Effects of Altered Expression of the Sumo Conjugating Enzyme, UBC9 on Mitosis, Meiosis and Conjugation in Tetrahymena Thermophila Qianyi Yang Purdue University

Purdue University Purdue e-Pubs

Open Access Dissertations Theses and Dissertations

Fall 2014 Effects of altered expression of the sumo conjugating enzyme, UBC9 on mitosis, meiosis and conjugation in Tetrahymena thermophila Qianyi Yang Purdue University

Follow this and additional works at: https://docs.lib.purdue.edu/open_access_dissertations Part of the Biochemistry Commons, and the Molecular Biology Commons

Recommended Citation Yang, Qianyi, "Effects of altered expression of the sumo conjugating enzyme, UBC9 on mitosis, meiosis and conjugation in Tetrahymena thermophila" (2014). Open Access Dissertations. 395. https://docs.lib.purdue.edu/open_access_dissertations/395

This document has been made available through Purdue e-Pubs, a service of the Purdue University Libraries. Please contact [email protected] for additional information. Graduate School Form 30 (Revised 08/14)

PURDUE UNIVERSITY GRADUATE SCHOOL Thesis/Dissertation Acceptance

This is to certify that the thesis/dissertation prepared

By Qianyi Yang

Entitled EFFECTS OF ALTERED EXPRESSION OF THE SUMO CONJUGATING ENZYME, UBC9 ON MITOSIS, MEIOSIS AND CONJUGATION IN TETRAHYMENA THERMOPHILA Doctor of Philosophy For the degree of

Is approved by the final examining committee: James D. Forney

Scott D. Briggs

Mark C. Hall

Clifford F. Weil

To the best of my knowledge and as understood by the student in the Thesis/Dissertation Agreement, Publication Delay, and Certification/Disclaimer (Graduate School Form 32), this thesis/dissertation adheres to the provisions of Purdue University’s “Policy on Integrity in Research” and the use of copyrighted material.

James D. Forney Approved by Major Professor(s): ______Approved by:Clint Chapple 12/08/2014

Head of the Department Graduate Program Date

EFFECTS OF ALTERED EXPRESSION OF THE SUMO CONJUGATING ENZYME, UBC9 ON MITOSIS, MEIOSIS AND CONJUGATION IN TETRAHYMENA THERMOPHILA

A Dissertation Submitted to the Faculty of Purdue University by Qianyi Yang

In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy

December 2014 Purdue University West Lafayette, Indiana

I dedicate this dissertation to my parents and my husband for their constant support and unconditional love.

iii

ACKNOWLEDGEMENTS

First and foremost, my deepest gratitude to my research advisor Dr. James Forney, who introduced me to the wonders of the scientific world. I thank him for his guidance, support, patience and for providing me with an excellent atmosphere for conducting research. He is such a knowledgeable person and also humble at the same time. Being a primary resource for getting my scientific questions answered, he never made me feel my questions were stupid. His help was invaluable in the preparation of this dissertation.

I would also like to thank my committee members: Dr. Scott Briggs, Dr. Mark Hall and Dr. Cliff Weil for their guidance, encouragement, insights and useful comments.

I thank our collaborators, members of the Hall lab, for their expertise in protein biochemistry. Special thanks to Dr. Mark Hall and Brendan Powers for their help with the affinity purifications and mass spectrometry.

I also thank present and past members of Forney group, including all the undergraduates that I worked with over the years. You made me realize the impact a good mentor can make in the lives of their students. And Dr. Kim Kandl, who spent full two semesters in our lab on her sabbatical. I thank her for advice on research, as well as her advice on future careers. Her enthusiasm for science is contagious and I admire her persistence to answer scientific quandaries.

I would also like to thank people who were not directly involved in my project but helped me out in one way or the other, including Dr. Steve Broyles for his generosity in sharing equipment, Dr. Christie Eissler and Dr. Paul South for discussions on science, Kelly Sullivan, Michael Melesse and Aurélie Chuong who joined Purdue with me and have iv

been there for support, Kristi Trimble for taking such good care of graduate students in the department, and everyone in the Department of Biochemistry.

I also thank Dr. Jim Forney’s wife, Mrs. Nanci Forney, for making West Lafayette my second home. She took me out for shopping and she taught me how to bake and she made my life outside lab entertained. Things that I will miss a lot after I leave Purdue are her chocolate brownies, cheesecakes, and chocolate carrot cake which would fuel me for days on end.

I especially thank my parents for their unconditional love, care and support. Without them I would not be able to come this far. I know I can always count on my family in times of need.

One of the best decision I have ever made was to marry to Amjad Nasir, my husband and my soul-mate. He has been supportive of me at work and at home. I thank him for his understanding and encouragement and for being there by my side through the good times and rough ones.

TABLE OF CONTENTS

Page ACKNOWLEDGEMENTS ...... iii LIST OF FIGURES ...... vi LIST OF TABLES ...... viii ABSTRACT ...... ix CHAPTER 1 INTRODUCTION ...... 1 CHAPTER 2 DEPLETION OF UBC9 CAUSES DEFECTS IN SOMATIC AND GERMLINE NUCLEI IN TETRAHYMENA THERMOPHILA ...... 15 CHAPTER 3 IDENTIFICATION OF THE TETRAHYMENA THERMOPHILA UBC9P INTERACTOME ...... 40 CHAPTER 4 DISCUSSION AND FUTURE PERSPECTIVE...... 72 REFERENCES ...... 86 VITA ...... 96

LIST OF FIGURES

Figure Page Figure 1: SUMO conjugation pathway ...... 2 Figure 2: Tetrahymena life cycle ...... 13 Figure 3: Sequence alignment of Ubc9p from different species ...... 22 Figure 4: Generation of UBC9 knock-out strain by homologous recombination in Tetrahymena ...... 24 Figure 5: Depletion of UBC9 is vegetative lethal ...... 25 Figure 6: Generation of conditional UBC9 knockout cell lines ...... 27 Figure 7: Growth curve of UBC9 depletion strain ...... 29 Figure 8: Depletion of Ubc9p causes instability of nuclei ...... 30 Figure 9: Cells expressing dominant negative Ubc9p have multiple micronuclei ...... 31 Figure 10: Depletion of Ubc9p results in hypersensitivity to DNA damaging agents ...... 33 Figure 11: Localization of Ubc9p during conjugation ...... 34 Figure 12: Depletion of Ubc9p results in reduced paring ...... 36 Figure 13: Reduced expression of Ubc9p leads to stall in meiosis ...... 38 Figure 14: Tetrahymena cells expressing catalytic inactive Ubc9p arrested at macronuclear development stage ...... 39 Figure 15: Schematic drawing of dual tagged UBC9 ...... 45 Figure 16: Purification of Ubc9p interacting proteins from vegetative and mated Tetrahymena cells ...... 46 Figure 17: Coomassie staining affinity purified fractions ...... 47 Figure 18: Graphical representation of functional categories of Ubc9p and SUMO interacting partners in both vegetative and mated cells ...... 49 Figure 19: Overlap between Ubc9p interacting proteins in vegetative growth and conjugation ...... 50 vii

Figure Page Figure 20: Graphical representation of biological processes of Ubc9p interacting proteins in yeast ...... 51 Figure 21: Graphical representation of biological processes of SUMO interacting proteins in Tetrahymena ...... 81 Figure 22: Overlap between Ubc9p native purification and SUMO native purification during Tetrahymena vegetative growth ...... 82

viii

LIST OF TABLES

Table Page Table 1: Oligonucleotides used in this study ...... 21 Table 2: Expression of dominant negative Ubc9p reduces conjugation efficiency ...... 39 Table 3: Ubc9p interacting proteins identified from log phase vegetative cells ...... 52 Table 4: Ubc9p interacting proteins identified from 8-hour conjugating cells ...... 58 Table 5: List of Ubc9p conjugation-specific interacting proteins in Tetrahymena...... 64 Table 6: Putative “junk” proteins that appeared in three unrelated Tetrahymena purifications...... 67 Table 7: Comparison between numbers of proteins identified from vegetative vs conjugating Tetrahymena based on biological function ...... 77 Table 8: Numbers of Ubc9 interacting proteins identified from Ubc9p proteomics screens between Tetrahymena and yeast ...... 78 Table 9: Number of proteins categorized by biological functions from Ubc9p and SUMO proteomics screens ...... 82

ABSTRACT

Yang, Qianyi. PhD, Purdue University, December 2014. Effects of altered expression of the sumo conjugating enzyme, UBC9 on mitosis, meiosis and conjugation in Tetrahymena thermophila. Major Professor: James D. Forney

SUMOylation is a critical posttranslational modification in eukaryotic species. Ubc9p is the E2-conjugating enzyme for SUMOylation and consequently it influences multiple cellular pathways. Nuclear proteins are common targets of SUMOylation and regulate nuclear events such as transcription, DNA repair and mitosis. The segregation of the Tetrahymena thermophila genome into two different nuclear compartments provides an unusual context for the analysis of SUMOylation. Each cell contains a transcriptionally silent, diploid germ line micronucleus (MIC) that divides by mitosis and a polyploid transcriptionally active somatic macronucleus (MAC) that divides by an amitotic mechanism. With the long-term goal to exploit these opportunities we initiated studies of Ubc9p and therefore indirectly SUMOylation, on the functionally distinct nuclei in T. thermophila using genetic analysis combined with proteomics study. We found that complete deletion of the UBC9 gene is lethal. Rescue of the lethal phenotype with a GFP-UBC9 fusion gene driven by a metallothionein promoter generated a cell line with a

slow growth phenotype in the absence of CdCl2-dependent expression of GFP-Ubc9p. Altered expression of Ubc9p resulted in differential effects in MICs and MACs. MICs were lost from cells during vegetative growth but MACs were capable of division. Interestingly, cells expressing a catalytically inactive dominant negative Ubc9p (DN- Ubc9p) accumulated multiple MICs. Ubc9p depleted cells were hypersensitive to DNA damaging agents that promote double-strand DNA breaks. Additional studies point to critical roles for Ubc9p during the sexual life cycle of Tetrahymena. Crosses between cell lines expressing the dominant negative Ubc9p were delayed in meiosis and produced

fewer exconjugant progeny who successfully completed genetic exchange and conjugation than from wild-type controls. In contrast, cell lines that were depleted for Ubc9p did not form pairs and therefore could not complete any of the subsequent stages of conjugation including meiosis and macronuclear development. The results are consistent with roles for Ubc9p in mitosis, meiosis and double strand break repair. A proteomics-based approach generated an unbiased spectrum of Ubc9p interacting proteins during Tetrahymena vegetative growth and conjugation. We identified 128 high- confidence Ubc9p interacting proteins during Tetrahymena vegetative growth and 106 proteins during conjugation, among which 58 are conjugation-specific. Seven proteins with homologs in other species have been reported previously as SUMO substrates, or Ubc9p interacting proteins. The Ubc9p interactome covers a wide range of cellular processes, including chromatin remodeling, cell cycle progression, stress response, gene transcription and Tetrahymena macronuclear development, which further support our observations from phenotypic analysis. The findings provide evidence for distinct roles for SUMOylation in ciliate nuclei and provide opportunities for future studies of SUMOylated substrates in a context specific for gene expression (MAC) or mitotic and meiotic division (MIC).

CHAPTER 1 INTRODUCTION

SUMOylation SUMOylation is a reversible post-translational modification of lysine residues that targets a diverse set of proteins and regulates a wide range of pathways including mitosis, meiosis, transcription and DNA repair [1-4]. SUMO (Small Ubiquitin-related MOdifier) is a small polypeptide (75-89 amino acids) with structural similarity to ubiquitin [5]. It attaches via isopeptide bonds to lysine side chains through a series of enzymatic steps catalyzed by E1, E2 and E3 complexes that are analogous to but independent from those used for ubiquitin addition. Nevertheless, the functions of those two modifications are different. The primary (but not exclusive) function of ubiquitin modification is targeting proteins for proteolytic degradation, on the other hand, SUMOylation alters the intracellular localization, protein-protein interactions or other types of post-translational modifications of the target [1,3]. While most SUMO substrates are found in the nucleus, increasing evidence indicates that SUMOylation can regulate processes in the cytoplasm, membrane and mitochondria such as Ion channel activity, nuclear export/import, mitochondrial fusion [6-8]. SUMOylation has an emerging role as a key regulator in gene expression, chromosome stability, cell cycle regulation and DNA repair [1-4,9].

All eukaryotic SUMO proteins are expressed as precursor proteins that must be processed by a C- terminal hydrolase to expose the C-terminal di-glycine of the mature protein [10]. The mature SUMO reacts with ATP in the Uba2-Aos1 SUMO activating (E1) complex to form a SUMO-adenylate conjugate [11] that is subsequently attacked by

a conserved cysteine on the Uba2 subunit to form an Uba2-SUMO thioester bond [12] (Fig. 1). Next, SUMO is transferred from Uba2 to the E2 conjugating enzyme, Ubc9 [13], forming a thioester bond between the conserved catalytic site cysteine of UBC9 and SUMO C-terminal carboxyl group. Lastly, Ubc9p transfers SUMO to substrates, via an isopeptide bond formed between the SUMO C-terminal glycine residue and a lysine side chain contained within the substrate. This step is often assisted by a SUMO E3 ligase that enhances the transfer of SUMO from Ubc9p to targets. Many SUMOylation sites contain the consensus motif ψKXD/E (where ψ is a large hydrophobic residue, K is lysine, X is any residue, and D and E are aspartic acid and glutamic acid respectively). These residues directly interact with E3 and Ubc9p and therefore it has a critical regulatory role in stabilizing interactions between the E2 enzyme and the substrate [14]. However, it should be noted that not all ψKXD/E motifs are SUMOylated [3] and SUMO modification can also occur at other lysine residues.

Fig. 1: SUMO conjugation pathway. SUMO undergoes processing by SUMO proteases to expose a C-terminal Gly-Gly motif that is required for conjugation. The E1 complex, a heterodimer of Uba2 and Aos1, catalyzes a thioester bond between the C-terminal of mature SUMO and the catalytic cysteine in Uba2 an ATP-dependent manner. Then the SUMO is transferred from the E1 to the catalytic cysteine in the E2 enzyme (Ubc9), forming a SUMO-E2 thioester intermediate. Finally, SUMO is attached to the amino group of a lysine residue with in the substrate protein. This ligation reaction is assisted by an E3 enzyme. The SUMO protein can be released from the substrate by members of the SUMO protease (Ulp) family. This process is called deSUMOylation.

Substrate specificity of the SUMO pathway relies mostly on the single SUMO E2 enzyme and a handful of SUMO E3 ligases that have been identified [15-20]. Unlike Ubiquitin E2 enzymes, the SUMO E2 enzyme in vitro is able to recognize and conjugate SUMO to targets in the absence of E3 ligases [21]. However, SUMO E3 ligases enhance the specificity and efficiency of SUMOylation via two proposed mechanisms. First, the E3 ligase may orient the E2-SUMO thioester bond in a preferable conformation for catalysis without interacting with the substrate, as is the case for RanBP2 [22]. Alternately, the E3 enzyme could directly interact with the substrate by forming a complex with the E2-SUMO complex. The Siz and PIAS (Protein inhibitor of activated STAT) proteins (in humans) are E3 ligases that interact with E2 and SUMO through their SP-RING domain and Siz/PIAS C-terminal domains respectively [23,24] indicating that specificity is derived from the combination of interactions between E2, E3 and SUMO.

Substrate recognition can also be regulated by substrate phosphorylation. SUMO substrates can be phosphorylated at the site adjacent to a SUMO consensus motif, aptly termed phosphorylation-dependent SUMO motifs (PDSMs) (ψKX(D/E)XXSP where P is the phosphate moiety on a serine residue). Phosphorylation enhances SUMO conjugation both in vitro and in vivo [25,26] because the phosphorylated serine side chain interacts with a basic patch on the E2 surface, increasing interactions with E2 enzyme [27]. Phosphorylation of the transcription factor myocyte-specific enhancer factor 2A (MEF2A) by cyclin-depended kinase 5 (SDK5) within a PDSM enhances its SUMO modification, which further inhibits transcription and results in synapse maturation [28]. It should be noted that phosphorylation does not always occur within canonical PDSMs. Phosphorylation of NF-κB inhibitor α (IκBα) has been reported to inhibit modification by SUMO, and this phosphorylation occurs on a serine residue outside the PDSM [29].

SUMO E2 enzyme Ubc9 Ubc9 is the single E2 enzyme in the SUMO pathway. Loss of function studies of Ubc9p in different organisms suggest important roles for SUMOylation in cellular processes (described below). Although different phenotypes have been reported in

different species, these studies have revealed that both Ubc9p and the SUMO pathway play critical roles in mitosis, meiosis and DNA damage repair.

UBC9 and mitosis Ubc9 in known to regulate several aspects of mitosis including chromosome segregation, cell cycle progression, kinetochore assembly and cytokinesis [15,30-32]. Some of the first studies demonstrating the requirement of Ubc9p in mitosis were done in the budding yeast showing that depletion of Ubc9p prevents the cell cycle progression beyond the G2/M boundary [33]. Degradation of B-type cyclins Clb2 and Clb5, which are essential for exit from mitosis, requires the Ubc9p protein. In UBC9-depleted cells, CLB5 and CLB2 were significantly stabilized [33]. Most likely, this resulted from the absence of SUMO-targeted ubiquitin degradation that was not known at the time. In the same model system budding yeast, depletion of UBC9 causes cells to arrest with undivided nuclei and high levels of securin Pds1 which is an anaphase-promoting complex/C (APC/C) substrate, indicating that SUMOylation is also required for proper proteolysis mediated by APC/C [34,35]. In contrast, Schizosaccharomyces pombe cells lacking the UBC9 homologue Hus5 are viable but appear to arrest at S/G2 phase and show defects in chromosome segregation [35]. Similarly, in the fruit fly Drosophila melanogaster, one UBC9 mutant, termed semushi, suffers from wide-spread chromosome mis-segregation during embryogenesis [36]. In vertebrate Xenopus egg extracts, Topoisomerase II (TOP2) is modified by SUMO-2/3 exclusively during mitosis. Inhibition of SUMO modification by expression of a dominant-negative Ubc9p increases the amount of unmodified topoisomerase II retained on mitotic chromosomes and blocks the dissociation of sister chromatids at the metaphase-anaphase transition, indicating the importance of SUMO conjugation in chromosome segregation [37]. Conditional depletion of Ubc9p in chicken cell lines leads to an increase in cells with multiple or fragmented nuclei, indicating defects in cytokinesis [38]. In contrast to depletion of Ubc9p in fission yeast and budding yeast, most of the chick Ubc9p depleted cells commit apoptosis without arresting at any phase of the cell cycle, suggesting the apoptosis is triggered without activating cell cycle check-point mechanisms when chromosome damages are accumulated these cells [38]. Loss of Ubc9p in mice leads to embryonic

lethality in the early post-implantation stage [39]. In culture, homozygous null UBC9 mutant blastocysts are viable up to 2 days but subsequently die of apoptosis. Two types of mitotic chromosome defects were observed in embryonic Ubc9p deletion mutants: 1) a significant increase in the size of nearly all metaphase plates; 2) aberrantly segregating chromosome in anaphase. In addition, nuclear organization is grossly altered in Ubc9p mutant cells, such as disassembled nucleoli and promyelocytic leukemia (PML) nuclear bodies [39]

UBC9 and meiosis A few studies have demonstrated the role of UBC9 in meiosis. The first clue of SUMOylation in synapsis came from studies in hamster cells lines [40]. Yeast two-hybrid screens identified Ubc9p as a protein that interacts with the Cor1 and Syn1 components of the synaptonemal complex (SC). The SC is meiotic structure that promotes both genetic exchange between chromosome pairs and correct chromosome segregation to daughter cells during meiosis [40]. Additional studies showed that Ubc9p localized to meiotic chromosomes in S. cerevisiae and mice [41,42], which suggests that Ubc9p is associated with and regulates SC structure. A UBC9-GFP fusion led to meiotic defects. A diploid homozygous of UBC9-GFP mutant reduced meiotic division by 50% of the wild- type level and exhibited decreased sporulation [41]. SUMOylation is also important for timely synapsis. Synapsis in the same UBC9-GFP mutant was delayed significantly relative to that in the wild-type. At late times in the UBC9 mutant, chromosomes did eventually synapsed [41]. In mouse male germ cells, the Ubc9p homolog, UBE2I is localized to centromeres after SC disassembly [43], implying potential Ubc9p regulation in non-SC proteins. The yeast two-hybrid system was used to identify Ubc9 interacting protein in the basidiomycete Corprinus cinereus and revealed that Ubc9p interacts with the meiosis-specific RecA homolog, Lim15/Dmc1 (CcLim15) [44]. This interaction mediates SUMOylation of the C-terminus of CcLim15 during meiosis. Immunocytochemistry demonstrates that CcUbc9 and CcLim15 co-localize in the nuclei from the leptotene stage to the early pachytene stage during meiotic prophase I. These results suggest that SUMOylation is a potential mediator of meiotic recombination via interaction between Ubc9p and Lim15/Dmc1. Recently, Yuan et al showed that

inhibition of SUMO-1 or Ubc9p using a specific antibody or their depletion by specific siRNA microinjection in germinal vesicle (GV) - stage oocytes decreased the rates of GV breakdown and first polar body extrusion, causing defective spindle organization and misaligned chromosomes leading to aneuploidy in the mature oocyte [45]. In addition to Ubc9, other SUMO pathway components are known to be indispensable for meiosis. For example, the SUMO proteases Ulp1, when deleted, exhibits a cell cycle arrest phenotype at meiotic prophase [46], indicating that SUMO modification or removal is likely to have specific meiotic functions.

UBC9 and development In addition to its functions in mitosis and meiosis, UBC9 RNAi knockdown in Caenorhabditis elegans leads to embryonic arrest after gastrulation. Loss of Ubc9p also cause pleiotropic defects in larval development in worms that completed embryogenesis [47]. Reduction of maternal zygotic UBC9 during an early stage of zebrafish development leads to widespread cell death, but inactivation of zygotic Ubc9p transcription in the embryo causes defects in development, including brain, eyes and cartilage formation [48]. Together these studies indicate that in addition to regulating particular cellular processes, Ubc9p regulates developmental programs in multicellular eukaryotes.

UBC9 and DNA repair DNA lesions can occur through exogenous and endogenous agents. One of the continuous challenges of all organisms is to faithfully replicate their genomes and maintain them in an error-free state as they undergo cell division. DNA double-strand breaks (DSBs) represent the most destructive chromosomal lesion and may prove deleterious if left unrepaired [49,50]. All eukaryotic cells employ sophisticated cellular networks, collectively termed the DNA damage response (DDR) to constantly monitor genomic integrity. Increasing evidence suggests that the recruitment of these factors to the damage site, as well as their turnover is orchestrated by the crosstalk of post- translational modifications (PTMs) [51], and SUMO is one important player in this network that regulates the dynamics of DNA repair complexes [52]. Galanty et al showed

upon DNA damage SUMO-1 and Ubc9p accumulate at repair foci in a pathway that requires SUMO E3 ligases PIAS1 and PIAS4 [53]. Moreover, the recruitment of receptor associated protein 80 (RAP80), a key component in DDR pathway, requires PIAS1 and PIAS4. PIAS1 also affects the recruitment of RNF168, another component in DDR pathway, as well as its formation of polyubiquitylation [54]

There is increasing evidences for SUMOylation and Ubiquitylation cross-talk in DNA damage repair. A novel class of Ubiquitin ligases, termed SUMO-targeted Ubiquitin ligases (STUbL), mediates Ubiquitylation of SUMOylated proteins to target them for degradation by the proteasome [55-58]. One of the most extensively studied STUbLs is RNF4 [57-61]. In 2012, both Hay and Jackson laboratories uncovered RNF4- mediated SUMO-dependent protein degradation in DDR [62,63]. Cells in which RNF4 expression has been abolished are hypersensitive to DNA damage that requires Homologous Recombination for its repair, meanwhile, mice deficient in RNF4 display an accumulation of ionizing radiation-induced DNA damage. RNF4 recruitment to DNA damage sites requires its SIMs and RING domain, as well as DNA damage factors such as NBS1, MDC1, RNF8, 53BP1 and BRCA1. Without RNF4, these factors were still loaded to damage sites but 53BP1, RNF8 and RNF168 showed delayed removal from such foci. Cells lack of RNF4 displayed defective recruiting RAD51 on to single- stranded DNA, which appeared to be a consequence of reduced recruitment of single- strand-specific DNA-binding protein replication protein A (RPA) and the CtIP [CtBP(C- terminal-binding protein)-interacting protein] nuclease complex, resulting in inefficient reaction [62]. These studies indicate that RNF4 plays an important role in homologous recombination in DNA repair. Prior to the discovery of RNF4, two other RING-finger proteins in yeast, Slx5p and Slx8p, were identified as members of STUbL family. Both proteins are required for cellular survival following replication stress and deletion of either gene causes hydroxyurea sensitivity, meiotic defects and a slow growth phenotype [64].

