Supporting Information

Jin et al. 10.1073/pnas.1418629112 SI Materials and Methods Santa Cruz Biotechnology, 1:100), anti–neural-specific β-tubulin − − − − Animals. Mice carrying the Gas1 (1), Shh (2), Cdo , Boc (3), (Tuj1, mouse, Millipore, 1:800), anti-Neurotrophin receptor P75 f − Smo (4), Gnaz (5), and transgenic Wnt1:Cre (6) alleles were (Rabbit, Millipore, 1:200), anti-GFP (rabbit, Invitrogen, 1:100), − − − previously described. For simplicity, Gas1 , Cdo ,andBoc were anti-mouse Gas1 (goat, R&D Systems, 1:200), and anti-HuC/D used for the Lac-Z knock-in allele of Gas1 and β-geo–internal (mouse, Molecular Probes, 1:100). Alexa Fluor 488- and Alexa ribosomal entry site (IRES) human placental alkaline phosphatase Fluor 568-conjugated secondary antibodies (Invitrogen) against (hPLAP) gene-trapped alleles of Cdo and Boc, respectively. Ap- specific species (goat, mouse, and rabbit) were used for detection propriate mating schemes were designed to generate embryos of (Molecular Probes, all at 1:1,000). DAPI (Sigma) was used at desired genotypes, including controls. Embryo stages are specified 1 μg/mL for staining of DNA. in the text. The vaginal plug date is designated as embryonic day 0.5 (E0.5), following convention. For genotyping, tail or embryo Neurosphere Culture. Neurosphere-like bodies were generated −/− sac DNAs were used. Oligonucleotide primers and conditions using whole guts dissected from E11.5 wild-type or Gas1 for PCR are described in corresponding publications and on the embryos as previously described (7–9). They were dissociated in f Jackson Laboratory (JAX) website. The Gas1 allele was gener- basal media by mechanical pipetting, then plated into culture ated for this work, and its characterization is detailed in Fig. S2; dish freshly coated with 20 μg/mL of fibronectin (Sigma), and ′ primers flanking the 3 loxP site were used for routine genotyping: cultured at 37 °C, 5% CO2. The fresh basal media was replaced 5′-TTGCCCCACGGTCCCGGGCGCA and 5′-CATGTTGG- every 2 d. Around day 5, 20 ng/mL of human recombinant epi- CTGCGGTACGAGCTG. All procedures are approved by the dermal growth factor (Calbiochem) was added to induce enteric Carnegie Institutional Animal Care and Use Committee. neurosphere formation. These primary neurospheres were then used for axon outgrowth and guidance assays. Histochemistry and Immunostaining. For X-gal reactions and im- munofluorescence, embryos or dissected guts were fixed in 4% Outgrowth and Turning Assays. For axon outgrowth assay, neuro- (wt/vol) paraformaldyhyde/PBS overnight at 4 °C, washed exten- spheres obtained from E11.5 guts described above were embedded sively in PBS, transferred through serial sucrose/PBS, and em- in the 3D collagen matrices (BD Biosciences) with a supplement bedded in O.C.T. compound (Tissue Tek) for cryosectioning. of different concentrations of recombinant Shh-N or GDNF Tissue sections 10 μm thick were made by using LEICA CM3050S proteins (specified in the text and figure legends) in basal media cryostat. X-gal reactions followed standard protocols as described for 48 h. For the turning assay, COS cell aggregates transfected for 24 h of staining and were counterstained with Nuclear Fast with a control or Shh expression plasmid by X-tremeGENE HP Red (Sigma), dehydrated, and mounted in Permount (Fisher) (7). (Roche) or heparin beads (Sigma) soaked in PBS or in PBS with For gut cross-section immunostaining, the sections were per- recombinant Shh-N (2 μg/mL, R&D Systems) were embedded in meablized in 1% Triton-X100 (Sigma)/PBS for 15 min at room 3D collagen matrices (10) next to neurospheres and cultured for temperature, blocked for 1 h in 4% (wt/vol) BSA (Sigma)/PBS 48 h. PTX (Calbiochem) at 75 ng/mL was added in the culture solution at room temperature, and then incubated with primary media. At the end of culture, samples were fixed and stained as antibodies in the blocking solution overnight at 4 °C. The next day, described above. Based on Tuj1 staining of the axon, axon length slides were washed three times with PBS (10 min per wash), was measured with MetaMorph software, and axon turning angle incubated with secondary antibodies for 1.5 h at room tempera- degrees were measured with ImageJ software. ture, washed with PBS three times, counterstained by DAPI for 5 min, and washed with PBS three times before mounting in Flu- RNA-Seq and qRT-PCR. Neurospheres in an undifferentiated or oromount G (SouthernBiotech). For single neuron immunostain- differentiated (induced by 50 ng/mL of GDNF for 48 h) status ing, dissociated neurons from E11.5 gut were cultured in eight-well were collected for RNA-seq. Total RNA was extracted using the chamber slides (Nunc) for 48 h in basal media plus 50 ng/mL of ArcturusPicoPure RNA isolation kit (Applied Biosystems). Then GDNF (Prospec). Basal media includes DMEM media (Life ribosomal RNA was depleted using the Ribo-Zero rRNA Re- Technology) supplied with 15% chicken embryo extract, 1% moval Core Kit (Epicentre). cDNA libraries were constructed pencillin/streptomycin (Life Technology), 0.1% glutamine (Life from ribonsome-depleted RNA using Illumina TruSeq RNA Technology), 1% N2 supplement (Life Technology), 2% B27 sup- Library Prep Kit v2 and sequenced using a HiSeq2000. RNA-seq plement (Life Technology), 50 μM β-mercaptoethanol (Gibco), 20 ng/mL bFGF (R&D Systems), and 35 ng/mL retinoic acid reads were mapped using TopHat to the mouse genome (mm9), (Sigma) per refs. 7–9. At the end of culture, samples were fixed and RefSeq annotations were downloaded from the University of in 4% paraformaldyhyde/PBS for 30 min at room temperature, California Santa Cruz table browser. The number of reads over- washed in PBS three times (10 min per wash), and the rest lapping exon regions of each gene was counted with custom scripts. Gαi followed the immunostaining protocol mentioned above. For Differentially expressed family members were analyzed using Gnaz neurosphere whole-mount immunostaining, cultured neurosphere edgeR. qRT-PCR was applied to confirm the gene expres- samples were fixed in 4% paraformaldyhyde/PBS overnight at sion. For qRT-PCR, 500 pg of total RNA from each sample was 4 °C, washed three times in PBS (20 min/wash) at room tem- used for standard RT using quantiTect reverse transcription kit perature, blocked for 2 h in 4% BSA solution at room temper- (Qiagen) in a 20-μL reaction. We then used 1 μLoftheRTre- ature, incubated with primary antibody overnight at 4 °C, washed action in a 20-μL PCR containing syber green for 45 cycles in three times in PBS (2 h per wash) at room temperature, in- C1000 Touch C (BioRad). The oligonucleotide primers used for cubated with secondary antibody overnight at 4 °C, washed three each gene are as follows: Gli1,5′-CCAAGCCAACTTTATGT- times in PBS (2 h per wash) at room temperature, and then CAGGG and 5′-AGCCCGCTTCTTTGTTAATTTGA; Gnaz,5′- imaged using a Nikon Eclipse TE200 fluorescence scope. CCCAGCAGGAGAAGTTTGATTTC and 5′-ATGTCGGCAA- The primary antibodies used were anti–β-gal (rabbit, Chem- AGCTCAGAGG; and Gapdh,5′-AGGTCGGTGTGAACGGA- icon, 1:1,000, or mouse, Promega, 1:1,000), anti-Gnaz (rabbit, TTTG and 5′-TGTAGACCATGTAGTTGAGGTCA. Relative

