DOCSLIB.ORG

Imipenem-Resistance in S. Marcescens Is Mediated by Plasmid Expression of KPC-2 Imipenem-Resistant S

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Imipenem-Resistance in S. Marcescens Is Mediated by Plasmid Expression of KPC-2 Imipenem-Resistant S European Review for Medical and Pharmacological Sciences 2017; 21: 1690-1694 Imipenem-resistance in Serratia marcescens is mediated by plasmid expression of KPC-2 W.-Q. SU1, Y.-Q. ZHU3, N.-M. DENG2, L. LI1 1Department of Laboratory, Qingdao Municipal Hospital, Qingdao, China 2Department of Hospital Infection Management, Qingdao Municipal Hospital, Qingdao, China 3Affiliated Hospital of Qingdao University, Qingdao, China Abstract. – OBJECTIVE: Imipenem is a broad- production of carbapenemases, enzymes that spectrum carbapenem antibiotic with applications break down these antibiotics4. Here, we describe against severe bacterial infections. Here, we de- the identification of imipenem-resistant Serra- scribe the identification of imipenem-resistantSer - ratia marcescens in our hospital and the role of tia marcescens and analyze its drug-resistance plasmid-mediated KPC-2 expression in imipenem mechanism, concluding that plasmid-dependent resistance. Klebsiella pneumoniae carbapenemase-2 (KPC- MATERIALS AND METHODS: We used the 2) is the main mediator of imipenem resistance. modified Hodge test to detect carbapenemase produced in imipenem-resistant strains. RESULTS: His resistance can be transferred to Materials and Methods E. coli in co-culture tests, which implicates the plasmid in imipenem resistance. PCR amplifi- cation from the plasmid identified two products Source of Drug-Resistant Bacteria consistent with KPC-2 of 583 and 1050 bp that We identified 32 multi-drug-resistant bacteria were also present in E. coli after co-culture. The in the clinical departments of our center after cul- restriction pattern for both plasmids was iden- ture and drug sensitivity tests. The bacterial iden- tical, supporting the transfer from the S. marc- tification by Vitek instrument (bioMerieux, Marcy, escens isolate to E. coli. Finally, gene sequenc- ing confirmed KPC-2 in the plasmid. l’Etoile, France) identified 20 cases of E. coli, eight CONCLUSIONS: Due to the presence of KPC- of K. pneumoniae, and four of S. marcescens. The 2 in the imipenem-resistant S. marcescens, we average minimum inhibitory concentration (MIC) propose that KPC-2 mediates antibiotic resis- for S. marcescens resistance to imipenem was 46.5 tance in the S. marcescens isolate. + 7.2 g/ml. We used E. coli ATCC25922 as quality Key Words: control bacteria for the drug sensitivity test. Imipenem, Drug resistance, Serratia marcescens, Plasmid, KPC-2. Detection of Carbapenemase Produced by Modified Hodge test E. coli ATCC25922 suspension was diluted to Introduction 0.5 McF with sterile saline (1:10 dilution) and ino- culated into MH agar plates and dried for 5 min. The isolation of bacteria resistant to carba- Three strains were inoculated into plates contai- penem antibiotics brings new challenges to the ning 10 μg imipenem paper with a 1 μl inoculating clinic1. Current statistics indicates that Esche- loop. Then, at least 20 mm lines were drawn from richia coli, Klebsiella pneumoniae, and other the center. The plate was incubated at 35°C for enterobacteria are the main community- and 20 hr. E. coli rapid growth near the tested strains hospital-acquired pathogenic infections2. Drug indicates the production of carbapenemase. We sensitivity tests3 in our hospital suggest that drug used as positive control K. pneumoniae strains resistance rates of K. pneumoniae to imipenem, that produce KPC-2 and as negative control K. meropenem, and ertapenem are 1.5, 2, and 2.9%, pneumoniae ATCC700603. respectively. Multiple drug resistance rate to ex- tended spectrum β-lactamase (ESBLs) and Ampc Co-culture enzyme are 45%. The drug-resistance mechani- E. coli EC600 (rifampicin, MIC> 1000 μg/ml) sm is considered to be mediated mainly by the was inoculated into 5 ml Luria-Bertani broth with 1690 Corresponding Author: Li Li, MD; e-mail: [email protected] Imipenem-resistance in S. marcescens is mediated by plasmid expression of KPC-2 imipenem-resistant S. marcescens. The mixtu- the primers, and could be extended to 72˚C 1 min, re was shaken overnight. Then, 200 μl of donor 30 cycles, and at last 72˚C 10 min. Amplified pro- strain, 100 μl of recipient strain and 600 μl of fre- ducts were resolved by 1.2% gel electrophoresis, sh LB broth were mixed together in 1.5 ml centri- EB staining, and photographed under the gel ima- fuge tubes, and incubated at 35˚C for 4 hr. A small ging system. PCR products were purified accor- volume, mixed and without the mix, was transfer- ding to Purification Test Kit Manual from Shan- red on Mueller-Hinton agar plates (cefotaxime ghai Shenergy gaming Biological Technology. 2.0 μg/ml, rifampin 512 μg/ml), and incubated at Purified products were sent to Hangzhou biosune 35˚C for 24 hr. Single colonies were picked and Biotechnology for sequencing. The sequencing incubated at 35˚C for 4 hr. VITEK bacterial iden- results were compared in GenBank to identify the tification was used for the biochemical identifica- corresponding β-lactamase genes. tion of trans-conjugants and drug sensitivity test Analysis of plasmid DNA map: The plasmid was carried out to detect the MIC of mixed and DNA was extracted by alkaline lysis, and was non-mixed E. coli. carried out by the reference kit. S. marcescens and Escherichia coli plasmid DNA was dealt with Plasmid purification a restriction endonuclease at 37˚C for 2 hr. Ori- Plasmid Extraction Kit (Axygen, Union City, ginal plasmid and plasmid fragment dealt by re- CA, USA) was used according to the instructions striction enzyme were added with a 0.8% agarose manual. Isoelectric focusing electrophoresis: we ethidium bromide gel, electrophoresed at 85 V used a polyacrylamide gel pH 3.5-9.5 (Pharma- constant voltage for 75 min, and observed under cia co., Kalamazoo, MI, USA) in a PhastSystem UV light. electrophoresis instrument and isoelectric focu- sing electrophoresis, DYY-II electrophoresis in- Statistical Analysis strument (Beijing Six One Instrument Factory). SPSS 19.0 statistical software (SPSS Inc., Chi- The ultrasonic crushing method was used for cago, IL, USA) was used for statistical analysis plasmid extraction, and Nitrocefin (Oxoid, UK) and data was expressed as mean ± standard devia- was used as a substrate. In addition, conduction tion. The comparison between groups was made should follow reference5. The enzyme PI and by t-test. p<0.05 was considered to be statistically known β-lactamase TEM-1 (5.4), SIIV-1 (7.6) and significant. SIIV-5 (8.2) PI were compared as controls. Plasmid Analysis: PCR and DNA Result Sequencing BlaKPC and blaOXA-1 genes were amplified Results of the Improved Hodge Test with specific primers (Table 1). The reaction vo- The Hodge test allows identifying bacterial lume was: 50 μl (final concentration was 1 x PCR strains that produce carbapenemases because buffer, Mg2+ 3.5 mmol/L, dNTPs 2 mmol/L, 500 they permit the growth of carbapenem-sensitive mol/L primer, Taq 0.25U enzyme and 2 mu l tem- strains towards the antibiotic disc in the center of plate). For the PCR, we used PCR System Gene- the plate (Figure 1). Imipenem creates an inhibi- Amp 9600 (ABI co., Oyster Bay, NY, USA). The tion zone around the central disc that prevents the reaction parameters were 94˚C 5 min, 94˚C 45 sec. growth of E. coli ATCC25922. We identified four The annealing temperature was adjusted based on cases of S. marcescens that allow the growth of Table I. PCR primer sequences. Gene Primers Sequence(5’-3’) Size(bp) blaKPC KPC-A TCTAAGTTACCGCGCTGAGG 583 KPC-B CCAGACGACCCCATACTCAT blaKPC KPC-F GCTACACCTAGCTCCACCTTC 1050 KPC-R TCAGTGCTCTACAGAAAACC blaOXA-1 OXA-1-S ACCCCTTAAAATTAAGCCC OXA-1-AS CTTGATTGAAGGGTTGGGCG 908 1691 W.