Published January 14, 2011, doi:10.4049/jimmunol.1001338 The Journal of Immunology

An Essential Role of STIM1, Orai1, and S100A8–A9 Proteins for Ca2+ Signaling and FcgR-Mediated Phagosomal Oxidative Activity

Natacha Steinckwich,1 Ve´ronique Schenten, Chantal Melchior, Sabrina Bre´chard, and Eric J. Tschirhart

Phagocytosis is a process of innate immunity that allows for the enclosure of pathogens within the phagosome and their subsequent destruction through the production of reactive oxygen species (ROS). Although these processes have been associated with increases of intracellular Ca2+ concentrations, the mechanisms by which Ca2+ could regulate the different phases of phagocytosis remain unknown. The aim of this study was to investigate the Ca2+ signaling pathways involved in the regulation of FcgRs- induced phagocytosis. Our work focuses on IgG-opsonized zymosan internalization and phagosomal ROS production in DMSO- differentiated HL-60 cells and neutrophils. We found that chelation of intracellular Ca2+ by BAPTA or emptying of the in- tracellular Ca2+ store by thapsigargin reduced the efficiency of zymosan internalization. Using an small interfering RNA strategy, our data establish that the observed Ca2+ release occurs through two isoforms of inositol 1,4,5-triphosphate receptors, ITPR1 and ITPR3. In addition, we provide evidence that phagosomal ROS production is dependent on extracellular Ca2+ entry. We dem- onstrate that the observed Ca2+ influx is supported by ORAI calcium release-activated calcium modulator 1 (Orai1) and stromal interaction molecule 1 (STIM1). This result suggests that extracellular Ca2+ entry, which is required for ROS production, is mediated by a store-operated Ca2+ mechanism. Finally, our data identify the complex formed by S100A8 and S100A9 (S100 calcium-binding protein A8 and A9 complex), two Ca2+-binding proteins, as the site of interplay between extracellular Ca2+ entry and intraphagosomal ROS production. Thus, we demonstrate that FcgR-mediated phagocytosis requires intracellular Ca2+ store depletion for the internalization phase. Then phagosomal ROS production requires extracellular Ca2+ entry mediated by Orai1/ STIM1 and relayed by S100A8–A9 as Ca2+ sensor. The Journal of Immunology, 2011, 186: 000–000.

hagocytosis is one of the most important innate immune of specific receptors for opsonized particles. Activation of these responses that infected systems use to eliminate invading receptors triggers engulfment of the pathogen and secretion of P pathogenic agents. Phagocytosis is accompanied by the proinflammatory mediators involved in the development of the activation of antimicrobial enzymes, which contribute to the re- adaptive immune response (2). FcgRs constitute an important fam- spiratory burst and allow for the production of reactive oxygen ily of receptors implicated in the recognition of IgG-coated com- species (ROS), which lead to the destruction of ingested micro- plexes. Human neutrophils possess three structurally distinct re- organisms (1). Professional phagocytes, such as polymorphonuclear ceptors for the Fc region of IgGL FcgRI (CD64), FcgRII (CD32), granulocytes, dendritic cells, and macrophages, possess an array and FcgRIII (CD16) (3). Binding of IgG to FcgRs leads to tyrosine phosphorylation of ITAM motifs, within CD32 cytoplasmic tails Life Sciences Research Unit, University of Luxembourg, L-1511 Luxembourg, Lux- or g-chain subunits associated with CD16 and CD64, and subse- embourg quent production of diacylglycerol and inositol 1,4,5-triphosphate 1Current address: Laboratory of Signal Transduction, National Institute of Environ- mental Health Sciences, Department of Health and Human Services, National Insti- (IP3) via phospholipase Cg (PLCg) activation (4, 5). 2+ tutes of Health, Research Triangle Park, NC. IP3, through the activation of its receptor, the Ca channel Received for publication April 23, 2010. Accepted for publication December 10, (inositol 1,4,5-triphosphate receptors [ITPRs]), is a second mes- 2010. 2+ senger. IP3 is known to initiate Ca release from internal stores, This work was supported by a research grant from the University of Luxembourg and which triggers extracellular Ca2+ entry through store-operated a postdoctoral grant from the Fonds National de la Recherche (Luxembourg) (Grant 2+ TR-PDR BFR07-091 to N.S.). Ca channel (SOC) activation. This phenomenon is referred to 2+ Address correspondence and reprint requests to Dr. Eric J. Tschirhart, University of as store-operated Ca entry (SOCE) (6, 7). Alternatively, extracel- 2+ Luxembourg, 162A, Avenue de la Faı¨encerie, L-1511 Luxembourg, Luxembourg. lular Ca entry can also occur through a pathway completely inde- E-mail address: [email protected] 2+ pendent of the initial IP3-mediated Ca store depletion, by a The online version of this article contains supplemental material. non-SOCE mechanism (8). 2+ 2+ Abbreviations used in this article: [Ca ]i, intracellular Ca concentration; DCFH2, Edberg et al. (9) and Kobayashi et al. (10) demonstrated that dichlorodihydrofluorescein; dHL-60, DMSO-differentiated HL-60; DPI, dibenziodo- 2+ lium chloride; lem, emission wavelength; lex, excitation wavelength; F, fluores- phagocytosis is Ca dependent. In addition, several other studies 2+ cence; IP3, inositol 1,4,5-triphosphate; ITPR, inositol 1,4,5-triphosphate receptor; have suggested that an increase of intracellular Ca concentration NOX2, NADPH oxidase 2; Orai1, ORAI calcium release-activated calcium modula- 2+ ([Ca ]i) is required for phagosome maturation or phagosomal tor 1; PLCg, phospholipase Cg; ROS, reactive oxygen species; S100A8–A9, S100 2+ calcium-binding protein A8 and A9 complex; siRNA, small interfering RNA; SOC, ROS production (9, 11, 12). The source of the Ca has not yet store-operated Ca2+ channel; SOCE, store-operated Ca2+ entry; STIM1, stromal in- been formally established. However, in a previous study, SOCE teraction molecule 1; TG, thapsigargin. did not appear to be involved in these phagocytosis mechanisms Copyright Ó 2011 by The American Association of Immunologists, Inc. 0022-1767/11/$16.00 (13). But that study was essentially based on the use of BTP2,