Jin et al. www.pnas.org/cgi/content/short/1418629112 1of6 expression levels or Δcq values (Gli1 cq value – Gapdh cq) were buffer) per lane for SDS/PAGE. PVDF membranes (Bio-Rad) shown and are described in the figure legends. were used for Western blotting. Primary antibodies used were goat anti–Shh-N (N-19, Santa Cruz Biotechnology, 1:1,000), goat anti- Lentiviral shRNA Transduction. All lentiviral shRNA (of the GIPZ mGas1 (R&D Systems, 1:500), and mouse anti-Gapdh (clone 6C5, and pLEX system)-expressing vectors were purchased from Millipore, 1:5,000), followed by species-specific HRP-conjugated Thermo Scientific. Trans-Lentiviral shRNA Packaging Kit secondary antibodies and ECL detection (Amersham). The pro- (TL5913) was used to produce lentiviruses expressing mouse cedure was adapted from Biau et al. (7). Gnaz shRNAs (1, V2LMM-78357; 2, V2LMM-80266) and con- + trol nonspecific shRNA (nonshRNA, RHS4346) according to the Quantitation and Statistical Analyses. Villi containing Tuj1 - procedures provided by the company. The pLEX vector (Thermo stained axons were counted on captured digital images from Scientific) was used to express Smo-GFP and the dominant 10 sections of each of three embryos of each genotype. For in negative form of Gnaz (11) using the corresponding viral pack- vitro neurosphere assay, each experiment was repeated at aging kit (Thermo Scientific). Neurospheres were cultured in basal media with these lentiviral particles for 48 h and then used least three times, with 20 neurospheres prepared from at least for axon guidance assays with PBS- and Shh-N–soaked heparin three animals for each experiment. Bar graphs represent ± beads as described above. mean SEs. All statistical data considered significant were with P values <0.05, <0.01, or <0.001 as assessed by Student’s t Western Blots. Supernatants collected from transfected COS cells test; ns, not significant. They are presented in the figure leg- (48 h after transfection) were used neat at 7.5 μL (in SDS sample ends accordingly.