DSBs are repaired primarily by two pathways: homologous recombination (HR) and non-homologous end-joining (NHEJ) [65]. HR is initiated by the MRE11-RAD50-

NBS1 (MRN) complex that stabilizes DNA ends, promotes the DNA resection, and triggers the recruitment of ATM [66]. DNA resection is carried out by CtIP [67]. In S and G2 phase, interaction between CtIP and BRCA1 facilitates DNA end processing [67]. Many other proteins, such as CDK, ATM, MRN, are also involved in the entire process of DSB resection [68,69]. Next, Rad51/Rad52 are loaded to DSBs where RPA binds to the ssDNA overhangs. Invasion of a resected end of the DSB into duplex DNA to form D-loop takes place in the Rad51 filament and both RPA and RAD52 help load Rad51 onto ssDNA to form filament [70]. The newly synthesized fragments ends joined by DNA ligases that form double Holliday Junctions (dHJs). It has been demonstrated that SUMOylation is involved in HR. SUMOylation of RPA has been detected in yeast and mammalian cells [69,71]. SUMOylation of Rad 52 by SUMO E3 ligase Siz2 stabilizes Rad52 and reduces the DNA binding and single-strand annealing activities of this protein [72,73].

Apart from repairing DSB damage, homologous recombination also helps restart stalled or collapsed replication forks. In this regard, SUMOylated proteins that are relevant to this process include members of RECQ helicase family: BLM (Bloom syndrome, RecQ helicase) [74], WRN (Werner syndrome, RecQ helicase) in higher eukaryotes [75], and Sgs1 in budding yeast [76]. However, it is very likely that not all SUMOylated proteins have been identified and how SUMO affects the activities of these proteins and subsequently leads to restart of replication forks is still largely unclear.

DSBs in budding yeast are mostly repaired by HR which is considered as a high- fidelity way because it essentially involves copying the missing information from its homologous chromosome in a diploid cell [77]. On the other hand, NHEJ, which is the more common DSB repair pathway in mammalian systems [78,79], involves holding broken ends together followed by re-ligation. NHEJ is an imperfect process from the standpoint of preserving genetic information because a few nucleotides at each end of the broken DNA are missing in most cases in mammals [80] and in many circumstances when it is used in yeast [81].

NHEJ starts with the Ku70/80 heterodimer binding to the ends of dsDNA at the site of the DSB [82]. DNA-PKcs is recruited to Ku proteins to form the active DNA-PK protein ligase [83]. Synapsis forms when two broken ends are held together by two DNA- PKcs molecules [84,85]. XRCC4/DNA ligase IV complex is recruited to DNA-PKcs to carry out processing and aligning DNA ends, as well as the DNA ligation [86]. Multiples NHEJ components are known to be SUMOylated. In humans, XRCC4 is SUMOylated [87] and XRCC4 mutants that cannot be SUMOylated are hypersensitive to radiation and fail to complete V(D)J recombination [87]. Ku70 is also SUMOylated in yeast. Ku70 SUMOylation deficiency is associated with short telomeres and internal breaks, as well as impaired ability to block DNA end resection and suppression of multiple defects caused by inefficient resection, which in turns alters levels of NHEJ [88].

SUMOylation and ribosome

Several studies showed that SUMOylation is required for pre-ribosomal complex formation in yeast and higher eukaryotes. Eukaryotic ribosomes are comprised of a small 40S subunit and a large 60S subunit, each of which contains distinct ribosomal proteins and ribosomal RNA (rRNA). Biogenesis of ribosomes is a tightly regulated process that involves a large numbers of non-ribosomal proteins, called trans-acting factors, as well as non-coding RNA species [89,90]. Ribosome biogenesis begins in nucleolus, where 47S rRNA is transcribed and assembled into large subunit called 90S pre-ribosome complex, which will further separate into 40S and 60S pre-ribosomes that mature independently in the nucleolus and cytoplasm. In 2006, Panse et al used a proteomic approach to show that SUMO targets several trans-acting factors along the 40S and 60S synthesis pathway, including Ytm1, Nop7 and Rix 1 [91]. When components of SUMO conjugation or deconjugation are inactivated, several defects in ribosome maturation were observed. For example, ULP1, which is a SUMO isopeptidase that is homologous to the human SENP family, is required for early and late pre-rRNA processing and nuclear export of 60S particle [92]. In humans, deletion of human SUMO-specific-isopeptidase SENP3 strongly inhibits the nucleolar processing of 32S rRNA to the 28S rRNA and precludes the subsequent steps of pre-60S maturation [93,94].

SUMOylation and transcription regulation Transcription factors are a prominent class of proteins targeted by SUMOylation. A growing number of SUMO substrates are now allowing attempts to dissect mechanism of SUMOylation on transcription in detail. Many studies have led to the conclusion that SUMO modification of transcription factors have a role in transcriptional repression [95,96]. Also the fact that recruitment of Ubc9p to promoter sequences is sufficient to repress transcription further supports this idea [97]. The tumor suppressor ING1b is SUMOylated at Lysine 193 in human [98]. The SUMO attachment to ING1b regulates its binding to the ISG15 and DGCR8 promoters, which regulates ISG15 and DGCR8 transcription [98]. Forkhead box transcription factor M1 (FoxM1) is SUMOylated in mice [99]. FoxM1 is a key regulator of cell-cycle progression and chromosome segregation. SUMOylation-deficient FoxM1 mutant is less active compare to wild-type FoxM1, indicating that SUMOylation of FoxM1 enhances its transcriptional activity [99]. Increased global acetylation was observed in yeast with reduced SUMOylation due to down-regulation of UBC9 which is consistent with the role of SUMOylation in repressing transcription given the association between acetylation and gene transcription activation [100]. Alongside with evidences of SUMO in transcription repression, there are also a few reports where SUMO has been shown to activate transcription. For example, SUMOylation of p53 results in an increased transactivation of p53, which suggests a novel mechanism to regulate p53 activity [101,102]

UBC9 autoSUMOylation SUMOylation of Ubc9p has been observed in mammalian cells in vitro [103-105]. SUMOylation of Ubc9p was also observed in yeast in the analysis of global SUMOylated proteins [106,107]. Studies by Knipscheer et al have revealed that Ubc9p is SUMOylation at Lys-14 in mammalian cells regulates target discrimination [105]. SUMOylation of Ubc9p does not seem to affect Ubc9-SUMO thioester bond formation but rather alters the capability of Ubc9p to modify particular SUMO substrates. For example, SUMOylation of Ubc9p impairs SUMOylation of RanGAP1 and strongly activates SUMOylation of the transcriptional regulator Sp100, whereas its activity toward HDAC4, E2-25K, PML, or TDG is not changed. Hwang et al report that SUMOylation of

Ubc9p in yeast negatively regulates SUMOylation of septins and Ubc9p autoSUMOylation is important for maintaining cell morphology [108]. Interestingly, Sp100 contains a SUMO interaction motif (SIM), a non-covalent SUMO binding mechanism, which is required for the enhanced SUMOylation of Sp100 by Ubc9p autoSUMOylation [105]. This suggests that SIM-mediated recruitment of SUMOylated Ubc9p to substrates may represent a novel mechanism of substrate specificity. More recently, studies by Klug et al have identified Ubc9p SUMOylation as a key regulatory step for synaptonemal complex (SC) formation. Yeast containing a Ubc9p mutant that could not be SUMOylated showed a significant reduction of SUMO conjugants during meiosis and failed to form a synaptonemal complex [109]. This study has revealed a mechanism for E2 regulation that orchestrates catalytic and non-catalytic functions of Ubc9.

In addition to the covalent interaction between Ubc9p and SUMO, Ubc9p also interacts with SUMO in a non-covalent manner, where SUMO interacts with Ubc9p at its N-terminus rather than the Cysteine active site [110]. It has been shown that non-covalent Ubc9p-SUMO interaction promotes SUMO chain formation in yeast [111], but other than that the role of this interaction is largely obscure.

Tetrahymena provides advantages in studying SUMOylation Tetrahymena thermophila is a ciliated unicellular eukaryote. Like other ciliates Tetrahymena displays “nuclear dimorphism”; the germ-line and somatic genomes are segregated into separate nuclei called the micronucleus (MIC) and macronucleus (MAC) respectively. The diploid micronuclei possess features of typical eukaryotic nuclei; they divide by mitosis during vegetative cell division and undergo meiosis during sexual reproduction, also known as conjugation. The micronucleus is transcriptionally inert and gene transcription is limited to the macronucleus, which is composed of an amplified subset (45 copies) of the sequences present in the MIC. Both nuclei replicate their genomes and divide during vegetative growth, but the MAC divides by an amitotic process.

Vegetative cell division MICs and MACs replicate their DNA at different points in the cell cycle [112,113]. In non-dividing cells, the MIC rests in a pocket in the MAC. Division of the MIC starts first, followed by amitotic division of the MAC that does not have functional centromeres. When mitosis starts, the MIC becomes spindle shape and is still half- attached to the MAC. Next, the MIC is detached from the MAC and becomes a thin thread, which quickly becomes shortened and disappears, leaving the MIC directly attached to the cortex on one end and to the MAC on the other end. In the meantime, the MAC moves from its central position to a place near the cortex adjacent to the MIC. The spindled MIC then gets stretched and divides and returns to the MAC following cytokinesis. During MAC amitotic division, the MAC shape becomes irregular for a short period of time and then becomes rod shape followed by its fission that coincides with the division of the cell.

MAC chromosomes segregate randomly between the two daughter cells during division, as a result, heterozygous progeny will become pure for one allele or the other [114]. This phenomenon is called phenotypic assortment and it can be utilized to generate a MAC gene knockout in Tetrahymena if the gene is not essential for vegetative growth.

In Tetrahymena, nuclear dimorphism allows the creation of cells that are genetically different in the MIC and MAC [115]. Combined with phenotypic assortment, scientists are able to construct genetically useful strains that carry a non-expressed mutation in the MIC but express only the non-expressed mutant in MAC, which can be either homozygous or heterozygous. Mutations in essential genes can be maintained as heterokaryons, containing the lethal mutation in the MIC and a wild-type MAC. Only after mating will the lethal genotype be expressed in the newly formed MAC that is generated from the MIC genome.

Conjugation Conjugation is the sexual stage of the Tetrahymena life cycle. Cells must be starved for a period of time in order to be mating reactive. Mating pairs form between two cells of different mating types. There are two primary events during conjugation:

meiosis and macronuclear development. MIC meiosis starts at ~2h after cells are mixed. It elongates to form an unusual crescent shaped MIC that corresponds to meiotic prophase, during which chromosome pairing and recombination occurs. Following the crescent stage, the chromosomes condense and standard meiotic divisions occur, giving rise to four haploid products, one of which is selected for survival and the other three are destroyed. The selected meiotic product undergoes mitosis to produce two identical haploid pronuclei, one of which remains in the cell and the other is transferred to the mating partner. The migratory and resident nuclei in each cell fuse producing one diploid zygotic MIC in each partner. The zygotic MIC undergoes two rounds of mitosis, generating four diploid nuclei, one of which develop into MICs and two become MACs. Eventually, the parental MAC condenses and is degraded (Fig. 2).

Fig.2: Tetrahymena life cycle. Cells of two different mating types are mixed and pair at 1.5 hours post-mixing. MIC undergoes meiosis by elongated into a crescent shape, which corresponding to meiotic prophase I. MIC then will divide twice, generating four haploid nuclei, only one of which is selected and retained. This round of division is terms prezygotic division. The surviving progeny will form a zygotic nuclei with its counterpart from its partner. Events involved in this process include chromosome pairing and cross- over. Two post-zygotic mitosis produce four diploid, two of which develop into new MACs and two of which will become new MICs. During this time, massive DNA rearrangement occur. After feeding, the first cell division occurs as the cells return to vegetative growth.

As the macronuclear anlagen develops, the genome undergoes a massive reorganization. The five micronuclear chromosomes are broken down into approximately 180 macronuclear chromosomes [116]. The single-copy of micronuclear rDNA is amplified to a copy number of about 10,000 per cell [117]. Approximately 6000 specific

DNA elements, called internal eliminated sequences (IES) are removed from the genome, at the same time the genome in the macronuclear anlagen undergoes several rounds of DNA replication without cell division, resulting in a total of approximately 45 copies of each MAC chromosome.

IES elimination is an extensively studied process in Tetrahymena [118,119]. The removal of these elements is accompanied by the generation and ligation of DNA DSBs, which makes Tetrahymena a wonderful system to study DSB repair.

IES elimination is an RNA-directed event, which depends on the RNA interference pathway. The genome of the micronucleus is bidirectionally transcribed early in conjugation. The resulting double-strand RNA is processed by a Dicer-like enzyme to 28bp scanRNA (scRNA), which are incorporated into a complex containing an argonaute protein Twi1p [120]. The mechanism for scRNA identification of DNA that should be eliminated during MAC development is not fully established, but the current model has the following features. The parental MAC genome is scanned by the scRNA complexes and those complexes containing scRNAs with homology to macronuclear sequences are degraded. The remaining complexes that are complementary to MIC- limited sequences are transported to the developing macronucleus, where they identify their homologous DNA sequence and induce formation of specialized heterochromatin that is subsequently excised from the germline genome [118,119].

The synchronous molecular events of Tetrahymena conjugation including meiosis, RNAi scanning, programmed double strand DNA breaks and repair provide a potential rich system for the analysis for SUMOylation.

CHAPTER 2 DEPLETION OF UBC9 CAUSES DEFECTS IN SOMATIC AND GERMLINE NUCLEI IN TETRAHYMENA THERMOPHILA

Introduction Post-translational modification by Small Ubiquitin-related MOdifier (SUMO) is a major regulator of protein function. The mechanism of SUMO attachment to substrates shares common features with ubiquitin but unlike ubiquitin, which primarily targets proteins for proteasome-mediated protein degradation, SUMOylation alters the intracellular localization, protein-protein interactions or other types of post-translational modifications of the target [2,4]. The importance of SUMOylation as a modification is evident in its regulation of progression through the cell cycle, transcription, subnuclear architecture, chromosome stability, and nuclear-cytoplasmic transport, mitosis and meiosis, and DNA damage repair [1,3,9,53]. SUMO proteins are ubiquitously expressed across eukaryotes and proteins required for SUMOylation, such as Uba2p and Ubc9p, are highly conserved from yeast to human. Like ubiquitin, SUMO proteins are expressed as precursors that need to be proteolytically processed by C-terminal hydrolases to expose a C-terminal Gly-Gly motif which participates in the isopeptide bond with lysine residue on substrate proteins [12]. The mature SUMO proteins are activated by the heterodimeric E1 activating enzyme comprising Aos1p-Uba2p subunits [11] in an ATP-dependent reaction. Subsequently, SUMO is transferred from the E1 enzyme active site Cys to a Cys residue-linked thioester bond in the E2 enzyme known as Ubc9p [13]. In the last step, SUMO is attached to the target protein through a Lys-linked isopeptide bond. In vitro, conjugation of SUMO onto substrates can be done directly by Ubc9p; in vivo, E3 ligases increase the specificity and efficiency of the reaction [29,121].

Ubc9 is the only known SUMO E2 enzyme and therefore a key modulator of SUMOylation. Ubc9p was first described as an essential protein for mitosis in fission yeast [33]. Studies in several eukaryotes highlight its importance in multiple aspects of mitosis, including chromosome integrity and segregation, cell cycle progression, kinetochore assembly, and cytokinesis [35,39,122]. In Xenopus egg extracts the dissociation of sister chromatids is blocked at the metaphase-anaphase transition when SUMOylation of topoisomerase-II is inhibited by a dominant negative Ubc9p [37]. Loss of Ubc9p in mice leads to embryonic lethality during the early post-implantation stage and results in selective apoptosis of cells of the inner cell mass (ICM) in blastocysts [39]. Reduction of Ubc9p activity in zebrafish also shows that Ubc9p is required for G2/M transition and progression through mitosis during vertebrate organogenesis [48].

Apart from its function in mitosis, UBC9 has also been shown to be involved in DNA damage repair and tumorigenesis. SUMOylation has been demonstrated to play important roles in the repair of DNA double-strand breaks (DSBs) via Homologous Recombination (HR) and Non-Homologous End-Joining (NHEJ). For example, as key components of HR machinery, both Rad51 and Rad52 are shown to interact with both SUMO1 and Ubc9p [42,73,123]. Depletion of Ubc9p causes signiﬁcant disruption of Rad51 intracellular trafﬁcking, which causes the inhibition of Rad51 nuclear foci induced DNA damaging agents [124]. SUMO1/2 and Ubc9p are shown accumulated to the DSBs, suggesting their roles in DSBs repair [53].

Although investigations of SUMOylation in ciliated protozoa have lagged behind other species, they offer a unique platform for studies of nuclear functions of SUMOylation. Like other ciliates Tetrahymena thermophila displays “nuclear dimorphism” where germ-line and somatic genomes are separated in the micronucleus (MIC) and macronucleus (MAC) respectively [125]. The diploid micronuclei possess features of typical eukaryotic nuclei; they divide by mitosis during vegetative cell division and undergo meiosis during sexual reproduction, also known as conjugation. Unlike a typical eukaryotic nucleus, the micronucleus is transcriptionally inert and gene transcription is limited to the macronucleus, which is composed of an amplified subset

(~45 copies) of the sequences present in the MIC. Both nuclei replicate their genomes and divide during vegetative growth, but the MAC divides by an amitotic process. Previous studies demonstrated that RNAi gene silencing of UBA2 and SUMO in Paramecium tetraurelia had little effect on vegetative cells but prevented the excision of short regions of DNA called internal eliminated sequences (IESs) during formation of the somatic macronucleus [126].

We initiated this study to evaluate the contribution of Ubc9p, and therefore indirectly SUMOylation, on the functionally distinct nuclei in Tetrahymena. We found that complete deletion of UBC9 was lethal, but reduced expression of Ubc9p resulted in distinct phenotypes in MICs and MACs. The MICs were lost from cells during vegetative growth and MACs were capable of division. However, cells expressing catalytically inactive dominant negative Ubc9p (DN-Ubc9) have multiple MICs. Ubc9p depleted cells also were hypersensitive to DNA damaging agents that promote double-strand DNA breaks. Additional studies point to critical roles for Ubc9p during the sexual life cycle of Tetrahymena. Crosses between cell lines that express the dominant negative Ubc9p were delayed in meiosis and resulted in fewer true exconjugant progeny than from wild-type controls. In contrast, cell lines that were depleted for Ubc9p did not form pairs and therefore could not complete any of the subsequent stages of conjugation including meiosis. The findings provide evidence for distinct roles for SUMOylation in ciliate nuclei and provide opportunities for studies of SUMOylated substrates in a context specific for gene expression (MAC) or mitotic and meiotic division (MIC).

Materials and Methods

Strains and cell culture. Tetrahymena thermophila cell lines were obtained from the Tetrahymena Stock Center (Cornell University, Ithaca, NY). Cells were cultured in 1×SPP media (2% proteose peptone, 0.1% yeast extract, 0.2% glucose and 0.003%

FeCl3) at 30 °C according to established procedures [127]. Inbred wild type strains B2086 (mpr1-1/mpr1-1 [mpr1; mp-s, II]) and CU428 (mpr1-1/mpr1-1 [MPR1; mp-s, VII]) were used for cell transformation and all other analysis. Star strains B*(VI) and

B*(VII) that possess defective micronuclei but wild-type macronuclei were used for generating UBC9 homozygous germline knockout strains [115,128-130]

Construction of plasmids. A Tetrahymena UBC9 knockout construct (pUBC9KO) was generated by ligating UBC9 flanking sequences into pMNBL, which contains a neomycin selectable cassette expressed via the metallothionein 1 (MTT1) promoter from T. thermophila [131]. UBC9 upstream sequences (1202 bp; 354,009 to 355,211 of scaffold 8254664) were amplified by PCR using phusion DNA polymerase (Thermo Fisher Scientific), genomic DNA template from wild-type strain B2086 and the knockout cassette primers shown in Table 1. The PCR product was cloned into the unique XhoI and BglII restriction sites of pMNBL. The corresponding downstream flanking sequences (1404 bp; 356,442 to 357846 of scaffold 8254664) were amplified and cloned into the unique BamHI and NotI restriction sites. The bacterial neomycin gene, which confers paromomycin resistance (pm-r) on transformed cells, is expressed from the CdCl2 (Cd)- inducible MTT1 promoter.

A GFP-UBC9 fusion construct was made in a pENTR Gateway plasmid (Life Technologies). The 997 bp coding region of the UBC9 gene (TTHERM_00522720) from the second codon to the TGA stop, was PCR amplified and cloned into the pENTR-D entry vector. The gene cassette in the entry vector was then inserted into a pBS-MTT- GFP-gtw destination vector (Doug Chalker, Washington University, St. Louis, MO) using the LR recombinase in the Gateway cloning system (Life Technologies). Successful insertion of GFP-UBC9 fusion gene at the rpl 29 locus confers cycloheximide resistance.

Endogenous C-terminal mCherry fusions were made in the plasmid pmCherryLAP-NEO2 as described previously [132]. Approximately 1 kb of the 3’ end of UBC9 gene was ligated into the KpnI and NotI sites adjacent to the mCherryLAP tag and 1 kb of the 3’ downstream sequence was placed adjacent to the NEO2 selectable marker, which confers paromomycin resistance.

The dominant negative UBC9 (pDN-UBC9) construct was generated by inserting an N- terminal (His)6-FLAG tagged version of UBC9 containing a mutation of the catalytic cysteine in the 100th position to a serine residue. The gene was chemically synthesized by IDT (Coralville, Iowa) with BsiWI and ApaI restriction sites adjacent to the 5’ and 3’ coding regions respectively. The coding region was then inserted into the plasmid pBS- MTT-YFP-gtw (obtained from Doug Chalker, Washington University, St. Louis) after digesting with BsiWI and ApaI. The construct was linearized by HindIII digest and transformed into Tetrahymena. This plasmid integrates adjacent to the rpl29 locus and confers resistance to cycloheximide (12.5 µg/ml).

Construction of UBC9 germline knockout. Plasmid pUBC9KO was purified using a Qiagen Plasmid Maxi kit (Qiagen) and was linearized with XhoI and NotI digestion. The DNA was coated with 0.6 mM gold particles (S550d DNAdelTM Gold carrier particles, Seashell Technology, LLC) and introduced into mating B2086 and CU428 populations 2.5 to 3.5 h post-mixing [133] by biolistic bombardment as described previously [134]. Putative transformants with UBC9 disrupted (ΔUBC9) within micronuclei were selected by growth in the presence of paromomycin (100 µg/mL) followed by 6-methylpurine (7.5 µg/mL). The heterozygous (ubc9::neo3/ubc9 [pm-r]) transformants were crossed to star strains B*VI and B*VII to generate two homozygous germ line-knockout heterokaryon strains, BVI ΔUBC9 (ubc9::neo3/ubc9::neo3 [VI, UBC9+ pm-s]) and BVII ΔUBC9 (ubc9::neo3/ubc9::neo3 [VII, UBC9+ pm-s]). Star strains contain defective micronuclei that do not contribute meiotic products in the cross and therefore result in endoduplication of the haploid genome from the heterozygous micronuclear knockout strain and generation of a homozygous knockout MIC genome. Star crosses do not complete conjugation, they maintain their parental MAC and the progeny of the Star parent contains a wild-type MAC with a homozygous knockout MIC. BVI and BVII ΔUBC9 germ line-knockout heterokaryons were crossed to obtain progeny that are complete ΔUBC9 homozygous homokaryon strains. These cells were used for phenotypic analyses with the initially generated complete micronuclear and macronuclear knockout lines described above. Elimination of the UBC9 gene was confirmed by genomic PCR (Fig. 4C) and genetic crosses to wild-type strains (Fig. 5).

Generation of Conditional UBC9 mutant line. The pGFP-UBC9 construct that inserts adjacent to the Rpl29 locus was biolistically transformed [133] into mated heterokaryon homozygous ΔUBC9 cells at 8 hours post-mixing. Transformed cells were selected with

12.5 µg/mL cycloheximide and induced with CdCl2 to initiate the expression of the GFP- UBC9 fusion gene. The knock out heterokaryon parents of the cross have wild-type paromomycin sensitive MACs. The cycloheximide resistant, GFP-Ubc9p progeny of the cross were tested for paromomycin resistance to demonstrate successful mating and generation of the new Ubc9p knock out MAC.

Isolating DNA, RNA and RT-PCR. Genomic DNA was isolated by Phenol: Chloroform extraction followed by isopropanol as described previously [134]. Wild-type Tetrahymena thermophila strains B2086 and conditional UBC9 KO strains were used for isolation of total RNA using Qiagen RNeasy mini kit (Qiagen) supplemented by a QIAshredder for cell homogenization. For RT-PCR, approximately 1 µg of RNA was used for the first-strand cDNA synthesis (qScriptTM cDNA supermix, Quanta Biosciences) using gene specific primers that amplify wild-type UBC9 (UBC9WT5’UTRF and UBC9WT5’UTRR shown in Table 1).