-Q. Su, Y.-Q. Zhu, N.-M. Deng, L. Li Figure 2. Joint Experiment and isoelectric focusing electrophoresis. 1, S. marcescens. 2, Joint carbapenem. 3, Known βphenolic amine TEM-1. PCR and DNA Sequencing Following co-culture and isoelectric focusing electrophoresis, we found a common pattern Figure 1. Improved Hodge test to detect carbapenem. 1, between S. marcescens and E. coli, with two Zuckerberg pneumonia strains producing KPC-2 type. 2, Z. bands running at 6.5 and 6.7 (Figure 2). PCR am- pneumonia strain ATCC700603. 3, Experimental strain to plification from the purified plasmid produced two be identified). fragments of 583 and 1050 bp. The products iso- lated from E. coli after co-culture were the same as those purified fromS. marcescens, but without E. coli ATCC25922, creating a cloverleaf inden- blaOXA-1 and other fragments (Figure 3). Pla- tation in the inhibition area. The positive Hodge smid analysis showed that the plasmids isolated test indicates that the S. marcescens isolates can from S. marcescens and E. coli after co-culture produce carbapenemase. had the same size, about 60 Kb and showed the same EcoRI restriction map. Gene sequencing of Co-culture Experiment the PCR products confirmed the presence of the The co-culture of the S. marcescens isolates KPC-2 gene (SEQ ID NO AY034847) in both S. and imipenem-sensitive E. coli EC600 produced marcescens isolates and E. coli after co-culture. similar resistance spectrum for S. marcescens (Table II). But the imipenem resistance rate and MIC for E. coli EC600 increased markedly (Table Discussion II). These results further support the production of carbapenemase by the S. marcescens isolates So far, 11 isoforms of KPC enzymes have been that result in significant benefits forE. coli EC600. identified, KPC-1 to 116. Despite this diversity, the Table II. Results of the co-culture. Drug rate to imipenem (%) MIC (μg/ml) before after before after S. marcescens 92.4±5.5 90.5±6.2 46.5±7.2 45.2±6.9 E. coli EC600 3.7±0.5 86.6±7.3# 1.7±0.6 42.3±5.8# t 42.615 0.439 38.652 0.538 p <0.001 0.626 <0.001 0.714 Notes: #comparison of E.
Load more

Recommended publications
  • A Collection of Serratia Marcescens Differing in Their Insect Pathogenicity Towards Manduca Sexta Larvae
    bioRxiv preprint doi: https://doi.org/10.1101/2020.07.29.226613; this version posted July 29, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. A collection of Serratia marcescens differing in their insect pathogenicity towards Manduca sexta larvae Short title: Serratia marcescens toxic to Manduca sexta Ellen C. Jensen14¶, Diana Sue Katz Amburn2¶, Aimee Hultine Schlegel3, and Kenneth W. Nickerson1* 1School of Biological Sciences University of Nebraska Lincoln, Nebraska, United States of America 2Biology Department, Rogers State University, Claremore, Oklahoma, United States of America and 3Biology Department Doane University Crete, Nebraska, United States of America 4/ Permanent address: Biological Sciences, College of Saint Benedict and St. John's University, Collegeville, MN 56321 * Corresponding author: email, [email protected] (KWN) ¶ These two authors contributed equally to the described research. 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.29.226613; this version posted July 29, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Abstract 2 We investigated the ability of Serratia marcescens to kill Manduca sexta (tobacco/tomato 3 hornworm) larvae following injection of ca. 5 x 105 bacteria into the insect hemolymph. Fifteen bacterial 4 strains were examined, including 12 non-pigmented clinical isolates from humans.
