Chimeric Antigen Receptors for Adoptive T Cell Therapy in Acute
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Harnessing Gene Expression Profiles for the Identification of Ex Vivo Drug
cancers Article Harnessing Gene Expression Profiles for the Identification of Ex Vivo Drug Response Genes in Pediatric Acute Myeloid Leukemia David G.J. Cucchi 1 , Costa Bachas 1 , Marry M. van den Heuvel-Eibrink 2,3, Susan T.C.J.M. Arentsen-Peters 3, Zinia J. Kwidama 1, Gerrit J. Schuurhuis 1, Yehuda G. Assaraf 4, Valérie de Haas 3 , Gertjan J.L. Kaspers 3,5 and Jacqueline Cloos 1,* 1 Hematology, Cancer Center Amsterdam, Amsterdam UMC, Vrije Universiteit Amsterdam, 1081 HV Amsterdam, The Netherlands; [email protected] (D.G.J.C.); [email protected] (C.B.); [email protected] (Z.J.K.); [email protected] (G.J.S.) 2 Department of Pediatric Oncology/Hematology, Erasmus MC–Sophia Children’s Hospital, 3015 CN Rotterdam, The Netherlands; [email protected] 3 Princess Máxima Center for Pediatric Oncology, 3584 CS Utrecht, The Netherlands; [email protected] (S.T.C.J.M.A.-P.); [email protected] (V.d.H.); [email protected] (G.J.L.K.) 4 The Fred Wyszkowski Cancer Research, Laboratory, Department of Biology, Technion-Israel Institute of Technology, 3200003 Haifa, Israel; [email protected] 5 Emma’s Children’s Hospital, Amsterdam UMC, Vrije Universiteit Amsterdam, Pediatric Oncology, 1081 HV Amsterdam, The Netherlands * Correspondence: [email protected] Received: 21 April 2020; Accepted: 12 May 2020; Published: 15 May 2020 Abstract: Novel treatment strategies are of paramount importance to improve clinical outcomes in pediatric AML. Since chemotherapy is likely to remain the cornerstone of curative treatment of AML, insights in the molecular mechanisms that determine its cytotoxic effects could aid further treatment optimization. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Human Lectins, Their Carbohydrate Affinities and Where to Find Them
biomolecules Review Human Lectins, Their Carbohydrate Affinities and Where to Review HumanFind Them Lectins, Their Carbohydrate Affinities and Where to FindCláudia ThemD. Raposo 1,*, André B. Canelas 2 and M. Teresa Barros 1 1, 2 1 Cláudia D. Raposo * , Andr1 é LAQVB. Canelas‐Requimte,and Department M. Teresa of Chemistry, Barros NOVA School of Science and Technology, Universidade NOVA de Lisboa, 2829‐516 Caparica, Portugal; [email protected] 12 GlanbiaLAQV-Requimte,‐AgriChemWhey, Department Lisheen of Chemistry, Mine, Killoran, NOVA Moyne, School E41 of ScienceR622 Co. and Tipperary, Technology, Ireland; canelas‐ [email protected] NOVA de Lisboa, 2829-516 Caparica, Portugal; [email protected] 2* Correspondence:Glanbia-AgriChemWhey, [email protected]; Lisheen Mine, Tel.: Killoran, +351‐212948550 Moyne, E41 R622 Tipperary, Ireland; [email protected] * Correspondence: [email protected]; Tel.: +351-212948550 Abstract: Lectins are a class of proteins responsible for several biological roles such as cell‐cell in‐ Abstract:teractions,Lectins signaling are pathways, a class of and proteins several responsible innate immune for several responses biological against roles pathogens. such as Since cell-cell lec‐ interactions,tins are able signalingto bind to pathways, carbohydrates, and several they can innate be a immuneviable target responses for targeted against drug pathogens. delivery Since sys‐ lectinstems. In are fact, able several to bind lectins to carbohydrates, were approved they by canFood be and a viable Drug targetAdministration for targeted for drugthat purpose. delivery systems.Information In fact, about several specific lectins carbohydrate were approved recognition by Food by andlectin Drug receptors Administration was gathered for that herein, purpose. plus Informationthe specific organs about specific where those carbohydrate lectins can recognition be found by within lectin the receptors human was body. -
