in legumes is currently unknown. This study isolated and Missouri, Columbia, MO, USA characterized Tnt1-transposon mutants of MtPDH1 (pdh1) in Medicago truncatula to 7Metabolomics and Bond Life Sciences Centers, University of Missouri, Columbia, investigate PDH function. The pdh1 mutants lacked PDH transcript and PDH activ- MO, USA ity, and displayed little aberrant morphological phenotypes under standard growth Correspondence conditions, providing genetic evidence that MtPDH1 is responsible for the PDH ac- Hiroshi A.
    [Show full text]
  • Lab FAQ from Roche
    Great information – compact format – the RAS Lab FAQS, 3rd edition Dear Valued Customer, At Roche Applied Science, we know that time is an increasingly scarce resource these days. Relevant information, available at your fingertips at the right time and in an easily accessible format can help you perform your experiments more efficiently. Based upon requests from many different customers, Roche Applied Science has updated Lab FAQS. We hope you find this new compendium of information even more useful for your laboratory work. Think of the Lab FAQS as our way of saying “Thank you” for using our reagents, kits and systems over the years. We wish you continued success in your research projects. Sincerely Roche Applied Science PS: To offer comments and/or suggestions on content, structure and/or layout of this guide, please don’t hesitate to contact Bettina Kruchen (e-mail: [email protected]) or your local representative. Your cooperation in improving Lab FAQs is highly appreciated. Acknowledgements: We thank all contributors and editors for their diligent efforts during the proofreading and production of this book. Without their help, this project would never have been realized. Editorial management 3rd edition: Critical reading of the manuscript: Doris Eisel, Design and Layout Yair Argon, University of Chicago, USA Urs W. Hoffmann-Rohrer, DKFZ , Heidelberg, Editor in Chief Hans-Joachim Degen, RAS, Germany Bettina Kruchen, Editor in Chief Ingrid Hoffmann, DKFZ, Heidelberg, Germany Paul Labaere, Scientific Advice Jürgen Kartenbeck, DKFZ,
    [Show full text]
  • Tecnologia Do DNA Recombinante Histórico
    Tecnologia do DNA recombinante Histórico Em 1953 James Watson e Francis Crick, descreveram o DNA como uma dupla fita, enrolada em hélice ao redor de um eixo, sendo as fitas antiparalelas. Elucidação do código genético O Dogma Central da Biologia Molecular Tecnologia de DNA recombinante Ferramentas para o estudo da genética de qualquer organismo Isolamento, clonagem expressão genes de diferentes organismos. Como conseqüência : -O estudo de cada gene individualmente ou em genomas -A obtenção de proteínas recombinantes -Estudar a função dos genes Clonagem Molecular Fragmentos de DNA de interesse Vetores: Plasmídeos Hospedeiros: Fagos E.coli Cosmídeos Levedura BACs/ YACs Células vegetais Vírus Células animais Enzimas: Enzimas de restrição DNA polimerases DNA ligases Topoisomerases Fosfatases ENZIMAS Enzimas que quebram ligações Enzimas que ligam DNA: fosfodiester em RNA e DNA: A. E.coli DNA Ligase A.Endonucleases B. T4 DNA Ligase 1- Enzimas de restrição: tipo I, II e III C. T4 RNA Ligase 2- Deoxyribonlucleases 3- Ribonucleases Enzimas que sintetizam novas ligações: B. Exonucleases A. DNA polimerase I C. Endonucleases e Exonucleases B. Fragmento grande de DNA polimerase I C. T4 DNA polimerase D. T7 DNA polimerase modificada E.Taq DNA polimerase F. RNA polimerases G. Transcriptase Reversa Enzimas que trabalham em fosfatos H. Terminal Deoxinucletil Transferase terminais de DNA e RNA : A. T4 polinucleotídeo Kinase B. fosfatase alcalina Enzimas que protegem o DNA: A. DNA metilases B. Proteínas de ligação a DNA simples fita C. Topoisomerases Histórico Isolamento de DNA polimerase de E.coli – Arthur Kornberg in 1958. Primeira ferramenta para manipulação do DNA in vitro Necessidade de entendimento detalhado da natureza do material genético sugiram as DNA polimerases, fosfatases, fosforilases e transferases Histórico W.