    [Show full text]
  • Cross-Infection with Serratia Marcescens
    J Clin Pathol: first published as 10.1136/jcp.15.2.145 on 1 March 1962. Downloaded from J. clin. Path. (1962), 15, 145 Cross-infection with Serratia marcescens GEOFFREY TAYLOR AND P. M. KEANE From the Department of Clinical Pathology, the Royal Infirmary, Manchester SYNOPSIS Cross-infection in a urological unit due to Serratia marcescens is reported. The bacteriology of the organism and its mode of spread are described. It is suggested that Serratia marcescens may be a more virulent organism than is generally believed, especially in situations in which there is an excess of mucus. The normal habitat of Serratia marcescens (Chromo- This pyrexial illness persisted intermittently for several bacterium prodigiosum) is in soil and water. It is weeks and he was admitted to the local hospital. What- usually considered not to be pathogenic to man, but ever the significance of the cat scratch, the symptoms on a number of occasions has been isolated from were thought to be due to a urinary infection. He was treated with antibiotics, but relapsed when treatment situations which suggest that it can sometimes was withdrawn. He was transferred to the Manchester behave as a human pathzgen. Thus Woodward and Royal Infirmary. Clarke (1913) described its isolation from a patient Investigation revealed a tight stricture of the penile with bronchiectasis who produced red sputum, and urethra. The urine was found to contain large numbers Aronson and Alderman (1943) reported meningitis of pus cells, and culture yielded a heavy pure growth due to this organism following repeated lumbar of Serr. marcescens. Blood cultures on three occasions puncture.
    [Show full text]
  • Carbapenem-Resistant Enterobcteriace Report
    Laboratory-based surveillance for Carbapenem-resistant Enterobacterales (CRE) Center for Public Health Practice Oregon Public Health Division Published: August 2021 Figure1: CRE reported by Oregon laboratories, by year, 2010 – June 2021 180 160 140 120 100 80 60 40 20 0 2010 2011 2012 2013 2014 2015 2016 2017 2018 2019 2020 2021 Year 1 About carbapenem-resistant Enterobacterales (CRE): For more information about CRE The carbapenems are broad-spectrum antibiotics frequently used to surveillance in Oregon including treat severe infections caused by Gram-negative bacteria. the specifics of our definition, see Carbapenem resistance in the Enterobacterales order emerged as a http://public.health.oregon.gov/Di public health concern over the past decade, as few treatment options seasesConditions/DiseasesAZ/P remain for some severely ill patients. ages/disease.aspx?did=108 CRE Resistance. Carbapenem resistance emerges through various mechanisms, including impaired membrane permeability and the production of carbapenemases (enzymes that break down the carbapenems). Carbapenemase-producing CRE (CP-CRE) are associated with rapid spread and require the most aggressive infection control response; however, all CRE call for certain infection control measures, including contact precautions, and should be considered a public health and infection prevention priority. CRE Infection. CRE can cause pneumonia, bloodstream infections, surgical site infections, urinary tract infections, and other conditions, frequently affecting hospitalized patients and persons with compromised immune systems. Infections with CRE often require the use of very expensive antibiotics that may have toxic side effects. While CP-CRE have spread rapidly throughout the United States, they are still not endemic in Oregon. We hope we can delay or prevent their spread through surveillance and infection control.