CLEC12A (NM 001207010) Human Tagged ORF Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG233616 CLEC12A (NM_001207010) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: CLEC12A (NM_001207010) Human Tagged ORF Clone Tag: TurboGFP Symbol: CLEC12A Synonyms: CD371; CLL-1; CLL1; DCAL-2; MICL Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RG233616 representing NM_001207010 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTGGATAGATTTCTTTACATATTCATCAATGTCTGAAGAAGTTACTTATGCAGATCTTCAATTCCAGA ACTCCAGTGAGATGGAAAAAATCCCAGAAATTGGCAAATTTGGGGAAAAAGCACCTCCAGCTCCCTCTCA TGTATGGCGTCCAGCAGCCTTGTTTCTGACTCTTCTGTGCCTTCTGTTGCTCATTGGATTGGGAGTCTTG GCAAGCATGTTTCACGTAACTTTGAAGATAGAAATGAAAAAAATGAACAAACTACAAAACATCAGTGAAG AGCTCCAGAGAAATATTTCTCTACAACTGATGAGTAACATGAATATCTCCAACAAGATCAGGAACCTCTC CACCACACTGCAAACAATAGCCACCAAATTATGTCGTGAGCTATATAGCAAAGAACAAGAGCACAAATGT AAGCCTTGTCCAAGGAGATGGATTTGGCATAAGGACAGCTGTTATTTCCTAAGTGATGATGTCCAAACAT GGCAGGAGAGTAAAATGGCCTGTGCTGCTCAGAATGCCAGCCTGTTGAAGATAAACAACAAAAATGCATT GGAATTTATAAAATCCCAGAGTAGATCATATGACTATTGGCTGGGATTATCTCCTGAAGAAGATTCCACT CGTGGTATGAGAGTGGATAATATAATCAACTCCTCTGCCTGGGTTATAAGAAACGCACCTGACTTAAATA ACATGTATTGTGGATATATAAATAGACTATATGTTCAATATTATCACTGCACTTATAAAAAAAGAATGAT ATGTGAGAAGATGGCCAATCCAGTGCAGCTTGGTTCTACATATTTTAGGGAGGCA -
Single-Cell Transcriptomes Reveal a Complex Cellular Landscape in the Middle Ear and Differential Capacities for Acute Response to Infection
fgene-11-00358 April 9, 2020 Time: 15:55 # 1 ORIGINAL RESEARCH published: 15 April 2020 doi: 10.3389/fgene.2020.00358 Single-Cell Transcriptomes Reveal a Complex Cellular Landscape in the Middle Ear and Differential Capacities for Acute Response to Infection Allen F. Ryan1*, Chanond A. Nasamran2, Kwang Pak1, Clara Draf1, Kathleen M. Fisch2, Nicholas Webster3 and Arwa Kurabi1 1 Departments of Surgery/Otolaryngology, UC San Diego School of Medicine, VA Medical Center, La Jolla, CA, United States, 2 Medicine/Center for Computational Biology & Bioinformatics, UC San Diego School of Medicine, VA Medical Center, La Jolla, CA, United States, 3 Medicine/Endocrinology, UC San Diego School of Medicine, VA Medical Center, La Jolla, CA, United States Single-cell transcriptomics was used to profile cells of the normal murine middle ear. Clustering analysis of 6770 transcriptomes identified 17 cell clusters corresponding to distinct cell types: five epithelial, three stromal, three lymphocyte, two monocyte, Edited by: two endothelial, one pericyte and one melanocyte cluster. Within some clusters, Amélie Bonnefond, Institut National de la Santé et de la cell subtypes were identified. While many corresponded to those cell types known Recherche Médicale (INSERM), from prior studies, several novel types or subtypes were noted. The results indicate France unexpected cellular diversity within the resting middle ear mucosa. The resolution of Reviewed by: Fabien Delahaye, uncomplicated, acute, otitis media is too rapid for cognate immunity to play a major Institut Pasteur de Lille, France role. Thus innate immunity is likely responsible for normal recovery from middle ear Nelson L. S. Tang, infection. The need for rapid response to pathogens suggests that innate immune The Chinese University of Hong Kong, China genes may be constitutively expressed by middle ear cells. -
WO 2018/071455 Al 19 April 2018 (19.04.2018) W ! P O PCT
(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2018/071455 Al 19 April 2018 (19.04.2018) W ! P O PCT (51) International Patent Classification: (US). GHONE, Sanjeevani; 14 Adams Court, Plainsboro, A61K 47/62 (2017.01) C07D 403/14 (2006.01) New Jersey NJ 08536 (US). A61K 47/64 (20 .01) (74) Agent: GARRETT- WACKO WSKI, Eugenia et al; Kil- (21) International Application Number: patrick Townsend & Stockton LLP, Mailstop: IP Docketing PCT/US2017/055994 - 22, 1100 Peachtree Street, Suite 2800, Atlanta, GA 30309 (US). (22) International Filing Date: 10 October 2017 (10.10.2017) (81) Designated