Fluorescence microscopy. Approximately 1 ml of vegetative or conjugating cells were concentrated to 106 cells/ml by low speed centrifugation (1,100g), fixed for 30 minutes with one volume of 4% paraformaldehyde, washed once in 10 X phosphate-buffered saline (PBS, 1.37 M NaCl, 27 mM KCl, 100 mM Na2HPO4 and 18 mM KH2PO4) then stained with DAPI at 1 µg/ml (4′, 6′-diamidino-2-phenylindole; 1 μg/ml) for 10 minutes. Cells were then examined under fluorescence microscopy (Olympus BX51 TF model microscope).

Growth rate test. Ubc9p conditional mutant strains were first cultured overnight in SPP media with 0.1 µg/ml CdCl2 and then transferred to 10 ml SPP medium at a concentration

of 200 cells/ml in the presence or absence of 1 µg/ml CdCl2. Cell populations were measured by direct cell counts at 0, 4, 8, 18, 24 and 48 hours using a hemocytometer.

Drug sensitivity test. Ubc9p conditional mutant cells and wild-type B2086 cells were cultured in SPP medium in the presence of 1.0 ug/ml CdCl2 or no CdCl2 for 24 h and treated with 8 mM Methyl MethaneSulfonate (MMS) or 2 mM cisplatin for 2 hours respectively and then washed twice with 10 mM Tris-Cl pH7.5. Single cells were isolated

into drops containing 0.5 µg/ml CdCl2. After 48 hours, the number of cells in each drop was counted. Drops containing fewer than 10 cells were considered non-viable, drops with more than 500 cells were considered viable.

Pairing efficiency test. UBC9 conditional mutants and wild-type were cultured in SPP for 16 hours, harvested at 1,100 g, washed twice with 10 mM Tris pH7.5 and starved in the presence of 0.05 µg/ml or no CdCl2 for 16-24 hours at 30 degrees. Two different mating types were mixed (time 0) and samples of 200 µl were fixed with the addition of 200 µl 4% paraformaldehyde and counted for pairing efficiency. 100 cells were scored at 2, 4, 6, and 8 hours post-mixing. Pairing efficiency was calculated by counting the number of mating pairs and multiplying by 2 (2 cells per pair) then dividing by the total number of cells.

Table 1. Oligonucleotides used in this study. Purpose Name Sequence

Knockout cassette UBC9 5’flankF GTCACTCGAGAGGAACCTATGCCGTATTAGATACA UBC9 5’flankR GACTAGATCTGTTTAAATAAATAAGTAAGCAGGTAGCTGC T UBC9 3’flankF TTAGGGATCCGTAAGAGAATTTGCTGAAACCATG UBC9 3’flankR ATTAGCGGCCGCAGCCTATTCGATCATTATTT

PCR to confirm knockout lines UBC9KOupstreamF TTGTTATCCTTATGACCAAATTTTCTA

UBC9WTupstreamR TGAGCCTAATATTGATAGTCCTGCT MTTpR TTTGCTAACCATAGCCAAAAT

RT-PCR assay of conditional lines UBC9WT5’UTRF TCAATTCAGATTCAGCGAAA UBC9WT5’UTRR GCTGATTTCCAATCTTCTTCC UBC9CodingF+start ATCGGGTACCATGTAGCAACAAAATA UBC9CodingR-stop ACTGGAATTCGTCTTTTTTTTTCATGGT

GFP-UBC9 construct UBC9–startF CACCTAGCAACAAAATAAAGAAGTAAATGAATTAG UBC9+stopR TCAGTCTTTTTTTTTCATGGTTTCAGCAAA

UBC9-mCherry construct UBC9CodingF+start ATCGGGTACCATGTAGCAACAAAATA UBC9CodingR-stop ACTGGAATTCGTCTTTTTTTTTCATGGT

UBC93'FlankF ATCGGCGGCCGCAAAATTCACAAATTAAA UBC93'FlankR TGACGAGCTCAAAGGAGAGAACCAA

Results

UBC9 is an essential gene. We identified a single UBC9 homolog in the Tetrahymena genome. Searches of the Tetrahymena Genome Database (http://ciliate.org/index.php/home/welcome/) with UBC9 orthologs from S. cerevisiae, S. pombe and D.melanogaster revealed the same top Blast hit (TTHERM_00522720). Reciprocal searches of the S. pombe and D. melanogaster genomes using the Tetrahymena ortholog identified the corresponding UBC9 genes as the top Blast hits. The Tetrahymena UBC9 deduced amino acid sequence has approximately 55% identity with UBC9 orthologs from yeast and Drosophila. The deduced amino acid sequence contains the conserved catalytic cysteine residue found in other Ubc9p proteins [135] and was 87% identical across the conserved catalytic domain (Fig. 3).

Figure 3. Sequence alignment of Ubc9 from different species. Dark shading represents residues with high identify across all species. Light shading indicates less conserved residues. The sequences and accession numbers of Ubc9p are as follows: H Sapiens, NM_194261.2; M. musculus, NM_001177610.1; X. laevis, NM_001087289.1; D. rerio, BC059506.1; D. melanogaster, AB017607.1; S. cerevisiae, Z74112.1; I. multifiliis, XM_004034933.1; P. tetraurelia, XM_001430839.1; T. thermophila, GG662717.1. Arrow is pointing to the cysteine active site residue.

Previous studies in budding yeast, nematodes, plants and mice have shown UBC9 is an essential gene [13,48,136]. An exception is S. pombe wherein the deletion of hus5 (UBC9 homolog) causes severe mitotic defects and slow growth but cells can survive [35]. To determine if UBC9 is essential in Tetrahymena, micronuclear (germline) UBC9 knockout

cell lines were constructed. Sequences flanking UBC9 were amplified by PCR and cloned into plasmid pMNBL, which contains a neomycin resistance gene (neo3) that is driven by the inducible promoter from the metallothionein 1 gene (MTT1) (Fig.4A). The knockout construct was introduced into Tetrahymena using standard biolistic transformation procedures [134]. The transformed cells were selected for paromomycin resistance and then crossed to a test strain to confirm germline integration. Finally the heterozygous UBC9 deletion strains were mated with a star strain which contains a defective micronucleus. This results in duplication of one of the haploid copies of the MIC genome but these cells do not complete conjugation so they maintain a wild-type MAC. The resulting cell lines are either wild-type (and investigated further) or homozygous knock out heterokaryons with UBC9 deletions in the MIC but wild-type MACs (Fig. 4B). Phenotypically these cell lines are paromomycin sensitive (wild-type MAC), but PCR amplification generated the expected 481bp product derived from the neo3 insertion in the MIC (Fig. 4C). Two homozygous ΔUBC9 heterokaryons cell lines were mated to generate complete deletions in both the MIC and MAC in the daughter progeny. Individual pairs were isolated and placed in drops with nutrient medium. The majority of cells that survived conjugation subsequently died 8-9 cell divisions after mating (Fig. 5). The remaining 19 drops contained live cells after 72 hours but these could results from a failure to complete conjugation and form a new ΔUBC9 MAC. The drops were replica- plated to medium containing 6-methypurine in order to identify true exconjugants that have successfully completed conjugation by exchanging genetic material and forming a new MAC. All 19 drops were sensitive to 6-methylpurine which shows they are not UBC9 complete deletions. This result demonstrates that the UBC9 gene is essential for vegetative cell viability. Presumably cells survive for several fissions after conjugation (with the formation of a new MAC) because Ubc9p from the parental cell is stable and is gradually diluted to progeny cells. The results also demonstrate that there is no requirement for expression of the UBC9 gene from the developing MAC to complete conjugation.

Fig. 4: Generation of UBC9 knock-out strain by homologous recombination in Tetrahymena. (A) Sequences flanking UBC9 were PCR amplified and cloned into the pMNBL plasmid [131].The plasmid was digested with NotI and XhoI to yield a fragment capable of homologous recombination with the complementary sequence on the chromosome. The shaded portion of the knockout construct represents the neomycin 3 cassette [131] that includes the neomycin resistance gene (NeoR) and metallothionein promoter (MTTp). PCR primers used to assay integration of the NeoR cassette – one set specific for the KO allele and the other specific for the wild-type allele – are shown. (B) Schematic of the genetic cross to generate UBC9 knockout heterokaryon strains containing homozygous UBC9 deletions in the micronucleus and a wild-type macronucleus. The heterozygous ΔUBC9 cell line was crossed to a star strain resulting in a homozygous micronuclear genome (see text for additional details). (C) PCR analysis of UBC9 heterokaryon strains. PCR amplification using the primers shown in panel A was followed by separation of the products on an agarose. The homozygous heterokaryon UBC9 KO strains generated a knockout product of 480 bp (lanes 5-8) despite a neomycin sensitive (wild-type MAC) phenotype. The wild-type strains yielded only the 291 bp wild-type product as expected (lanes 1-2).

Fig. 5: Depletion of UBC9 is vegetative lethal. Complete deletion strains of UBC9 (MIC and MAC) were generated by mating two homozygous germ-line knockout heterokaryon strains. All progeny of UBC9 deletion strains died approximately 8-9 cell divisions after conjugation. Progeny of UBC9 heterokaryon knockout and wild-type cells were viable and their successful conjugation confirmed by showing paromomycin resistance.

Generation of a cell line with conditional Ubc9 expression. The lethal phenotype of UBC9 complete deletion strains provided limited opportunities for the molecular analysis of Ubc9p function. To circumvent this problem we created a cell line with conditional expression of Ubc9p. The strategy involved mating UBC9 homozygous heterokaryons strains and then transforming those cells with a green fluorescent protein GFP-UBC9 fusion gene regulated by the Tetrahymena thermophila metallothionein 1 gene promoter (Fig. 6A). The GFP-UBC9 transgene was introduced into the progeny of mated homozygous heterokaryon Tetrahymena at 8 hours post-mixing when cells begin to generate new MACs. Insertion of transgene into the Rpl29 locus in anlagen confers cycloheximide resistance [137]. Transformants were selected with cycloheximide and induced with CdCl2 to initiate the expression of the GFP-UBC9 fusion gene. The resulting cell lines were GFP positive and paromomycin resistant as expected for the progeny of the homozygous heterokaryon parents. As predicted by Ubc9p localization in other species, we observed nuclear localization when cells were grown in the presence of

CdCl2 (Fig. 6B, middle and right panel). In order to verify GFP-UBC9 CdCl2-dependent

regulation, conditional mutants were grown in the medium without CdCl2 and in the

presence of two different concentrations of CdCl2. Cells were fixed with 4% paraformaldehyde and examined using fluorescent microscopy. As shown in Figure 6B

(left panel) no fluorescence signal can be detected in the cells cultured without CdCl2, consistent with the low level of MTT promoter activity in the absence of heavy metal. On the other hand, an increasing fluorescent signal was observed in the nucleus when the cells were cultured in 0.1 mg/ml or 1.0 mg/ml CdCl2 (Fig. 6B, middle and right panel). RT-PCR was carried out to confirm the transcript of UBC9. Two sets of primers were designed and indicated in schematic drawing (Fig. 6C). The first set was used to detect UBC9 transcript at endogenous locus. One primers was in 5’ UTR of endogenous UBC9 and the other primer was inside UBC9 coding region (Fig. 6C, indicated by arrow heads). The second set of primer was used to detect UBC9 coding region, where both primers are inside UBC9 (Fig 6C, indicated by arrows). The band corresponding to endogenous UBC9 was only observed in wild-type Tetrahymena and was not present in ΔUBC9 conditional mutants (Fig. 6D, first panel). On the other hand, bands corresponding to UBC9 coding regions were detected in both wild-type and conditional mutants (Fig. 6D, second panel), which demonstrates that ΔUBC9 conditional mutants express only the GFP-UBC9 form and not wild-type UBC9. We therefore conclude that a conditional

CdCl2-dependent UBC9 expression strain was generated.

Fig. 6: Generation of conditional UBC9 knockout cell lines. (A) Schematic drawing of the approach used to generate a conditional GFP-UBC9 expressing strain. Heterokaryons homozygous UBC9 deletion cells of different mating types were mixed. GFP-UBC9 construct was biolistically transformed into mated cells at 8 hours post-mixing. (B) The expression of GFP-Ubc9p is regulated by CdCl2. The conditional GFP-Ubc9p strains were grown in the SPP medium supplemented with different concentrations of CdCl2. Cells were fixed, stained with DAPI and viewed by fluorescence microscopy using 10x objective. Exposure times were identical for all pictures. (C, D) RT-PCR was used to confirm that endogenous UBC9 transcript cannot be detected in conditional mutants. The location of the primers used to amplify regions from cDNA are shown (C). One set of primer was used to assay UBC9 transcript at its endogenous locus. One primer is located in UBC9 5’ UTR and the other one is located inside UBC9 (Showing in arrow head). A second set of primer was used to assay UBC9 coding region (showing in arrows). (D) Endogenous UBC9 transcript was only detected in wild-type strain but not conditional mutants, while UBC9 coding region was present in both wild-type and conditional mutants.

Depletion of UBC9 leads to reduced cell growth and nuclear defects. In other species Ubc9p has been shown to regulate many aspects of mitosis, including chromosome segregation, cell cycle progression [35,39,138]. We made use of our ΔUBC9 conditional cell lines to study the phenotypic effects of Ubc9p depletion in Tetrahymena during

vegetative growth. To determine whether loss of Ubc9p affects Tetrahymena growth rate,

equal numbers of cells were inoculated into media with or without 1 µg/ml CdCl2 and cells were counted at intervals of 4, 8, 18, 24 and 48 hours. As shown in Figure 7, the ΔUBC9 conditional cells had a slower growth rate than the wild-type strain in the absence

of CdCl2. However, the same cell lines cultured in CdCl2 exhibited growth rates similar to wild-type cells. Depletion of Ubc9p has been shown to cause chromosome mis- segregation. DAPI staining combined with florescent microscopy revealed that Ubc9p depleted cells lost DAPI-detectable micronuclei (Fig. 8A, middle panel). Conditional mutants cultured with or without CdCl2, as well as wild-type cells, were isolated after 24 hours. The number of micronuclei were counted and summarized (Fig. 8B). In the UBC9 depleted cells, nearly half of the cells contained no DAPI-detectable micronuclei. For those cells with MICs, division often involved with unequal partitioning of DNA to daughter nuclei (Fig. 8C). This is consistent with defects in separation of sister chromatids. Unlike most eukaryotes, Tetrahymena does not require accurate chromosome segregation during mitosis because they do not rely on the MIC for gene expression during the vegetative life cycle. Cells can be maintained indefinitely with micronuclear aneuploidy. Surprisingly, we observed an increase in the number of cells having more

than two MICs when medium is supplemented with CdCl2. One possible explanation was that over expression of Ubc9p has a dominant negative effect due to increased Ubc9p activity. In order to test this hypothesis, we generated a cell line expressing a catalytically inactive Ubc9p (DN-Ubc9p) due to a point mutation that changes the active site cysteine (C100) to a serine. To reduce the wild-type copy of Ubc9, we also disrupted the wild- type UBC9 gene by introducing the pUBC9KO plasmid used for the construction of the micronuclear knockout into the DN-Ubc9p cell line. These cells should have decreased expression of catalytically active Ubc9p, yet rather than lacking micronuclei they contain multiple MICs (Fig. 9).

Fig. 7: Growth curve of UBC9 depletion strain. ΔUBC9 conditional mutants and wild- type cells were inoculated into 10 ml of SPP medium at a concentration of 200 cells/ml in either presence or absence of CdCl2. Cell populations were measure by direct cell counts at 0, 4, 8, 18, 24 and 48 hours. Cell numbers were plotted by strains in the presence or absence of CdCl2. Solid line with solid square represents conditional mutant with CdCl2, solid line with empty square represents conditional mutants without CdCl2, dash line with solid circle represents wild-type with CdCl2, and dash line with empty circle represents wild-type without CdCl2.

Fig. 8: Depletion of Ubc9p causes instability of nuclei. The ΔUBC9 conditional mutants were cultured in SPP medium in the presence or absence of 1 CdCl2 for 24 hours along with wild-type cells in the absence of CdCl2 (A) Cells sampled after 24 hours of culture in the different conditions were fixed with 4% paraformaldehyde and stained with DAPI then viewed with a 40x objective under fluorescence. Representative images shows that ΔUBC9 conditional cells cultured in the absence of CdCl2 lost micronuclei but samples from the same cell lines in the presence of CdCl2 contained at least one micronucleus. (B) The numbers of micronuclei were scored and summarized in the pie chart. 100 cells from each condition were scored and characterized into three subsets, cells with no MIC, cells with 1 MIC and cells with 2 or more MICs. (C) Ubc9p is required for proper chromosome segregation. Wild-type or ΔUBC9 conditional mutants cultured in 1.0 µg/ml or no CdCl2 were fixed and stained with DAPI. Examples of dividing cells (Panel C, a and b) were selected to illustrate nuclear division in each condition. Arrows indicate MICs.

Fig. 9: Cells expressing dominant negative Ubc9 have multiple micronuclei. DN- UBC9-KO cells were grown in 1 x SPP in the presence of 1 µg/ml CdCl2 for 16 hours. (A) Samples were fixed and stained with DAPI and viewed with 40x objective. Large numbers of cells had multiple micronuclei (Top left panel). (B) For each culture 100 cells were scored for the numbers of micronuclei and are summarized in the pie chart (B). More than 85% of cells have MIC number greater than 2, only 13% have 1 MIC.

Depletion of Ubc9p results in hypersensitivity to DNA damaging agents. A role for SUMOylation in DNA damage repair, especially in response to double-strand breaks has been established in mammalian species and yeast [53,63,76,139,140]. To evaluate whether Ubc9p is involved in DNA damage repair in Tetrahymena, we tested the effect of DNA-damaging agents MMS and cisplatin on ΔUBC9 conditional mutants. ΔUBC9 conditional mutants and wild-type cells were cultured separately in SPP medium containing 1 µg/ml CdCl2 or no CdCl2. Cells were treated with 8 mM MMS or 2 mM cisplatin for 2 hours then washed twice with 10 mM Tris pH7.5. Single cells were placed into drops (approximately 15 µl) of SPP containing 0.5 µg/ml CdCl2. The CdCl2 in the post-treatment drops provides conditions that are optimal for growth of conditional cell lines and at a disadvantage without cadmium (Fig. 7). After 48 hours the cells in each drop were scored as viable if greater as 500 cells were in a drop and nonviable if there were 0-10 cells. No drops had cell numbers between 10 and 500. As shown in Figure 10,

ΔUbc9 conditional cells cultured in the absence of CdCl2 show only 12% survival in

MMS compared with 90% survival when cultured with CdCl2. Survival in cisplatin rises roughly 15 fold (5% vs 80%) in the presence of cadmium. Wild- type cells show little change in sensitivity regardless of the presence or absence of CdCl2 (Fig. 10). This is consistent with a role of Ubc9p and SUMOylation in DNA break repair.

Fig. 10: Depletion of Ubc9p results in hypersensitivity to DNA damaging agents. UBC9 conditional mutant strains were grown in 1 x SPP medium in the presence or absence of 1 µg/ml CdCl2 for 24 h. Cells were treated with 8 mM MMS or 2 mM cisplatin for 2 hours and then washed twice with 10 mM Tris-Cl pH7.5. 80 single cells were isolated to drops with growth medium in the presence of 0.5 µg/ml CdCl2 and incubated for 48 hours. Drops containing more than 500 cells were scored as viable, and drops containing fewer than 10 cells were counted as nonviable. Viability is expressed as the percentage of viable drops out of the total.

Ubc9p localizes to developing macronuclei. Tetrahymena conjugation is a dynamic process, involving meiosis, selection of one meiotic product, formation of the diploid zygotic nucleus, two rounds of post zygotic mitosis and macronuclear development. To establish the location of Ubc9p during these nuclear event, we generated Tetrahymena cell lines in which a UBC9-mcherry transgene is driven by the endogenous UBC9 promoter. Cells were prepared for mating by overnight log phase culture then starvation in 10 mM Tris pH 7.5 for 16- 24 hours. Cell samples were taken before mixing and at various time points after mixing, then fixed and stained with DAPI and observed using a fluorescence microscope. Wild-type cells without a mcherry tag were used as controls. A faint signal was observed in the macronucleus of starved cells indicating the low expression of Ubc9p during starvation (Fig. 11, starvation). During meiosis, the signal was exclusively observed in the parental macronuclei during the pronuclear exchange

stage and post-zygotic division stage (Fig 11, T=3-6). At 8 hour post-mixing, the signal was accumulated in the developing MAC (Fig. 11, T=8). The data indicates increased expression of Ubc9p during conjugation and the majority of Ubc9p accumulates in the developing macronucleus, the site of developmentally regulated genome reorganization.

Fig. 11: Localization of Ubc9 during conjugation. Ubc9 was tagged with mCherry on the C-terminus at its endogenous locus. Cells were fixed with 4% paraformaldehyde and stained with 1 µg/µl DAPI and viewed by a 40x objective under fluorescent microscope. The following developmental stage are observed: a. Prophase meiosis I (T=3 hrs); b. Zygotic nuclei (T=4 hrs); c. postzygotic division (T=6hrs); d. formation of developing macronuclei (T=8 hrs).

Ubc9 is required for pair formation in conjugating Tetrahymena. The localization of Ubc9-mcherry to the developing macronucleus suggested a role in conjugation, consequently we mated our Ubc9p depleted cell lines to assay for a conjugation defective phenotype. ΔUBC9 conditional mutants of different mating types were cultured overnight

in SPP medium with or without CdCl2 to promote or reduce expression of the GFP- UBC9 transgene. Cells were washed twice in 10 mM Tris pH7.5 and cultured in the same

media plus (+Cd) or minus CdCl2 (-Cd). Wild-type cells served as controls and were treated with the same conditions. The ΔUBC9 conditional cells from non-CdCl2 treated

cultures (Ubc9 depleted) were mixed to initiate mating. Separate cultures of CdCl2- treated Ubc9p conditional lines or wild-type cells were also mixed to initiate cell pairing. Cells were evaluated at 2, 4, 6, and 8 hours post-mixing for pair formation. As shown in

Figure 12, Ubc9p conditional mutant cultures that were not exposed to CdCl2 (Ubc9p- depleted) were unable to form mating pairs at two hours post-mixing and only formed 10 % pairs after 8 hours, well past the standard 2 hour pairing period. In contrast, the same

cell line supplemented with CdCl2 was able to generate 40-60% mating pairs. Wild-type cells exhibited pairing efficiencies >90%. Although the conditional cell lines cultures with CdCl2 did not pair as well as wild-type cells (59% versus 82% at 8 hours), the

difference between +CdCl2 and -CdCl2 was much larger (59% versus 4%). We consistently observe a slight loss of pairing efficiency when wild-type cells are exposed

to CdCl2 (see Figure 12) so a large increase upon exposure to CdCl2 is particularly significant. In addition to Ubc9p effects on pairing, other experiments in the Forney lab show a pairing defect for Uba2 and Smt3 (SUMO) depleted cell lines (A. Nasir and J. Forney, manualscript in press). Cells expressing the dominant negative Ubc9p showed

normal pairing regardless of CdCl2 treatment (data not shown).

Fig. 12: Depletion of Ubc9p results in reduced pairing. ΔUBC9 conditional mutants were grown and starved in the presence and absence of CdCl2 and mixed. After fixation, 100 cells were scored for mating efficiency at 2, 4, 6, 8 hours post-mixing. CdCl2- depleted cells were unable to from mating pairs. Light blue bar represents wild-type cells supplemented with CdCl2, dark blue bar represents wild-type cells without CdCl2; Pink bar represents ΔUBC9 conditional mutants with CdCl2 and red bar represents ΔUBC9 conditional mutants without CdCl2.

Reduced expression of UBC9 results in delayed meiosis. The inability of Ubc9p depleted cells to form pairs prevented the analysis of later stages during conjugation. As an alternative approach, we decided to mate ΔUBC9 conditional mutants to wild-type cells and examine the cells for defects during conjugation. ΔUBC9 conditional mutant

cells were cultured in the presence and absence of CdCl2 and starved as described in the previous experiment. They were mated to wild-type cells that were cultured without

CdCl2. Paired cells were examined 8 hours post-mixing to check for the progression through conjugation. Each pair was placed into one of four categories based on DAPI stained nuclei. At 2-3 hours wild-type cells are expected at the crescent micronucleus stage (meiotic prophase) followed by prezygotic mitosis, 2nd post-zygotic nuclear division and MAC differentiation (expected at 8 hours). Wild- type cells progressed through conjugation normally and were primarily in the macronuclear differentiation

stage as expected (Fig. 13). ΔUBC9 conditional mutants cultured in CdCl2 were slightly delayed with 63% of the cells in the second post-zygotic stage and 18% of cells in macronuclear differentiation stage. In stark contrast, for conditional mutants in the

absence of CdCl2 41% of pairs were in meiotic prophase and 28% were in pre-zygotic nuclear division stage in their progression through conjugation. Eventually, these cells progressed through conjugation which may be attributed to the expression of Ubc9p from the wild-type partner.

