UNDERSTANDING THE STATUS, AUTECOLOGY AND TAXONOMY OF UK BIODIVERSITY ACTION PLAN SPECIES: ARABLE BRYOPHYTES

FINAL REPORT

MARCH 2012

Simon Conyers Christine Conyers Ruth Laybourn

Food and Environment Research Agency Sand Hutton, York, YO41 1LZ

Contents

1. Introduction ...... 4 2. Methods ...... 5 2.1 Field survey ...... 5 2.1.1 Weissia squarrosa ...... 5 2.1.2 Weissia multicapsularis ...... 7 2.2 pH and texture of soil ...... 8 2.3 Genetic studies ...... 8 2.3.1 Sampling of Weissia species for genetic testing ...... 8 2.3.2 Molecular analysis ...... 8 2.4 Spore germination studies ...... 9 2.4.1 Germination from sporophyte collections ...... 9 2.4.2 Germination from Soil Samples ...... 11 3. Results ...... 11 3.1 Field assessments ...... 11 3.1.1 Weissia squarrosa ...... 11 3.1.2 Weissia multicapsularis ...... 17 3.2 Genetic studies ...... 17 3.2.1 nrITS ...... 17 3.2.2 trnL-trnF, rbcL, and trnH-psbA ...... 20 3.3 Spore germination studies ...... 23 3.3.1 Effect of pH ...... 23 3.3.2 Effect of Fertilisers ...... 23 3.3.3 Germination from Soil Samples ...... 28 4. Discussion ...... 28 5. Further Research ...... 33 Appendix 1. Personnel ...... 37 Appendix 2. Sequences of primers ...... 39 Appendix 3. Bryophytes recorded during survey of over-wintered stubble fields in Lincolnshire and Gloucestershire ...... 40 Appendix 4. Results of genetic studies with nrITS region ...... 47 Appendix 5. Initial samples of Weissia for genetic testing: their location, collection date, verifier, GenBank® result using nrITS region and groupings from trnL-trnF and rbcL ...... 52 Appendix 6. Samples of Weissia from trnL-trnF analysis: their location, collection date, verifier and sample code ...... 55 Appendix 7. Location of soil sample, their number and results of germination and subsequent growth at 20oC and 60 r.h...... 60 Appendix 8: Text for advisory leaflet for the conservation of arable mosses ...... 61 Appendix 9. Dissemination of results ...... 62

2

List of Tables

Table 1 Results of field surveys of Staffordshire, Gloucestershire and Worcestershire ...... 13 Table 2 Results of field surveys of Surrey and Sussex ...... 14 Table 3 Results of over-wintered stubble field surveys of Lincolnshire ...... 15 Table 4 Results of over-wintered stubble field surveys of Gloucestershire ...... 16 Table 5 Results of soil sampling at sites for W. multicapsularis ...... 17 Table 6 Species comparisons of nrITS sequences - Number of basepair differences (number of gaps in sequence) ...... 18 Table 7 Initial samples of Weissia for genetic testing: their location, GenBank® comparisons using nrITS results and the species groupings from trnL-trnF and rbcL sequences ...... 19 Table 8 Results of trnL-trnF sequence analysis for Weissia species: Number of basepair differences (number of gaps in sequence) ...... 21 Table 9 Results of rbcL sequence analysis: Number of basepair differences ...... 22 Table 10 Location of soil sample, their number and number of leafy growths produced ...... 27 Table 11 Example of the results of microsatellite analysis ...... 33

List of Figures

Figure 1 Effect of pH on the germination of the spores of Weissia multicapsularis: average number (with SEMs) of protonemata and leafy growths produced after 11 month's growth at 20oC ...... 24 Figure 2 Effect of pH on the germination of the spores of Weissia squarrosa: average number (with SEMs) of protonemata and leafy growths produced after 11 month's growth at 20oC ...... 24 Figure 3 Effect of Ammonium nitrate on the germination of the spores of Weissia multicapsularis: average number (with SEMs) of protonemata and leafy growths produced after 8 month's growth at 20oC ...... 25 Figure 4 Effect of Ammonium nitrate on the germination of the spores of Weissia squarrosa: average number (with SEMs) of protonemata and leafy growths produced after 8 month's growth at 20oC ...... 25 Figure 5 Effect of Sodium phosphate on the germination of the spores of Weissia multicapsularis: average number (with SEMs) of leafy growths produced after 8 month's growth at 20oC ...... 26 Figure 6 Effect of Sodium phosphate on the germination of the spores of Weissia squarrosa: average number (with SEMs) of protonemata and leafy growths produced after 8 month's growth at 20oC ...... 26

3

1. INTRODUCTION

The UK Biodiversity Action Plan (UK BAP), published in 1994, described the UK’s biological resources and presented a detailed plan for the protection and sustainable use of these resources. It contained objectives for conserving and enhancing species and habitats as well as promoting public awareness. In 2007 as part of the BAP review process, the UK Biodiversity Reporting and Information Group (BRIG) updated the UK BAP species and habitats, highlighting the priorities for conservation action. A UK list of priority species and habitats was published together with ‘signposts’ and subsequent actions for each of the 1150 UK BAP species (Peak Ecology Ltd, 2009).