    [Show full text]
  • 1. Isolation of Molds 2. Isolation of Bacteria
    Professor Diane Hilker I. Exp. 3: Collection of Microbes 1. Isolation of molds 2. Isolation of bacteria Where you successful in isolating molds? Pure Culture Not a Pure Culture Where you successful in isolating individual bacterial colonies with the T-Streak method? Colony: a visible mass of microbial cells originating from one cell. Mixed Culture Broth: 3 types of microbes ◦ Med., pink-red, creamy colonies: Serratia marcescens ◦ Large, beige, dry-like colonies: Escherichia coli ◦ Small, pin-point or dot-like, white colonies: Staphylococcus epidermidis Mixed Culture Broth: 3 types of microbes Serratia marcescens Escherichia coli Staphylococcus epidermidis Professor Diane Hilker Purpose: To become familiar with several staining procedures and to compare morphological features, such as size & shape of various microbes. Today: 1. Wet Mount 2. Heat Fixation: required prior to staining 3. Simple Stain 4. Gram Stain 5. Review Stains: Endospore, Capsule & Acid-Fast Stains Wet Mount: observing living cells ◦ Motility and size of cells Place 1 drop dH2O on center of slide Using a sterile loop, remove a small amount of growth from the colony. Mix cells in the drop of H2O; spread to ½ inch Focus on edge of coverslip with scan (dim light) Move toward center of slide Observe under low & high powers Slides will dry out quickly Wet Mount ◦ Bacteria: E. coli Must observe under 400x Very small & motile Looks like specks of sand Hard to discern shape Smaller than yeast & protozoa Instructor to provide demonstration & instructions
    [Show full text]
  • A Genome-Scale Antibiotic Screen in Serratia Marcescens Identifies Ydgh As a Conserved Modifier of Cephalosporin and Detergent S
    bioRxiv preprint doi: https://doi.org/10.1101/2021.04.16.440252; this version posted April 17, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 A genome-scale antibiotic screen in Serratia marcescens identifies YdgH as a conserved 2 modifier of cephalosporin and detergent susceptibility 3 Jacob E. Lazarus1,2,3,#, Alyson R. Warr2,3, Kathleen A. Westervelt2,3, David C. Hooper1,2, Matthew 4 K. Waldor2,3,4 5 1 Department of Medicine, Division of Infectious Diseases, Massachusetts General Hospital, Harvard 6 Medical School, Boston, MA, USA 7 2 Department of Microbiology, Harvard Medical School, Boston, MA, USA 8 3 Department of Medicine, Division of Infectious Diseases, Brigham and Women’s Hospital, Harvard 9 Medical School, Boston, MA, USA 10 4 Howard Hughes Medical Institute, Boston, MA, USA 11 * Correspondence to [email protected] 12 13 Running Title: Antibiotic whole-genome screen in Serratia marcescens 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.16.440252; this version posted April 17, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 14 Abstract: 15 Serratia marcescens, a member of the order Enterobacterales, is adept at colonizing healthcare 16 environments and an important cause of invasive infections. Antibiotic resistance is a daunting 17 problem in S. marcescens because in addition to plasmid-mediated mechanisms, most isolates 18 have considerable intrinsic resistance to multiple antibiotic classes.
    [Show full text]
  • Transcription Factor Eepr Is Required for Serratia Marcescens Host Proinflammatory Response by Corneal Epithelial Cells
    antibiotics Article Transcription Factor EepR Is Required for Serratia marcescens Host Proinflammatory Response by Corneal Epithelial Cells Kimberly M. Brothers , Stephen A. K. Harvey and Robert M. Q. Shanks * Charles T. Campbell Ophthalmic Microbiology Laboratory, Department of Ophthalmology, University of Pittsburgh School of Medicine, Pittsburgh, PA 15213, USA; [email protected] (K.M.B.); [email protected] (S.A.K.H.) * Correspondence: [email protected]; Tel.: +1-412-647-3537 Abstract: Relatively little is known about how the corneal epithelium responds to vision-threatening bacteria from the Enterobacterales order. This study investigates the impact of Serratia marcescens on corneal epithelial cell host responses. We also investigate the role of a bacterial transcription factor EepR, which is a positive regulator of S. marcescens secretion of cytotoxic proteases and a hemolytic surfactant. We treated transcriptomic and metabolomic analysis of human corneal limbal epithelial cells with wild-type bacterial secretomes. Our results show increased expression of proinflammatory and lipid signaling molecules, while this is greatly altered in eepR mutant-treated corneal cells. Together, these data support the model that the S. marcescens transcription factor EepR is a key regulator of host-pathogen interactions, and is necessary to induce proinflammatory chemokines, cytokines, and lipids. Keywords: bacterial infection; Serratia marcescens; transcription factor; keratitis; ocular surface; epithelium; cornea; metabolomics Citation: Brothers, K.M.; Harvey, S.A.K.; Shanks, R.M.Q. Transcription Factor EepR Is Required for Serratia marcescens Host Proinflammatory 1. Introduction Response by Corneal Epithelial Cells. The cornea, the transparent, anterior layer of the eye, is essential for vision and pro- Antibiotics 10 2021, , 770.