States (unless otherwise indicated, for every kind of national protection available): AE, AG, AL, AM, (25) Filing Language: English AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, BZ, (26) Publication Language: English CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, (30) Priority Data: HR, HU, ID, IL, IN, IR, IS, JO, JP, KE, KG, KH, KN, KP, 10 October 2016 (10.10.2016) 62/406,077 KR, KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, 62/45 1,658 27 January 2017 (27.01.2017) MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, (71) Applicant: CELLERANT THERAPEUTICS, INC. OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, [US/US]; 1561 Industrial Road, San Carlos, California SC, SD, SE, SG, SK, SL, SM, ST, SV, SY,TH, TJ, TM, TN, 94070 (US). -
Downloaded Per Proteome Cohort Via the Web- Site Links of Table 1, Also Providing Information on the Deposited Spectral Datasets
www.nature.com/scientificreports OPEN Assessment of a complete and classifed platelet proteome from genome‑wide transcripts of human platelets and megakaryocytes covering platelet functions Jingnan Huang1,2*, Frauke Swieringa1,2,9, Fiorella A. Solari2,9, Isabella Provenzale1, Luigi Grassi3, Ilaria De Simone1, Constance C. F. M. J. Baaten1,4, Rachel Cavill5, Albert Sickmann2,6,7,9, Mattia Frontini3,8,9 & Johan W. M. Heemskerk1,9* Novel platelet and megakaryocyte transcriptome analysis allows prediction of the full or theoretical proteome of a representative human platelet. Here, we integrated the established platelet proteomes from six cohorts of healthy subjects, encompassing 5.2 k proteins, with two novel genome‑wide transcriptomes (57.8 k mRNAs). For 14.8 k protein‑coding transcripts, we assigned the proteins to 21 UniProt‑based classes, based on their preferential intracellular localization and presumed function. This classifed transcriptome‑proteome profle of platelets revealed: (i) Absence of 37.2 k genome‑ wide transcripts. (ii) High quantitative similarity of platelet and megakaryocyte transcriptomes (R = 0.75) for 14.8 k protein‑coding genes, but not for 3.8 k RNA genes or 1.9 k pseudogenes (R = 0.43–0.54), suggesting redistribution of mRNAs upon platelet shedding from megakaryocytes. (iii) Copy numbers of 3.5 k proteins that were restricted in size by the corresponding transcript levels (iv) Near complete coverage of identifed proteins in the relevant transcriptome (log2fpkm > 0.20) except for plasma‑derived secretory proteins, pointing to adhesion and uptake of such proteins. (v) Underrepresentation in the identifed proteome of nuclear‑related, membrane and signaling proteins, as well proteins with low‑level transcripts. -
Departments of 3Oncology and 4Pathology, St. Jude
UNIVERSAL MONITORING OF MINIMAL RESIDUAL DISEASE IN ACUTE MYELOID LEUKEMIA Elaine Coustan-Smith,1 Guangchun Song,4 Sheila Shurtleff,4 Allen Eng-Juh Yeoh,1,2 Chng Wee Joo,2 Siew Peng Chen,1 Jeffrey E. Rubnitz,3,5 Ching-Hon Pui,3,4,5 James R. Downing,4,5 Dario Campana1,2 1Department of Pediatrics and 2National University Cancer Institute Singapore, National University of Singapore, Singapore; Departments of 3Oncology and 4Pathology, St. Jude Children's Research Hospital, Memphis, TN; and 5University of Tennessee Health Science Center, Memphis, TN Supplemental Material (Supplemental Tables S3-S6; Supplemental Figures S1-S6) 1 Table S3. Genes overexpressed in AML “stem cells” according to previous studies and their overexpression in AML according to the present analysis Gene overexpressed in AML Gene overexpressed in AML AML cases with stem cells according to Saito et stem cells according to Kikushige overexpression in this al.(1) et al.(2) study (%)a WT1 84.7 CD32 CD32 76.4 DOK2 70.1 CD96 66.9 HCK 65.6 CD86 CD86 64.3 CD44 64.3 CD93 56.7 ITGB2, CD18 ITGB2, CD18 52.9 CSF1R, CD115 51.0 IL2RA, CD25 IL2RA, CD25 47.8 LY86 43.3 IL7R, CD127 42.0 CD99 42.0 IL17R 39.5 CD97 CD97 37.6 CD33 CD33 36.9 CD9 36.9 CD1C 35.7 AK5 33.1 BIK 31.2 CD47 30.6 TNFRSF4, CD134 29.3 CD84 29.3 IL2RG, CD132 27.4 ITGB7 27.4 CEACAM6, CD66c 26.8 FLT3 25.5 CD180 <25 CTSC <25 PDE9A <25 CD24 <25 CD36 <25 CD123 <25 ITGAE <25 2 LRG1 Not on HG-U133A array SUCNR1 Not on HG-U133A array TNFSF13B, CD257 Not on HG-U133A array CD366, HAVCR2, TIM-3 Not on HG-U133A array CD371, CLEC12A, CLL-1 Not on HG-U133A array aGene expression was studied by HG-U133A oligonucleotide microarrays in157 AML samples and 7 samples of normal CD34+ myeloid progenitors. -