Bryophytes were an important part of this conservation list. They are also an important constituent of arable plant communities and at least 17 liverworts and hornworts and 73 mosses have been recorded on arable land (Porley, 2000). Arable land is a transient habitat subject to regular disturbance due to cultivation. Arable bryophytes have compressed life cycles that are adapted to growth within this ephemeral environment. Some species also produce vegetative propagules such as tubers, bulbils or gemmae, which also allow bryophytes to persist through stressful periods such as seasonal drought and ploughing (Porley, 2008).

Two species of arable mosses, Weissia squarrosa (Nees & Hornsch.) Mull.Hal. (Spreading-leaved beardless-moss) and Weissia multicapsularis (Sm.) Mitt. (Many-fruited beardless-moss), both with BAP status, were selected for immediate action in the signposting exercise (Peak Ecology Ltd, 2009). Both would also benefit from the Habitat Action Plan (HAP) for Arable Field Margins, which is considered a priority habitat. These two species grow through vegetative clonal expansion and, unusually for bryophytes in this environment; they are perennial in growth strategy. They require bare soil for germination and a stable environment for two to three years to reach sexual maturity and spore production, their means of survival through cultivation. Both also closely resemble other species within the same genus, making positive identification difficult, even for taxonomic experts.

Weissia is a genus of small plants frequently with much branched stems up to 15 mm in length (Smith, 2004). They are generally species of open, nutrient-poor, stable habitats where competition from higher plants is minimal. Eleven species are recorded from Britain and they are divided into three sections. Section 1 (Weissia) contains W. controversa, W. perssonii, and W. rutilans; Section 2 (Hymenostomum) W. condensa, W. brachycarpa, and W. squarrosa; and Section 3 (Astomum) W. rostellata, W. multicapsularis, W. sterilis, W. levieri and W. longifolia (Smith, 2004). However a molecular phylogeny study of their subfamily Trichostomoidea (Pottiaceae, Bryophyta) showed that Section 2 may not be justified and that W. squarrosa was more closely related to the species in Section 1 (Werner et al., 2005). This project was concerned with W. squarrosa and W. multicapsularis, which are found in the arable environment along with other members of the genus W. brachycarpa and W. longifolia, morphologically similar to the respective target species. Therefore genetic studies were important to confirm the identification of field collections.

W. squarrosa is one of the most threatened members of its genus (Church et al., 1991), and assessed by IUCN criteria as Endangered in Britain. It had not been recorded in Britain for ten years prior to a Survey of Bryophytes of Arable Land (2004-5) (SBAL) organised by the British Bryological Society (BBS), when it was rediscovered and 14 sites have now been recorded since 1990. The information collected during the survey and other long-term studies of populations has led to a detailed review of W. squarrosa (Bosanquet and Preston, 2005). Almost all the recently-discovered colonies of W. squarrosa have been in arable stubble fields on acidic clay soils. It has been found over a wide area of central England from Staffordshire to Berkshire. Surveys for W. squarrosa were done on farms with agri-environment stubble options on suitable soil types in areas where there had been previous records of this species.

W. multicapsularis is endemic in Western Europe and is a very rare and globally threatened species (Holyoak, 1999). It has only ever been reported from about 22 locations with all but two of these in southern England (Holyoak, 2004). It has now gone extinct at the other single sites in south Wales and western France. A comprehensive search was made during 1998-9 at all localities where it had been recorded between 1962 - 80. This resulted in its rediscovery at only three small coastal localities, on hedgebanks amongst adjoining arable fields, on low steep banks in a pasture and 4 coastal grassland, all in Cornwall (Holyoak, 2004). It is classed as Endangered (Church et al., 2001), however all available information would indicate that it is Critically Endangered. Its decline has been due to loss of habitat through absence of grazing on coastal grass-arable rotations, the increasing use of fertilisers and annual rather than biennial ploughing which militate against species with extended life cycles (Porley, 2008). Material for potential reintroductions is kept in an ex situ cryopreservation facility at the Royal Botanic Gardens, Kew. Surveys for this species were carried out at the known locations and at a few historic sites that were also in Cornwall.

Objectives of study 1. In collaboration with the British Bryological Society (BBS), to survey parts of the historic range of W. squarrosa, a Nationally Scarce species and a Biodiversity Action Plan (BAP) moss, to determine the current distribution of this species within the arable environment.

2. In collaboration with the BBS, to collect soil, habitat and management data for autecological studies from any positive historic sites and from a selection of sites found during the previous Survey of Bryophytes of Arable Land (SBAL) by the BBS.

3. Using the expertise of the BBS, visit the sites of W. multicapsularis, both known and historic, to collect basic data on the soils including pH, texture, and nutrient status. This quantitative information is currently lacking and will support future efforts on reintroductions by helping to identify suitable locations.