Although the ΔUBC9 conditional lines mated to wild-type cells provide some evidence for stalling at meiosis, the cell lines may accumulate micronuclear genome defects that make it difficult use a genetic assay to test for successful conjugation. We examined matings between cells expressing the previously described dominant negative-Ubc9 (DN- Ubc9) as an alternative approach. When DN-Ubc9p cells were cultured in the presence of

CdCl2 (inducing expression of DN-Ubc9p) and then mated to each other 32% of mating pairs were in the meiotic prophase stage and 51% were at pre- or post-zygotic division stage at 8 hours when wild-type cells were in the MAC differentiation stage (data not

shown). Since these cells were only exposed to CdCl2 immediately before mating the progeny were scored for successful conjugation by treating them with 6-methylpurine (6- MP). The parental strains have the 6-MP resistance gene in the mic but not the MAC. Progeny that successfully completed conjugation and form a new MAC are 6-MP resistance. . Although there is variation in the frequency of successful conjugation between different transformants the cell lines expressing the dominant negative Ubc9p display reduced conjugation efficiency relative to the same cell lines without CdCl2. (Table 2). 35% of the cells expressing DN-Ubc9p arrested at macronuclear development stage (Fig.14). Both sets of genetics crosses, cells with depletion of Ubc9p and cells with excess catalytically defective Ubc9p (DN-Ubc9), have defects in conjugation and point toward a role in meiosis.

Figure 13: Reduced expression of Ubc9 leads to stall in meiosis. ΔUBC9 conditional mutants were grown and starved in the presence of 1.0 µg/ml CdCl2 or no CdCl2 and mixed with wild-type cells to initiate mating, respectively. Samples were fixed with 4% paraformaldehyde and stained with DAPI at 8 hours post-mixing. 100 pairs were examined under fluorescent microscope and divided into 4 groups based on the progression in conjugation.

Table 2: Expression of dominant negative Ubc9p reduces conjugation efficiency.

Figure 14: Tetrahymena cells expressing catalytic inactive Ubc9p arrested at macronuclear development stage. DN-Ubc9p cells were grown and starved in the presence of 1.0 µg/ml CdCl2 or no CdCl2 and mixed with wild-type cells to initiate mating, respectively. Samples were fixed with 4% paraformaldehyde and stained with DAPI at 24 hours post-mixing. 100 pairs were examined under fluorescent microscope and divided into 3 groups based on the progression in conjugation.

CHAPTER 3 IDENTIFICATION OF THE TETRAHYMENA THERMOPHILA UBC9 INTERACTOME

Introduction Ubc9 is the sole SUMO E2 enzyme and therefore interacts with the SUMO E1 complex (Uba2p/Aos1p), potential E3s and protein targets of SUMOylation. The majority of the Ubc9p interacting proteins have been discovered through yeast two-hybrid screening [138,141-144]. Prudden et al revealed that Ubc9p regulates SUMOylation in distinct cellular processes through noncovalent interaction [145]. In Tetrahymena, microarray expression data shows upregulation in expression levels of SUMO pathway genes during conjugation which suggest that SUMOylation may regulate cellular processes during this stage of Tetrahymena development. Previous studies demonstrated that RNAi-induced silencing of Uba2 and SUMO in Paramecium tetraurelia prevented the excision of IES during formation of the somatic macronucleus [126]. This selective effect on DNA elimination in the developing macronucleus suggests that SUMOylation is a key regulator of this process. Here, I propose that Ubc9p regulates SUMOylation differently during vegetative growth and conjugation in Tetrahymena by interacting with different proteins. We anticipated major changes in the Ubc9p interacting proteins at different stages of conjugation. Previous global analyses of SUMO substrates in S. cerevisiae during vegetative growth have produced lists of Ubc9p interacting proteins [146], however, there no published studies that document the spectrum of Ubc9p interacting proteins between specific developmental settings.

To broaden our understanding of the function of SUMOylation in the Tetrahymena sexual life cycle, we utilized a mass spectrometry-based identification of Ubc9p interacting partners from vegetative and conjugating cell cultures. We found over 240

direct Ubc9p interacting proteins during vegetative growth and more than 200 proteins during conjugation. Among the identified Ubc9p interacting proteins are players in many processes, including proteins involved in cell cycle control, chromosome remodeling, ribosome biogenesis, RNA processing, transcription, translation and metabolism.

Materials and Methods Plasmid construction. Tetrahymena thermophila Ubc9p was expressed with an N- terminal six histidine tag followed by a triple FLAG epitope tag and a short linker

(GGSG) (Fig. 14). The Tetrahymena (His)6-(FLAG)3-UBC9 was chemically synthesized by IDT (Coralville, Iowa) and inserted into the BsiWI and ApaI sites of pBS-MTT-YFP- gtw vector (Douglas Chalker, Washington University at St. Louis, MO) to generate p(His)6-(FLAG)3-UBC9 plasmid. The plasmid contains the Tetrahymena CdCl2- inducible MTT1 promoter upstream of the BsiWI insertion site. It also has flanking sequences that guide homologous recombination into the rpl29 locus generating

cycloheximide-resistant Tetrahymena. Expression is induced by the addition of CdCl2.

Cell transformation and culture conditions. For biolistic transformation the p(His)6-

(FLAG)3-UBC9 plasmid was digested with HindIII to generate a linear fragment with flanking rpl29 sequences. Wild-type B2086 and CU428 Tetrahymena cells were transformed as described in Chapter 2 using previously published methods [133]. Cells were selected in SPP nutrient medium containing 12.5 μg/ml cycloheximide to identify

transformants. To induce (His)6-(FLAG)3-UBC9 expression, 0.1 μg/mL CdCl2 was supplemented to cell cultures two hours prior to lysis. To generate samples from conjugating cells two cultures of different mating types were grown overnight in SPP media then washed and starved overnight in 10 mM Tris (pH 7.5). Approximately 500

mls of starved cells to an Abs540nm of 0.3 from each culture were mixed to induce mating.

They were treated with 0.05 ug/ml CdCl2 at 6 hours then harvested and lysed at 8 hours post-mixing. The samples were processed using the same procedure for tandem affinity purification described below.

Affinity purification. The (His)6-(FLAG)3-UBC9 containing Tetrahymena strain was

grown to an Abs540nm of 0.3 in 1 liter of SPP media at 30 °C. The cells were washed once

with 10 mM Tris-HCl (pH 7.5) and lysed in 10 ml Native lysis buffer (150 mM NaCI, 50 mM Tris, 10% Glycerol, 10 mM beta-mercaptoethanol (βME), 1 mM Imidazole, 0.2% IGEPAL CA-630 (Sigma, Inc.) pH7.5, with addition of 50 mM NEM and protease inhibitors (1 µg/ml E-64, 5 µg/ml antipain, 5 µg/ml leupeptin, 6 µg/ml chymostatin). The cell suspension was lysed by sonication (50 pulses at setting 7 with 50% output using Misonix XL-2015 sonicator) and clarified by centrifugation at 25,000 rpm in a Beckman SW41 Ti rotor for 50 minutes at 4o C. Ten mls of supernatant was incubated with 500 µl of Ni-NTA agarose (Qiagen, Valencia, CA) overnight at 4 °C with gentle rotation. Beads were washed three times with 10 ml of wash buffer for 15 minutes (150 mM NaCI, 50 mM Tris, 10 mM Imidazole, pH 7.5) at 4o C. After each wash the beads were collected at 500 rpm for 3 minutes using J2-MC Backman Coulter High-performance centrifuge. The beads were eluted twice with total 10 ml of elution buffer (150 mM NaCI, 50 mM Tris, 250 mM Imidazole, pH 7.5). The elution fractions were pooled and incubated with 200 µl anti-FLAG affinity resin (Genscript, Piscataway, NJ) for 1 hour at 4 °C. Beads were washed three times with 10 ml TBS buffer (50 mM Tris-Cl, pH7.5, 150 mM NaCl) and collected by centrifugation at 500 rpm for 1 minute. Samples were eluted with 1 ml of 3xFLAG peptide (Sigma, St. Louis, MO) at a final concentration of 100 µg/ml in TBS. The final elution was subjected to Trichloroacetic acid (TCA) precipitation. Briefly, 1 volume of 100% TCA was added to 4 volumes of protein sample followed by incubation at 4 ° C for 10 min. Samples were spun in bench top microcentrifuge (Eppendorf centrifuge 5424) at 14K rpm for 5 min to collect pellets, which were further washed twice with 200 µl cold acetone. Pellets were air dried and re-suspended in 4 x loading buffer (200 mM Tris-Cl pH6.8, 8% SDS, 0.4 % bromophenol blue and 40% glycerol) supplemented with 100 mM dithiothreitol (DTT). Samples were incubated for 5 min in 95 °C heating block before loading onto a polyacrylamide gel.

Western analysis. Affinity purified protein samples were loaded proportionally onto 10% polyacrylamide gels for SDS-PAGE analysis. Gels were blotted onto polyvinylidene difluoride (PVDF) membranes, which were further blocked in 5% skim milk in PBST (0.1% (v/v) Tween 20 in 1x PBS) for 3 hours and incubated with affinity-purified anti- FLAG antibody (Sigma Inc, 1:10,000 dilution in 5% skim milk in PBST) for 16 hours.

Blots were washed 3 three, 15 minutes each at room temperature with PBST. Secondary horseradish peroxidase-conjugated Goat anti-monse lgG antibody (Jackson ImmunoResearch, West Grove, PA) was used at 1: 10,000 dilution followed by washing as before and detection by Luminata Crescendo Western HRP substrate (Millipore, Darmstadt, Germany) according to manufacture direction.. Blots were typically exposed for 30s using ChemiDocTM XRS+ gel imaging system (Bio-Rad, Hercules, California).

In gel trypsin digestion and protein fractionation. Final purified protein samples were separated on 12 % SDS-PAGE and stained with Coomassie Blue R-250. Each lane was cut into 5 to 6 small pieces and each piece was transferred into a 1.8 ml low-binding tube

(Axygen Maxymum Recovery) with 100 µl HPLC-grade H2O. Tubes were incubated at room temperature for 10 minutes with gentle shaking. Samples are then washed twice with 100 µl freshly made 25 mM ammonium bicarbonate in 50% acetonitrile and incubated for 10 minutes with shaking. The final wash was performed with 100% acetonitrile for 10 minutes. 100% acetonitrile was removed and followed by trypsin digestion at a concentration of 20 µg/ml in 50 mM ammonium bicarbonate overnight at 37 °C. The tryptic digestion was extracted three time with 50 µl 100% acetonitrile and quenched by adding trifluoroacetic acid (TFA) to a concentration of 0.1%, followed by C18 column cleanup.

LC-MS Sample Acquisition and database search. A commercial 5600 TripleTOFTM (ABSciex, Concord, Canada) was used for all the experiments. The instrument was coupled with an Eksigent NanoLC-2DPlus with nanoFlex cHiPLC (Eksigent, Dublin, CA) system. The solvents used were as follows: solvent A: composed of 0.1% (v/v) formic acid in water and solvent B: 95% (v/v) acetonitrile with 0.1% (v/v) formic acid. The sample acquisitions were performed using a “trap and elute” configuration on the nanoFlex system. The trap column (200 m 0.5 mm) and the analytical column (75 m 15 cm) were packed with 3 m ChromXP C18 medium. Samples were loaded at a flow rate of 2 nl/min for 10 min and eluted from the analytical column at a flow rate of 300 nl/min in a linear gradient of 5% solvent B to 35% solvent B in 90 min. The column was regenerated by washing with 80% solvent B for 10 min and re-equilibrated with 5%

solvent B for 10 min. For standard data-dependent analysis experiments, the mass spectrometer was operated in a manner where a 250-ms survey scan (TOF-MS) was collected, from which the top 50 ions were selected for automated MS/MS in subsequent experiments where each MS/MS event consisted of a 50-ms scan. The selection criteria for parent ions included intensity, where ions had to be greater than 100 counts/s with a charge state between 2 to 4 and were not present on the dynamic exclusion list. Once an ion had been fragmented by MS/MS, its mass and isotopes were excluded for a period of 6 s. Ions were isolated using a quadrupole resolution of 0.7 Da and fragmented in the collision cell using collision energy ramped from 15 to 45 eV within the 50-ms accumulation time. In the instances where there were less than 20 parent ions that met the selection criteria, those ions that did were subjected to longer accumulation times to maintain a constant total cycle time.

The Mascot database search analysis for the reference peptide of the dilution series was performed on Mascot v. 2.5. The enzyme selected was trypsin with 2 missed cleavages. A search tolerance of 20 ppm was specified for the peptide mass tolerance and 0.2 Da for the MS/MS tolerance. The charges of the peptides to search for were set to 2, 3, and 4. The search was set on monoisotopic mass and the instrument configuration was set to ESI-QUADTOF. No variable or fixed modifications were used. The spectra were searched against a reverse database to estimate the false discovery rate. Peptides were filtered to an FDR of 1% and proteins were required to have 2 or more peptides identified at the 1% FDR level.

Results Isolation of SUMO conjugates during Tetrahymena vegetative growth and conjugation. We adopted a scheme that involved a two-step affinity- purification strategy using N-terminal tagged Ubc9p with both (His)6 and (FLAG)3 tags (Fig. 15), followed by tandem mass spectrometry-based protein identification of trypsin-digested proteins. As a control, wild-type Tetrahymena lacking tagged Ubc9p were collected and processed under identical conditions. In the first step of the two-step affinity purification,

the (His)6 tag was bound to nickel-coupled agarose under native conditions in order to

preserve non-covalent protein complexes that interact with Ubc9. To achieve a higher degree of purification, a second affinity purification step employing anti-FLAG antibodies was carried out. Immunoblotting probed with FLAG antibody confirmed the tagged Ubc9p signal did not exist in control sample (Fig. 16). Coomassie Blue staining of a SDS-polyacrylamide gel with samples purified from vegetative and conjugating containing dual-tagged Ubc9p and from untagged negative control, demonstrated very few proteins in the control sample (Fig. 17). The Coomassie stained SDS-PAGE gel lanes containing the experimental and control samples were each cut into 7 equal-size slices, followed by in-gel trypsin digestion and subsequent analysis by LC-MS/MS. Three biological replicates were conducted with vegetative samples and two for conjugating samples.

Fig. 15: Schematic drawing of dual tagged UBC9. UBC9 was N-terminal tagged with (His)6, followed by (FLAG)3. Two small linkers were inserted in this construct to increase the flexibility. One was Alanine that was inserted between His tag and FLAG tag. The other one (GGSG) was inserted between FLAG tag and UBC9 gene. This construct is driven by the metallothionein promoter (MTTp) that can be induced by CaCl2. Codons were optimized for expression in Tetrahymena usage. Construct was chemically synthesized by IDT (Coralville, Iowa) and inserted into the BsiWI and ApaI sites of pBS-MTT-YFP-gtw vector (Douglas Chalker, Washington University at St. Louis, MO) to create p(His)6-(FLAG)3-UBC9 plasmid.

Fig. 16: Purification of Ubc9 interacting proteins from vegetative and mated Tetrahymena cells. Samples were collected after each step during purification, for both the Ni-NTA and FLAG purifications including whole cell extract (input), flow through and elution. Samples were loaded proportionally and resolved by SDS-PAGE (10% gel). Top: Fractions from vegetative growth. Lane 1 contains proteins from the tagged Ubc9p strain and lane 2 contains protein from is the untagged wild type cell control; lane 3 and 4 are flow through from Ni-NTA agarose purification of tagged and untagged strains; lane 5 and 6 are elution from Ni-NTA agarose purification of tagged and untagged strains; lane 7 is marker; lane 8 is flow through from anti-FLAG resin of tagged strain; lane 9 and 10 are elution from anti-FLAG resin purification of tagged and untagged strains. Bottom: Fractions from mated samples. Lane 1 contains proteins from the tagged Ubc9p strain and lane 2 contains protein from is the untagged wild type cell control; lane 3 is flow through from Ni-NTA agarose purification of tagged strains; lane 4 and 5 are elution from Ni-NTA agarose purification of tagged and untagged strains; lane 6 is marker; lane 7 is flow through from anti-FLAG resin of tagged strain; lane 8 and 9 are elution from anti-FLAG resin purification of tagged and untagged strains.

Fig. 17: Coomassie stained gels ofing affinity purified fractions. (His)6-(FLAG)3- Ubc9 cell lines and untagged control strains were induced with cadmium and then lysed under native conditions. The clarified lysates were used for two rounds of affinity purification, first with Ni-NTA resin and then anti-FLAG resin. Final elutes were separated by SDS-PAGE (12% gel) and stained with Coomassie blue. Left: Purified proteins from vegetative cells after elution from the second affinity resin and concentration by TCA precipitation. Lane 1 contains proteins from the tagged Ubc9p strain and lane 2 contains protein from is the untagged wild type cell control. Right: Proteins from mated cell purifications. Lane 1 and 2 are input of strains with tagged protein and untagged; lane 3 and 4 are elution from Ni-NTA agarose purification of tagged and untagged strains; lane 5 is marker; lane 6 and 7 are elution from FLAG resin puridication of tagged and untagged strains.

LC-MS/MS data were analyzed using mascot to search the database of known Tetrahymena proteins sequences. A total of 242 proteins were uniquely found in vegetative samples expressing tagged-Ubc9 and 213 were uniquely found in conjugating samples. In addition to a large number of novel Ubc9p interacting proteins identified, the list includes orthologous of previously identified Ubc9p interacting protein or SUMO conjugates in other organisms (e.g. Cdc2, TopI, EEF2, DRH19, multiple aminoacyl- tRNA synthetases and ribosomal proteins) [146,147].

Evaluation of Ubc9 interacting proteins found through global MS analysis. To our surprise, there are large numbers of metabolic proteins were identified in our affinity purifications. Many of the same proteins showed up in yeast SUMO purification too (personal communication with Dr. Mark Hochstrasser, Yale University). Highly abundant proteins complicate the data set as they stick to the epitope tags but are not physiologically significant Ubc9p interacting partners. In order to increase our confidence in the list of Ubc9p interacting proteins, we compared the proteins on our lists to those identified from two other published unrelated Tetrahymena purifications. In one study mitochondria were purified and proteins were identified by mass spectrometry. In the other study, the outer pellicle, which is the scaffold for outer membrane structure, was purified and proteins identified [148,149]. Proteins that appeared in all three purifications works (mitochondria, pellicle and Ubc9) were are subtracted from our lists, which resulted in new lists with proteins of higher confidence. Those so-called “junk proteins” are summarized in Table 6. After the subtraction of these common proteins, our list contained 128 proteins that we have higher confidence direct interact with Ubc9p during Tetrahymena vegetative growth (Table 3) and 106 proteins during conjugation (Table 4). These two data sets are categorized based on their functions (Fig. 18), including cell cycle regulation, RNA processing, gene transcription, chromatin remodeling and stress response. The cell cycle proteins that we identified include TopoI, which has been previously identified as a SUMO substrate, and CDC2, homolog of which has been identified as Ubc9p interacting protein in yeast [146]. Our goal is to identify conjugation- specific Ubc9p interacting proteins and we anticipate that some of these will be identified as SUMO substrates. We compared the Ubc9p interacting protein list from vegetative and conjugating cell culture and found 48 proteins that were common which means that there were 58 proteins that are specific to conjugation (Fig. 19 and Table 5). These proteins include Twi 1 which is an argonaute protein that is required for IES excision during macronuclear development [119]. The other example is High Mobility Group B protein (HMGB) that is involved in genetic exchange during conjugation [148].

Fig. 18: Graphical representation of functional categories of Ubc9 and SUMO interacting partners in both vegetative and mated cells. Proteins that were identified were categorized into different subsets based on their biological functions. The uniprot knowledgebase and Tetrahymena Genome Database (TGD) were both used to graphically display the biological functions of Ubc9p interacting proteins in (A) vegetative cells, (B) mated cells. As expected, a high number of proteins responsible for ribosome biogenesis were identified. The largest category of these proteins are involved in metabolic processes. However, SUMOylation clearly regulates other key cellular processes such as crosstalk with other protein translation modifications, response to cellular stimuli, progression of the cell cycle and chromatin remodeling.

Fig. 19: Overlap between Ubc9 interacting proteins in vegetative growth and conjugation. There are 48 proteins that are present in purifications from both vegetative growth and mated cells.

In 2013, Dr. Raught’s group identified 97 high-confidence Ubc9p interacting proteins from S. cerevisiae using affinity purification followed by mass spectrometry approach [146]. Four of these proteins were previously reported as Ubc9p interactors and 37 were identified as SUMO conjugates. Again, we compared our Ubc9p list against their data set and the majority of them were classified in the same functional category (Fig. 20). This included 19% of proteins in metabolism in yeast compared with 27% in Tetrahymena, surprisingly high fractions considering SUMOylation is considered primarily a modification associated with nuclear proteins. It is possible that Ubc9p (and SUMO) has a larger role in metabolism than currently recognized.

Fig. 20: Graphical representation of biological processes of Ubc9p interacting proteins in yeast. 97 high-confidence Ubc9p interacting proteins were reported by Sirkumar et al. These proteins are categorized into different subsets based on their major functions, including transcription, response to cellular environment, structure maintenance, metabolism, cell division, chromatin remodeling, translation, transport, bud site selection, ribosome biogenesis, RNA processing, PTM & degradation and unknown.