www.jimmunol.org/cgi/doi/10.4049/jimmunol.1001338 2 Orai1, STIM1, Ca2+, OXIDATIVE ACTIVITY, AND PHAGOCYTOSIS a potential pharmacological inhibitor of SOCE. Thus, further in- siRNA specificity for each ITPR or Orai isoforms was tested at the vestigations are required to establish or disprove this conclusion. mRNA expression level. We did not observe any significant suppression of 2+ mRNA for nontargeted Orai and ITPR isoforms (data not shown). The aim of our work was to determine the source of the [Ca ]i variations and the molecular players involved in the Ca2+ de- Real-time PCR pendence of FcgR-mediated internalization and phagosomal oxi- Total RNA was extracted from the siRNA-transfected dHL-60 cells, and dative activity in granulocytes. Because neutrophils are terminally cDNA was prepared using the Thermoscript RT-PCR system (Invitrogen, differentiated and therefore refractory to genetic manipulation, Merelbeke, Belgium). PCR primers were designed from published se- we used DMSO-differentiated HL-60 (dHL-60) cells, which have quences found in GenBank (Table II). PCR products were cloned and granulocyte-like phenotypes, to investigate the molecular mech- sequenced to control their specificity. Real-time PCR was performed on anisms relating Ca2+ and phagocytosis. Supplementary experi- the iQ5 Real-Time PCR Detection System using the iQSYBR Green Supermix following the manufacturer’s protocol (Bio-Rad, Nazareth Eke, ments, based on a pharmacological approach, were performed in Belgium). The annealing temperature was set at 60˚C, and the reaction was human primary neutrophils to verify our results and conclusions. carried out in a 25 ml volume containing a minimum of 10 ng cDNA. 2 We demonstrate that intracellular Ca2+ store depletion, through Relative mRNA expression was quantified using the 2 DDCt method, as the isoforms 1 and 3 of ITPR, is sufficient to induce IgG- previously described (17). opsonized zymosan phagocytosis. In contrast, we show that Western blotting phagosomal ROS production is dependent on SOCE-induced ex- 3 6 3 tracellular Ca2+ entry. We further identify ORAI calcium release- The dHL-60 cells (2 10 ) were then lysed in a 1 Laemmli buffer (30 mM Tris, pH 6.8, 5% v/v glycerol, 1% w/v SDS, 0.01% w/v bromophenol activated calcium modulator 1 (Orai1) and stromal interaction blue, 2% v/v 2-ME). After resolving on 12.5% SDS-PAGE gels or 3–8% molecule 1 (STIM1) as active players in this mechanism. Finally, Tris Acetate Criterion XT precast gels (Bio-Rad), proteins were trans- we delineate the complex formed by S100 calcium-binding pro- ferred onto HybondTM-ECL (Amersham, GE Healthcare, Belgium) or tein A8 and A9 complex (S100A8 and S100A9), two Ca2+-binding Immobilon-FL (Millipore, Brussel, Belgium) membranes, which were 2+ 2+ saturated with a blocking buffer containing 5% w/v BSA. Immunode- proteins, as a Ca sensor linking Ca influx to phagosomal ROS tection was realized by using appropriate primary and HRP-conjugated production. secondary Abs. Labeled bands were quantified by densitometric scan- ning using the Gel-Pro Analyzer (INTAS, Go¨ttingen, Germany). The in- tegrated intensity of the target protein bands was normalized to the Materials and Methods reference protein (b-actin). The Abs used included: rabbit polyclonal anti- Cell culture STIM1 (Alomone Laboratories, Jerusalem, Israel), rabbit polyclonal anti- Orai1 (Alomone Laboratories), rabbit polyclonal anti-Orai2 (Abcam, HL-60 cells (American Type Culture Collection, Manassas, VA) were Cambridge, U.K.), rabbit polyclonal anti-Orai3 (Abcam), rabbit polyclonal cultured at 37˚C with 5% CO2 in an RPMI 1640 medium supplemented anti-ITPR1 (Affinity BioReagents, Dublin, Ireland), mouse monoclonal with a 10% heat-inactivated FBS, 2 mM L-glutamine, and 100 U/ml anti-ITPR2 (American Research Products, Belmont, CA), mouse mono- penicillin-streptomycin (Lonza, Verviers, Belgium). To differentiate HL- clonal anti-ITPR3 (BD Biosciences, Erembodegem, Belgium), and mouse 60 cells into the neutrophil lineage (dHL-60), we grew cells in the presence anti–b-actin (Millipore). HRP-conjugated secondary Abs directed against of 1.3% v/v DMSO for 5 d (14). rabbit or mouse Igs were obtained from Dako (Heverlee, Belgium). Preparation of IgG-opsonized zymosan bioparticles Purification of human neutrophils FITC-labeled (excitation wavelength [lex]: 494 nm; emission wavelength Human polynuclear neutrophils were isolated from normal healthy donors [lem]: 518 nm), Texas Red-labeled (lex: 595 nm; lem: 615 nm), or by discontinuous plasma Percoll centrifugation (15, 16) in accordance with dichlorodihydrofluorescein (DCFH )-labeled (lex: 490 nm; lem: 520 nm) a Research Center Institutional Review Board-approved protocol. 2 zymosan (Saccharomyces cerevisiae) was opsonized by rabbit polyclonal IgG Abs against zymosan (50% diluted) for 1 h at 37˚C (Dr. M. Erard, Chemicals Universite´ Paris-Sud/Centre National de la Recherche Scientifique Unite´ The chemicals thapsigargin (TG), EGTA, ionomycin, lanthanum(III) chlo- Mixte de Recherche 8000, Orsay, France). Particles were washed three times with an ice-cold PBS buffer to remove the unfixed IgG. ride (LaCl3), SK&F-96365, dibenziodolium chloride (DPI), and DMSO were obtained from Sigma-Aldrich (Bornem, Belgium). Additional prod- Flow cytometry monitoring of zymosan phagocytosis ucts including U73122, fluo-4-acetoxymethylester, and BAPTA-AM were obtained from Invitrogen (Merelbeke, Belgium). We obtained trypan blue The dHL-60 cells were then resuspended in the ES buffer or in an RPMI stain 0.4% w/v from Lonza. All other chemicals were of analytical grade 1640 medium without phenol red (Lonza) and supplemented with 10% heat- 6 and were obtained from Merck (Darmstadt, Germany). inactivated FBS and 2 mM L-glutamine. The dHL-60 cells (1.3 3 10 ) We used a physiological salt solution (ES buffer) with the following were coincubated with zymosan in 24 well- culture plates at 37˚C with 5% composition: 140 mM NaCl, 5 mM KCl, 1 mM MgCl2, 2 mM CaCl2,10 CO2 (10 particles/cell). After 30 min of incubation, phagocytosis was mM HEPES, 9 mM glucose, pH 7.4. halted by adding an ice-cold PBS buffer. The addition of trypan blue (0.1% w/v), which quenched the fluorescence (F) of extracellular FITC-labeled mRNA silencing zymosan, allowed for the discrimination of cells with internalized bio- particles from cells bound to extracellular bioparticles. The percentage of Specific sequences (19 nucleotides) of human S100A8, S100A9, ITPR1, cells with internalized FITC-zymosan was evaluated by flow cytometry ITPR2, ITPR3, Orai1, Orai2, Orai3, and STIM1 cDNAwere selected for the after gating out with dHL-60 cells incubated without bioparticles (FACS synthesis of double-stranded small interfering RNAs (siRNAs). The pre- Canto II; BD Biosciences). annealed siRNAs for S100A8, S100A9, STIM1, ITPR, or Orai isoforms and a nonsilencing control sequence were custom-ordered from Eurogentec Confocal microscopy monitoring of intracellular Ca2+ (Seraing, Belgium). All siRNA target sequences chosen in this study were variations during zymosan phagocytosis screened by National Center for Biotechnology Information BLAST searches to avoid mismatches. We transiently transfected the HL-60 cells The dHL-60 cells (2 3 106) were then centrifuged for 5 min at 500 g to (2 3 106) with 1–3 mg specific siRNA or a nonsilencing sequence at day 3 adhere to a round glass coverslip. The cells were incubated in 500 ml of the differentiation using a Nucleofector apparatus (Amaxa Biosystems, loading buffer (ES buffer with 4 mM fluo-4-acetoxymethylester, 250 mM Cologne, Germany), using the Nucleofector V kit and the T-019 program sulfinpyrazone, 0.02% Pluronic acid, and 0.1% w/v BSA) for 1 h at room according to the manufacturer’s instructions. Forty-eight hours post-trans- temperature. The cells were then washed and 500 ml ES buffer with 250 fection, the cells were processed for further experimentation. In these mM sulfinpyrazone was added. Cells were maintained in this buffer until conditions, at least 80% of the cells were able to integrate Cy3-conju- their use. Immediately before the measurement, cells were washed in ES gated siRNA oligonucleotides (data not shown). The silencing efficiency buffer with or without Ca2+, and opsonized zymosan was added. F of fluo-4 was optimized to obtain an mRNA knockdown of at least 70%. Se- (lex: 494 nm; lem: 516 nm) and Texas Red-labeled zymosan was mon- quences for selected siRNA oligonucleotides are listed in Table I. itored by confocal microscopy (LSM 510 META; Zeiss, Zaventem, Bel- The Journal of Immunology 3

Table I. Oligonucleotide sequences of the forward strand of RNA duplexes for siRNA assays