Acute Myeloid Leukemia
Kantarjian et al. Blood Cancer Journal (2021) 11:41 https://doi.org/10.1038/s41408-021-00425-3 Blood Cancer Journal REVIEW ARTICLE Open Access Acute myeloid leukemia: current progress and future directions Hagop Kantarjian 1, Tapan Kadia 1, Courtney DiNardo 1, Naval Daver 1, Gautam Borthakur 1, Elias Jabbour1, Guillermo Garcia-Manero 1, Marina Konopleva 1 and Farhad Ravandi1 Abstract Progress in the understanding of the biology and therapy of acute myeloid leukemia (AML) is occurring rapidly. Since 2017, nine agents have been approved for various indications in AML. These included several targeted therapies like venetoclax, FLT3 inhibitors, IDH inhibitors, and others. The management of AML is complicated, highlighting the need for expertise in order to deliver optimal therapy and achieve optimal outcomes. The multiple subentities in AML require very different therapies. In this review, we summarize the important pathophysiologies driving AML, review current therapies in standard practice, and address present and future research directions. Introduction regimens consisting of all trans-retinoic acid (ATRA) and Progress in understanding the pathophysiology and arsenic trioxide in acute promyelocytic leukemia (APL) – improving the therapy of acute myeloid leukemia (AML) resulted in cure rates of 90%8 12. In core-binding factor is now occurring at a rapid pace. The discovery of the (CBF) AML, adding gemtuzumab ozogamicin (CD33-tar- 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; activity of cytarabine (ara-C) and of anthracyclines in geted monoclonal antibody conjugated to the calicheamicin AML, and combining them in the 1970’s, into what is payload) to high-dose cytarabine-based chemotherapy – known as the “3 + 7 regimen” (3 days of daunorubicin + increased the long-term survival rate from 50% to 75+%13 17. -
Epigenetic Changes in Human Model KMT2A Leukemias Highlight Early Events During Leukemogenesis
Epigenetic changes in human model KMT2A leukemias highlight early events during leukemogenesis Thomas Milan1, Magalie Celton1, Karine Lagacé1, Élodie Roques1, Safia Safa-Tahar-Henni1, Eva Bresson2,3,4, Anne Bergeron2,3,4, Josée Hebert5,6, Soheil Meshinchi7, Sonia Cellot8, Frédéric Barabé2,3,4, 1,6 Brian T Wilhelm Author contributions: BTW and TM designed the study, analyzed data and drafted the manuscript. TM and KL performed ChIP-seq and ATAC-seq, analysed the data and generated figures. MC performed Methyl-seq experiments, analysed data, generated figures and drafted the manuscript. SS-T-H assisted with the ATAC-seq analysis and generation of figures. KL, ER, EB, and AB helped with molecular biology work, cloning and cell culture. EB, AB and FB generated the model on mice from CD34+ cells. SM provided expression and clinical data for patient samples and JH and SC collected, characterized, and banked the local patient samples used in this study. Affiliations: 1Laboratory for High Throughput Biology, Institute for Research in Immunology and Cancer, Montréal, QC, Canada 2Centre de recherche en infectiologie du CHUL, Centre de recherche du CHU de Québec – Université Laval, Québec City, QC, Canada, 3CHU de Québec – Université Laval – Hôpital Enfant-Jésus; Québec City, QC, Canada; 4Department of Medicine, Université Laval, Quebec City, QC, Canada 5Division of Hematology-Oncology and Leukemia Cell Bank of Quebec, Maisonneuve-Rosemont Hospital, Montréal, QC, Canada, 6Department of Medicine, Université de Montréal, Montréal, QC, Canada, 7Clinical Research Division, Fred Hutchinson Cancer Research Center, Seattle, Washington, USA 8Department of pediatrics, division of Hematology, Ste-Justine Hospital, Montréal, QC, Canada Running head: Early epigenetic changes in KM3-AML *Correspondence to: Brian T Wilhelm Institute for Research in Immunology and Cancer Université de Montréal P.O. -