Table 3: Ubc9 interacting proteins identified from log phase vegetative cells Times Gene Name Standard Name Description identified TTHERM_00194730 hypothetical protein 1 TTHERM_00125640 SSA3 (HSP70a paralog) dnaK protein 1 TTHERM_01080440* SSA4 (HSP70a paralog) dnaK protein 2 TTHERM_01044390* † HSP71 (Heat Shock Protein ) Putative 70-kDa heat-shock protein (hsp70 2 TTHERM_00558440*† SSA5 (HSP70a paralog) dnaK protein 2 TTHERM_01435670 GLC3 (GLC3 Ortholog) Alpha amylase, catalytic domain containing protein 1 TTHERM_00013700 hypothetical protein 1 TTHERM_01107480* hypothetical protein 2 TTHERM_01287980* hypothetical protein 3 TTHERM_00193410 * serine hydroxymethyltransferase family protein 1 TTHERM_00318570*† citrate synthase 1 TTHERM_00666180*† conserved hypothetical protein 1 TTHERM_00535740† Mitochondrial carrier protein 2 MCF2 (Mitochondrial carrier TTHERM_00535730 Mitochondrial carrier protein 1 family) TTHERM_00052470*† AMP-binding enzyme family protein 2 TTHERM_00378560* eukaryotic translation initiation factor 3 subunit 8 1 TTHERM_00429910*† cytidyltransferase-related domain containing protein 2 TTHERM_00015980* cytidyltransferase-related domain containing protein 1 TTHERM_00147510† Coenzyme A transferase family protein 2 RRM34 (RNA recognition motif- TTHERM_00497940*† 2 containing protein 34) Protein kinase domain containing protein. Sequence similarity to the PKA protein TTHERM_00433420*† 1 kinase family 52

Protein kinase domain containing protein. Sequence similarity to the PKA protein TTHERM_00658860* 1 kinase family TTHERM_01014740* hypothetical protein 2 TTHERM_00243730 *† Glucosamine-6-phosphate isomerase/6-phosphogluconolactonase family protein 2 TTHERM_00402120 † Glutathione S-transferase, N-terminal domain containing protein 2 TTHERM_00663830 XRN3 (5'-3' exoribonuclease 3) XRN 5'-3' exonuclease N-terminus family protein 1 TTHERM_00205180† cyclic nucleotide-binding domain containing protein 1 TDH1 (glyceraldehyde-3- TTHERM_00551160 *† Glyceraldehyde-3-phosphate dehydrogenase; metabolic enzyme involved in glycoloysis 1 phosphate dehydrogenase 1) TTHERM_00346560*† Ubiquitin family protein 2

TTHERM_00085200*† Ubiquitin family protein 3

TTHERM_00343440*† conserved hypothetical protein 1 TTHERM_00569100 Thioredoxin family protein 2 TTHERM_00467390 SOR3 (Sortilin 3) BNR/Asp-box repeat family/ VPS10 domain containing protein 1

RPP0 (Ribosomal Protein P0 of Homolog of yeast RPP0, human RPLP0, bacteria RPL10; Acidic ribosomal protein P0 TTHERM_00636970 † 1 the large subunit) of the large subunit ERS3 (glutaminyl-tRNA TTHERM_00056140*† glutaminyl-tRNA synthetase family protein 1 synthetase 3) TTHERM_00773610 enoyl-CoA hydratase/isomerase family protein 2 TTHERM_00497380 *† oxidoreductase, zinc-binding dehydrogenase family protein 1

TTHERM_00614859† conserved hypothetical protein 1

TTHERM_00339700*† hypothetical protein 1 TTHERM_00024200* oxidoreductase, short chain dehydrogenase/reductase family protein 1 TTHERM_00024180 oxidoreductase, short chain dehydrogenase/reductase family protein 1

TTHERM_00024190* oxidoreductase, short chain dehydrogenase/reductase family protein 1

TTHERM_00302100* aminotransferase, classes I and II family protein 1 53

TTHERM_00149340 *† CCT2 (CCT2 Ortholog) TCP-1/cpn60 chaperonin family protein 1 DRH19 (DExD/H box RNA TTHERM_00522650* DEAD/DEAH box helicase family protein 1 helicase 19) TTHERM_01048110*† Glutamate/Leucine/Phenylalanine/Valine dehydrogenase family protein 1

60S ribosomal protein L9 1 Protein kinase domain containing protein. Sequence similarity to the ULK protein TTHERM_00442880 1 kinase family TTHERM_01084100 *† Glutamine synthetase, catalytic domain containing protein 1

TTHERM_01250050 AMP-binding enzyme family protein 1

TTHERM_00118600*† PYK1 (PYruvate Kinase) pyruvate kinase; converts phosphoenolpyruvate to pyruvate during glycolysis 1

TTHERM_00277470* acetyl-CoA acyltransferases family protein 1

TTHERM_00836690 *† Peptidase M16 inactive domain containing protein 2

TTHERM_00426260* hypothetical protein 1 CRS1 (cysteinyl-tRNA TTHERM_00560000 cysteinyl-tRNA synthetase family protein 1 synthetase 1) TTHERM_01015930* hypothetical protein 1 FSF1 (Formaldehyde Formaldehyde dehydrogenase/S-formylglutathione hydrolase fusion protein; fusion dehydrogenase/S- TTHERM_00295700* protein containing two enzymes known to catalyze sequential steps in the formaldehyde 2 formylglutathione hydrolase detoxification pathway in yeast; this fusion unique to ciliates fusion protein) TTHERM_00753340 hypothetical protein 1 FRS2 (phenylalanyl-tRNA TTHERM_00218410 phenylalanyl-tRNA synthetase, beta subunit family protein 1 synthetase 2) TTHERM_00035180† acetoacetate decarboxylase 1 TTHERM_00534010* zinc finger protein, putative 2 TTHERM_00151390 ATP:guanido phosphotransferase, C-terminal catalytic domain containing protein 1 TTHERM_00813040 hypothetical protein 1

TTHERM_00670350 hypothetical protein 1

TTHERM_00444470 *† S-adenosylmethionine synthetase family protein 2 54

TTHERM_00954320* Zinc finger, C2H2 type family protein 1 TTHERM_00388400† hypothetical protein 2 TTHERM_00245120 hypothetical protein 1 TTHERM_00313119 predicted protein 1 FRS1 (phenylalanyl-tRNA TTHERM_00133690† phenylalanyl-tRNA synthetase, alpha subunit family protein 1 synthetase 1) TTHERM_01194660* translation elongation factor G 1

TTHERM_00052420 asparagine synthase 1

TTHERM_00787250 Glutamate/Leucine/Phenylalanine/Valine dehydrogenase family protein 1 LRS1 ( leucyl-tRNA synthetase TTHERM_00670340 leucyl-tRNA synthetase family protein 1 1) TTHERM_00688570 Alanine racemase, N-terminal domain containing protein 1 TTHERM_00537300*† ribose-phosphate pyrophosphokinase family protein 1 TTHERM_00681790* hypothetical protein 1 Metabolic enzyme involved in triterpenoids biosynthesis; catalyzes the formation of TTHERM_01008630 THC1 (Tetrahymanol cyclase) 1 tetrahymanol from squalene by a direct cyclization. TTHERM_00049060 hypothetical protein 1

TTHERM_00649120 ATP-dependent protease La family protein 1

TTHERM_00218270* hypothetical protein 1 Glycine cleavage system T protein. Sequence similarity to the HisK protein kinase TTHERM_00499390*† 2 family TTHERM_00475310† hypothetical protein 1 TTHERM_00300370 ABC transporter family protein 1 TTHERM_00077220 hypothetical protein 1 TTHERM_00348060* Acyl-CoA oxidase family protein 1 TTHERM_00522760 ribose-phosphate pyrophosphokinase family protein 1 55

TTHERM_00773690† adenylosuccinate synthetase family protein 1 TTHERM_00052020 ROK family protein 1 TTHERM_00028780 hypothetical protein 1 Putative Ran GTPase; an evolutionarily conserved small GTPase with roles in nuclear TTHERM_00023980† RAN1 (RAN GTPase) 2 transport, mitotic spindle assembly and nuclear envelope assembly TTHERM_00353480*† HELP domain containing protein 1

TTHERM_00196200† isocitrate dehydrogenase, NADP-dependent family protein 1 TTHERM_00377250 adenylosuccinate lyase family protein 1 MCM5 (DNA replication TTHERM_00069420 Component of the Mcm2-7 complex involved in DNA replication 1 licensing factor MCM5) TTHERM_00197760 hypothetical protein 2 TTHERM_00558490* PUF2 (Pumilio-family protein 2) Pumilio-family RNA binding repeat containing protein 1 TTHERM_00035580 preprotein translocase, SecY subunit containing protein 1 Eukaryotic release factor 1; believed to recognize the stop codon of mRNA and ERF1 (Eukaryotic Release Factor TTHERM_00292170 terminate translation; gene has 4 introns; deduced protein sequence 57% similar to 2 ) human eRF1; domain 1 proposed to be the codon recognition site TTHERM_00448660† hypothetical protein 1

TTHERM_00659131 conserved hypothetical protein 1 TTHERM_00077120 hypothetical protein 1 TTHERM_00312220 nucleotide binding protein 2, putative 1 TTHERM_00442930* bZIP transcription factor family protein 1 TTHERM_00790780 Glycosyl transferase family, helical bundle domain containing protein 1 TTHERM_00195860† Thiolase, N-terminal domain containing protein 1 Myosin heavy chain; unclassisfied member of myosin protein family; not a member of TTHERM_00526770 MYO13 (MYOsin ) 1 proposed myosin Class XX; contains predicted coiled-coil domains TTHERM_01266070 protein phosphatase 2A regulatory B subunit (B56 family) 1 RPN2 (26S proteasome TTHERM_00442210 Proteasome/cyclosome repeat family protein 1 regulatory subunit N2) TTHERM_00408760† Ubiquitin carboxyl-terminal hydrolase family protein 1 56

TTHERM_00382380† AMP-binding enzyme family protein 1

TTHERM_01207690 hypothetical protein 1

TTHERM_01029960 MDH4 (malate dehydrogenase 4) malate dehydrogenase family protein 1

TTHERM_00697230 cyclic nucleotide-binding domain containing protein 1 RRM20 (RNA recognition motif- TTHERM_00421020* RNA recognition motif-containing protein 2 containing protein 20) TTHERM_00375130 Carboxyvinyl-carboxyphosphonate phosphorylmutase -related 1

TTHERM_00840140 Kelch motif family protein 1 RPL40 (Ribosomal Protein of the Homolog of Yeast RPL40; RPL40-Ubiquitin fusion protein; Ribosomal L40e family TTHERM_00339620*† 2 Large Subunit #40) protein Phosphoglucomutase; carbohydrate metabolism enzyme that catalyzes the conversion TTHERM_00577080 PGM1 (PhosphoGlucoMutase ) of alpha-D-glucose 1-phosphate into alpha-D-glucose 6-phosphate; knock-out mutants 1 have no defects in growth, morphology or exocytosis TTHERM_00620980 hypothetical protein 1 Profilin family protein; both inhibits and enhances actin polymerization; co-localizes TTHERM_00105430*† PRF1 (PRoFilin) 1 with actin in the division furrow

TTHERM_00449180* hypothetical protein 1 UBC9 (Ubiquitin conjugating SUMO-conjugating enzyme involved in the Smt3p conjugation pathway; a member of TTHERM_00522720† 1 enzyme 9) the ubiquitin-conjugating enzyme E2 family small ubiquitin-related modifier (SUMO), conjugated to lysine residues on target TTHERM_00410130† SMT3 (Suppressor of Mif Two ) 1 proteins, post-translational modification, TTHERM_00657560† hypothetical protein 1 DRH1 (DExD/H box RNA TTHERM_00190830† P68-like protein, putative 1 helicase 1) TTHERM_00535260 succinyl-CoA synthetase, beta subunit family protein 1 TTHERM_00456860 hypothetical protein 1 * indicates the proteins that appeared in SUMO native purification

† indicated the proteins that appeared in Ubc9p native purification during conjugation

Table 4: Ubc9 interacting proteins identified from 8-hour conjugating cells

Times Gene Name Standard Name Description identified

UBC9 (Ubiquitin conjugating SUMO-conjugating enzyme involved in the Smt3p conjugation pathway; a member of TTHERM_00522720†‡ 2 enzyme 9) the ubiquitin-conjugating enzyme E2 family small ubiquitin-related modifier (SUMO), conjugated to lysine residues on target TTHERM_00410130†‡ SMT3 (Suppressor of Mif Two ) 2 proteins, post-translational modification, RPL40 (Ribosomal Protein of the Homolog of Yeast RPL40; RPL40-Ubiquitin fusion protein; Ribosomal L40e family TTHERM_00339620† 2 Large Subunit #40) protein TTHERM_00346560† Ubiquitin family protein 2 TTHERM_00085200† Ubiquitin family protein 2 TTHERM_01006550 Thioredoxin family protein 1 Citrate synthase; bifunctional 14-nm filament-forming protein; structural protein TTHERM_00529790‡ CIT1 (CITrate synthase) involved in oral morphogenesis and pronuclear behavior during conjugation; citrate 2 synthase activity decreased by polymerization and dephosphorylation TTHERM_00622710‡ Pyridine nucleotide-disulphide oxidoreductase family protein 2

TTHERM_00655820 translation elongation factor EF-1, subunit alpha 2 TTHERM_00191720‡ 2

TTHERM_01044390† HSP71 (Heat Shock Protein ) Putative 70-kDa heat-shock protein (hsp70); 2 TTHERM_00558440†‡ SSA5 (HSP70a paralog) dnaK protein 1 TTHERM_00777260 hypothetical protein 2 TTHERM_01084110 Glutamine synthetase 2 TTHERM_00318570† citrate synthase 2 TTHERM_00666180† conserved hypothetical protein 2

TTHERM_00487140 hypothetical protein 1 Protein kinase domain containing protein. Sequence similarity to the PKA protein kinase TTHERM_00433420† 2 family TTHERM_00160770 FTT49 (14-3-3 protein) 14-3-3 protein 1 58

TDH1 (glyceraldehyde-3- TTHERM_00551160† Glyceraldehyde-3-phosphate dehydrogenase; metabolic enzyme involved in glycoloysis 2 phosphate dehydrogenase 1) RPL14 (Ribosomal protein of the TTHERM_00697490 Homolog of yeast RPL14/(RPL14e) 2 large subunit) PAZ/Piwi Domain protein similar to Piwi/Argonaute; required for accumulation of TTHERM_01161040‡ TWI1 (Tetrahymena piWI ) scnRNAs, elimination of IES and chromosome breakage during macronuclear 2 development; interacts with scnRNAs; involved in histone H3 lysine 9/27 methylations

TTHERM_01084100†‡ Glutamine synthetase, catalytic domain containing protein 2 RPL25 (Ribosomal Protein of the Homolog of Yeast RPL25, Human RPL23A, Bacteria RPL23; Ribosomal protein L23 TTHERM_00134940 1 Large subunit #25) containing protein TTHERM_00494880‡ hypothetical protein 1 TTHERM_00051840 hypothetical protein 2 TTHERM_00849260‡ hypothetical protein 2 RPP0 (Ribosomal Protein P0 of the Homolog of yeast RPP0, human RPLP0, bacteria RPL10; Acidic ribosomal protein P0 of TTHERM_00636970† 2 large subunit) the large subunit TTHERM_00693060 enoyl-CoA hydratase/isomerase family protein 1 TTHERM_00497380† oxidoreductase, zinc-binding dehydrogenase family protein 2

TTHERM_00434020 ribosomal protein S8.e containing protein 2

TTHERM_01435670† GLC3 (GLC3 Ortholog) Alpha amylase, catalytic domain containing protein 2

TTHERM_00624780 metallopeptidase family M24 containing protein 1

TTHERM_00205180†‡ cyclic nucleotide-binding domain containing protein 2 RRM34 (RNA recognition motif- TTHERM_00497940† 2 containing protein 34) TTHERM_00402120† Glutathione S-transferase, N-terminal domain containing protein 2

TTHERM_00537300† ribose-phosphate pyrophosphokinase family protein 1 Profilin family protein; both inhibits and enhances actin polymerization; co-localizes TTHERM_00105430† PRF1 (PRoFilin) 2 with actin in the division furrow TTHERM_00128870 hypothetical protein 1 LBE1 (Lycopene Biosynthesis- TTHERM_00600650 Lycopene biosynthesis-enhancing protein; similar to sigma cross-reacting protein 27A 1 Enhancing ) 59

TTHERM_00348410‡ hypothetical protein 2

Histone H4; one of the four histones (H2A, H2B, H3 and H4) that comprise the protein TTHERM_00498190‡ HHF1 (Histone H Four ) core of the eukaryotic nucleosome; adjacent to HHT2; encoded protein identical to 2 Hhf2p; expressed during macronuclear S-phase

RRM28 (RNA recognition motif- TTHERM_00484731 RNA recognition motif-containing protein 2 containing protein 28) RPL35 (Ribosomal Protein of the TTHERM_00561680 Homolog of Yeast RPL35, Bacterial RPL29 2 Large subunit #35) NAP1 (Nucleosome Assembly TTHERM_00786930 nucleosome assembly protein 2 Protein ) RPL31 (Ribosomal Protein of the TTHERM_00943010 Homolog of Yeast RPL31, Human RPL31 1 Large subunit #31) TTHERM_00773690† adenylosuccinate synthetase family protein 2

TTHERM_01048110† Glutamate/Leucine/Phenylalanine/Valine dehydrogenase family protein 1 G-quartet DNA binding protein; shows preference for binding parallel G-DNAs; activity TGP1 (Tetrahymena G-DNA TTHERM_00499420 localized predominantly in the nuclear fraction; knockout strain shows increased 2 binding Protein ) occurrence of extra micronuclei; not essential for growth TTHERM_00195860† Thiolase, N-terminal domain containing protein 2

TTHERM_00657560† hypothetical protein 2 Histone H2B; one of the four histones (H2A, H2B, H3 and H4) that comprise the protein TTHERM_00283180 HTB2 (Histone h Two B ) 1 core of the eukaryotic nucleosome; differs from Htb1p by three amino acids Homolog of the catalytic subunit of the major cell cycle cyclin-dependent kinase (cdk); TTHERM_01207660 CDC2 (Cell Division Cycle ) studies suggest cdc2p phosphorylates HHO1; expression positively regulated by HHO1 1 phosphorylation during starvation, resulting in a positive feedback TTHERM_00535740† Mitochondrial carrier protein 1

TTHERM_00339700† hypothetical protein 1

Glycine cleavage system T protein. Sequence similarity to the HisK protein kinase TTHERM_00499390†‡ 2 family TTHERM_00052470†‡ AMP-binding enzyme family protein 1 TTHERM_00444470† S-adenosylmethionine synthetase family protein 2 TTHERM_00196200† isocitrate dehydrogenase, NADP-dependent family protein 1 60

Glycolytic enzyme phosphoglucose isomerase, catalyzes the interconversion of glucose- TTHERM_01108700 PGI1 (PhosphoGlucoIsomerase) 2 6-phosphate and fructose-6-phosphate. TTHERM_00475310† hypothetical protein 2 TTHERM_00530250 aldehyde dehydrogenase 1 TTHERM_00118600† PYK1 (PYruvate Kinase) pyruvate kinase; converts phosphoenolpyruvate to pyruvate during glycolysis 2 TTHERM_00437600 succinyl-CoA synthetase, beta subunit family protein 2 RACK1 (Receptor for Activated C TTHERM_01113100 Homolog of yeast ASC1 2 Kinase 1) TTHERM_00147510† Coenzyme A transferase family protein 2

TTHERM_00194240 homeobox-containing protein-related 1

TTHERM_00448660†‡ hypothetical protein 1

TTHERM_00927250‡ oxidoreductase, short chain dehydrogenase/reductase family protein 1 TTHERM_00185350 ubiquitin-activating enzyme 1 TTHERM_01035530 thioesterase family protein 1 TTHERM_00243730† Glucosamine-6-phosphate isomerase/6-phosphogluconolactonase family protein 2 TTHERM_00433610 PCI domain containing protein 1 TTHERM_00621400 TRM8 (tRNA methyltransferase 8) tRNA methyltransferase 1 TTHERM_00241740 Thioredoxin family protein 1

TTHERM_00429910† cytidyltransferase-related domain containing protein 1 RPS12 (Ribosomal Protein of the Homolog of yeast RPS23, human RPS23 and bacterial RPS12; small (40S) ribosomal TTHERM_00434040 2 Small subunit ) subunit protein with sequence similarity to E.coli ribosomal protein S12 TTHERM_00836690† Peptidase M16 inactive domain containing protein 2 FRS1 (phenylalanyl-tRNA TTHERM_00133690† phenylalanyl-tRNA synthetase, alpha subunit family protein 1 synthetase 1) TTHERM_00332160 hypothetical protein 1

TTHERM_00388400† hypothetical protein 1 61

Protein kinase domain containing protein. Sequence similarity to a protein kinase family TTHERM_00220990‡ 1 unique to Tetrahymena thermophila TTHERM_00148900‡ hypothetical protein 1 DRH1 (DExD/H box RNA helicase TTHERM_00190830†‡ P68-like protein, putative 1 1) TTHERM_00382380† AMP-binding enzyme family protein 2 RPB81 (RNA polymerase II TTHERM_00549610‡ Subunit shared in RNA polymerases I, II & III 1 subunit 8A) TTHERM_00149340† CCT2 (CCT2 Ortholog) TCP-1/cpn60 chaperonin family protein 1 Protein kinase domain containing protein. Sequence similarity to the ULK protein kinase TTHERM_00790590‡ 1 family TTHERM_00343440† conserved hypothetical protein 1 TTHERM_00614859† conserved hypothetical protein 1 TTHERM_00383610 Citrate synthase family protein 1 TTHERM_00476640 Ribosomal protein L24e containing protein 1 TTHERM_00046920† TATA box-binding protein 1 TTHERM_00464990 DNA topoisomerase family protein 1 TTHERM_00035180† acetoacetate decarboxylase 1 ERS3 (glutaminyl-tRNA synthetase TTHERM_00056140†‡ glutaminyl-tRNA synthetase family protein 1 3) RPL27 (Ribosomal Protein of the TTHERM_00780960 1 Large subunit #27) RPL25 (Ribosomal Protein of the Homolog of Yeast RPL25, Human RPL23A, Bacteria RPL23; Ribosomal protein L23 TTHERM_00134940 1 Large subunit #25) containing protein High-Mobility-Group (HMG) protein; induces negative supercoiling of DNA in vitro; TTHERM_00660180‡ HMGB (High Mobility Group) present in both macro- and micronuclei but with elevated expression during both 1 macronuclear S phase and endoreplication of developing new macronuclei TTHERM_00408760†‡ Ubiquitin carboxyl-terminal hydrolase family protein 1 Putative Ran GTPase; an evolutionarily conserved small GTPase with roles in nuclear TTHERM_00023980†‡ RAN1 (RAN GTPase) 1 transport, mitotic spindle assembly and nuclear envelope assembly TTHERM_00353480† HELP domain containing protein 1 62

RPL38 (Ribosomal Protein of the TTHERM_00812780 Homolog of Yeast RPL38 1 Large subunit #38) TTHERM_00118610 ATP synthase F1, gamma subunit family protein 1 TTHERM_00655520‡ Copper/zinc superoxide dismutase family protein 1

† indicates proteins that appeared in Ubc9p native purification during vegetative growth ‡ indicates proteins that are up-regulated during conjugation

Table 5: List of Ubc9p conjugation-specific interacting proteins in Tetrahymena. Times Gene Name Standard Name Description identified TTHERM_01006550 Thioredoxin family protein 1 Citrate synthase; bifunctional 14-nm filament-forming protein; structural protein involved in 2

TTHERM_00529790 CIT1 (CITrate synthase) oral morphogenesis and pronuclear behavior during conjugation; citrate synthase activity decreased by polymerization and dephosphorylation

TTHERM_00622710 Pyridine nucleotide-disulphide oxidoreductase family protein 2

TTHERM_00655820 translation elongation factor EF-1, subunit alpha 2

TTHERM_00191720 2

TTHERM_00777260 hypothetical protein 2

TTHERM_01084110 Glutamine synthetase 2

TTHERM_00487140 hypothetical protein 1

TTHERM_00160770 FTT49 (14-3-3 protein) 14-3-3 protein 1 RPL14 (Ribosomal protein of TTHERM_00697490 Homolog of yeast RPL14/(RPL14e) 2 the large subunit) PAZ/Piwi Domain protein similar to Piwi/Argonaute; required for accumulation of

TTHERM_01161040 TWI1 (Tetrahymena piWI ) scnRNAs, elimination of IES and chromosome breakage during macronuclear development; 2 interacts with scnRNAs; involved in histone H3 lysine 9/27 methylations RPL25 (Ribosomal Protein of Homolog of Yeast RPL25, Human RPL23A, Bacteria RPL23; Ribosomal protein L23 TTHERM_00134940 1 the Large subunit #25) containing protein

TTHERM_00494880 hypothetical protein 1

TTHERM_00051840 hypothetical protein 2

TTHERM_00849260 hypothetical protein 2

TTHERM_00693060 enoyl-CoA hydratase/isomerase family protein 1

TTHERM_00434020 ribosomal protein S8.e containing protein 2

TTHERM_00624780 metallopeptidase family M24 containing protein 1 64

TTHERM_00128870 hypothetical protein 1 LBE1 (Lycopene Biosynthesis- TTHERM_00600650 Lycopene biosynthesis-enhancing protein; similar to sigma cross-reacting protein 27A 1 Enhancing )

TTHERM_00348410 hypothetical protein 2 Histone H4; one of the four histones (H2A, H2B, H3 and H4) that comprise the protein core

TTHERM_00498190 HHF1 (Histone H Four ) of the eukaryotic nucleosome; adjacent to HHT2; encoded protein identical to Hhf2p; 2 expressed during macronuclear S-phase RRM28 (RNA recognition TTHERM_00484731 RNA recognition motif-containing protein 2 motif-containing protein 28) RPL35 (Ribosomal Protein of TTHERM_00561680 Homolog of Yeast RPL35, Bacterial RPL29 2 the Large subunit #35) NAP1 (Nucleosome Assembly TTHERM_00786930 nucleosome assembly protein 2 Protein ) RPL31 (Ribosomal Protein of TTHERM_00943010 Homolog of Yeast RPL31, Human RPL31 1 the Large subunit #31) G-quartet DNA binding protein; shows preference for binding parallel G-DNAs; activity TGP1 (Tetrahymena G-DNA TTHERM_00499420 localized predominantly in the nuclear fraction; knockout strain shows increased occurrence 2 binding Protein ) of extra micronuclei; not essential for growth Histone H2B; one of the four histones (H2A, H2B, H3 and H4) that comprise the protein TTHERM_00283180 HTB2 (Histone h Two B ) 1 core of the eukaryotic nucleosome; differs from Htb1p by three amino acids Homolog of the catalytic subunit of the major cell cycle cyclin-dependent kinase (cdk);

TTHERM_01207660 CDC2 (Cell Division Cycle ) studies suggest cdc2p phosphorylates HHO1; expression positively regulated by HHO1 1 phosphorylation during starvation, resulting in a positive feedback Glycolytic enzyme phosphoglucose isomerase, catalyzes the interconversion of glucose-6- TTHERM_01108700 PGI1 (PhosphoGlucoIsomerase) 2 phosphate and fructose-6-phosphate.