Gene GenBank Accession No. Forward Oligonucleotide Sequences (59–39) Corresponding Nucleotides Orai1 NM_032790 GCAACGUGCACAAUCUCAA 455–473 Orai2 NM_032831 CCUGCAUCCUGCCCAAUGU 444–462 Orai3 NM_152288 Mix of CUGCCCUGGGCACCUUUCU and 657–675 and 573–591 GCAACAUCCACAACCUCAA STIM1 NM_003156 GGAGGAUAAUGGCUCUAUU 1965–1983 ITPR1 NM_001099952 CUGCCUCUUUAAGCUAUGU 511–529 ITPR2 NM_002223 Mix of GGAGGUUUGUAACCAAAUU and 1439–1457 and 1265–1283 GGCCUGUUAUGUUAAAGAU ITPR3 NM_002224 GCACCAAGAACGAGAAGAU 5445–5463 S100A8 NM_002964 GUUCCUCAUUCUGGUGAUA 260–278 S100A9 NM_002965 AUCAUGGAGGACCUGGACAC 209–228 Control AAUUCUCCGAACGUGUCAC Nonsilencing gium) at 37˚C using a 633/1.4 water objective lens, with long-pass fil- the differential interference contrast images (Supplemental Video 1). The ters of 505 and 575, nm respectively. Images were obtained every 4 s. average rate of the phagosomal oxidase activity was analyzed in the The calibration of the fluo-4 F was achieved by measuring the signal of linear portion of the F increase between the initial DCFH2 Frise(point the cells incubated with 10 mM ionomycin in the ES buffer (maximal Ca2+ 0 s) and 50 s later. In addition, the average rate values were normalized 2+ signal, Fmax), followed by addition of 30 mM EGTA (minimal Ca signal, to the F intensity measured immediately before the bioparticle inter- 2+ Fmin). The amount of [Ca ]i was then determined using the following nalization. 2+ equation: [Ca ]i = Kd 3 (F 2 Fmin)/(Fmax 2 F), where Kd = 345 nM (18). 2+ 2+ Ca changes (D[Ca ]i) were defined as the average maximal value after Immunofluorescence analysis of S100A8-9 localization during contact was initiated between the cells and the zymosan, less the average phagocytosis basal level before phagocytosis. The dHL-60 cells (2 3 106) were centrifuged for 5 min at 500 g, again to Microscopy monitoring of phagosomal oxidative activity cause them adhere to a round glass coverslip. Afterward, the cells were Labeling of zymosan bioparticles with the oxidant-sensitive probe, incubated in ES buffer with Texas Red-labeled zymosan (five particles/ cell) at 37˚C, with 5% CO2, for 30 min. After fixation (15 min) with 3% w/ DCFH2, was performed as previously described (Invitrogen) (13). The DCFH probe is poorly fluorescent before oxidation by ROS, but v formaldehyde in PBS, the cells were permeabilized in a PBS buffer 2 containing 2.5% v/v Triton X-100 and 0.5% w/v BSA. A blocking step becomes significantly brighter when the zymosan becomes engulfed in used 5% human IgG (Sigma-Aldrich). Immunostaining was achieved with the phagosome. The DCFH2 F then reflects the particle’s oxidation state, which increases with phagosomal ROS production. The labeled bio- the mouse monoclonal anti-human S100A8–A9 Ab (clone MAC 387; particles were also shown to be useful as an indicator for measuring the Dako) and Cy2-conjugated donkey anti-mouse IgG secondary Ab (Jackson oxidase activity directly in the phagosome (19). The dHL-60 cells (2 3 ImmunoResearch Laboratories, Newmarket Suffolk, U.K.). The F of Cy2- 6 conjugated Abs (lex: 492 nm; lem: 510 nm) and Texas Red-labeled zy- 10 ) were centrifuged for 5 min at 500 g to cause them to adhere to 3 a round glass coverslip. They were subsequently incubated in 500 mlES mosan was monitored by confocal microscopy using a 63 /1.4 oil ob- jective with long-pass filters of 505 and 575 nm, respectively (LSM 510 buffer with or without a chemical component. Just before the measure- 2+ META; Zeiss). The percentage of cells with S100A8–A9 relocalization at ment, the cells were washed in ES buffer with or without Ca ,then the plasma membrane or around the phagosome was calculated as the opsonized zymosan was added. F of the DCFH2 probe (lex: 494 nm; lem: 516 nm) was monitored by microscopy (LSM 510 META; Zeiss) at number of cells displaying S100A8–A9 translocation divided by the total 37˚C with a 633/1.4 water objective, with long-pass filters of 505 nm. amount of available cells. A minimum of 100 cells were counted per Images were recorded every second. Experiments performed with human condition. purified neutrophils were carried out with a LSM 710 Zeiss microscope Data analyses and statistics and a 403/1.30 oil differential interference contrast M27 objective. Analysis was performed when a complete phagocytosis process (pseu- Data were subjected to ANOVAs followed by the post hoc test of Newman– dopod extension/closing of invaginated membrane) was observed with Keuls with a threshold ,5%. Data are shown here as the mean 6 SEM.

Table II. Oligonucleotide sequences of primers used for real-time PCR

Forward (F) and Reverse (R) Corresponding Gene Oligonucleotide Sequences (59-39) Nucleotides Orai1 F: ACTGGATCGGCCAGAGTTAC 333 R: CGGCTCAAGTAGAGCTTGC 402 Orai2 F: TGCTGAGCTTAACGTGCCTA 104 R: CGGTAATCCATGCCCTTATG 159 Orai3 F: GCTGGAGAGTGACCACGAGT 443 R: TGGATGTTGCTCACAGCTTC 564 STIM1 F: TGGGATCTCAGAGGGATTTG 2094 R: CATTGGAAGTCATGGCATTG 2211 ITPR1 F: TCTGGCTCTGATCCTCGTTT 7566 R: GGAGAACAGGAACTCGCTTG 7710 ITPR2 F: GCCAAGATGTTGAGTGGGTT 8643 R: ATGCATTGCGAATGTGTGAT 8759 ITPR3 F: CTGGTGTTCTTTGTCAGCGA 1654 R: TTCTGCTCCCTCATCAGCTT 1757 S100A8 F: TCATCGACGTCTACCACAAGT 90 R: CCAACTCTTTGAACCAGACG 230 S100A9 F: ATCATGGAGGACCTGGACAC 209 R: CCATCAGCATGATGAACTCC 275 b-actin F: TGACCCAGATCATGTTTGAGA 397 R: AGTCCATCACGATGCCAGT 504 4 Orai1, STIM1, Ca2+, OXIDATIVE ACTIVITY, AND PHAGOCYTOSIS

Results Ca2+ release from intracellular stores regulates FcgR-mediated zymosan internalization during phagocytosis To investigate which FcgR-mediated Ca2+ signaling pathways lead to the particle internalization phase of phagocytosis, we used flow cytometry analysis for monitoring the efficiency of IgG-opsonized, FITC-labeled zymosan internalization by dHL-60 in two different Ca2+ conditions (Fig. 1A). After incubating the cells for 30 min with BAPTA-AM (10 mM), which results in loading cells with the in- tracellular Ca2+ chelator, BAPTA, the percentage of dHL-60 cells that had internalized at least one particle had decreased by 65%, demonstrating the requirement that intracellular Ca2+ signaling is needed for phagocytosis in FcgR-activated cells (Fig. 1A). FIGURE 2. FcgR-mediated zymosan internalization is dependent on in- Although our data, and that from other studies, support the fact tracellular Ca2+ store depletion in human neutrophils. Human neutrophils 2+ that changes in [Ca ]i occur during the FcgR-mediated phagocy- were incubated for 30 min with IgG-opsonized FITC-conjugated zymosan. 2+ 2+ tosis (data not shown), the source of the Ca underlying this [Ca ]i The percentage of cells internalizing zymosan was quantified by flow increase has not been formally established (12). To resolve this is- cytometry as described inFig. 1. A, Cells were pretreated or not pretreated with 3+ 2+ sue, we examined the contribution of Ca2+ pools both outside and Gd (0.1 mM) in the presence or absence of extracellular Ca (2 mM). B, 2+ 2+ Cells were pretreated or not pretreated with BAPTA-AM (10 mM) or TG (0.2 within the cells (Ca influx through the plasma membrane and Ca 2+ release from intracellular stores) during IgG-opsonized zymosan mM) in the absence of extracellular Ca (2 mM). Asterisks denote signifi- cantly different from the control (0 mM BAPTA-AM, 0 mM TG). Results are expressed as mean 6 SEM from three individual experiments.