1. Martinelli DC, Fan CM (2007) Gas1 extends the range of Hedgehog action by facili- 7. Biau S, Jin S, Fan CM (2013) Gastrointestinal defects of the Gas1 mutant involve tating its signaling. Genes Dev 21(10):1231–1243. dysregulated Hedgehog and Ret signaling. Biol Open 2(2):144–155. 2. Chiang C, et al. (1996) Cyclopia and defective axial patterning in mice lacking Sonic 8. Fu M, Lui VC, Sham MH, Pachnis V, Tam PK (2004) Sonic hedgehog regulates the hedgehog gene function. Nature 383(6599):407–413. proliferation, differentiation, and migration of enteric neural crest cells in gut. J Cell 3. Okada A, et al. (2006) Boc is a receptor for sonic hedgehog in the guidance of com- Biol 166(5):673–684. missural axons. Nature 444(7117):369–373. 9. Bondurand N, Natarajan D, Thapar N, Atkins C, Pachnis V (2003) Neuron and glia 4. Long F, Zhang XM, Karp S, Yang Y, McMahon AP (2001) Genetic manipulation of generating progenitors of the mammalian enteric nervous system isolated from hedgehog signaling in the endochondral skeleton reveals a direct role in the regu- foetal and postnatal gut cultures. Development 130(25):6387–6400. lation of chondrocyte proliferation. Development 128(24):5099–5108. 10. Charron F, Stein E, Jeong J, McMahon AP, Tessier-Lavigne M (2003) The morphogen 5. Yang J, et al. (2000) Loss of signaling through the G protein, Gz, results in abnormal sonic hedgehog is an axonal chemoattractant that collaborates with netrin-1 in platelet activation and altered responses to psychoactive drugs. Proc Natl Acad Sci midline axon guidance. Cell 113(1):11–23. USA 97(18):9984–9989. 11. Nagahama M, et al. (2002) Inactivation of Galpha(z) causes disassembly of the Golgi 6. Danielian PS, Muccino D, Rowitch DH, Michael SK, McMahon AP (1998) Modification apparatus. J Cell Sci 115(Pt 23):4483–4493. of gene activity in mouse embryos in utero by a tamoxifen-inducible form of Cre recombinase. Curr Biol 8(24):1323–1326.

