Genomic Structure of the Human ING1 Gene and Tumor-Specific Mutations Detected in Head and Neck Squamous Cell Carcinomas1

[CANCER RESEARCH 60, 3143–3146, June 15, 2000] Advances in Brief Genomic Structure of the Human ING1 Gene and Tumor-specific Mutations Detected in Head and Neck Squamous Cell Carcinomas1 Mehmet Gunduz, Mamoru Ouchida, Kunihiro Fukushima, Hiroko Hanafusa, Tsutomu Etani, Shinji Nishioka, Kazunori Nishizaki, and Kenji Shimizu2 Department of Otolaryngology [M. G., K. F., T. E., S. N., K. N.] and Department of Molecular Genetics, Institute of Cellular and Molecular Biology [M. O., H. H., K. S.], Okayama University Medical School, Okayama 700-8558, Japan Abstract patient. All tissues were frozen in liquid nitrogen immediately after surgery and stored at Ϫ80°C until the extraction of DNA and RNA. Histological We characterized the genomic structure of the human ING1 gene, a studies were also performed at the Department of Pathology, and all tumors candidate tumor suppressor gene, and found that the gene has three were confirmed as squamous cell carcinoma. exons. We also demonstrated that four mRNA variants were transcribed DNA and RNA Extraction. Genomic DNAs were isolated from frozen from three different promoter regions. Of 34 informative cases of head tissues by SDS/proteinase K treatment, phenol-chloroform extraction, and ethanol and neck squamous cell carcinoma, 68% of tumors showed loss of het- precipitation. Total RNAs were prepared by using a modified acid guanidinium erozygosity at chromosome 13q33–34, where the ING1 gene is located. phenol chloroform method (ISOGEN; Nippon Gene Co., Tokyo, Japan). Here we present the first report that three missense mutations and three Microsatellite Analysis. Primers for amplification of microsatellite markers silent changes were detected in the ING1 gene in 6 of 23 tumors with allelic D13S285, D13S796, D13S278, D13S158, and D13S779 are available through the loss at the 13q33–34 region. These missense mutations were found within internet genome database.4 PCR was carried out in 20 ␮l of reaction mixture with the PHD finger domain and nuclear localization motif in ING1 protein, 10 pmol of each primer, 100 ng of genomic DNA, 1ϫ PCR buffer, 200 ␮M of each probably abrogating the normal function. deoxynucleotide triphosphate, and 0.5 unit of Taq DNA polymerase (Takara, Kyoto, Japan). Initial denaturation at 94°C for 3 min was followed by 25 cycles of Introduction a denaturation step at 94°C for 30 s, an annealing step at 52°C (D13S278 and Tumor suppressor genes are defined as genetic elements whose loss or D13S158) or 56°C (D13S285, D13S796, and D13S779) for 30 s, and an extension mutational inactivation allows cells to display one or more phenotypes of step at 72°C for 1 min. A final extension step at 72°C for 7 min was added. After ␮ ␮ neoplastic growth (1). Tumor suppressor proteins are known to be in- amplification, 2 l of the reaction mixture were mixed with 8 l of loading dye (95% formamide, 20 mM EDTA, 0.05% bromphenol blue, and 0.05% xylene volved in negative regulation of the cell cycle by different mechanisms cyanol), heat denatured, chilled on ice, and then electrophoresed through an 8% (2). A candidate tumor suppressor gene, ING1, has recently been cloned polyacrylamide gel containing 8 M urea. The DNA bands were visualized by silver (3). Forced overexpression of the ING1 gene led the cells to arrest in the staining (10). LOH was scored if one of the heterozygous alleles showed at least G1 phase of the cell cycle and induced apoptosis in several cell types (3, 50% reduced intensity in tumor DNA as compared with the corresponding normal 4). Conversely, inhibition of ING1 expression by antisense constructs DNA. promoted the transformation of mouse breast epithelial cells and in- Analysis of the Genomic Structure of the Human ING1 Gene. PCR creased the frequency of focus formation with NIH3T3 cells and pro- analysis with ING1-specific primers was used to screen a BAC library, and a tected the cells from apoptosis (3, 4). The ING1 gene was mapped on positive BAC clone (118N21) was purchased from Genome Systems, Inc. (St. human chromosome 13q34 by radiation hybrid analysis (5). Deletion of Louis, MO). The BAC DNA was digested with appropriate restriction enzymes, the chromosomal 13q33–34 region has been reported in HNSCCs3 (6– and regions containing ING1 exons were mapped by Southern blotting with ING1 8). Limited analysis of the gene demonstrated rearrangement of the ING1 cDNA probes. Some restriction fragments containing ING1 exons were subcloned Ϫ gene in one neuroblastoma cell line and reduced expression in primary into pBluescript KS( ) (Stratagene, La Jolla, CA) and sequenced. Luciferase Assay. Each putative promoter region around exon 1a and exon breast cancers and cell lines (3, 9). Only one germ-line mutation in this 1b was subcloned, and sequential 5Ј truncation was introduced by