internalization by dHL-60. First, we investigated the role of extra- cellular Ca2+ entry in this process by omitting Ca2+ from the medium or by incubating the cells with La3+, a plasma membrane Ca2+ channel blocker (20). Our data revealed that the percentage of dHL- 60 cells internalizing zymosan is similar in the presence (32 6 3%) or absence of extracellular Ca2+ (30 6 9%; Fig. 1B). Moreover, La3+ (30 mM) had no effect (31 6 9%) on the ability of the cells to in- ternalize bioparticles (Fig. 1B). Additional experiments revealed that the internalization efficien- cy increased proportionally with time of incubation with zymosan incubation. For example, given 10 min of incubation, the efficiency was 5 6 3%, whereas with 20 min, the efficiency of internalization increased to 13 6 5% (Supplemental Fig. 1A). This correlation

FIGURE 1. FcgR-mediated zymosan internalization is dependent on in- tracellular Ca2+ store depletion. dHL-60 cells were incubated for 30 min with IgG-opsonized FITC-conjugated zymosan. The percentage of cells in- ternalizing zymosan was quantified by flow cytometry. Trypan blue was added to quench the F of FITC-labeled zymosan and to discriminate cells with internalized bioparticles from cells with bioparticles bound to the cell surface. A, Cells were pretreated or not pretreated with BAPTA-AM (10 mM) in the presence of extracellular Ca2+ (2 mM). Asterisk denotes significantly FIGURE 3. ITPR1 and ITPR3 are involved in FcgR-mediated zymosan different from the control (0 mM BAPTA-AM). B, Cells were pretreated or internalization. dHL-60 cells were incubated for 30 min with IgG-opsonized not pretreated with La3+ (30 mM) in the presence or absence of extracellular FITC-conjugated zymosan. The efficiency of zymosan internalization was Ca2+ (2 mM). Asterisk denotes significantly different from the control (2 mM monitored by flow cytometry, as previously described in Fig. 1A. Cells were extracellular Ca2+,0mMLa3+). Time course of zymosan internalization in pretreated or not pretreated with U73122 (2 mM) in the presence of extra- the presence or absence of extracellular Ca2+ is shown in the inset. C, Cells cellular Ca2+ (2 mM). Asterisk denotes significantly different from the were pretreated or not pretreated with BAPTA-AM (10 mM) or TG (0.1 mM) control (0 mM U73122). B, Cells were transiently transfected with ITPR1, in the absence of extracellular Ca2+ (2 mM). Asterisks denote significantly ITPR2, ITPR3, or nonsilencing siRNAs. The efficiency of zymosan in- different from the control (0 mM BAPTA-AM, 0 mM TG). Time course of ternalization was determined 48 h post-transfection. Results are expressed as zymosan internalization with or without BAPTA-AM(10 mM) in the absence mean 6 SEM from three individual experiments. Asterisks denote signifi- of extracellular Ca2+ is shown in the inset. Results are expressed as mean 6 cantly different from the control (nonsilencing siRNA). Representative SEM from three individual experiments. traces of three independent experiments are shown in the inset. The Journal of Immunology 5 between incubation time and internalization was not modified when treatment of cells with BAPTA-AM (10 mM) or with TG (0.2 mM), the cells were incubated in the absence of extracellular Ca2+ (Sup- in the absence of extracellular Ca2+, resulted in a substantial de- plemental Fig. 1A). These results indicate that extracellular Ca2+ crease of zymosan internalization (57 and 32%, respectively; n =3; entry is not required for the internalization of zymosan during Fig. 2B). These data from primary neutrophils provide evidence that phagocytosis. Ca2+ release from intracellular stores is a crucial step in the regu- 2+ Consequently, we postulated that [Ca ]i elevation triggered by lation of zymosan internalization, validating our previous findings Ca2+ release from internal stores is sufficient to regulate Ca2+-de- obtained in dHL-60 cells. pendent phagocytosis. To test this hypothesis, we incubated dHL- 60 cells with BAPTA-AM (10 mM) for 30 min before adding ITPR1 and ITPR3 are involved in IgG-opsonized zymosan zymosan, in the absence of extracellular Ca2+. Under these con- internalization ditions, the efficiency of IgG-opsonized zymosan-induced in- It is well known that the Ca2+ release from the internal stores ternalization was reduced by 80% (Fig. 1C) and did not change primarily occurs through IP3 receptors (ITPRs) (6). In addition, over the period of zymosan incubation (Supplemental Fig. 1B). In IP3 production has been associated with the mechanism of phago- addition, when BAPTA-AM is replaced by TG (0.1 mM), a sarco/ cytosis (21, 22). In contrast, Rosales and Brown (23) excluded a endoplasmic reticulum calcium-ATPase pump inhibitor allowing role for the IP3 pathway in FcgR-mediated particle internalization. passive intracellular Ca2+ store emptying before phagocytosis, we To resolve the issue whether ITPRs are involved in the regulation observed a 50% reduction of zymosan internalization (Fig. 1C). of FcgR-mediated zymosan internalization via intracellular Ca2+ 2+ 2+ These findings support the idea that [Ca ]i increase, through Ca store depletion, we used both functional and molecular approaches release from internal stores, is required for regulation of FcgR- based on a pharmacological inhibition of phospholipase C (re- mediated zymosan internalization. sponsible for IP3 formation) and a knockdown of ITPR isoforms To ensure the physiological relevance of the results obtained in by specific siRNA. We find that with a pretreatment of the dHL-60 differentiated HL-60 cells, we investigated the role of intracellular cells with 2 mM U73122, which inhibits PLC activity and its ca- 2+ Ca variations on IgG-opsonized zymosan internalization during pacity to produce the IP3 product, a strong reduction in the per- phagocytosis in purified human neutrophils. Our results showed centage of internalized zymosan (66%) was provoked, suggesting 2+ that extracellular Ca deprivation or incubation with the plasma a potential role for IP3 during the internalization phase of phago- membrane Ca2+ channel blocker Gd3+ (0.1 mM) did not alter the cytosis (Fig. 3A). This observation is further supported by the data efficiency of the zymosan internalization (Fig. 2A). In contrast, we obtained from ITPR knockdown in dHL-60 cells.

2+ FIGURE 4. FcgR-mediated phagosomal oxidative activity is dependent on extracellular Ca influx. Cells were incubated for 30 min with DCFH2-labeled yeast, and intraphagosomal ROS production was monitored by time-lapse microscopy. A, ROS production-increased DCFH2 F in the phagosome. B, Changes of DCFH2- labeledzymosanF were illustratedby pseudocolor images. The colorindex correlating the differentcolors(from greentored) todifferent F intensitiesisshown atthe far right. C, dHL-60 cells were pretreated or not pretreated with La3+ (30 mM), SK&F-96365 (30 mM), or DPI (10 mM) in the presence of extracellular Ca2+ (2 mM).