    [Show full text]
  • Clearance of Gram-Negative Bacterial Pathogens from the Ocular Surface by Predatory Bacteria
    antibiotics Article Clearance of Gram-Negative Bacterial Pathogens from the Ocular Surface by Predatory Bacteria Eric G. Romanowski 1 , Shilpi Gupta 2, Androulla Pericleous 2, Daniel E. Kadouri 2 and Robert M. Q. Shanks 1,* 1 Charles T. Campbell Eye Microbiology Laboratory, Department of Ophthalmology, The Eye and Ear Institute, University of Pittsburgh School of Medicine, 203 Lothrop Street, Room 1020, Pittsburgh, PA 15213, USA; [email protected] 2 Department of Oral Biology, Rutgers School of Dental Medicine, 110 Bergen St, Newark, NJ 07103, USA; [email protected] (S.G.); [email protected] (A.P.); [email protected] (D.E.K.) * Correspondence: [email protected]; Tel.: +1-(412)-647-3537 Abstract: It was previously demonstrated that predatory bacteria are able to efficiently eliminate Gram-negative pathogens including antibiotic-resistant and biofilm-associated bacteria. In this proof-of-concept study we evaluated whether two species of predatory bacteria, Bdellovibrio bacteri- ovorus and Micavibrio aeruginosavorus, were able to alter the survival of Gram-negative pathogens on the ocular surface. Clinical keratitis isolates of Pseudomonas aeruginosa (strain PAC) and Serratia marcescens (strain K904) were applied to the ocular surface of NZW rabbits followed by application of predatory bacteria. At time intervals, surviving pathogenic bacteria were enumerated. In addi- tion, B. bacteriovorus and S. marcescens were applied to porcine organ culture corneas under contact lenses, and the ocular surface was examined by scanning electron microscopy. The ocular surface Citation: Romanowski, E.G.; Gupta, epithelial layer of porcine corneas exposed to S. marcescens, but not B. bacteriovorus was damaged. S.; Pericleous, A.; Kadouri, D.E.; Using this model, neither pathogen could survive on the rabbit ocular surface for longer than 24 h.
    [Show full text]
  • Burkholderia Cepacia Complex 洋蔥伯克氏菌
    1 Burkholderia cepacia complex 洋蔥伯克氏菌 Formerly known as Pseudomonas cepacia A group of closely related Gram-negative, non-lactose fermenting bacteria Found in natural environments including soil, water, plants and animals First Discovered in 1949 as the cause of onion skin rot, first described as a human pathogen in the 1950s Opportunistic human pathogen that most commonly causes pneumonia in immunocompromised patients and patients with cystic fibrosis or chronic granulomatous disease (CGD) Photos from Wikipedia and Applied and Nine genomovars, Burkholderia cenocepacia (genomovar III) Environmental Microbiology Mar 2003, and Burkholderia multivorans (genomovar II) are the most common 69 (3) 1739-1747; causes of B. cepacia colonization and infection in cystic fibrosis patients Naturally resistant to multiple antibiotics including polymixin B and aminoglycoside Burkholderia lata Infections from Intrinsically Contaminated Chlorhexidine Mouthwash, Australia, 2016. 2 Leong LEX, Lagana D, Carter GP, Wang Q, Smith K, Stinear TP, Shaw D, Sintchenko V, Wesselingh SL, Bastian I, Rogers GB. Emerg Infect Dis. 2018 Nov;24(11):2109-2111. doi: 10.3201/eid2411.171929. Outbreak of Burkholderia cepacia pseudobacteraemia caused by intrinsically contaminated commercial 0.5% chlorhexidine solution in neonatal intensive care units. Song JE, Kwak YG, Um TH, Cho CR, Kim S, Park IS, Hwang JH, Kim N, Oh GB. J Hosp Infect. 2018 Mar;98(3):295-299. doi: 10.1016/j.jhin.2017.09.012. Epub 2017 Sep 19. [Implication of a national outbreak of Serratia marcescens associated with a contaminated solution of chlorhexidine in a paediatric hospital]. Morillo Á, Torres MJ, Alonso Salas MT, Conde M, Aznar J. An Pediatr (Barc).