TTHERM_00530250 aldehyde dehydrogenase 1

TTHERM_00437600 succinyl-CoA synthetase, beta subunit family protein 2 RACK1 (Receptor for TTHERM_01113100 Homolog of yeast ASC1 2 Activated C Kinase 1)

TTHERM_00194240 homeobox-containing protein-related 1

TTHERM_00927250 oxidoreductase, short chain dehydrogenase/reductase family protein 1

TTHERM_00185350 ubiquitin-activating enzyme 1

TTHERM_01035530 thioesterase family protein 1

TTHERM_00433610 PCI domain containing protein 1 65

TRM8 (tRNA TTHERM_00621400 tRNA methyltransferase 1 methyltransferase 8)

TTHERM_00241740 Thioredoxin family protein 1 RPS12 (Ribosomal Protein of Homolog of yeast RPS23, human RPS23 and bacterial RPS12; small (40S) ribosomal TTHERM_00434040 2 the Small subunit ) subunit protein with sequence similarity to E.coli ribosomal protein S12

TTHERM_00332160 hypothetical protein 1 Protein kinase domain containing protein. Sequence similarity to a protein kinase family TTHERM_00220990 1 unique to Tetrahymena thermophila

TTHERM_00148900 hypothetical protein 1 RPB81 (RNA polymerase II TTHERM_00549610 Subunit shared in RNA polymerases I, II & III 1 subunit 8A) Protein kinase domain containing protein. Sequence similarity to the ULK protein kinase TTHERM_00790590 1 family

TTHERM_00383610 Citrate synthase family protein 1

TTHERM_00476640 Ribosomal protein L24e containing protein 1

TTHERM_00464990 DNA topoisomerase family protein 1 RPL27 (Ribosomal Protein of TTHERM_00780960 1 the Large subunit #27) RPL25 (Ribosomal Protein of Homolog of Yeast RPL25, Human RPL23A, Bacteria RPL23; Ribosomal protein L23 TTHERM_00134940 1 the Large subunit #25) containing protein High-Mobility-Group (HMG) protein; induces negative supercoiling of DNA in vitro;

TTHERM_00660180 HMGB (High Mobility Group) present in both macro- and micronuclei but with elevated expression during both 1 macronuclear S phase and endoreplication of developing new macronuclei RPL38 (Ribosomal Protein of TTHERM_00812780 Homolog of Yeast RPL38 1 the Large subunit #38) TTHERM_00118610 ATP synthase F1, gamma subunit family protein 1

TTHERM_00655520 Copper/zinc superoxide dismutase family protein 1

Table 6: Putative “junk” proteins that appeared in three unrelated Tetrahymena purifications. Gene Name Standard Name Description TRS1 (Threonyl-tRNA TTHERM_00194650 threonyl-tRNA synthetase family protein synthetase 1) TTHERM_00794020 glycine dehydrogenase family protein TTHERM_00105110 HSP70 (Heat Shock Protein ) Putative 70-kDa heat-shock protein (hsp70) TTHERM_00171850 SSA6 (HSP70a paralog) dnak protein BiP

TTHERM_00926980 acetyl-CoA acyltransferases family protein SRS1 (seryl-tRNA synthetase TTHERM_00114360 seryl-tRNA synthetase family protein 1) TTHERM_00353280 adenosylhomocysteinase family protein TTHERM_00158520 HSP82 (Heat Shock Protein ) Hsp90 family member; 82 kDa heat shock-inducible protein TTHERM_00047080 succinate dehydrogenase, flavoprotein subunit containing protein TTHERM_00794110 dehydrogenase, isocitrate/isopropylmalate family protein TTHERM_00268070 2-oxoglutarate dehydrogenase, E1 component family protein Actin; structural protein; monomeric subunits of the actin protein (G-actin) polymerize to form structural TTHERM_00190950 ACT1 (ACTin) filiaments (F-actin); localized to the cleavage forrow during cytokinesis TTHERM_01049200 Glutamate/Leucine/Phenylalanine/Valine dehydrogenase family protein TTHERM_00128330 Amylo-alpha-1,6-glucosidase family protein TPA8 (Tetrahymena P-type P-type ATPase; putative sarco(endo)plasmic reticulum Ca(2+) ATPase (SERCA); constitutively TTHERM_01084370 ATPase ) expressed; starvation downregulates expression TTHERM_00196370 HSP60 (Heat Shock Protein) HSP60; TCP-1/cpn60 chaperonin family protein TTHERM_01014750 dnaK protein TTHERM_00052310 AAC (ADP/ATP Carrier) Hydrogenosomal ADP/ATP carrier protein TTHERM_00954380 2-oxoglutarate dehydrogenase, E1 component family protein TTHERM_00241700 succinate dehydrogenase and fumarate reductase iron-sulfur protein

TTHERM_00725970 glycosyl transferase, group 1 family protein 67

TGP2 (Tetrahymena G-DNA G-quartet DNA binding protein; has dihydrolipoamide dehydrogenase (DLDH) activity; preferentially TTHERM_00043870 binding Protein ) binds G4-DNA oligonucleotides with adjacent single-stranded domains TTHERM_00151810 Elongation factor Tu, mitochondrial precursor, putative TTHERM_00059330 hypothetical protein DRS1 (Aspartyl-tRNA TTHERM_00616050 aspartyl-tRNA synthetase family protein synthetase 1) TTHERM_00535260 succinyl-CoA synthetase, beta subunit family protein TTHERM_00695650 AMP-binding enzyme family protein TTHERM_00237560 AMP-binding enzyme family protein TTHERM_00571650 hypothetical protein ARS2 (alanyl-tRNA synthetase TTHERM_00221140 alanyl-tRNA synthetase family protein 2) TTHERM_00899460 acetyl-CoA acyltransferases family protein PRS1 (Prolyl-tRNA synthetase TTHERM_00487020 prolyl-tRNA synthetase family protein 1) EEF2 (Eukaryotic translation Translation elongation factor 2; catalyzes ribosomal translocation during protein synthesis; mRNA is TTHERM_00938820 Elongation Factor ) expressed during vegetative growth; high amino acid identity with EF-2 in other eukaryotes TTHERM_00864870 hypothetical protein TTHERM_00486480 ENO1 (ENOlase) Enolase; portions of this gene may have been laterally transferred TTHERM_00122290 TCP1 (TCP1 Ortholog) TCP-1/cpn60 chaperonin family protein VMA2 (Vacuolar Membrane TTHERM_00529860 V-type ATPase, B subunit family protein Atpase) PDA1 (Pyruvate pyruvate dehydrogenase complex E1 component, catalyzes the direct oxidative decarboxylation of TTHERM_00193230 Dehydrogenase Alpha 1) pyruvate to acetyl-CoA TTHERM_00691520 KRS1 (lysyl-tRNA synthetase) lysyl-tRNA synthetase family protein VMA1 (Vacuolar Membrane TTHERM_00339640 V-type ATPase, A subunit family protein Atpase) NRS1 (asparaginyl-tRNA TTHERM_00691890 asparaginyl-tRNA synthetase family protein synthetase 1) TTHERM_00037060 CCT8 (CCT8 Ortholog) TCP-1/cpn60 chaperonin family protein DRH14 (DExD/H box RNA TTHERM_00469380 DEAD/DEAH box helicase family protein helicase 14) TTHERM_00429890 hypothetical protein

TTHERM_00471950 hypothetical protein 68

TTHERM_00193640 2-oxoglutarate dehydrogenase, E1 component family protein TTHERM_00068140 succinyl-CoA synthetase, alpha subunit family protein TTHERM_00616340 HEAT repeat family protein TTHERM_01394370 hypothetical protein TTHERM_00239290 CCT3 (CCT3 Ortholog) TCP-1/cpn60 chaperonin family protein TTHERM_00859260 EF-1 guanine nucleotide exchange domain containing protein TTHERM_00723390 dehydrogenase, isocitrate/isopropylmalate family protein TTHERM_00013760 hypothetical protein TTHERM_00365340 AAA family ATPase, CDC48 subfamily protein TTHERM_00046920 TATA box-binding protein TTHERM_00344030 dehydrogenase, isocitrate/isopropylmalate family protein TTHERM_00037050 CCT4 (CCT4 Ortholog) TCP-1/cpn60 chaperonin family protein TTHERM_00979780 Transketolase, pyridine binding domain containing protein DRH18 (DExD/H box RNA TTHERM_01197120 DEAD/DEAH box helicase family protein helicase 18) TTHERM_00151670 oxidoreductase, zinc-binding dehydrogenase family protein

TTHERM_00802450 Mitochondrial carrier protein

TTHERM_00502240 Carbamoyl-phosphate synthase L chain, ATP binding domain containing protein

TTHERM_00285620 NAC domain containing protein

TTHERM_00474970 60s Acidic ribosomal protein TTHERM_00549480 Thioredoxin family protein CCT7 (Chaperonin Containing TTHERM_00497960 CCT-eta chaperonin subunit; expressed during cilia biogenesis and conjugation TCP-1 )

TTHERM_00338470 PFK3 (PhosphoFructoKinase) Alpha subunit of heterooctameric phosphofructokinase

TTHERM_00446390 small GTP-binding protein domain containing protein 69

TTHERM_00363210 Mitochondrial carrier protein TTHERM_00670500 CCT6 (CCT6 Ortholog) TCP-1/cpn60 chaperonin family protein TTHERM_00459390 CTP synthase family protein TTHERM_00735240 small GTP-binding protein domain containing protein TTHERM_00134970 CCT5 (CCT5 Ortholog) TCP-1/cpn60 chaperonin family protein TTHERM_00925340 hypothetical protein TTHERM_00998940 hypothetical protein TTHERM_00046480 ENO2 (ENOlase) enolase family protein RPL12 (Ribosomal Protein of Homolog of Yeast RPL12, Human RPL12, Bacterial RPL11; Ribosomal protein L11; RNA binding TTHERM_00028740 the Large subunit #12) domain containing protein RPL11 (Ribosomal protein of TTHERM_00829380 Homolog of yeast RPL11(/RPL5)and E.coli RPL5 the large subunit) CHC1 (Clathrin Heavy Chain- TTHERM_00275740 Region in Clathrin and VPS family protein like protein) TTHERM_00338460 PFK2 (PhosphoFructoKinase) Beta subunit of heterooctameric Phosphofructokinase TTHERM_00715730 Calpain family cysteine protease containing protein TTHERM_00476820 TIP49 C-terminus family protein TTHERM_00377330 hypothetical protein

TTHERM_00049030 Na,H/K antiporter P-type ATPase, alpha subunit family protein TTHERM_00659010 hypothetical protein TTHERM_00584700 Protein kinase domain. Sequence similarity to a protein kinase family unique to Tetrahymena thermophila TTHERM_00725990 hypothetical protein RRS1 (arginyl-tRNA TTHERM_00657270 arginyl-tRNA synthetase family protein synthetase 1) TTHERM_00268030 Polyprenyl synthetase family protein

TTHERM_00527090 PBS lyase HEAT-like repeat family protein TTHERM_00773720 hypothetical protein TTHERM_00424720 hypothetical protein 70

TTHERM_00047230 hypothetical protein TTHERM_00161250 hypothetical protein TTHERM_00865270 DnaJ domain containing protein

TTHERM_01513260 BBC49 hypothetical protein PGK1 (PhosphoGlycerate Phosphoglycerate kinase; glycolytic enzyme that catalyzes the conversion of 3-phospho-D-glycerate to 3- TTHERM_00929450 Kinase ) phospho-D-glyceroyl phosphate SRS1 (seryl-tRNA synthetase TTHERM_00114360 seryl-tRNA synthetase family protein 1) MFE1 (Fusion of peroxisomal multifunctional oxydation TTHERM_00317440 Fusion of peroxisomal multifunctional oxydation protein and 2-enoyl-CoA hydratase protein and 2-enoyl-CoA hydratase) TTHERM_00052400 Cystathionine beta-lyase RPS18 (Ribosomal Protein of TTHERM_00131110 Homolog of yeast RPS18, human RPS18, bacterial RPS13 the Small subunit 18) RPS19 (Ribosomal Protein of TTHERM_00823670 Homolog of yeast RPS19, human RPS19; the Small subunit 19) RPS4 (Ribosomal Protein of TTHERM_00149300 Homolog of yeast RPS4, human RPS4; the Small subunit 4) RPS22 (Ribosomal Protein of TTHERM_00454080 Homolog of yeast RPS22, bacterial RPS8; the Small subunit 22) Catalase; peroxisomal enzyme involved in the metabolism of hydrogen peroxide; enzyme activity induced TTHERM_01146030 CAT1 (CATalase ) by linolenic acid RPS17 (Ribosomal Protein of TTHERM_00762890 Homolog of yeast RPS17, human RPS17 the Small subunit 17) PDI1 (Protein Disulfide- TTHERM_00475140 protein disulfide-isomerase domain containing protein Isomerase) TTHERM_00777250 hypothetical protein RPL8 (Ribosomal protein of TTHERM_00773340 Homolog of Yeast RPL8, Human RPL7A, Archaeal RPL7AE; the large subunit)

CHAPTER 4 DISCUSSION AND FUTURE PERSPECTIVE

Since the discovery of SUMO in 1996, efforts have been focused on the identification of its cellular targets in order to characterize the functional consequences of SUMOylation. In this study, we combined phenotypic study as well as proteomic study to elucidate cellular functions of SUMOylation in Tetrahymena thermophila during vegetative growth and sexual reproduction. Our proteomic analyses and genetic analyses all support roles of SUMOylation in regulating mitosis, metabolism, ribosome biogenesis, progression through conjugation, heat shock response and MAC development.

Ubc9p regulates cell cycle progression and chromosomal segregation

One of the first roles discovered for SUMOylation was in regulation of the cell cycle progression in numerous model systems [99,149,150]. We have demonstrated that there is a requirement for SUMOylation in Tetrahymena mitosis. We found that complete deletion of UBC9 was lethal, a result consistent with studies in other organisms [13,38,48,136]. However, reduced expression of UBC9 resulted in distinct phenotypes in MICs. The MICs were lost from UBC9-depleted cells during vegetative growth. Having a separate mitotic nucleus that does not contribute to gene expression makes Tetrahymena a unique system for this study as other organisms will die aneuploidy nuclei. Our model is that there is little to no DNA that is distributed to the MIC during mitosis due to chromosome mis-segregation events that occur as a result of UBC9 depletion. This is supported by the observation of unequal signal in dividing nuclei in DAPI stained cells during mitosis (Fig. 8C). The requirement for SUMOylation in chromosome segregation is well established in other species [45,109,151,152]. In budding yeast, deficiency in SUMOylation brought upon by deletion of UBC9 results in gross defects in chromosome structure and integrity as well as aberrant segregation and polyploidy [39]. On the other hand, we observe that Tetrahymena cells expressing catalytically inactive dominant

negative Ubc9p have multiple MICs. This could be explained if dominant-negative Ubc9 expression prevents MAC division and/or cytokinesis but MIC division is unaffected. In this case, the single MIC undergoes one or more divisions without cytokinesis occurring which would indicate a requirement of SUMOylation in cytokinesis. A multi-nucleate phenotype was observed by Hayashi et al in a large number of chicken cells expressing a conditional UBC9 mutant [38]. Septins are proteins have that been identified as high abundant substrates of SUMO in budding yeast during mitosis. Septins are SUMO- modified prior to anaphase and disappear abruptly at cytokinesis. Only SUMOylated septins have been observed to accumulate at the bud neck in mother cells[153] in yeast. These results all suggest that Ubc9p plays an indispensable role in Tetrahymena mitosis either through regulating cytokinesis or controlling chromosome segregation.

In agreement with the diverse cell cycle defects in SUMO mutants in model systems, we identified a Cell Division Cycle protein 2 (CDC2) as an Ubc9p interacting partner in our proteomic screen. CDC2, also known as cyclin dependent kinase 1 (Cdk1), is a key regulator in cell cycle regulation that functions as a serine/threonine kinase [154]. It is possible that SUMOylation of Cdc2 is necessary for its role in regulating progression of the cell cycle. Alternatively, Ubc9 in Tetrahymena may be a substrate of Cdc2 phosphorylation as it is in human [155]. Another Ubc9p interacting protein that we identified is DNA topoisomerase I (TOPO I) which has been previously reported as SUMO substrate, as well as a Ubc9 interacting protein [156]. TOPO I was SUMO conjugated in a Ubc9p-dependent manner and its interaction with SUMO and Ubc9p was required for TOPO I-mediated DNA damage repair.

This loss-of-MIC phenotype is particularly interesting to us, because it has not been reported previously in other species. We have observed Tetrahymena cells devoid of DAPI-detectable MICs are able to survive with a micronucleus that does not have DNA, which makes it a unique organism that provides more opportunity to study genome integrity. A similar mitotic phenotype has been described previously by Cui and Gorovsky in Tetrahymena [157] where they identified a centromeric H3 protein, Cna1p, which exhibits micronuclear DNA loss and unequal chromosome segregation during

mitosis when CNA1 gene was partially knockdown in somatic macronucleus. CNA1 gene encodes a centromere-specific histone H3 variants, termed CenH3s [158-160], that is associated with centromeric DNA in place of the typical H3s associated with the rest of the genome. CenH3s are functionally conserved [161] and are required for functional centromeres and recruitment of other centromeric and spindle checkpoint proteins. CNA1 is essential for vegetative growth. Incomplete macronuclear knockout results in MICs that are smaller than MICs in wild-type cells [157], rather than the loss-of-MIC phenotype observed in our Ubc9p depletion cells. Small MICs do not seem to prevent MIC mitosis, however, DNA is unequally distributed to daughter nuclei [157], which is in line with our observation in cells with reduced expression of Ubc9p. There is evidence that SUMOylation plays critical roles in centromere function. Saccharomyces cerevisiae Slx5/8 complex is the founding member of a recently defined class of SUMO-targeted ubiquitin ligases (STUbLs). Slx5 exhibits a unique centromeric location though genome- wide biding analysis. Deletion of slx5 and slx 8 in yeast show severe mitotic defects that include aneuploidy and spindle mispositioning. Yeast two-hybrid screening has identified that Ubc9 interacts with three subunits of the S. cerevisiae centromere DNA-binding core complex, CBF3 [122]. All of these point towards the role of SUMOylation in centromere-specific functions during mitosis. It would be interesting to analyze whether Cnap1 is a SUMOylation substrate.

Howard-Till et al have recently identified a protein that is part of the cohesion components, termed Rec8 [162], which is shown to localize to mitotic and meiotic nuclei. RNAi-induced depletion of Rec8 results in slow growth, as well as lagging chromosomes in mitotic anaphase [162]. Immunoprecipitation of Rec8 followed by probing with anti- SUMO antibody suggests that Rec8 is SUMOylated (R. Howard-Till personal communication). This provides another model where SUMOylation regulates cohesion which further controls chromosomal segregation.

SUMOylation in Tetrahymena conjugation

Tetrahymena thermophila increase transcript levels of SUMO pathway enzymes during the sexual life cycle indicating that SUMOylation may be involved in the nuclear

processes that occur during conjugation. Our studies demonstrate critical roles for Ubc9p during the sexual life cycle of Tetrahymena. Crosses between cell lines that express the dominant negative Ubc9 were delayed in meiosis and resulted in fewer true exconjugant progeny than from wild-type controls (Shown in Table 2). In contrast, cell lines that were depleted for Ubc9p did not form pairs and therefore could not complete any of the subsequent stages of conjugation including meiosis and macronuclear development. This non-pairing phenotype was unexpected yet there is precedent for a SUMOylation requirement for mating in other species. In budding yeast, degradation of the yeast mating type factor, α1 protein, requires SUMO Targeted Ubiquitin Ligases (STUbLs) Slx5 and Slx8 [163]. The requirement for SUMOylation could result from direct modification of protein in cell pairing, a signal transduction pathway or a transcriptional pathway needed to produce mating proteins. Although future studies will be required to evaluate these possibilities we can note one observation made from an abandoned project. In an earlier study, we identified three SUMO E3 ligase candidates based on domains/structures (Q. Yang and J. Forney unpublished data). Cell lines expressing GFP- E3#3 (Candidate 3) were generated and we found that the fusion protein localized at the junctions of conjugating cells. It is possible that candidate 3 is a SUMO E3 ligase that transfers SUMO to targets that are required for cell pairing. At that time we were expecting nuclear SUMO E3 ligases so we did not pursue studies of this protein but in view of the non-pairing phenotype this could be significant. The non-pairing phenotype and delay in meiosis prevented us from analyzing the role of SUMOylation during macronuclear development. To overcome this problem, future efforts will be focused on developing alternative approaches such as inducible RNAi knockdown of SUMO pathway genes or examination of SUMO substrate proteins during conjugation. Ultimately we anticipate that severe defects will be discovered upon depletion of SUMO pathway proteins. Previous studies demonstrated that RNAi-based silencing of Uba2p and SUMO in Paramecium tetraurelia prevented the excision of IES during formation of the somatic macronucleus [126]. Several conjugation-specific Ubc9 interacting proteins have been identified from our proteomics screening. One such example is Twi1, which is

an argonaute protein that is required in RNAi-mediated DNA rearrangements in Tetrahymena macronuclear development [120].

Identification of Ubc9 interacting proteins using proteomics-based approach

Prior to 2004, identification of Ubc9p interacting protein was on performed using mostly yeast two-hybrid screens and limited numbers of proteins were identified. However, the discovery of proteomics methods dramatically changed this. One challenge that we are constantly facing is that SUMOylation is a dynamic process with conjugation and deconjugation taking place concurrently, which means that at a given time in the cell, the form of a particular substrate attached to Ubc9p or SUMO is present in very low quantities, making detection of such protein-protein interactions very difficult. In addition, different proteins will be SUMOylated under different cellular conditions at different times. All these factors make it impossible for any single study to be comprehensive. We are focusing on identification of Ubc9p interacting proteins during Tetrahymena vegetative growth vs sexual reproduction. Ubc9p was N-terminal tagged with (His)6 followed by (FLAG)3 tag. Purification was performed under native conditions to protect the integrity of the protein complexes, followed by LC-MS protein mass spectrometry. We identified 242 proteins from vegetative cells and 213 proteins from conjugating samples. To verify the authenticity of these proteins as true interactors is another challenge. One source of background is from high abundant “sticky” proteins. In order to identify these “sticky” proteins and increase our confidence, we compared proteins that we identified against those from two other Tetrahymena purifications performed by Gould et al. and Smith et al. Proteins that appear in all three purifications are ones which we consider to be low-confidence substrates. Proteins that are unique to

our Ubc9p proteomic screen (they are not present in the two studies) are high-confidence proteins. We have identified 128 such high confidence proteins from vegetative samples (Veg.) and 106 from conjugating Tetrahymena (Conj.) (Table 7). In addition to a large number of novel Ubc9p interacting proteins identified, the list includes orthologs of previously identified Ubc9p interacting proteins or SUMO conjugates in other organisms (e.g. Cdc2, TopI, EEF2, DRH19, multiple aminoacyl-tRNA synthetases and ribosomal proteins)

Table 7: Comparison between numbers of proteins identified from vegetative vs conjugating Tetrahymena based on biological function. Veg. Conj. Metabolism 36 31 PTM & degradation 13 11 Signal transduction 4 2 Ribosome biogenesis 2 12 RNA processing 8 5 Translation 4 1 Structure maintenance 2 2 Response to cellular environment 10 4 Unknown 39 24 Transcription 4 4 Cell division 1 2 Transport 5 4 Chromatin remodeling 0 2 Tetrahymena Conjugation 0 2 Total 128 106

As shown in table 6, no proteins that are involved in chromatin remodeling and Tetrahymena conjugation were identified from vegetative samples, while 2 proteins in chromatin remodeling and 2 proteins involved in Tetrahymena conjugation were identified from conjugating samples. In addition, increased numbers of ribosomal proteins were identified in conjugating samples compares to vegetative samples (12 vs 2).

In 2013, Dr. Brian Raught’s laboratory reported 97 high-confidence Ubc9p interacting proteins in budding yeast using affinity purification-coupled mass spectrometry approach [146]. Four of these proteins were previously reported to be Ubc9 interactors, and 37

have previously been identified as SUMO conjugants. Table 8 categorizes proteins identified in yeast (S.c.) and Tetrahymena (T.t) based on their biological functions.

Table 8: Numbers of Ubc9 interacting proteins identified from Ubc9p proteomics screens between Tetrahymena and yeast T.t S.c Metabolism 36 19 PTM & degradation 13 1 Signal transduction 4 0 Ribosome biogenesis 2 21 RNA processing 8 9 Translation 4 5 Structure maintenance 2 3 Response to cellular environment 10 1 Unknown 39 8 Transcription 4 9 Cell division 1 5 Transport 5 7 Bud site selection 0 2 chromatin remodeling 0 7 Total 128 97

Many known SUMO substrates regulate nuclear activity, including roles in transcription, chromatin remodeling, DNA/RNA modification and DNA repair [164]. Surprisingly, only a small fraction of the Ubc9 interacting proteins were classified as nuclear proteins (~7 from vegetative cells and ~12 from mated samples). The reasons for this are unclear but future efforts to identify additional nuclear Ubc9p interacting proteins may require the purification of nuclei followed by protein purification and protein mass spectrometry. There is increasing evidence, however, that suggests SUMOylation is a less-centralized process than expected and regulates several processes outside the nucleus including membrane transport, mitochondrial activity, ribosomal biogenesis and heat shock stress [6-8,91,165]. Indeed we identified several proteins that are involved in these processes.