DCFH2-labeled yeast F was quantified according to the time, and DCFH2-labeled yeast oxidation average rate (R) was determined. D, Human neutrophils were 3+ 2+ pretreated or not pretreated with Gd (100 nM) in the presence of extracellular Ca (2 mM). DCFH2-labeled yeast F was quantified according to the time, and the average rate (R)ofDCFH2-labeled yeast oxidation was determined. Results are expressed as mean 6 SEM from three individual experiments. Asterisks denote significantly different from the control (no pretreatment). Representative traces in the presence or absence of extracellular Ca2+ are shown in the insets. 6 Orai1, STIM1, Ca2+, OXIDATIVE ACTIVITY, AND PHAGOCYTOSIS

We determined the expression of each ITPR isoform at the RNA reduces phagosomal oxidative activity, we now postulate that this and protein levels. Three isoforms of ITPR were detected in dHL- process is regulated by SOCs after depletion of the intracellular Ca2+ 60 cells. ITPR2 mRNA is dominantly expressed, whereas a lower store. To test this hypothesis, we used an siRNA strategy to decrease expression is detected for ITPR1 and ITPR3 mRNA (Supplemental the expression levels of Orai1-3 (Supplemental Fig. 2B–E), which Fig. 1A). We conducted a set of Western blots to correlate the probably constitute the pore-forming subunits of the Ca2+ channels, 2+ mRNA expression to the protein expression of the ITPR isoforms. with further assessment of the knockdown impact on [Ca ]i eleva- As expected, ITPR1, ITPR2, and ITPR3 are expressed at the tion during DCFH2-labeled zymosan phagocytosis (27–29). A sim- protein level in dHL-60 cells (Supplemental Fig. 2D). A siRNA ilar approach was used to decrease the endogenous expression of strategy was developed to downregulate ITPR1, ITPR2, and STIM1, the intraluminal Ca2+ sensor (30, 31). Suppression of Orai ITPR3 expression. The ITPR siRNA efficiency was assessed on isoforms and STIM1 expression by siRNA was effective with a re- mRNA expression by real-time PCR (Supplemental Fig. 2C). duction by at least 70 and 50% of mRNA and protein expression, siRNAs induced a reduction of ∼50% for each targeted ITPR respectively (Supplemental Figs. 2C–E). STIM1 and Orai1 knock- protein (Supplemental Figs. 2D,2E). The ITPR1 and ITPR3 down in dHL-60 cells incubated in the presence of extracellular siRNA reduced the percentage of zymosan internalized by dHL- Ca2+ resulted in a substantial abrogation (90 and 84%) of Texas 2+ 60 cells (ITPR1 siRNA: 50 6 5% control; ITRP3 siRNA: 74 6 Red-labeled zymosan-mediated [Ca ]i elevation. Alterations of 2+ 7% control; Fig. 3B, inset). The ITPR2 siRNA had no effect on endogenous Orai2 or Orai3 mRNA had no effect on [Ca ]i ele- internalization of zymosan (Fig. 3B, inset). Thus, we can conclude vation (Fig. 5A). Furthermore, Orai1 and STIM1 reduced by 54 that ITPR1 and ITPR3 are required for the internalization phase of and 37%, respectively, the rate of DCFH2-labeled zymosan oxi- phagocytosis. These data support the idea that Ca2+ store depletion dation (Fig. 5B). Thus, our data provide evidence that extracel- 2+ through an IP3 signaling pathway is involved in FcgR-mediated lular Ca entry, regulated by Orai1 and STIM1, is involved in phagocytosis. FcgR-mediated phagosomal ROS production. 2+ Extracellular Ca2+ entry regulates phagosomal oxidative S100A8 and S100A9 act as Ca sensors in the regulation of 2+ activity Ca influx-induced phagosomal oxidative activity 2+ Although our results provide evidence that [Ca ]i elevation As previously demonstrated, the complex formed by S100A8 and 2+ through store depletion is involved in the internalization phase of S100A9, two Ca -binding proteins, could constitute the link 2+ phagocytosis, we cannot exclude the possibility that extracellular between [Ca ]i elevation and NOX2 activation, which is the en- Ca2+ entry has a role at a further stage in phagocytosis. Given that zyme primarily responsible for ROS production in neutrophils 2+ extracellular Ca2+ entry is required for optimal NADPH oxidase 2 (32–34). To test whether S100A8–A9 may be involved in the Ca (NOX2) activity to the plasma membrane, and because several dependence of FcgR-induced phagosomal oxidative activity, we studies implicated a role for Ca2+ influx in phagocytosis (9, 10, analyzed the effect of silencing the endogenous S100A8–A9 ex- 2+ 24), we questioned whether this Ca influx is involved in the pression on the rate of ROS production during DCFH2-labeled regulation of phagosomal oxidative activity. To address this question, we used time-lapse confocal microscopy to follow phagosomal ROS production within individual dHL-60 cells un- dergoing phagocytosis of DCFH2-labeled zymosan bioparticles in the presence or absence of extracellular Ca2+ (Figs. 4A,4B). To validate our experimental conditions, we used DPI (10 mM), which is extensively used as an inhibitor of NOX2 (25). DPI de- creased the rate of the ROS production by 86%, reflecting a re- duction of phagosomal oxidative activity (Fig. 4C, inset). To determine whether ROS production is regulated by extracellular 2+ Ca entry, we monitored phagocytosis of DCFH2-labeled zy- mosan bioparticles in the absence of extracellular Ca2+. Under these conditions, the rate of ROS production was reduced by 53% (Fig. 4C). These data support the fact that extracellular Ca2+ entry regulates phagosome-induced ROS production. To obtain further evidence about the contribution of Ca2+ influx in phagosomal oxidative activity, we incubated dHL-60 cells with La3+ (30 mM) or SK&F-96365 (30 mM), two inhibitors of extracellular Ca2+ entry, before the addition of labeled zymosan (20, 26). Because the rate of ROS production is also strongly decreased by cell pretreatment using these inhibitors, we conclude that the regula- tion of phagosomal oxidative activity is dependent on extracellular Ca2+ entry (Fig. 4C). Similarly, intraphagosomal ROS production was inhibited in the absence of extracellular Ca2+ or in the pres- 3+ ence of Gd in human neutrophils, ensuring the physiological 2+ relevance of our findings obtained in dHL-60 cells (Fig. 4D). FIGURE 5. Orai and STIM1 are required for FcgR-mediated Ca influx and phagosomal oxidative activity. dHL-60 cells were transiently trans- Orai1 and STIM1 are involved in the regulation of Ca2+ fected with Orai1, Orai2, Orai3, STIM1 siRNA, or nonsilencing siRNAs. influx-mediated phagosomal oxidative activity Cells were incubated for 30 min with DCFH2-labeled yeast 48 h post- 2+ transfection. A, Measurement of D[Ca ]i. B, Measurement of DCFH2- Although selectivity and targets of SK&F-96365 are the subject of labeled yeast oxidation average rate (R) as described in Fig. 3. Results are controversy, this compound has been extensively used as an SOCE expressed as mean 6 SEM from three individual experiments. Asterisks inhibitor (26). As we previously demonstrated that SK&F-96365 denote significantly different from the control (nonsilencing siRNA). The Journal of Immunology 7 zymosan phagocytosis by dHL-60 cells. Simultaneous transfection some (Fig. 6C,6D). Finally, after zymosan internalization, of specific S100A8 and S100A9 siRNA decreased these protein S100A8–A9 staining persists around the phagosome (Fig. 6E). levels by ∼50%, as assessed by immunoblot and densitometric These data are consistent with the hypothesis that the S100A8– analysis. This knockdown of both the S100A8 and S100A9 pro- A9 complex is involved in FcgR-mediated phagosomal oxidative teins inhibited phagosomal ROS production by 45% (Fig. 6A, activity and suggest that this process is dependent on S100A8–A9 inset). translocation to the phagosomal membrane. To further investigate We next investigated the intracellular distribution of the active this latter point, we examined the relocalization of endogenous S100A8–A9 complex on IgG-opsonized zymosan stimulation S100A8–A9 under different extracellular Ca2+ conditions. We using immunofluorescence. Resting dHL-60 cells exhibited a per- quantified the percentage of cells with a periphagosomal staining inuclear and cytoplasmic distribution of S100A8–A9, as shown by of S100A8–A9 in a 100-cell sample. As shown in Fig. 6F and 6G, staining of proteins with a complex-specific primary Ab (Mac387) the zymosan-stimulated S100A8–A9 redistribution observed in and then Cy2-labeled secondary Ab (green) (Fig. 6B). After the the presence of extracellular Ca2+ is substantially inhibited (by addition of IgG-opsonized Texas Red-labeled zymosan (red), we 65%) when Ca2+ is omitted from the medium. Thus, we conclude observed that endogenous S100A8–A9 is recruited to the phago- that FcgR-mediated extracellular Ca2+ entry is necessary for cytic cup (Fig. 6C). Then after phagosome closure, the S100A8– S100A8–A9 recruitment to the phagosomal membrane and sub- A9 recruitment is still observed as a ring surrounding the phago- sequent phagosomal oxidative activity.