    [Show full text]
  • An Auxiliary Mode of Apoptotic DNA Fragmentation Provided by Phagocytes
    Downloaded from genesdev.cshlp.org on September 25, 2021 - Published by Cold Spring Harbor Laboratory Press An auxiliary mode of apoptotic DNA fragmentation provided by phagocytes Dorian McIlroy,1,2 Masato Tanaka,1,2 Hideki Sakahira,1,2 Hidehiro Fukuyama,1,2 Misao Suzuki,3 Ken-ichi Yamamura,3 Yoshiyuki Ohsawa,4 Yasuo Uchiyama,4 and Shigekazu Nagata1,2,5 1Department of Genetics, and 4Cell Biology and Anatomy, Osaka University Medical School, and 2Core Research for Evolutional Science and Technology, Japan Science and Technology Corporation, Suita, Osaka 565-0871, Japan; 3Institute of Molecular Embryology and Genetics, Kumamoto University School of Medicine, Kumamoto 862-0976, Japan CAD (caspase-activated DNase) can cause DNA fragmentation in apoptotic cells. Transgenic mice that ubiquitously express a caspase-resistant form of the CAD inhibitor (ICAD) were generated. Thymocytes prepared from the mice were resistant to DNA fragmentation induced by a variety of stimuli. However, similar numbers of TUNEL-positive cells were present in adult tissues of transgenic and wild-type mice. Exposure to ␥-irradiation caused a striking increase in the number of TUNEL-positive cells in the thymus of wild-type, but not transgenic, mice. TUNEL-positive nuclei in transgenic mice were confined to thymic macrophages. When apoptotic thymocytes from the transgenic mice were cocultured with macrophages, the thymocytes underwent phagocytosis and their chromosomal DNA underwent fragmentation. This DNA fragmentation was sensitive to inhibitors that block the acidification of lysosomes. Hence, we conclude that the DNA fragmentation that occurs during apoptosis not only can result cell-autonomously from CAD activity but can also be attributed to a lysosomal acid DNase(s), most likely DNase II, after the apoptotic cells are engulfed.
    [Show full text]
  • Dictionary of DNA and Genome Technology, Second Edition
    Dictionary of DNA and Genome Technology Second Edition Paul Singleton A John Wiley & Sons, Ltd., Publication Dictionary of DNA and Genome Technology Second Edition Dictionary of DNA and Genome Technology Second Edition Paul Singleton A John Wiley & Sons, Ltd., Publication Ó 2010 Paul Singleton First edition 2008 Second edition 2010 Wiley-Blackwell is an imprint of John Wiley & Sons, formed by the merger of Wiley’s global Scientific, Technical and Medical business with Blackwell Publishing. Registered office: John Wiley & Sons Ltd, The Atrium, Southern Gate, Chichester, West Sussex, PO19 8SQ, UK Other Editorial Offices: 9600 Garsington Road, Oxford, OX4 2DQ, UK 111 River Street, Hoboken, NJ 07030-5774, USA For details of our global editorial offices, for customer services and for information about how to apply for permission to reuse the copyright material in this book please see our website at www.wiley.com/wiley-blackwell The right of the author to be identified as the author of this work has been asserted in accordance with the Copyright, Designs and Patents Act 1988. All rights reserved. No part of this publication may be reproduced, stored in a retrieval system, or transmitted, in any form or by any means, electronic, mechanical, photocopying, recording or otherwise, except as permitted by the UK Copyright, Designs and Patents Act 1988, without the prior permission of the publisher. Wiley also publishes its books in a variety of electronic formats. Some content that appears in print may not be available in electronic books. Designations used by companies to distinguish their products are often claimed as trademarks.
    [Show full text]