Jin et al. www.pnas.org/cgi/content/short/1418629112 2of6 ABStomach Colon Tuj1 DAPI Tuj1 DAPI

WT Shh-/- Gas1-/- WT Shh-/- Gas1-/-

-/- -/- -/- -l- -/- -/- Cdo-/- Boc-l- Cdo Boc Cdo ; Boc Cdo Boc ;

40 6 35 *** 5 30 4 25 3 20 ** ** 15 ** 2 10 1 5 0 0 -/- -/- -/- -/- WT Shh-/- -/- -/- -/- -/- Gas1 ; Cdo Gas1 Boc Gas1-/- Cdo -/- Boc -/- Gas1 ;Cdo Gas1 Boc WT ; Shh-/- ; Gas1-/- Cdo -/- Boc -/- Cdo -/-;Boc-/-Gas1-/-;Cdo-/- Gas1-/-;Boc-/-

Cdo-/-;Boc-/- Gas1-/-;Cdo-/-Gas1-/-;Boc-/-

CDstomachintestine colon stomachintestine colon

E11.5 E11.5

E13.5 E13.5 g

E15.5 E15.5

E18.5 E18.5

CDO BOC

Fig. S1. Enteric axon projections in mutants of the Shh pathway genes and expression patterns of Cdo-LacZ and Boc-LacZ. (A) Tuj1 (in red)-stained E18.5 stomach sections (counterstained with DAPI in blue) of wild type (WT), Shh−/−, Gas1−/−, Cdo−/−, Boc−/−, Cdo−/−;Boc−/−, Gas1−/−;Cdo−/−, and Gas1−/−;Boc−/−. Arrows point to centrally projected axons underneath the villi. (B) Tuj1 (in red)-stained E18.5 colon sections (counterstained with DAPI in blue) of wild type − − − − − − − − − − − − − − − − − − − − (WT), Shh / , Gas1 / , Cdo / , Boc / , Cdo / ;Boc / , Gas1 / ;Cdo / ,andGas1 / ;Boc / . Shown is the quantification of percentages of villi that contain Tuj1+ axons in both A and B;**P < 0.01 and ***P < 0.001 by Student’s t test; three animals per genotype and 10 sections (≥50 villi) per sample were counted. Error + − bars, SEM. (Scale bars, 50 μm.) (C) Cdo-LacZ expression in the developing gut. X-gal staining was performed on sectioned Cdo / embryos or guts at E11.5, + − E13.5, E15.5, and E18.5 and counterstained with nuclear fast red. (D) Boc-LacZ expression in the developing gut. X-gal staining was performed on Boc / sectioned embryos or guts at E11.5, E13.5, E15.5, and E18.5 and counterstained with nuclear fast red. In both C and D, the regions of the guts along the anterior–posterior (A–P) axis, stomach, intestine, and colon are indicated. Higher magnifications of the boxed regions in E18.5 samples at the bottom panel show clear signals in smooth muscles but little or no signal in enteric neurons of the myenteric plexus (arrows).

Jin et al. www.pnas.org/cgi/content/short/1418629112 3of6 A Gas1 Gas1+ Gas1 coding +/+ +/ neo 250 150 84bp 13bp X Actin-Flpe 100 75 X WT Gas1 50

37 X Germline-Cre Gas1 X WT Gas1 25

deletion 37 M +/+ +/f f/f (-) M +/+ +/f f/f (-) M +/++/ (-) KD 504 1.37k Gapdh 420 375 332 364