FIGURE 6. FcgR-mediated phagosomal oxidative activity is dependent on Ca2+ influx-induced S100A8–A9 translocation. A, dHL-60 cells were transiently transfected with S100A8 and S100A9 or nonsilencing siRNAs. Cells were incubated for 30 min with DCFH2-labeled yeast 48 h post-trans- fection, and the average rate (R) of DCFH2-labeled yeast oxidation was determined as described in Fig. 3. Results are expressed as mean 6 SEM from three individual experiments. Asterisk denotes significantly different from the control (nonsilencing siRNA). B–F, S100A8–A9 protein localization during phagocytosis of Texas Red-labeled opsonized zymosan (red) was detected by immunostaining with an anti–S100A8-9 Ab (green). Inserted pseudocolor images show intensity of S100A8–A9 immunostaining. The color index at the bottom right shows that different colors (from blue to red) correspond to different F intensities. Localization of S100A8–A9 proteins was observed in (B) unstimulated dHL-60 cells, (C) during phagocytic cup formation, (D) phagocytic cup closing, and (E) zymosan internalization in phagosome. Images are representative of three independent experiments. G, dHL-60 cells were incubated in the presence or absence of extracellular Ca2+ (2 mM), and S100A8–A9 protein localization around the phagosome was evaluated. The percentage of phagosomal S100A8–A9 was calculated on a total of 100 cells per experiment. Results are expressed as mean 6 SEM from three individual experiments. Asterisk denotes significantly different from the control (in the presence of extracellular Ca2+). 8 Orai1, STIM1, Ca2+, OXIDATIVE ACTIVITY, AND PHAGOCYTOSIS

Discussion pathway, IP3 formation is triggered by phosphorylation of tyrosine The initial response of human neutrophils to most bacterial and residues within ITAM of the FcR g-chain and the CD32 cyto- fungal pathogens is phagocytosis, which is triggered through plasmic tail, which enables phospholipase Cg activation (38, 39). distinct receptors. Most of the research regarding this phagocytic However, controversy exists concerning the role of IP3 in FcgR- process has been focused on the receptor that binds to the Fcg mediated phagocytosis. On the one hand, some studies have portion of IgG and the receptor that recognizes the complement shown that the ingestion of insoluble immune complex mediated component C3bi fragment of the complement system. The by FcgR was independent of IP3 (23). On the other hand, IP3 receptor-mediated phagocytosis occurring via these two major production has been found to be concomitant with FcgR activation 2+ opsonins is associated with a [Ca ]i elevation. Although C3bi (22, 23). This discordance could be explained by the fact that IP3 2+ 2+ receptors can induce an increase in [Ca ]i, the need for Ca was involvement in FcgR-mediated phagocytosis varies according to considered irrelevant for the engulfment (binding and cup for- the cell type studied and the subclasses of FcgR activated by mation) of C3bi particles (35). However, Dewitt and Hallett (35) a given stimulus (insoluble immune complex or zymosan bio- showed that extracellular Ca2+ entry was required for completion particles). The inhibition of IgG-zymosan internalization by PLCg of phagocytosis at the time of phagosome closure and was tem- inhibitor or by ITPR siRNA supports the notion that IP3-induced 2+ porally correlated with NOX2 activation. FcgR-mediated phago- Ca store depletion regulates FcgR-mediated zymosan inter- 2+ cytosis is accompanied by periphagosomal [Ca ]i elevation in nalization through ITPR1 and ITPR3 activation (Fig. 7, blue neutrophils (36), but IgG and C3bi-dependent phagocytosis appear pathway) (40, 41). 2+ 2+ 2+ 2+ to have different Ca requirements and sources of Ca . Molec- The contribution for phagocytosis of Ca influx-induced [Ca ]i 2+ ular identity of the proteins involved in the [Ca ]i changes oc- elevation has been reported by Dewitt et al. (11) following the curring during different stages of FcgR-mediated phagocytosis development of an original technique in which C3bi-opsonized remains an open question. particles labeled with an oxidant-sensitive probe were presented This study focuses on the identification of the Ca2+-dependent to neutrophils. Because extracellular Ni2+, a blocker of Ca2+ in- 2+ regulation of FcgR-mediated internalization and phagosomal oxi- flux, prevented [Ca ]i change, which was involved in phagosomal dative activity phases during phagocytosis in granulocyte-like ROS production, the authors postulated that Ca2+ influx is nec- HL-60 cells. Our data show that internalization of IgG-opsonized essary for maximal phagosomal oxidative activity but is not suf- 2+ zymosan is dependent on [Ca ]i changes in dHL-60 cells. Both ficient to trigger oxidative activation in neutrophils. Using BAPTA-AM intracellular Ca2+ chelation or intracellular Ca2+ store a similar approach, we confirm that extracellular Ca2+ entry is emptying by TG in a Ca2+-free medium caused a large decrease in absolutely required for optimal phagosomal oxidative activity the percentage of internalized particles indicating that intracellular during phagocytosis of IgG opsonized zymosan in dHL-60 and in Ca2+ store depletion is essential for the internalization process primary human neutrophils. Our results associating Ca2+ influx mediated by FcgR. Moreover, the efficiency of particle ingestion is with an oxidative response during phagocytosis are in agreement not affected in the absence of extracellular Ca2+ or when dHL-60 with the work of Lundqvist-Gustafsson et al. (42). These authors cells are subjected to the channel blocker La3+. Additional experi- demonstrated that, after phagosomal closure of a serum ments performed in primary neutrophils confirmed our findings opsonized-conjugated zymosan particle, there is a Ca2+ release obtained in differentiated HL-60 cells. Extracellular Ca2+ absence from extracellular Ca2+ enclosed in the phagosome (42). These or Gd3+ addition does not affect zymosan ingestion purified human authors also observed that the phagosomal Ca2+ release is de- neutrophils. Our results support the conclusion that store depletion creased by econazole, a Ca2+ channel antagonist. Thus, extracel- 2+ 2+ is necessary for [Ca ]i-mediated phagocytosis without requiring lular Ca , whether enclosed in the phagosome or not, contributes 2+ 2+ a contribution of extracellular Ca . to [Ca ]i elevation accompanying the FcgR-mediated phag- It is largely acknowledged that IP3, produced by PLCg activa- osomal oxidative activity. tion, is the principal second messenger responsible for Ca2+ re- During the last few years, a number of studies have provided lease from intracellular stores (37). In the FcgR signaling evidence that Orai1 protein is an essential pore subunit of Ca2+