Anti-CD19 CAR T Cells That Secrete a Biparatopic Anti-CLEC12A Bridging
Author Manuscript Published OnlineFirst on July 12, 2021; DOI: 10.1158/1535-7163.MCT-20-1030 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Anti-CD19 CAR T cells that secrete a biparatopic anti-CLEC12A bridging protein have potent activity against highly aggressive acute myeloid leukemia in vitro and in vivo Paul D. Rennert, Fay J. Dufort, Lihe Su, Tom Sanford, Alyssa Birt, Lan Wu, Roy R. Lobb and Christine Ambrose. Aleta Biotherapeutics Inc. 27 Strathmore Rd, Natick MA 01760 USA. Running Title: anti-CD19 CAR T cells engineered to target AML Keywords: CAR T cell, CLEC12A, CD33, AML, biparatopic Corresponding Author: Paul D. Rennert, Aleta Biotherapeutics Inc. 27 Strathmore Rd, Natick MA 01760 USA. 1-508-282-6370. [email protected] Conflict of interest declaration: At the time the experimental work was performed all authors were employees and stockholders of Aleta Biotherapeutics, Inc. Rennert and Lobb are Aleta Biotherapeutics Board members and company Founders. Word count: 5489 Number of figures: 4 Number of tables: 2 1 Downloaded from mct.aacrjournals.org on October 5, 2021. © 2021 American Association for Cancer Research. Author Manuscript Published OnlineFirst on July 12, 2021; DOI: 10.1158/1535-7163.MCT-20-1030 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. ABSTRACT Refractory Acute Myeloid Leukemia (AML) remains an incurable malignancy despite the clinical use of novel targeted therapies, new antibody-based therapies and cellular therapeutics. Here we describe the preclinical development of a novel cell therapy that targets the antigen CLEC12A with a biparatopic bridging protein. -
Mapping the CLEC12A Expression on Myeloid Progenitors in Normal Bone Marrow; Implications for Understanding CLEC12A-Related Cancer Stem Cell Biology
Aalborg Universitet Mapping the CLEC12A expression on myeloid progenitors in normal bone marrow; implications for understanding CLEC12A-related cancer stem cell biology Bill, Marie; B van Kooten Niekerk, Peter; S Woll, Petter; Laine Herborg, Laura; Stidsholt Roug, Anne; Hokland, Peter; Nederby, Line Published in: Journal of Cellular and Molecular Medicine DOI (link to publication from Publisher): 10.1111/jcmm.13519 Creative Commons License CC BY 4.0 Publication date: 2018 Document Version Publisher's PDF, also known as Version of record Link to publication from Aalborg University Citation for published version (APA): Bill, M., B van Kooten Niekerk, P., S Woll, P., Laine Herborg, L., Stidsholt Roug, A., Hokland, P., & Nederby, L. (2018). Mapping the CLEC12A expression on myeloid progenitors in normal bone marrow; implications for understanding CLEC12A-related cancer stem cell biology. Journal of Cellular and Molecular Medicine, 22(4), 2311-2318. https://doi.org/10.1111/jcmm.13519 General rights Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. ? Users may download and print one copy of any publication from the public portal for the purpose of private study or research. ? You may not further distribute the material or use it for any profit-making activity or commercial gain ? You may freely distribute the URL identifying the publication in the public portal ? Take down policy If you believe that this document breaches copyright please contact us at [email protected] providing details, and we will remove access to the work immediately and investigate your claim.