B Tuj1 DAPI 50 *** 40 30 20 10

WT Gas1+/- (%) villi Tuj1-positive 0 WT Gas1+/-

DAPI

P75

DAPI HuC/D HuC/D

f/f f/f Wnt1:Cre Wnt1:Cre; Gas1 Wnt1:Cre; Smo

Fig. S2. Additional analyses of Gas1 and Smo conditional mutants. (A) Generation and characterization of a Gas1-floxed allele. Diagram of the Gas1floxed-neo allele (Top), the Gas1f allele used in this work after removal of the neo cassette by Actin-FLP mice (Gas1flox, Middle), and the Gas1-deleted allele after loxP recombination in the germ line (Gas1Δ, Bottom). The genomic structure of Gas1, as well as the placement of loxP and Frt sites relative to the coding region of Gas1, is depicted. Locations of primers (black arrows) for characterization are indicated. bp, base pairs; Frt sites, diamonds; genetic crosses, vertical arrows; loxP sites, triangles. See Materials and Methods for oligonucleotide primer sequences for genotyping. Genomic DNA PCR using primers flanking the 5′ loxP site (Left), flanking the 3′ loxP site (Middle), and flanking both loxP sites (Right). Genotypes are labeled on top, and PCR products are resolved on agarose gels and their sizes (in bp) labeled next to the figures. Western blot confirms that the deleted allele does not produce detectable Gas1 protein using E10.5 whole embryos, with the genotype labeled at the top and 1/40 of each embryo lysates loaded in each lane. The blot was reprobed for Gapdh (Bottom) for loading control. Newborn Gas1+/ Δ mice are normal (Left), whereas newborn Gas1Δ/Δ mice phenocopy published Gas1 null mutants (1) with microphthalmia and soft- tissue syndactyly in anterior digits (white arrowheads). (B) Enteric axonal projections in Gas1 heterozygous mice. Tuj1 (in red)-stained E18.5 small intestine + − sections (counterstained with DAPI in blue) of wild type (WT) and Gas1 / . Arrows point to abnormal axons found underneath the villi. Shown is the quan- + tification of percentages of villi that contain Tuj1 axons; ***P < 0.001 by Student’s t test; three animals per genotype and 10 sections (≥70 villi) per small intestine sample were counted. Error bars, SEM. (Scale bars, 50 μm.) (C) Conditional inactivation of Gas1 or Smo does not cause mislocalization of enteric progenitors and neurons: Enteric progenitors/neurons (Top panel) were stained by anti-P75 (in red) and DAPI (in blue) and enteric neurons (Bottom panel) by anti-HuC/D (in red) and DAPI (in blue) in E18.5 small intestines of Wnt1:Cre, Wnt1:Cre;Gas1f/f,andWnt1:Cre;Smof/f. Arrows point to staining signals localized at the peripheries. (Scale bars, 50 μm.)

1. Martinelli DC, Fan CM (2007) Gas1 extends the range of Hedgehog action by facilitating its signaling. Genes Dev 21(10):1231–1243.

Jin et al. www.pnas.org/cgi/content/short/1418629112 4of6 A Tuj1 DAPI

Gas1-/-

E13.5 E14.5 E15.5 B

300

5 m) 350 m)

µ 250 4 µ 300 * * 200 3 250 2 150 200

mRNA expression expression mRNA 1 100 150 100 0 50 Gli1 0 0.5 2 4 50 Shh-N (µg/ml) 0

Axon length ( length Axon 0 0 0.5 2 4 Axon length ( length Axon 0 10 50 100 Shh-N (µg/ml)

GDNF (ng/ml) Relative Relative C Shh-N protein expression by transfected COS cells

Empty vector Shh-N vector Purified Shh-N protein

6.4ng 32ng

) o 100 Empty vector

80 * Shh-N vector 60

Shh-N COS Shh-N

Shh-N COS Shh-N Empty COS Empty Empty COS Empty WT WT Gas1-/- Gas1-/- 0 Turning angle degree ( degree angle Turning WT Gas1-/-