FIGURE 7. Ca2+ signaling function in FcgR-in- duced phagocytosis and phagosomal oxidative activity regulation. Green pathway: IgG-opsonized zymosan is recognized by neutrophils through its FcgR. In- tracellular Ca2+ store depletion occurs via the opening of ITPR1 and ITPR3. Blue pathway: intracellular Ca2+ 2+ store depletion-mediated [Ca ]i elevation induces zy- mosan internalization. Red pathway: depletion of Ca2+ stores induces activation of the Ca2+ sensor STIM1, which interacts with Orai1 to allow extracellular Ca2+ 2+ entry. The resulting [Ca ]i increase mediates S100A8– A9 translocation to the phagosomal membrane and regulates the phagosomal oxidative activity. The Journal of Immunology 9 channels regulated by intracellular Ca2+ store depletion (27–29, Disclosures 2+ 43) with the participation of the intraluminal Ca sensor, STIM1 The authors have no financial conflicts of interest. (30, 31). To our knowledge, we demonstrate for the first time that Orai1 contributes to the regulation of phagosomal oxidative ac- tivity through the activation of store depletion-regulated Ca2+ in- References 1. Hampton, M. B., A. J. Kettle, and C. C. Winterbourn. 1998. Inside the neutrophil flux in granulocyte-like HL-60 cells. Moreover, we provide phagosome: oxidants, myeloperoxidase, and bacterial killing. Blood 92: 3007– evidence that STIM1 is also involved in this mechanism, in 3017. agreement with a recent study (44) in which the STIM1 re- 2. Nathan, C. 2006. Neutrophils and immunity: challenges and opportunities. Nat. 2+ Rev. Immunol. 6: 173–182. quirement for the activation of the FcgR-induced Ca entry and Biochemistry and physiology of the neutrophil. 2 2 3. Edwards, S. W. 1994. Cambridge phagocytosis was demonstrated using macrophage Stim1 / University Press, Cambridge, U.K. mice. All these data support the fact that intraphagosomal oxi- 4. Nimmerjahn, F., and J. V. Ravetch. 2006. Fcgamma receptors: old friends and 2+ new family members. Immunity 24: 19–28. dative activity occurs through SOCE-induced [Ca ]i elevation 5. Joshi, T., J. P. Butchar, and S. Tridandapani. 2006. Fcgamma receptor signaling (Fig. 7, red pathway). in phagocytes. Int. J. Hematol. 84: 210–216. 6. Berridge, M. J., M. D. Bootman, and H. L. Roderick. 2003. Calcium signalling: Although DCFH2-zymosan oxidation could be indirectly caused dynamics, homeostasis and remodelling. Nat. Rev. Mol. Cell Biol. 4: 517–529. by myeloperoxidase, the initial superoxide anion production 7. Putney, J. W., Jr. 1986. A model for receptor-regulated calcium entry. Cell necessary for myeloperoxidase activity is probably mediated by Calcium 7: 1–12. 8. DeHaven, W. I., B. F. Jones, J. G. Petranka, J. T. Smyth, T. Tomita, G. S. Bird, the NADPH oxidase enzyme (NOX2) (11), which is described as and J. W. Putney, Jr. 2009. TRPC channels function independently of STIM1 and the major source of ROS in the phagosome (1). The complex Orai1. J. Physiol. 587: 2275–2298. formed by S100A8–A9, two Ca2+-binding proteins, has been 9. Edberg, J. C., C. T. Lin, D. Lau, J. C. Unkeless, and R. P. Kimberly. 1995. The 2+ Ca2+ dependence of human Fc gamma receptor-initiated phagocytosis. J. Biol. demonstrated to regulate Ca -dependent NOX2 activation at the Chem. 270: 22301–22307. plasma membrane (32, 33). We address the question whether 10. Kobayashi, K., K. Takahashi, and S. Nagasawa. 1995. The role of tyrosine S100A8–A9 is also involved in Ca2+ influx-regulated phagosomal phosphorylation and Ca2+ accumulation in Fc gamma-receptor-mediated phagocytosis of human neutrophils. J. Biochem. 117: 1156–1161. oxidative activation in FcgR-induced phagocytosis. We found that 11. Dewitt, S., I. Laffafian, and M. B. Hallett. 2003. Phagosomal oxidative activity S100A8–A9 translocates to the phagosomal membrane on during beta2 integrin (CR3)-mediated phagocytosis by neutrophils is triggered 2+ by a non-restricted Ca2+ signal: Ca2+ controls time not space. J. Cell Sci. 116: zymosan-stimulated [Ca ]i elevation. This recruitment of en- 2857–2865. dogenous S100A8–A9 was observed at the beginning of the for- 12. Lew, D. P., T. Andersson, J. Hed, F. Di Virgilio, T. Pozzan, and O. Stendahl. mation of the phagocytic cup and persisted throughout the 1985. Ca2+-dependent and Ca2+-independent phagocytosis in human neu- trophils. Nature 315: 509–511. zymosan internalization process. In agreement with our results, 13. Steinckwich, N., J. P. Frippiat, M. J. Stasia, M. Erard, R. Boxio, C. Tankosic, Kumar et al. (45) showed that phagocytosis was associated with I. Doignon, and O. Nu¨sse. 2007. Potent inhibition of store-operated Ca2+ influx a rapid reduction of cytoplasmic immunostaining of the S100A8 and superoxide production in HL60 cells and polymorphonuclear neutrophils by 2+ the pyrazole derivative BTP2. J. Leukoc. Biol. 81: 1054–1064. homodimeric form. Moreover, previous work reported Ca de- 14. Collins, S. J., F. W. Ruscetti, R. E. Gallagher, and R. C. Gallo. 1978. Terminal pendence of S100A8–A9 protein translocation, particularly in differentiation of human promyelocytic leukemia cells induced by dimethyl sulfoxide and other polar compounds. Proc. Natl. Acad. Sci. USA 75: 2458– cytoskeletal structures (33, 46). All these data support the fact that 2462. 2+ the S100A8–A9 complex acts as a cytoplasmic Ca sensor during 15. Fessler, M. B., K. C. Malcolm, M. W. Duncan, and G. S. Worthen. 2002. A the phagosomal oxidative activity. To obtain direct evidence of genomic and proteomic analysis of activation of the human neutrophil by lipo- polysaccharide and its mediation by p38 mitogen-activated protein kinase. J. S100A8–A9 involvement in the oxidative response at the phag- Biol. Chem. 277: 31291–31302. osome, we performed siRNA-mediated S100A8–A9 knockdown 16. Fessler, M. B., P. G. Arndt, I. Just, J. A. Nick, K. C. Malcolm, and G. S. Worthen. and subsequent monitoring of ROS production. Our results dem- 2007. Dual role for RhoA in suppression and induction of cytokines in the hu- 2+ man neutrophil. Blood 109: 1248–1256. onstrate that S100A8–A9 mediates interplay between [Ca ]i el- 17. Bre´chard, S., C. Melchior, S. Planc¸on, V. Schenten, and E. J. Tschirhart. 2008. evation and phagosomal oxidative activity through its membrane Store-operated Ca2+ channels formed by TRPC1, TRPC6 and Orai1 and non- 2+ store-operated channels formed by TRPC3 are involved in the regulation of translocation dependent on extracellular Ca entry (Fig. 7, red NADPH oxidase in HL-60 granulocytes. Cell Calcium 44: 492–506. pathway). 18. Grynkiewicz, G., M. Poenie, and R. Y. Tsien. 1985. A new generation of Ca2+ In conclusion, our study clearly establishes that intracellular indicators with greatly improved fluorescence properties. J. Biol. Chem. 260: 2+ 2+ 3440–3450. Ca store depletion-induced [Ca ]i elevation through ITPR1 and 19. Hallett, M. B., E. V. Davies, and A. K. Campbell. 1990. Oxidase activation in ITPR3 activation is required for FcgR-mediated zymosan in- individual neutrophils is dependent on the onset and magnitude of the Ca2+ ternalization during phagocytosis in granulocyte-like HL-60 cells. signal. Cell Calcium 11: 655–663. 2+ 2+ 20. Itagaki, K., K. B. Kannan, and C. J. Hauser. 2005. Lysophosphatidic acid triggers Moreover, a Ca influx-induced [Ca ]i increase is necessary for calcium entry through a non-store-operated pathway in human neutrophils. J. a further stage of phagocytosis, phagosomal ROS production. Im- Leukoc. Biol. 77: 181–189. portantly, to our knowledge, we provide, for the first time, evidence 21. Davies-Cox, E. V., I. Laffafian, and M. B. Hallett. 2001. Control of Ca2+ influx 2+ in human neutrophils by inositol 1,4,5-trisphosphate (IP3) binding: differential that the process of extracellular Ca entry is regulated by Orai1 effects of micro-injected IP3 receptor antagonists. Biochem. J. 355: 139–143. and STIM1. Furthermore, we identify S100A8 and S100A9 as the 22. Fa¨llman, M., D. P. Lew, O. Stendahl, and T. Andersson. 1989. Receptor- 2+ mediated phagocytosis in human neutrophils is associated with increased for- links between extracellular Ca entry and phagosomal oxidative mation of inositol phosphates and diacylglycerol. Elevation in cytosolic free activity. calcium and formation of inositol phosphates can be dissociated from accumu- lation of diacylglycerol. J. Clin. Invest. 84: 886–891. Acknowledgments 23. Rosales, C., and E. J. Brown. 1992. Signal transduction by neutrophil immu- noglobulin G Fc receptors. Dissociation of intracytoplasmic calcium concen- We thank James W. Putney, Jr. and Gary S. Bird (Department of Health and tration rise from inositol 1,4,5-trisphosphate. J. Biol. Chem. 267: 5265–5271. Human Services) for helpful discussions and advice throughout the com- 24. Foyouzi-Youssefi, R., F. Petersson, D. P. Lew, K. H. Krause, and O. Nu¨sse. 1997. pletion of this study. We thank Sebastien Planc¸on (Life Sciences Research Chemoattractant-induced respiratory burst: increases in cytosolic Ca2+ con- centrations are essential and synergize with a kinetically distinct second signal. Unit, University of Luxembourg), Jeff Tucker (Department of Health and Biochem. J. 322: 709–718. Human Services), and Agnes Janoshazi (Department of Health and Human 25. Ellis, J. A., S. J. Mayer, and O. T. Jones. 1988. The effect of the NADPH oxidase Services) for assistance with confocal microscopy and Carl Bortner (De- inhibitor diphenyleneiodonium on aerobic and anaerobic microbicidal activities partment of Health and Human Services) for assistance with the flow of human neutrophils. Biochem. J. 251: 887–891. cytometry. We are grateful to Marie Erard for the kind gift of anti-yeast 26. Merritt, J. E., W. P. Armstrong, C. D. Benham, T. J. Hallam, R. Jacob, A. Jaxa- Chamiec, B. K. Leigh, S. A. McCarthy, K. E. Moores, and T. J. Rink. 1990. serum (Universite´ Paris-Sud/Centre National de la Recherche Scientifique SK&F 96365, a novel inhibitor of receptor-mediated calcium entry. Biochem. J. Unite´ Mixte de Recherche 8000, Orsay, France). 271: 515–522. 10 Orai1, STIM1, Ca2+, OXIDATIVE ACTIVITY, AND PHAGOCYTOSIS