SUMOylation and metabolism

Almost half of the Ubc9p interacting proteins we identified are classified as proteins in metabolism (27-29% in vegetative and conjugating samples). It is not surprising that

SUMO is known to modify and affect the function or regulate specific metabolic enzymes within pathways. There is increasing evidence that SUMO is a key factor in facilitating energy and nucleotide metabolism in response to cellular and environmental cues, one such example is hypoxia [166]. Under the condition of hypoxia, increased protein SUMOylation is observed. In addition, under hibernation, torpor and focal cerebral ischaemia conditions, increased protein SUMOylation is also observed [167,168]. These studies demonstrated that global protein SUMOylation is increased in response to metabolic stress despite the fact that specific targets under these conditions were not identified. A proposed model is that the basis of hypoxia-dependent increase in global SUMOylation appears to involve, at least in part, transcriptional upregulation of SUMO mRNA [166,169]. Researchers have also identified Hypoxia-induced factor (HIF) as a SUMO substrate [169]. HIF is a central transcriptional regulator of a cell’s adaptive response to hypoxia [170]. The regulation of transcriptional activity by SUMOylation during hypoxic stress is one of the first observations establishing the relationship between SUMOylation and metabolic stress response.

A second way by which the SUMO pathway may have an impact on metabolic processes is through the regulation of the balance between mitochondrial fission and fusion, which is critical for a number of processes including the maintenance of numbers of neuronal synapses [2,171]. Several mitochondria proteins have been identified from our immunoaffinity purification. They are either located in the mitochondrion (e.g. citrate synthase), or they are involved in mitochondrial-related process (e.g. Mitochondrial carrier protein).

SUMOylation and ribosomal biogenesis

The control of ribosome biogenesis is a critical cellular nodal point, which ensures that protein synthesis is coordinated with cell growth and proliferation. The process is initiated in the nucleolus, where the precursor forms of the small 40S and larger 60S subunits are generated. Following cleavage and processing, these subunits are exported to the cytoplasm for assembly into ribosomes. In the yeast Saccharomyces cerevisiae, genetic studies have led to the identification of many critical components of the ribosome

biogenesis pathway. Other biochemical approaches have enabled the isolation of specific ribosomal pre-40S and pre-60S sub-complexes, which seem to function as intermediates in the export of ribosomal particles to the cytoplasm [172]. Genetic studies in yeast also revealed a role of the ubiquitin-like SUMO system in the formation and nuclear export of pre-ribosomal particles [91]. Crucial roles of SUMOylation in mammalian ribosome biogenesis have also been described [93,173]. We identified numerous proteins of the ribosome complex in our proteomic screen in both vegetative and mating cells. Moreover, we identified more proteins in the mated sample corresponding to MAC development which would indicate the increased requirement of SUMO in protein expression. We cannot differentiate whether these proteins are modified by SUMO in the nucleus or in the cytoplasm but analysis of substrates prepared from nuclear extracts may aid in differentiating between these alternatives.

SUMOylation and heat shock stress

All organisms need to be able to sense and react to extreme environmental conditions. Without appropriate response such stresses can lead to cell damage or death. The heat shock response is one of the most conserved and well-studied defense mechanism. SUMOylation has been shown to involve in heat shock response. The levels of SUMO1 and SUMO2 conjugates were increased substantially followed the induction of heat shock in Arabidopsis [174]. Overexpression of SUMO2 enhanced steady state levels of SUMO2 conjugates in heat shock-induced accumulation. This accumulation was reduced in an Arabidopsis line modified for increased thermotolerence by overexpressing the cytosolic isoform of the Heat shock protein 70 (HSP70) chaperonin [174]. Following the heat stress, SUMO conjugates pool were drastically increased in plants [164]. RNAi knockdown of SUMO2 and SUMO3 substantially reduced cell survival after heat shock [165]. In 2009, the Hay group utilized a system-level proteomics approach to describe quantitative changed in protein modification with the SUMO2 paralog in mammalian cells during response to heat shock. A massive redistribution of SUMO2 conjugates was observed that affected many biological pathways [165]. Several Heat Shock Proteins,

such as Hsp70 and Hsp71, were identified as Ubc9 interacting proteins in Tetrahymena which is consistent with the role of SUMOylation in heat shock response.

Identification of SUMO interacting protein under native condition.

As an alternative approach to identify SUMO substrates, affinity purification of SUMO protein was carried out to identify SUMO interacting proteins. SUMO was tagged with the same dual tag that we described above (Q. Yang and J. Forney unpublished data). 78 proteins were identified, which includes proteins from several cellular processes, such as metabolism, ribosome biogenesis, transcription, and stress response (Fig. 21 and Table 9). We compared Ubc9p vegetative list and SUMO vegetative list and found large amount of proteins (52) that are common to both data sets (Fig. 22). There are two ways to interpret these overlapping proteins - some of these are potential SUMO substrates or SUMO E3 ligases that are interacting with both Ubc9p and SUMO, or it is also plausible that these proteins represent background proteins present in both proteomic screens.

Fig. 21: Graphical representation of biological processes of SUMO interacting proteins in Tetrahymena. 78 high-confidence SUMO interacting proteins were reported. These proteins are categorized into different subsets based on their major functions, including transcription, response to cellular environment, structure maintenance, metabolism, translation, transport, ribosome biogenesis, RNA processing, PTM & degradation and unknown.

Fig. 22: Overlap between Ubc9p native purification and SUMO native purification during Tetrahymena vegetative growth. There are 52 proteins that appeared in both Ubc9 and SUMO two-step purifications.

Table 9: Number of proteins categorized by biological functions from Ubc9p and SUMO proteomics screens Ubc9p SUMO Metabolism 36 20 PTM & degradation 13 7 Signal transduction 4 2 Ribosome biogenesis 2 1 RNA processing 8 5 Translation 4 2 Structure maintenance 2 2 Response to cellular environment 10 7 Unknown 39 27 Transcription 4 3 Cell division 1 0 Transport 5 2 Total 128 78

Future perspectives Different phenotypes were observed from cell lines depleted with Ubc9p (loss of MIC phenotype) and cell lines expressing catalytic inactive Ubc9p (multiple MICs phenotype). Loss-of-MIC phenotype was possibly attributed to the role of Ubc9p in chromosome

segregation, however, the cause of multiple micronuclei was unclear. One hypothesis is that cells expressing catalytic inactive Ubc9p causes defects in cytokinesis. Monitoring cell number at various time points will provide initial evidence whether cytokinesis is affected or not. One of the most abundant SUMOylated protein in budding yeast is septin [175]. SUMO conjugation of septins is required for bud-neck ring formation during cytokinesis [176]. It would be interesting to investigate SUMOylation of septins in the cells expressing catalytic inactive Ubc9p.

Validation and characteristic of Ubc9p interacting proteins

TWI1 and HMGB were identified as conjugation-specific Ubc9p interacting proteins. TWI1 is required for IES elimination in Tetrahymena macronuclear development [119]. In HMGB depleted Tetrahymena cells, mating was delayed and mating efficiency was decreased [148]. We anticipate Ubc9p is required during Tetrahymena conjugation. Two additional methods will be employed to validate interaction between Ubc9p and TWI1 or HMGB. The first approach will validate Ubc9p interaction with TWI1 or HMGB by co- immunoprecipitation. Specifically, samples either wild-type untagged strain, tandem- affinity purified Ubc9p preparation will be separated by SDS-PAGE. Following this, western blot analyses will be performed for TWI1 and HMGB using antibodies if they are readily available. If antibodies are not available, we can express HA- or GST- tagged TWI1 or HMGB. Western blotting can then be performed with anti-HA or anti-GST antibody. A band corresponding to Twi1 or HMGB is expected in the Ubc9p preparation as opposed to the control preparation. If such bands are observed, it would suggest that these proteins interact with Ubc9p. Reverse immunoprecipitation will be employed that proteins will be purified from tagged and untagged TWI1 or HMBG followed by probing with anti-UBC9 antibody. Bands corresponding to Ubc9p are expected.

In order to analyze whether TWI1 or HMGB are SUMO substrates, tagged TWI1 or HMGB will be affinity purified in cell lines expressing or depleted with UBC9. Western blots will be probed with anti-SUMO antibody. A slower migration is expected in cell lines expressing Ubc9p.

The second approach involves the use of in vitro SUMOylation assay. Bacterial strains will be engineered to express components of the SUMO pathway – SUMO, E1 heterodimer of Aos1p/Uba2p and Ubc9p and ATP. The advantage of such an assay is that it does not require E3 SUMO ligases. GST-tagged TWI1 or HMGB will be incubated in the presence of complete SUMO assay components after which proteins will be resolved by SDS-PAGE and then western blotting with anti-GST antibodies. Presence of the SUMO-modified form of TWI1 or HMGB will suggest that these are bona fide substrates of SUMOp where attachment of SUMOp requires the use of the E2 Ubc9p. We will also utilize SUMOplot (http://www.abgent.com/tools/) to identify putative SUMOylation sites. These putative sties can be confirmed as actual sites of SUMOp attachment by generating Lys mutants that are not SUMO-modified using the SUMOylation assay.

Affinity purification of nuclear Ubc9p interacting proteins.

It has been established that SUMOylation regulates various nuclear activities. Surprisingly, only a small fraction of the Ubc9p interacting proteins were classified as nuclear proteins with possible reason being most nuclear proteins are not released from the nucleus. Future effort should be focused on identify additional nuclear Ubc9p interacting proteins through protein purification followed by protein mass spectrometry. Two nuclei isolation and purification protocols are described previously by Sweet and Allis [177,178].

Identification and characteristic of SUMO E3 ligases.

Unlike Ubiquitin E3 ligases, not much is known about SUMO E3 ligases. Identification of SUMO E3 ligases will provide insights into the regulation of SUMOylation. We initially identify three SUMO E3 ligases candidates (TTHERM_00348490, TTHERM_00442270, TTHERM_00227730) based on bioinformatics approach. Knockout cell strain and cells expressing GFP-tagged E3#3 were generated. E3#3 localized to conjugation junction in Tetrahymena, which is interesting now and possibly in line with the role of UBC9 in Tetrahymena paring. In order to further characterize this being SUMO E3 ligase, global SUMOylation will be analyzed with reduced expression of E3 candidates.

Declaration of Co-Authorship I hereby declare that this thesis incorporates material that is the result of joint research, as follows: heterozygous UBC9 knockout cell lines and UBC9-mCherry cell lines were generated by Robert Coyne at J. Craig Venter Institute using plasmid DNA that I constructed and prepared. The collaboration is covered in Chapter 2 of the thesis. Amjad M. Nasir was responsible for designing and performing DN-Ubc9p mating experiments, which are presented in Chapter 2. He also constructed p(His)6- (FLAG)3-UBC9 plasmid, which I used for protein purification studies in Chapter 3. Chapter 3 incorporates the outcome of a joint research effort undertaken in collaboration with Dr. Mark C. Hall and Brendan L. Powers. The contribution of co-authors was primarily through the generation and analysis of Mass spectrometry data.

REFERENCES

1. Dohmen RJ (2004) SUMO protein modification. Biochim Biophys Acta 1695: 113-131. 2. Geiss-Friedlander R, Melchior F (2007) Concepts in sumoylation: a decade on. Nat Rev Mol Cell Biol 8: 947-956. 3. Wilkinson KA, Henley JM (2010) Mechanisms, regulation and consequences of protein SUMOylation. Biochem J 428: 133-145. 4. Zhao J (2007) Sumoylation regulates diverse biological processes. Cell Mol Life Sci 64: 3017- 3033. 5. Bayer P, Arndt A, Metzger S, Mahajan R, Melchior F, et al. (1998) Structure determination of the small ubiquitin-related modifier SUMO-1. J Mol Biol 280: 275-286. 6. Rajan S, Plant LD, Rabin ML, Butler MH, Goldstein SA (2005) Sumoylation silences the plasma membrane leak K+ channel K2P1. Cell 121: 37-47. 7. Andreou AM, Tavernarakis N (2009) SUMOylation and cell signalling. Biotechnol J 4: 1740- 1752. 8. Wang YE, Pernet O, Lee B (2012) Regulation of the nucleocytoplasmic trafficking of viral and cellular proteins by ubiquitin and small ubiquitin-related modifiers. Biol Cell 104: 121- 138. 9. Lomeli H, Vazquez M (2011) Emerging roles of the SUMO pathway in development. Cell Mol Life Sci 68: 4045-4064. 10. Hickey CM, Wilson NR, Hochstrasser M (2012) Function and regulation of SUMO proteases. Nat Rev Mol Cell Biol 13: 755-766. 11. Desterro JM, Rodriguez MS, Kemp GD, Hay RT (1999) Identification of the enzyme required for activation of the small ubiquitin-like protein SUMO-1. J Biol Chem 274: 10618-10624. 12. Tang Z, Hecker CM, Scheschonka A, Betz H (2008) Protein interactions in the sumoylation cascade: lessons from X-ray structures. FEBS J 275: 3003-3015. 13. Schwarz SE, Matuschewski K, Liakopoulos D, Scheffner M, Jentsch S (1998) The ubiquitin-like proteins SMT3 and SUMO-1 are conjugated by the UBC9 E2 enzyme. Proc Natl Acad Sci U S A 95: 560-564. 14. Sampson DA, Wang M, Matunis MJ (2001) The small ubiquitin-like modifier-1 (SUMO-1) consensus sequence mediates Ubc9 binding and is essential for SUMO-1 modification. J Biol Chem 276: 21664-21669. 15. Johnson ES (2004) Protein modification by SUMO. Annu Rev Biochem 73: 355-382. 16. Shuai K (2000) Modulation of STAT signaling by STAT-interacting proteins. Oncogene 19: 2638-2644. 17. Pichler A, Gast A, Seeler JS, Dejean A, Melchior F (2002) The nucleoporin RanBP2 has SUMO1 E3 ligase activity. Cell 108: 109-120. 18. Cheong MS, Park HC, Bohnert HJ, Bressan RA, Yun DJ (2010) Structural and functional studies of SIZ1, a PIAS-type SUMO E3 ligase from Arabidopsis. Plant Signal Behav 5: 567-569. 19. Schwartz DC, Hochstrasser M (2003) A superfamily of protein tags: ubiquitin, SUMO and related modifiers. Trends Biochem Sci 28: 321-328. 20. Kerscher O, Felberbaum R, Hochstrasser M (2006) Modification of proteins by ubiquitin and ubiquitin-like proteins. Annu Rev Cell Dev Biol 22: 159-180. 21. Melchior F (2000) SUMO--nonclassical ubiquitin. Annu Rev Cell Dev Biol 16: 591-626.

22. Reverter D, Lima CD (2005) Insights into E3 ligase activity revealed by a SUMO-RanGAP1- Ubc9-Nup358 complex. Nature 435: 687-692. 23. Yunus AA, Lima CD (2009) Structure of the Siz/PIAS SUMO E3 ligase Siz1 and determinants required for SUMO modification of PCNA. Mol Cell 35: 669-682. 24. Reindle A, Belichenko I, Bylebyl GR, Chen XL, Gandhi N, et al. (2006) Multiple domains in Siz SUMO ligases contribute to substrate selectivity. J Cell Sci 119: 4749-4757. 25. Hietakangas V, Ahlskog JK, Jakobsson AM, Hellesuo M, Sahlberg NM, et al. (2003) Phosphorylation of serine 303 is a prerequisite for the stress-inducible SUMO modification of heat shock factor 1. Mol Cell Biol 23: 2953-2968. 26. Yamashita D, Yamaguchi T, Shimizu M, Nakata N, Hirose F, et al. (2004) The transactivating function of peroxisome proliferator-activated receptor gamma is negatively regulated by SUMO conjugation in the amino-terminal domain. Genes Cells 9: 1017-1029. 27. Mohideen F, Capili AD, Bilimoria PM, Yamada T, Bonni A, et al. (2009) A molecular basis for phosphorylation-dependent SUMO conjugation by the E2 UBC9. Nat Struct Mol Biol 16: 945-952. 28. Shalizi A, Gaudilliere B, Yuan Z, Stegmuller J, Shirogane T, et al. (2006) A calcium-regulated MEF2 sumoylation switch controls postsynaptic differentiation. Science 311: 1012-1017. 29. Gareau JR, Lima CD (2010) The SUMO pathway: emerging mechanisms that shape specificity, conjugation and recognition. Nat Rev Mol Cell Biol 11: 861-871. 30. Hay RT (2005) SUMO: a history of modification. Mol Cell 18: 1-12. 31. Muller S, Hoege C, Pyrowolakis G, Jentsch S (2001) SUMO, ubiquitin's mysterious cousin. Nat Rev Mol Cell Biol 2: 202-210. 32. Seeler JS, Dejean A (2003) Nuclear and unclear functions of SUMO. Nat Rev Mol Cell Biol 4: 690-699. 33. Seufert W, Futcher B, Jentsch S (1995) Role of a ubiquitin-conjugating enzyme in degradation of S- and M-phase cyclins. Nature 373: 78-81. 34. Dieckhoff P, Bolte M, Sancak Y, Braus GH, Irniger S (2004) Smt3/SUMO and Ubc9 are required for efficient APC/C-mediated proteolysis in budding yeast. Mol Microbiol 51: 1375-1387. 35. al-Khodairy F, Enoch T, Hagan IM, Carr AM (1995) The Schizosaccharomyces pombe hus5 gene encodes a ubiquitin conjugating enzyme required for normal mitosis. J Cell Sci 108 ( Pt 2): 475-486. 36. Epps JL, Tanda S (1998) The Drosophila semushi mutation blocks nuclear import of bicoid during embryogenesis. Curr Biol 8: 1277-1280. 37. Azuma Y, Arnaoutov A, Dasso M (2003) SUMO-2/3 regulates topoisomerase II in mitosis. J Cell Biol 163: 477-487. 38. Hayashi T, Seki M, Maeda D, Wang W, Kawabe Y, et al. (2002) Ubc9 is essential for viability of higher eukaryotic cells. Exp Cell Res 280: 212-221. 39. Nacerddine K, Lehembre F, Bhaumik M, Artus J, Cohen-Tannoudji M, et al. (2005) The SUMO pathway is essential for nuclear integrity and chromosome segregation in mice. Dev Cell 9: 769-779. 40. Tarsounas M, Pearlman RE, Gasser PJ, Park MS, Moens PB (1997) Protein-protein interactions in the synaptonemal complex. Mol Biol Cell 8: 1405-1414. 41. Hooker GW, Roeder GS (2006) A Role for SUMO in meiotic chromosome synapsis. Curr Biol 16: 1238-1243.

42. Kovalenko OV, Plug AW, Haaf T, Gonda DK, Ashley T, et al. (1996) Mammalian ubiquitin- conjugating enzyme Ubc9 interacts with Rad51 recombination protein and localizes in synaptonemal complexes. Proc Natl Acad Sci U S A 93: 2958-2963. 43. La Salle S, Sun F, Zhang XD, Matunis MJ, Handel MA (2008) Developmental control of sumoylation pathway proteins in mouse male germ cells. Dev Biol 321: 227-237. 44. Koshiyama A, Hamada FN, Namekawa SH, Iwabata K, Sugawara H, et al. (2006) Sumoylation of a meiosis-specific RecA homolog, Lim15/Dmc1, via interaction with the small ubiquitin-related modifier (SUMO)-conjugating enzyme Ubc9. FEBS J 273: 4003-4012. 45. Yuan YF, Zhai R, Liu XM, Khan HA, Zhen YH, et al. (2014) SUMO-1 plays crucial roles for spindle organization, chromosome congression, and chromosome segregation during mouse oocyte meiotic maturation. Mol Reprod Dev 81: 712-724. 46. Li SJ, Hochstrasser M (2000) The yeast ULP2 (SMT4) gene encodes a novel protease specific for the ubiquitin-like Smt3 protein. Mol Cell Biol 20: 2367-2377. 47. Joseph J, Tan SH, Karpova TS, McNally JG, Dasso M (2002) SUMO-1 targets RanGAP1 to kinetochores and mitotic spindles. J Cell Biol 156: 595-602. 48. Nowak M, Hammerschmidt M (2006) Ubc9 regulates mitosis and cell survival during zebrafish development. Mol Biol Cell 17: 5324-5336. 49. Jackson SP, Bartek J (2009) The DNA-damage response in human biology and disease. Nature 461: 1071-1078. 50. Wyman C, Kanaar R (2006) DNA double-strand break repair: all's well that ends well. Annu Rev Genet 40: 363-383. 51. Bekker-Jensen S, Mailand N (2010) Assembly and function of DNA double-strand break repair foci in mammalian cells. DNA Repair (Amst) 9: 1219-1228. 52. Jackson SP, Durocher D (2013) Regulation of DNA damage responses by ubiquitin and SUMO. Mol Cell 49: 795-807. 53. Galanty Y, Belotserkovskaya R, Coates J, Polo S, Miller KM, et al. (2009) Mammalian SUMO E3-ligases PIAS1 and PIAS4 promote responses to DNA double-strand breaks. Nature 462: 935-939. 54. Morris JR, Boutell C, Keppler M, Densham R, Weekes D, et al. (2009) The SUMO modification pathway is involved in the BRCA1 response to genotoxic stress. Nature 462: 886-890. 55. Uzunova K, Gottsche K, Miteva M, Weisshaar SR, Glanemann C, et al. (2007) Ubiquitin- dependent proteolytic control of SUMO conjugates. J Biol Chem 282: 34167-34175. 56. Perry JJ, Tainer JA, Boddy MN (2008) A SIM-ultaneous role for SUMO and ubiquitin. Trends Biochem Sci 33: 201-208. 57. Tatham MH, Geoffroy MC, Shen L, Plechanovova A, Hattersley N, et al. (2008) RNF4 is a poly- SUMO-specific E3 ubiquitin ligase required for arsenic-induced PML degradation. Nat Cell Biol 10: 538-546. 58. Lallemand-Breitenbach V, Jeanne M, Benhenda S, Nasr R, Lei M, et al. (2008) Arsenic degrades PML or PML-RARalpha through a SUMO-triggered RNF4/ubiquitin-mediated pathway. Nat Cell Biol 10: 547-555. 59. Weisshaar SR, Keusekotten K, Krause A, Horst C, Springer HM, et al. (2008) Arsenic trioxide stimulates SUMO-2/3 modification leading to RNF4-dependent proteolytic targeting of PML. FEBS Lett 582: 3174-3178. 60. Prudden J, Pebernard S, Raffa G, Slavin DA, Perry JJ, et al. (2007) SUMO-targeted ubiquitin ligases in genome stability. EMBO J 26: 4089-4101.

61. Sun H, Leverson JD, Hunter T (2007) Conserved function of RNF4 family proteins in eukaryotes: targeting a ubiquitin ligase to SUMOylated proteins. EMBO J 26: 4102-4112. 62. Yin Y, Seifert A, Chua JS, Maure JF, Golebiowski F, et al. (2012) SUMO-targeted ubiquitin E3 ligase RNF4 is required for the response of human cells to DNA damage. Genes Dev 26: 1196-1208. 63. Galanty Y, Belotserkovskaya R, Coates J, Jackson SP (2012) RNF4, a SUMO-targeted ubiquitin E3 ligase, promotes DNA double-strand break repair. Genes Dev 26: 1179-1195. 64. Mullen JR, Kaliraman V, Ibrahim SS, Brill SJ (2001) Requirement for three novel protein complexes in the absence of the Sgs1 DNA helicase in Saccharomyces cerevisiae. Genetics 157: 103-118. 65. Chapman JR, Taylor MR, Boulton SJ (2012) Playing the end game: DNA double-strand break repair pathway choice. Mol Cell 47: 497-510. 66. Williams RS, Williams JS, Tainer JA (2007) Mre11-Rad50-Nbs1 is a keystone complex connecting DNA repair machinery, double-strand break signaling, and the chromatin template. Biochem Cell Biol 85: 509-520. 67. Huen MS, Sy SM, Chen J (2010) BRCA1 and its toolbox for the maintenance of genome integrity. Nat Rev Mol Cell Biol 11: 138-148. 68. You Z, Bailis JM (2010) DNA damage and decisions: CtIP coordinates DNA repair and cell cycle checkpoints. Trends Cell Biol 20: 402-409. 69. Dou H, Huang C, Van Nguyen T, Lu LS, Yeh ET (2011) SUMOylation and de-SUMOylation in response to DNA damage. FEBS Lett 585: 2891-2896. 70. West SC (2003) Molecular views of recombination proteins and their control. Nat Rev Mol Cell Biol 4: 435-445. 71. Burgess RC, Rahman S, Lisby M, Rothstein R, Zhao X (2007) The Slx5-Slx8 complex affects sumoylation of DNA repair proteins and negatively regulates recombination. Mol Cell Biol 27: 6153-6162. 72. Sacher M, Pfander B, Hoege C, Jentsch S (2006) Control of Rad52 recombination activity by double-strand break-induced SUMO modification. Nat Cell Biol 8: 1284-1290. 73. Altmannova V, Eckert-Boulet N, Arneric M, Kolesar P, Chaloupkova R, et al. (2010) Rad52 SUMOylation affects the efficiency of the DNA repair. Nucleic Acids Res 38: 4708-4721. 74. Eladad S, Ye TZ, Hu P, Leversha M, Beresten S, et al. (2005) Intra-nuclear trafficking of the BLM helicase to DNA damage-induced foci is regulated by SUMO modification. Hum Mol Genet 14: 1351-1365. 75. Kawabe T, Tsuyama N, Kitao S, Nishikawa K, Shimamoto A, et al. (2000) Differential regulation of human RecQ family helicases in cell transformation and cell cycle. Oncogene 19: 4764-4772. 76. Branzei D, Sollier J, Liberi G, Zhao X, Maeda D, et al. (2006) Ubc9- and mms21-mediated sumoylation counteracts recombinogenic events at damaged replication forks. Cell 127: 509-522. 77. Haber JE (1995) In vivo biochemistry: physical monitoring of recombination induced by site- specific endonucleases. Bioessays 17: 609-620. 78. Lieber MR, Ma Y, Pannicke U, Schwarz K (2003) Mechanism and regulation of human nonhomologous DNA end-joining. Nat Rev Mol Cell Biol 4: 712-720. 79. Lees-Miller SP, Meek K (2003) Repair of DNA double strand breaks by non-homologous end joining. Biochimie 85: 1161-1173.