restriction gene has been found (9). However, no tumor-specific somatic mutation in digestion. These DNA fragments were inserted into the promoterless luciferase the gene has been reported thus far. Here we report the genomic structure plasmid pOA-luciferase (11) to produce reporter plasmids for the luciferase of human ING1 gene and some significant tumor-specific mutations of assay (see Fig. 2). Each reporter plasmid (0.5 ␮g) was cotransfected with 0.25 the ING1 gene in HNSCCs. ␮g of an internal control Renilla luciferase plasmid, pRLTK (Promega, Mad- ison, WI), into 293 human embryonic kidney cells or Saos2 osteosarcoma cells Materials and Methods using the calcium phosphate coprecipitation method. The cells were harvested 48 h after transfection. The activities of firefly and Renilla luciferase were Tissue Samples. Paired normal and tumor samples were obtained from 55 measured simultaneously using the Dual-Luciferase Reporter Assay kit (Pro- patients with primary HNSCCs at the Department of Otolaryngology, mega) and normalized for the variation in transfection efficiency. These assays Okayama University Hospital after acquisition of informed consent from each were repeated at least twice in duplicate. SSCP Analysis. The coding region of exon 1a was amplified by PCR with Received 1/31/00; accepted 5/2/00. primers on the flanking regions, primers GS9 (5Ј-TGCAGTGCTATTTTTT- The costs of publication of this article were defrayed in part by the payment of page GAGGGG) and GAS9 (5Ј-CGCCCCCGCCCATCCATCA). Exon 2 was am- charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. plified as four overlapping fragments with four primer sets: (a) GS1 (5Ј- 1 Supported by grants-in-aids from the Ministry of Education, Science, Sports and ACGCCTGTCCTTCTTGCCCC) and AS8 (5Ј-CTTGCCGCTGTTGCCC- Culture and from the Ministry of Health and Welfare of Japan (to K. S.). Ј Ј 2 GCTG); (b)S8(5-TTCGAGGCGCAGCAGGAGCT) and AS5 (5 -CTTG- To whom requests for reprints should be addressed, at Department of Molecular Ј Genetics, Institute of Cellular and Molecular Biology, Okayama University Medical GCCTTCTTCTCCTTGGG); (c)S6(5-CAGCAACCACGACCACGACG) School, Shikata-cho 2-5-1, Okayama 700-8558, Japan. Phone: 81-86-235-7378; Fax: and AS3 (5Ј-TGAGCCCCACGCACGAGAAG); and (d)S3(5Ј-CCTC- 81-86-235-7383; E-mail: [email protected]. CCCATCGACCCCAACG) and AS1 (5Ј-ACATTTTACACTCCTTGCAC- 3 The abbreviations used are: HNSCC, head and neck squamous cell carcinoma; LOH, loss of heterozygosity; BAC, bacterial artificial chromosome; RT-PCR, reverse transcrip- tion-PCR; SSCP, single-strand conformational polymorphism; aa, amino acid(s). 4 http://gdbwww.gdb.org. 3143 Downloaded from cancerres.aacrjournals.org on September 25, 2021. © 2000 American Association for Cancer Research. STRUCTURE AND MUTATION OF THE HUMAN ING1 GENE ϫ CTCA). The PCR mixture contained 100 ng of DNA, 1.2 mM MgCl2,1 PCR D13S158. This deleted area was estimated to be, at most, 6 cM. It has buffer, 200 ␮M of each deoxynucleotide triphosphate, 20 pmol of each primer, been reported that a candidate tumor suppressor gene, ING1,is and 1 unit of rTth DNA polymerase XL (Perkin-Elmer Applied Biosystems, located in this region (5). By using the Stanford G3 radiation hybrid ␮ Foster City, CA) in a 50- l volume. Initial denaturation at 94°C for 3 min was panel, ING1 was linked to marker SHGC-5819, with a LOD score of followed by 30 cycles of a denaturation step at 94°C for 30 s, an annealing step 10.35 (5). The markers SHGC-5819 and D13S278 are colocalized at 64°C for 1 min, and an extension step at 72°C for 1 min. A final extension step within less than 3 cM.4 We therefore determined the genomic struc- at 72°C for 7 min was added. One ␮l of PCR product was mixed with 8 ␮lof loading dye as described above, heat denatured, chilled on ice, applied onto an 8% ture of the ING1 gene and searched for its mutation in HNSCCs. polyacrylamide gel with or without 5% glycerol, and run at variable temperatures. Genomic Structure of the Human ING1 Gene. We screened a Bands were detected by silver staining (10). Aberrantly migrating bands on the BAC clone library by PCR using specific primers for ING1 cDNA and gels were excised, reamplified with the same sets of primers, cloned into EcoRV- obtained BAC clone 118N21, which contains the entire region of the digested pBluescript KS(Ϫ) vector, and sequenced. ING1 gene, from Genome Systems, Inc. We identified and cloned two contiguous XbaI fragments (about 8 and 3.5 kb) that together con- Results and Discussion tained the whole coding region of the ING1 gene.5 Three exons and LOH Analysis. We examined DNA from 55 pairs of matched two introns were identified by sequence analysis, as shown in Fig. 2. HNSCCs and normal tissues for losses at five microsatellite markers Recently, three alternatively spliced forms of ING1 mRNA have been (D13S285, D13S796, D13S278, D13S158, and D13S779) on the described (12).

Load more