27. Feske, S., Y. Gwack, M. Prakriya, S. Srikanth, S. H. Puppel, B. Tanasa, 38. Lo¨fgren, R., L. Serrander, M. Forsberg, A. Wilsson, A. Wasteson, and P. G. Hogan, R. S. Lewis, M. Daly, and A. Rao. 2006. A mutation in Orai1 O. Stendahl. 1999. CR3, FcgammaRIIA and FcgammaRIIIB induce activation of causes immune deficiency by abrogating CRAC channel function. Nature 441: the respiratory burst in human neutrophils: the role of intracellular Ca(2+), 179–185. phospholipase D and tyrosine phosphorylation. Biochim. Biophys. Acta 1452: 28. Peinelt, C., M. Vig, D. L. Koomoa, A. Beck, M. J. Nadler, M. Koblan-Huberson, 46–59. A. Lis, A. Fleig, R. Penner, and J. P. Kinet. 2006. Amplification of CRAC current 39. Shen, Z., C. T. Lin, and J. C. Unkeless. 1994. Correlations among tyrosine by STIM1 and CRACM1 (Orai1). Nat. Cell Biol. 8: 771–773. phosphorylation of Shc, p72syk, PLC-gamma 1, and [Ca2+]i flux in Fc gamma 29. Mignen, O., J. L. Thompson, and T. J. Shuttleworth. 2008. Both Orai1 and Orai3 RIIA signaling. J. Immunol. 152: 3017–3023. are essential components of the arachidonate-regulated Ca2+-selective (ARC) 40. Smith, R. J., L. M. Sam, J. M. Justen, G. L. Bundy, G. A. Bala, and channels. J. Physiol. 586: 185–195. J. E. Bleasdale. 1990. Receptor-coupled signal transduction in human poly- 30. Liou, J., M. L. Kim, W. D. Heo, J. T. Jones, J. W. Myers, J. E. Ferrell, Jr., and morphonuclear neutrophils: effects of a novel inhibitor of phospholipase C- T. Meyer. 2005. STIM is a Ca2+ sensor essential for Ca2+-store-depletion- dependent processes on cell responsiveness. J. Pharmacol. Exp. Ther. 253: triggered Ca2+ influx. Curr. Biol. 15: 1235–1241. 688–697. 31. Roos, J., P. J. DiGregorio, A. V. Yeromin, K. Ohlsen, M. Lioudyno, S. Zhang, 41. Nu¨sse, O., L. Serrander, R. Foyouzi-Youssefi, A. Monod, D. P. Lew, and O. Safrina, J. A. Kozak, S. L. Wagner, M. D. Cahalan, et al. 2005. STIM1, an K. H. Krause. 1997. Store-operated Ca2+ influx and stimulation of exocytosis in essential and conserved component of store-operated Ca2+ channel function. J. HL-60 granulocytes. J. Biol. Chem. 272: 28360–28367. Cell Biol. 169: 435–445. 42. Lundqvist-Gustafsson, H., M. Gustafsson, and C. Dahlgren. 2000. Dynamic ca(2 32. Doussiere, J., F. Bouzidi, and P. V. Vignais. 2002. The S100A8/A9 protein as +)changes in neutrophil phagosomes A source for intracellular ca(2+)during a partner for the cytosolic factors of NADPH oxidase activation in neutrophils. phagolysosome formation? Cell Calcium 27: 353–362. Eur. J. Biochem. 269: 3246–3255. 43. Vig, M., C. Peinelt, A. Beck, D. L. Koomoa, D. Rabah, M. Koblan-Huberson, 33. Schenten, V., S. Bre´chard, C. Melchior, S. Planc¸on, A. Salsmann, and S. Kraft, H. Turner, A. Fleig, R. Penner, and J. P. Kinet. 2006. CRACM1 is E. J. Tschirhart. 2008. Ca2+-dependent regulation of NOX2 activity via MRP a plasma membrane protein essential for store-operated Ca2+ entry. Science 312: proteins in HL-60 granulocytes. Calcium Binding Proteins 3: 25–27. 1220–1223. 34. Quinn, M. T., and K. A. Gauss. 2004. Structure and regulation of the neutrophil 44. Braun, A., J. E. Gessner, D. Varga-Szabo, S. N. Syed, S. Konrad, D. Stegner, respiratory burst oxidase: comparison with nonphagocyte oxidases. J. Leukoc. T. Vo¨gtle, R. E. Schmidt, and B. Nieswandt. 2009. STIM1 is essential for Biol. 76: 760–781. Fcgamma receptor activation and autoimmune inflammation. Blood 113: 1097– 35. Dewitt, S., and M. B. Hallett. 2002. Cytosolic free Ca(2+) changes and calpain 1104. activation are required for beta integrin-accelerated phagocytosis by human 45. Kumar, R. K., Z. Yang, S. Bilson, S. Thliveris, B. E. Cooke, and C. L. Geczy. neutrophils. J. Cell Biol. 159: 181–189. 2001. Dimeric S100A8 in human neutrophils is diminished after phagocytosis. J. 36. Stendahl, O., K. H. Krause, J. Krischer, P. Jerstro¨m, J. M. Theler, R. A. Clark, Leukoc. Biol. 70: 59–64. J. L. Carpentier, and D. P. Lew. 1994. Redistribution of intracellular Ca2+ stores 46. Vogl, T., S. Ludwig, M. Goebeler, A. Strey, I. S. Thorey, R. Reichelt, D. Foell, during phagocytosis in human neutrophils. Science 265: 1439–1441. V. Gerke, M. P. Manitz, W. Nacken, et al. 2004. MRP8 and MRP14 control 37. Putney, J. W. 2009. Capacitative calcium entry: from concept to molecules. microtubule reorganization during transendothelial migration of phagocytes. Immunol. Rev. 231: 10–22. Blood 104: 4260–4268.