    [Show full text]
  • Microbiologically Contaminated and Over-Preserved Cosmetic Products According Rapex 2008–2014
    cosmetics Article Microbiologically Contaminated and Over-Preserved Cosmetic Products According Rapex 2008–2014 Edlira Neza * and Marisanna Centini Department of Biotechnologies, Chemistry and Pharmacy, University of Siena, Via Aldo Moro 2, Siena 53100, Italy; [email protected] * Correspondence: [email protected]; Tel.: +355-685-038-408 Academic Editors: Lidia Sautebin and Immacolata Caputo Received: 25 December 2015; Accepted: 25 January 2016; Published: 30 January 2016 Abstract: We investigated the Rapid Alert System (RAPEX) database from January 2008 until week 26 of 2014 to give information to consumers about microbiologically contaminated cosmetics and over-preserved cosmetic products. Chemical risk was the leading cause of the recalls (87.47%). Sixty-two cosmetic products (11.76%) were recalled because they were contaminated with pathogenic or potentially pathogenic microorganisms. Pseudomonas aeruginosa was the most frequently found microorganism. Other microorganisms found were: Mesophilic aerobic microorganisms, Staphylococcus aureus, Candida albicans, Enterococcus spp., Enterobacter cloacae, Enterococcus faecium, Enterobacter gergoviae, Rhizobium radiobacter, Burkholderia cepacia, Serratia marcescens, Achromabacter xylosoxidans, Klebsiella oxytoca, Bacillus firmus, Pantoea agglomerans, Pseudomonas putida, Klebsiella pneumoniae and Citrobacter freundii. Nine cosmetic products were recalled because they contained methylisothiazolinone (0.025%–0.36%), benzalkonium chloride (1%), triclosan (0.4%) in concentrations higher than the limits allowed by European Regulation 1223/2009. Fifteen products were recalled for the presence of methyldibromo glutaronitrile, a preservative banned for use in cosmetics. Thirty-two hair treatment products were recalled because they contained high concentrations of formaldehyde (0.3%–25%). Keywords: microbiologically contaminated; over-preserved cosmetics; formaldehyde; RAPEX 1. Introduction The European Commission (EC) has an early warning system for safety management called the Rapid Alert System (RAPEX).
    [Show full text]
  • Carbapenem-Resistant Enterobacteriaceae a Microbiological Overview of (CRE) Carbapenem-Resistant Enterobacteriaceae
    PREVENTION IN ACTION MY bugaboo Carbapenem-resistant Enterobacteriaceae A microbiological overview of (CRE) carbapenem-resistant Enterobacteriaceae. by Irena KennelEy, PhD, aPRN-BC, CIC This agar culture plate grew colonies of Enterobacter cloacae that were both characteristically rough and smooth in appearance. PHOTO COURTESY of CDC. GREETINGS, FELLOW INFECTION PREVENTIONISTS! THE SCIENCE OF infectious diseases involves hundreds of bac- (the “bug parade”). Too much information makes it difficult to teria, viruses, fungi, and protozoa. The amount of information tease out what is important and directly applicable to practice. available about microbial organisms poses a special problem This quarter’s My Bugaboo column will feature details on the CRE to infection preventionists. Obviously, the impact of microbial family of bacteria. The intention is to convey succinct information disease cannot be overstated. Traditionally the teaching of to busy infection preventionists for common etiologic agents of microbiology has been based mostly on memorization of facts healthcare-associated infections. 30 | SUMMER 2013 | Prevention MULTIDRUG-resistant GRAM-NEGative ROD ALert: After initial outbreaks in the northeastern U.S., CRE bacteria have THE CDC SAYS WE MUST ACT NOW! emerged in multiple species of Gram-negative rods worldwide. They Carbapenem-resistant Enterobacteriaceae (CRE) infections come have created significant clinical challenges for clinicians because they from bacteria normally found in a healthy person’s digestive tract. are not consistently identified by routine screening methods and are CRE bacteria have been associated with the use of medical devices highly drug-resistant, resulting in delays in effective treatment and a such as: intravenous catheters, ventilators, urinary catheters, and high rate of clinical failures.