80. Roth DB, Porter TN, Wilson JH (1985) Mechanisms of nonhomologous recombination in mammalian cells. Mol Cell Biol 5: 2599-2607. 81. Critchlow SE, Jackson SP (1998) DNA end-joining: from yeast to man. Trends Biochem Sci 23: 394-398. 82. Dynan WS, Yoo S (1998) Interaction of Ku protein and DNA-dependent protein kinase catalytic subunit with nucleic acids. Nucleic Acids Res 26: 1551-1559. 83. Yoo S, Dynan WS (1999) Geometry of a complex formed by double strand break repair proteins at a single DNA end: recruitment of DNA-PKcs induces inward translocation of Ku protein. Nucleic Acids Res 27: 4679-4686. 84. Weterings E, Verkaik NS, Bruggenwirth HT, Hoeijmakers JH, van Gent DC (2003) The role of DNA dependent protein kinase in synapsis of DNA ends. Nucleic Acids Res 31: 7238- 7246. 85. DeFazio LG, Stansel RM, Griffith JD, Chu G (2002) Synapsis of DNA ends by DNA-dependent protein kinase. EMBO J 21: 3192-3200. 86. Lee JW, Yannone SM, Chen DJ, Povirk LF (2003) Requirement for XRCC4 and DNA ligase IV in alignment-based gap filling for nonhomologous DNA end joining in vitro. Cancer Res 63: 22-24. 87. Yurchenko V, Xue Z, Sadofsky MJ (2006) SUMO modification of human XRCC4 regulates its localization and function in DNA double-strand break repair. Mol Cell Biol 26: 1786- 1794. 88. Hang LE, Lopez CR, Liu X, Williams JM, Chung I, et al. (2014) Regulation of Ku-DNA association by Yku70 C-terminal tail and SUMO modification. J Biol Chem 289: 10308- 10317. 89. Henras AK, Soudet J, Gerus M, Lebaron S, Caizergues-Ferrer M, et al. (2008) The post- transcriptional steps of eukaryotic ribosome biogenesis. Cell Mol Life Sci 65: 2334-2359. 90. Kressler D, Hurt E, Bassler J (2010) Driving ribosome assembly. Biochim Biophys Acta 1803: 673-683. 91. Panse VG, Kressler D, Pauli A, Petfalski E, Gnadig M, et al. (2006) Formation and nuclear export of preribosomes are functionally linked to the small-ubiquitin-related modifier pathway. Traffic 7: 1311-1321. 92. Raman N, Nayak A, Muller S (2013) The SUMO system: a master organizer of nuclear protein assemblies. Chromosoma 122: 475-485. 93. Haindl M, Harasim T, Eick D, Muller S (2008) The nucleolar SUMO-specific protease SENP3 reverses SUMO modification of nucleophosmin and is required for rRNA processing. EMBO Rep 9: 273-279. 94. Finkbeiner E, Haindl M, Muller S (2011) The SUMO system controls nucleolar partitioning of a novel mammalian ribosome biogenesis complex. EMBO J 30: 1067-1078. 95. Gill G (2005) Something about SUMO inhibits transcription. Curr Opin Genet Dev 15: 536- 541. 96. Verger A, Perdomo J, Crossley M (2003) Modification with SUMO. A role in transcriptional regulation. EMBO Rep 4: 137-142. 97. Shiio Y, Eisenman RN (2003) Histone sumoylation is associated with transcriptional repression. Proc Natl Acad Sci U S A 100: 13225-13230. 98. Satpathy S, Guerillon C, Kim TS, Bigot N, Thakur S, et al. (2014) SUMOylation of the ING1b tumor suppressor regulates gene transcription. Carcinogenesis 35: 2214-2223.

99. Schimmel J, Eifler K, Sigurethsson JO, Cuijpers SA, Hendriks IA, et al. (2014) Uncovering SUMOylation dynamics during cell-cycle progression reveals FoxM1 as a key mitotic SUMO target protein. Mol Cell 53: 1053-1066. 100. Nathan D, Ingvarsdottir K, Sterner DE, Bylebyl GR, Dokmanovic M, et al. (2006) Histone sumoylation is a negative regulator in Saccharomyces cerevisiae and shows dynamic interplay with positive-acting histone modifications. Genes Dev 20: 966-976. 101. Gostissa M, Hengstermann A, Fogal V, Sandy P, Schwarz SE, et al. (1999) Activation of p53 by conjugation to the ubiquitin-like protein SUMO-1. EMBO J 18: 6462-6471. 102. Lyst MJ, Stancheva I (2007) A role for SUMO modification in transcriptional repression and activation. Biochem Soc Trans 35: 1389-1392. 103. Bencsath KP, Podgorski MS, Pagala VR, Slaughter CA, Schulman BA (2002) Identification of a multifunctional binding site on Ubc9p required for Smt3p conjugation. J Biol Chem 277: 47938-47945. 104. Yang M, Hsu CT, Ting CY, Liu LF, Hwang J (2006) Assembly of a polymeric chain of SUMO1 on human topoisomerase I in vitro. J Biol Chem 281: 8264-8274. 105. Knipscheer P, Flotho A, Klug H, Olsen JV, van Dijk WJ, et al. (2008) Ubc9 sumoylation regulates SUMO target discrimination. Mol Cell 31: 371-382. 106. Wohlschlegel JA, Johnson ES, Reed SI, Yates JR, 3rd (2004) Global analysis of protein sumoylation in Saccharomyces cerevisiae. J Biol Chem 279: 45662-45668. 107. Zhou W, Ryan JJ, Zhou H (2004) Global analyses of sumoylated proteins in Saccharomyces cerevisiae. Induction of protein sumoylation by cellular stresses. J Biol Chem 279: 32262- 32268. 108. Ho CW, Chen HT, Hwang J (2011) UBC9 autosumoylation negatively regulates sumoylation of septins in Saccharomyces cerevisiae. J Biol Chem 286: 21826-21834. 109. Klug H, Xaver M, Chaugule VK, Koidl S, Mittler G, et al. (2013) Ubc9 sumoylation controls SUMO chain formation and meiotic synapsis in Saccharomyces cerevisiae. Mol Cell 50: 625-636. 110. Duda DM, van Waardenburg RC, Borg LA, McGarity S, Nourse A, et al. (2007) Structure of a SUMO-binding-motif mimic bound to Smt3p-Ubc9p: conservation of a non-covalent ubiquitin-like protein-E2 complex as a platform for selective interactions within a SUMO pathway. J Mol Biol 369: 619-630. 111. Knipscheer P, van Dijk WJ, Olsen JV, Mann M, Sixma TK (2007) Noncovalent interaction between Ubc9 and SUMO promotes SUMO chain formation. EMBO J 26: 2797-2807. 112. Doerder FP, Debault LE (1975) Cytofluorimetric analysis of nuclear DNA during meiosis, fertilization and macronuclear development in the ciliate Tetrahymena pyriformis, syngen 1. J Cell Sci 17: 471-493. 113. Woodard J, Kaneshiro E, Gorovsky MA (1972) Cytochemical studies on the problem of macronuclear subnuclei in tetrahymena. Genetics 70: 251-260. 114. Orias E, Flacks M (1975) Macronuclear genetics of Tetrahymena. I. Random distribution of macronuclear genecopies in T. pyriformis, syngen 1. Genetics 79: 187-206. 115. Hai B, Gaertig J, Gorovsky MA (2000) Knockout heterokaryons enable facile mutagenic analysis of essential genes in Tetrahymena. Methods Cell Biol 62: 513-531. 116. Karrer KM (2012) Nuclear dualism. Methods Cell Biol 109: 29-52. 117. Yao MC, Gorovsky MA (1974) Comparison of the sequences of macro- and micronuclear DNA of Tetrahymena pyriformis. Chromosoma 48: 1-18.

118. Feng X, Guang S (2013) Non-coding RNAs mediate the rearrangements of genomic DNA in ciliates. Sci China Life Sci 56: 937-943. 119. Mochizuki K (2012) Developmentally programmed, RNA-directed genome rearrangement in Tetrahymena. Dev Growth Differ 54: 108-119. 120. Mochizuki K, Fine NA, Fujisawa T, Gorovsky MA (2002) Analysis of a piwi-related gene implicates small RNAs in genome rearrangement in tetrahymena. Cell 110: 689-699. 121. Hoeller D, Hecker CM, Wagner S, Rogov V, Dotsch V, et al. (2007) E3-independent monoubiquitination of ubiquitin-binding proteins. Mol Cell 26: 891-898. 122. Jiang W, Koltin Y (1996) Two-hybrid interaction of a human UBC9 homolog with centromere proteins of Saccharomyces cerevisiae. Mol Gen Genet 251: 153-160. 123. Ohuchi T, Seki M, Branzei D, Maeda D, Ui A, et al. (2008) Rad52 sumoylation and its involvement in the efficient induction of homologous recombination. DNA Repair (Amst) 7: 879-889. 124. Saitoh H, Pizzi MD, Wang J (2002) Perturbation of SUMOlation enzyme Ubc9 by distinct domain within nucleoporin RanBP2/Nup358. J Biol Chem 277: 4755-4763. 125. Jahn CL, Klobutcher LA (2002) Genome remodeling in ciliated protozoa. Annu Rev Microbiol 56: 489-520. 126. Matsuda A, Forney JD (2006) The SUMO pathway is developmentally regulated and required for programmed DNA elimination in Paramecium tetraurelia. Eukaryot Cell 5: 806-815. 127. Orias E, Hamilton EP, Orias JD (2000) Tetrahymena as a laboratory organism: useful strains, cell culture, and cell line maintenance. Methods Cell Biol 62: 189-211. 128. Allen SL (1967) Cytogenetics of genomic exclusion in Tetrahymena. Genetics 55: 797-822. 129. Dave D, Wloga D, Gaertig J (2009) Manipulating ciliary protein-encoding genes in Tetrahymena thermophila. Methods Cell Biol 93: 1-20. 130. Satir BH, Reichman M, Orias E (1986) Conjugation rescue of an exocytosis-competent membrane microdomain in Tetrahymena thermophila mutants. Proc Natl Acad Sci U S A 83: 8221-8225. 131. Shang Y, Song X, Bowen J, Corstanje R, Gao Y, et al. (2002) A robust inducible-repressible promoter greatly facilitates gene knockouts, conditional expression, and overexpression of homologous and heterologous genes in Tetrahymena thermophila. Proc Natl Acad Sci U S A 99: 3734-3739. 132. Stemm-Wolf AJ, Meehl JB, Winey M (2013) Sfr13, a member of a large family of asymmetrically localized Sfi1-repeat proteins, is important for basal body separation and stability in Tetrahymena thermophila. J Cell Sci 126: 1659-1671. 133. Cassidy-Hanley D, Bowen J, Lee JH, Cole E, VerPlank LA, et al. (1997) Germline and somatic transformation of mating Tetrahymena thermophila by particle bombardment. Genetics 146: 135-147. 134. Gaertig J, Gu L, Hai B, Gorovsky MA (1994) High frequency vector-mediated transformation and gene replacement in Tetrahymena. Nucleic Acids Res 22: 5391-5398. 135. Bernier-Villamor V, Sampson DA, Matunis MJ, Lima CD (2002) Structural basis for E2- mediated SUMO conjugation revealed by a complex between ubiquitin-conjugating enzyme Ubc9 and RanGAP1. Cell 108: 345-356. 136. Jones D, Crowe E, Stevens TA, Candido EP (2002) Functional and phylogenetic analysis of the ubiquitylation system in Caenorhabditis elegans: ubiquitin-conjugating enzymes,

ubiquitin-activating enzymes, and ubiquitin-like proteins. Genome Biol 3: RESEARCH0002. 137. Ares M, Jr., Bruns PJ (1978) Isolation and genetic characterization of a mutation affecting ribosomal resistance to cycloheximide in Tetrahymena. Genetics 90: 463-474. 138. Chung TL, Hsiao HH, Yeh YY, Shia HL, Chen YL, et al. (2004) In vitro modification of human centromere protein CENP-C fragments by small ubiquitin-like modifier (SUMO) protein: definitive identification of the modification sites by tandem mass spectrometry analysis of the isopeptides. J Biol Chem 279: 39653-39662. 139. Potts PR, Porteus MH, Yu H (2006) Human SMC5/6 complex promotes sister chromatid homologous recombination by recruiting the SMC1/3 cohesin complex to double-strand breaks. EMBO J 25: 3377-3388. 140. De Piccoli G, Cortes-Ledesma F, Ira G, Torres-Rosell J, Uhle S, et al. (2006) Smc5-Smc6 mediate DNA double-strand-break repair by promoting sister-chromatid recombination. Nat Cell Biol 8: 1032-1034. 141. Xiong R, Wang A (2013) SCE1, the SUMO-conjugating enzyme in plants that interacts with NIb, the RNA-dependent RNA polymerase of Turnip mosaic virus, is required for viral infection. J Virol 87: 4704-4715. 142. Spektor TM, Congdon LM, Veerappan CS, Rice JC (2011) The UBC9 E2 SUMO conjugating enzyme binds the PR-Set7 histone methyltransferase to facilitate target gene repression. PLoS One 6: e22785. 143. Marongiu M, Deiana M, Meloni A, Marcia L, Puddu A, et al. (2010) The forkhead transcription factor Foxl2 is sumoylated in both human and mouse: sumoylation affects its stability, localization, and activity. PLoS One 5: e9477. 144. Kim EJ, Park JS, Um SJ (2008) Ubc9-mediated sumoylation leads to transcriptional repression of IRF-1. Biochem Biophys Res Commun 377: 952-956. 145. Prudden J, Perry JJ, Nie M, Vashisht AA, Arvai AS, et al. (2011) DNA repair and global sumoylation are regulated by distinct Ubc9 noncovalent complexes. Mol Cell Biol 31: 2299-2310. 146. Srikumar T, Lewicki MC, Raught B (2013) A global S. cerevisiae small ubiquitin-related modifier (SUMO) system interactome. Mol Syst Biol 9: 668. 147. Nie M, Xie Y, Loo JA, Courey AJ (2009) Genetic and proteomic evidence for roles of Drosophila SUMO in cell cycle control, Ras signaling, and early pattern formation. PLoS One 4: e5905. 148. Xu J, Tian H, Liu X, Wang W, Liang A (2013) Localization and functional analysis of HmgB3p, a novel protein containing high-mobility-group-box domain from Tetrahymena thermophila. Gene 526: 87-95. 149. Bellail AC, Olson JJ, Hao C (2014) SUMO1 modification stabilizes CDK6 protein and drives the cell cycle and glioblastoma progression. Nat Commun 5: 4234. 150. Myatt SS, Kongsema M, Man CW, Kelly DJ, Gomes AR, et al. (2014) SUMOylation inhibits FOXM1 activity and delays mitotic transition. Oncogene 33: 4316-4329. 151. Voelkel-Meiman K, Taylor LF, Mukherjee P, Humphryes N, Tsubouchi H, et al. (2013) SUMO localizes to the central element of synaptonemal complex and is required for the full synapsis of meiotic chromosomes in budding yeast. PLoS Genet 9: e1003837. 152. Wan J, Subramonian D, Zhang XD (2012) SUMOylation in control of accurate chromosome segregation during mitosis. Curr Protein Pept Sci 13: 467-481.

153. Johnson ES, Blobel G (1999) Cell cycle-regulated attachment of the ubiquitin-related protein SUMO to the yeast septins. J Cell Biol 147: 981-994. 154. Hagan IM, Grallert A (2013) Spatial control of mitotic commitment in fission yeast. Biochem Soc Trans 41: 1766-1771. 155. Su YF, Yang T, Huang H, Liu LF, Hwang J (2012) Phosphorylation of Ubc9 by Cdk1 enhances SUMOylation activity. PLoS One 7: e34250. 156. Mao Y, Sun M, Desai SD, Liu LF (2000) SUMO-1 conjugation to topoisomerase I: A possible repair response to topoisomerase-mediated DNA damage. Proc Natl Acad Sci U S A 97: 4046-4051. 157. Cui B, Gorovsky MA (2006) Centromeric histone H3 is essential for vegetative cell division and for DNA elimination during conjugation in Tetrahymena thermophila. Mol Cell Biol 26: 4499-4510. 158. Henikoff S, Dalal Y (2005) Centromeric chromatin: what makes it unique? Curr Opin Genet Dev 15: 177-184. 159. Sharp JA, Kaufman PD (2003) Chromatin proteins are determinants of centromere function. Curr Top Microbiol Immunol 274: 23-52. 160. Mellone BG, Allshire RC (2003) Stretching it: putting the CEN(P-A) in centromere. Curr Opin Genet Dev 13: 191-198. 161. Wieland G, Orthaus S, Ohndorf S, Diekmann S, Hemmerich P (2004) Functional complementation of human centromere protein A (CENP-A) by Cse4p from Saccharomyces cerevisiae. Mol Cell Biol 24: 6620-6630. 162. Howard-Till RA, Lukaszewicz A, Novatchkova M, Loidl J (2013) A single cohesin complex performs mitotic and meiotic functions in the protist tetrahymena. PLoS Genet 9: e1003418. 163. Nixon CE, Wilcox AJ, Laney JD (2010) Degradation of the Saccharomyces cerevisiae mating- type regulator alpha1: genetic dissection of cis-determinants and trans-acting pathways. Genetics 185: 497-511. 164. Saracco SA, Miller MJ, Kurepa J, Vierstra RD (2007) Genetic analysis of SUMOylation in Arabidopsis: conjugation of SUMO1 and SUMO2 to nuclear proteins is essential. Plant Physiol 145: 119-134. 165. Golebiowski F, Matic I, Tatham MH, Cole C, Yin Y, et al. (2009) System-wide changes to SUMO modifications in response to heat shock. Sci Signal 2: ra24. 166. Comerford KM, Leonard MO, Karhausen J, Carey R, Colgan SP, et al. (2003) Small ubiquitin- related modifier-1 modification mediates resolution of CREB-dependent responses to hypoxia. Proc Natl Acad Sci U S A 100: 986-991. 167. Lee YJ, Miyake S, Wakita H, McMullen DC, Azuma Y, et al. (2007) Protein SUMOylation is massively increased in hibernation torpor and is critical for the cytoprotection provided by ischemic preconditioning and hypothermia in SHSY5Y cells. J Cereb Blood Flow Metab 27: 950-962. 168. Cimarosti H, Lindberg C, Bomholt SF, Ronn LC, Henley JM (2008) Increased protein SUMOylation following focal cerebral ischemia. Neuropharmacology 54: 280-289. 169. Shao R, Zhang FP, Tian F, Anders Friberg P, Wang X, et al. (2004) Increase of SUMO-1 expression in response to hypoxia: direct interaction with HIF-1alpha in adult mouse brain and heart in vivo. FEBS Lett 569: 293-300. 170. Semenza GL (2007) Hypoxia-inducible factor 1 (HIF-1) pathway. Sci STKE 2007: cm8.

171. Martin S, Wilkinson KA, Nishimune A, Henley JM (2007) Emerging extranuclear roles of protein SUMOylation in neuronal function and dysfunction. Nat Rev Neurosci 8: 948- 959. 172. Tschochner H, Hurt E (2003) Pre-ribosomes on the road from the nucleolus to the cytoplasm. Trends Cell Biol 13: 255-263. 173. Yun C, Wang Y, Mukhopadhyay D, Backlund P, Kolli N, et al. (2008) Nucleolar protein B23/nucleophosmin regulates the vertebrate SUMO pathway through SENP3 and SENP5 proteases. J Cell Biol 183: 589-595. 174. Kurepa J, Walker JM, Smalle J, Gosink MM, Davis SJ, et al. (2003) The small ubiquitin-like modifier (SUMO) protein modification system in Arabidopsis. Accumulation of SUMO1 and -2 conjugates is increased by stress. J Biol Chem 278: 6862-6872. 175. Ulrich HD, Davies AA (2009) In vivo detection and characterization of sumoylation targets in Saccharomyces cerevisiae. Methods Mol Biol 497: 81-103. 176. Takahashi Y, Iwase M, Konishi M, Tanaka M, Toh-e A, et al. (1999) Smt3, a SUMO-1 homolog, is conjugated to Cdc3, a component of septin rings at the mother-bud neck in budding yeast. Biochem Biophys Res Commun 259: 582-587. 177. Sweet MT, Allis CD (2010) Purification of Tetrahymena nuclei by sedimentation at unit gravity. Cold Spring Harb Protoc 2010: pdb prot4501. 178. Sweet MT, Allis CD (2006) Isolation and purification of tetrahymena nuclei. CSH Protoc 2006.

VITA

Qianyi Yang Address: Department of Biochemistry 175 S. University St. Purdue University West Lafayette, IN 47907 Telephone: 765-494-1287 (Lab) 765-586-3383 (Cell) Email: [email protected]

EDUCATION

2009- Now PhD Candidate, Purdue University, West Lafayette, IN Biochemistry Advisor: Dr. James Forney Committee members: Dr. Scott Briggs Dr. Mark Hall Dr. Cliff Weil Thesis title: Effects of altered expression of the SUMO conjugating enzyme, Ubc9 on mitosis, meiosis and conjugation in Tetrahymena thermophila

2005- 2009 B.S., Northwest A&F University, China Biotechnology

HONORS

2008 National Scholarship Ministry of Education, China

2014 Best poster award 7th International Conference SUMO, Ubiquitin, UBL Proteins: Implications for Human Diseases Shanghai, China PRESENTATIONS

2010 Dept. of Biochemistry, Purdue University, West Lafayette, IN

2011 Dept. of Biochemistry, Purdue University, West Lafayette, IN

2012 Dept. of Biochemistry, Purdue University, West Lafayette, IN

2012 Midwest Protozoology Society Annual Meeting, Peoria, IL Title: The Role of SUMO-conjugating enzyme UBC9 in Tetrahymena

2012 Dept. of Biochemistry Annual Retreat, Turkey Run, IN

2013 Dept. of Biochemistry, Purdue University, West Lafayette, IN

POSTERS

2010 Midwest Protozoology Society Annual Meeting, Peoria, IL

2010 Dept. of Biochemistry Annual Retreat, Turkey Run, IN

2011 Midwest Protozoology Society Annual Meeting, Peoria, IL

2011 Dept. of Biochemistry Annual Retreat, Turkey Run, IN

2012 Dept. of Biochemistry Annual Retreat, Turkey Run, IN

2013 Midwest Protozoology Society Annual Meeting, Peoria, IL

2013 Dept. of Biochemistry Annual Retreat, Turkey Run, IN

2014 Dept. of Biochemistry Annual Retreat, Lafayette, IN

2014 7th International Conference SUMO, Ubiquitin, UBL Proteins: Implications for Human Diseases, Shanghai, China Title: Depletion of UBC9 causes defects in somatic and germline nuclei in Tetrahymena thermophila

TEACHING EXPERIENCE

2010-2011 BCHM561 General Biochemistry I (Job description: grading)

2011-2012 BCHM561 General Biochemistry I (Job description: grading)

BCHM307 Biochemistry (Job description: grading)

BIOL221L Microbiology lab (Job description: preparing and lecturing the lab session of Microbiology)

2012-2013 BIOL221L Microbiology lab (Job description: preparing and lecturing the lab session of Microbiology)

2013-2014 BCHM309 Biochemistry lab (Job description: preparing and lecturing biochemistry labs)

BCHM307 Biochemistry (Job description: recitation and grading)

2014-2015 BCHM561 General Biochemistry I (Job description: recitation)

BCHM307 Biochemistry (Job description: grading)

PUBLICATIONS Yang, Q., Coyne, R. and Forney, J.D. Depletion of Ubc9 causes defects in somatic and germline nuclei in Tetrahymena thermophila. (To be submitted to Journal PLoS One)

Nasir, A.M., Yang, Q., Chalker, D. L. and Forney, J.D., SUMOylation is developmentally regulated and required for cell pairing during conjugation in Tetrahymena. (Manual script in press) Yang, Q., Nasir, A.M., Powers, B., Hall, M.C. and Forney, J.D. A global Tetrahymena thermophila SUMO conjugating enzyme Ubc9 system interactome. (In preparation)