Fig. S3. Shh acts in a Gas1-dependent manner to repel enteric axons but not to prune preexisting enteric axons nor to inhibit enteric axon growth. (A) Developmental progression of enteric axon projection patterns in wild-type and Gas1 mutants. Tuj1 (in red)-stained intestine sections (counterstained with − − DAPI in blue) of E13.5, E14.5, and E15.5 wild type and Gas1 / . A higher magnification of the boxed region shows that as soon as villi are clearly defined, misprojected axons in the villus mesenchyme are visible in the Gas1 mutant, whereas the WT does not have erroneous projections during the early stage of villi formation. (Scale bars, 50 μm.) (B) Dosage effects of Shh-N and GDNF on axon growth of enteric neurospheres in collagen gels. Enteric neurospheres are responsive to Shh-N–induced transcription. qRT-PCR was performed to determine relative Gli1 mRNA expression levels (normalized to Gapdh) in enteric neurospheres treated with 0, 0.5, 2, and 4 μg/mL of recombinant Shh-N protein for16 h. Gli1 was undetectable with no Shh-N added, and the 0.5 μg/mL group was arbitrarily set as 1; n = 3. Shown are the axon lengths (y axis) 48 h after treatment by different concentrations of Shh-N (x axis). Over 150 axons from 20 neurospheres (n ≥ 3 animals) for each treatment were measured, and no difference was found among these treatments. Shown are axon lengths (y axis) 48 h after treatment by different concentrations of recombinant GDNF (x axis); *P < 0.05 by Student’s t test. Over 150 axons from 20 neurospheres (n ≥ 3 animals) for each treatment were measured. Error bars, SEM. (C) COS cell aggregates expressing Shh-N can repel enteric axons. Western blot shows that COS cells transfected with the Shh-N expression vector secreted Shh-N protein as expected, but not those transfected with the empty vector. Recombinant Shh-N was used as a positive control. COS cell aggregates transfected with empty (Empty) or Shh-N–expressing (Shh-N) vectors were placed next to enteric neurospheres − − derived from WT or Gas1 / guts in collagen gels. After 48 h, samples were fixed and stained by Tuj1 (in red). Turning angles based on Tuj1 staining were measured and shown; *P < 0.05 by Student’s t test; over 70 axons from 20 neurospheres (n ≥ 3 animals) were counted for each experiment. Error bars, SEM. (Scale bars, 50 μm.)

Jin et al. www.pnas.org/cgi/content/short/1418629112 5of6 A 8

6 Un-differentiated 5 Differentiated

2 Fold change of mRNA mRNA of change Fold 1

Gnaz Gnal Gnaq Gnas Gnao1 Gna12Gnai2 Gnai1 Gnai3 Gna13 Gna11 Gna14 Gna15 Gnat1 Gnat2 Gnat3 B

120

100 80 * 60

40 ** mRNA Level (%) (%) Level mRNA 20

0 Gnaz

Relative Gnaz-shRNA1 Gnaz-shRNA2

Scrambled-shRNA

Fig. S4. Evaluation of Gnaz expression levels and shRNA knockdown efficiency. (A) Relative changes in the expression level of the Gαi, Gαs, as well as other classes of Gα genes, between undifferentiated and differentiated wild-type enteric neurospheres by RNA-seq. The expression level of each gene in undifferentiated spheres was assigned to be 1, except for Gnat1, Gnat2, and Gnat3, which were undetectable. (B) Knockdown efficiency by lentiviral shRNA in enteric neurospheres. Neurospheres were infected by lentiviruses expressing nonspecific shRNA (non-shRNA), Gnaz-shRNA1, and Gnaz-shRNA2 for 48 h. qRT- PCR was performed to determine Gnaz knockdown efficiency (normalized to Gapdh). The Gnaz level of the control group was assigned as 100% for com- parison. Of the two shRNAs against Gnaz, Gnaz–shRNA2 achieved 64% knockdown efficiency and was used for experiments in Fig. 4; *P < 0.05 and **P < 0.01 by Student’s t test. Error bars, SEM.

Jin et al. www.pnas.org/cgi/content/short/1418629112 6of6