    [Show full text]
  • Description of Two Serratia Marcescens Associated Mastitis Outbreaks in Finnish Dairy Farms and a Review of Literature
    Friman et al. Acta Vet Scand (2019) 61:54 https://doi.org/10.1186/s13028-019-0488-7 Acta Veterinaria Scandinavica RESEARCH Open Access Description of two Serratia marcescens associated mastitis outbreaks in Finnish dairy farms and a review of literature Mari Johanna Friman1* , Marjut Hannele Eklund2, Anna Helena Pitkälä2, Päivi Johanna Rajala‑Schultz1 and Merja Hilma Johanna Rantala2 Abstract Background: Infection with Serratia spp. have been associated with mastitis outbreaks in dairy cattle herds. Environ‑ mental contamination or a point source, like a teat dip product, have often been observed to be potential sources of such outbreaks. We describe two Serratia marcescens associated mastitis outbreaks associated with a contaminated teat dip containing a tertiary alkyl amine, n,n‑bis (3‑aminopropyl) dodecylamine in two dairy cattle farms in Finland. S. marcescens strains isolated from milk and environmental samples were identifed by the MALDI‑TOF method. Results: Six specimens (n 19) on Herd 1 and all specimens (n 9) on Herd 2 were positive for S. marcescens. Positive specimens were from mastitis= milk and teat dip liquid and equipment.= Bacteria were not isolated from the unopened teat dip canister. The same clone of S. marcescens was isolated from milk samples and teat dip samples within the farms. Pulsed feld gel electrophoresis results to the S. marcescens isolates from these two diferent herds were tested with unweighted pair‑group method using arithmetic average clustering analysis. The isolates were not same clone in both herds, because similarity in that test was only 75% when cut‑of value to similarity is 85%. Conclusions: Our investigation showed that the post milking teat dip and/or temporary containers were contami‑ nated with S.
    [Show full text]
  • The Enterobacteriaceae
    Serratia Serratia marcescens • Gram negative rod • Enterobacteriaceae • Found in various ecological niches soil water plants animals • Survives under extreme conditions disinfectants and antiseptics distilled water salt water • Produces characteristic red pigment, prodigiosin Serratia sp. • water & soil • Serratia marcescens – produces a red pigment, prodigiosin; causes pneumonia, burn & wound infections, septicemia & meningitis • Serratia marcescens – nosocomial surgical wound infections, UTI, RTI, septicemia Serratia -Common opportunistic pathogen in hospital pts. -Cause pneumonia, bacterimia, endocarditis. -Often resist to aminoglycosides and penicillin. -Treatment-Third generation Cephalosporines. Seratia • The main risk factor for Serratia sepsis/bacteremia is hospitalization • Known to cause bacteremia, UTI, respiratory tract infection, meningitis, endocarditis, osteomyelitis, cutaneous infections, and ocular infections. • Serratia infections should be treated with an aminoglycoside plus an antipseudomonal beta- lactam. Most strains are susceptible to amikacin. Reports indicate increasing resistance to gentamicin and tobramycin. Quinolones also are highly active against most strains. • Definitive therapy should be based on the results of susceptibility testing because multiresistant strains are common Serratia marcescens Infection Issues • Transmission on hands of staff most important mode of spread • Occasional focal environmental source • Infection usually occurs in compromised patients: • Pneumonia in ventilated patients • UTI
    [Show full text]