4. To undertake taxonomic studies of species of the Weissia genus using samples collected during 1 and 2 above to elucidate the relationship of W. multicapsularis, W. squarrosa and other species within the genus that are found in the arable environment.

5. To consider options within the Environmental Stewardship scheme and to suggest appropriate management for arable land, which would benefit W. multicapsularis, W. squarrosa and other bryophytes found in this environment.

2. METHODS

2.1 FIELD SURVEY

2.1.1 Weissia squarrosa

A survey of possible sites with relevant agri-environment scheme options within the known and historic range of W. squarrosa was done. Overwintered stubble options were targeted as this is a species that prefers fallow land in the first years of vegetation succession. Options surveyed were:

Environmental Stewardship (ES) EF6 - Earliest return to production (ERP) 15th February

and from 2011 EF15 & EG4 - ERP 15th February

EF22 - ERP 1st August

Countryside Stewardship (CSS) OS1 followed by spring crop – ERP 15th February

OS2 followed by low input spring cereal ERP 14th February

OS3 followed by spring/summer fallow – ERP 1st August

Cotswold Hills Environmentally Sensitive Areas (ESA) overwintered stubbles – ERP 1st March

For each field surveyed, a transect was recorded with a 0.25 m2 quadrat assessment every 10 m. A record was made of the target species as well as bryophyte cover together with higher plant species 5 present and their cover. This was followed by a systematic search of the rest of the field and the field edge.

During the field surveys in 2010 of Staffordshire, Worcestershire, Surrey and Sussex records were made of Anthoceros, Entosthodon, Fossombronia, Phaeoceros and Riccia. These are less common bryophytes that are found in similar conditions to W. squarrosa. The 2011 surveys in Lincolnshire and Gloucestershire recorded all bryophyte species found in fields where possible target species occurred, in order to compare communities with those recorded in Preston et al. (2010).

2.1.1.1 Site selection

Bosanquet and Preston (2005) and the NBN Gateway provided the grid references for locations where W. squarrosa had been found most recently. Contact details of farms with appropriate options in the areas around these locations were supplied by Natural England (NE). The farms with the appropriate options were then compared to the distribution of suitable soil types on Soilscapes (2010), an interactive website showing the broad regional differences in the soil landscapes of England and Wales. A letter was sent to all the farms a few weeks in advance providing information on the survey, the options, and suitable soil types. It also included a request to carry out a survey and indicated that they would be contacted by phone to arrange a visit. Ten farms per area were contacted in Staffordshire, Worcestershire, Surrey and Sussex in 2010, and 37 farms in Lincolnshire and 29 in Gloucestershire in 2011. The candidates with the largest area of stubble in each area were then contacted by telephone to ask for permission to survey their fields.

Prior to the selection of survey sites for 2011, Vice County recorders from the BBS with previous NBN records for the species were contacted to see if there were any new records or any suggestions for areas to survey. The recorders in Berkshire, Cambridgeshire, Gloucestershire, Shropshire, Staffordshire, Lincolnshire, and Worcestershire were contacted but they did not report any new records. However, this process did establish contact with R. V. Lansdown, co-recorder for Gloucestershire who had recorded most of the finds for W. squarrosa in the county, who was interested in assisting with the project. Staffordshire

The area was chosen due to a record (SJ835130) from 11/2004 (Bosanquet and Preston, 2005). This location was from an area of naturally wet, acid loamy soils. An area within Moreton (SJ7917), Mitton (SJ8815), Bishop's Wood (SJ8309) and Brewood (SJ8808) was selected for sampling.

Worcestershire

The area was chosen due to two records (SO937538 and SO942404) from 04/2004 (Bosanquet and Preston, 2005). An area between Bredicot (SO9054), North Piddle (SO9654), Bishampton (SO9851) and Broughton (SO9248) was used for the first record. An area between Eckington(SO9241), Bricklehampton (SO9842), Bredon (SO9236) and Ashton under Hill (SO9933) was selected for the second record. Lime-rich loamy and clayey soils predominated but pockets of slightly acid loamy and clayey soils with impeded drainage were also present. Surrey and Sussex

The farms were surveyed in mid-March 2010. By this time all the EF3 options had been ploughed and therefore all farms visited were those in CSS with option OS3.

In Surrey, an area between Cranleigh (TQ0638) and Dunsfold (TQ0036), also around Chobham (SU9761), and between Compton (SU9547), Shalford (TQ0047), Chilworth (TQ0247) was selected on soil type alone as there are no recent records of W. squarrosa in Surrey. These are areas of acid loamy soils with naturally high groundwater tables.

In Sussex, an area within Crawley (TQ2736), East Grinstead (TQ4238), Uckfield (TQ4721), Lewes (TQ4109), and Bolney (TQ2622) where slightly acid loamy and clayey soils with impeded drainage predominate was chosen. This area was selected on soil type alone as the only records for W. squarrosa date back to the 1900s. The BAP species coordinator for the local NE team confirmed that

6 there were no outstanding records for the species in Sussex and it was classified as extinct in the county.

Lincolnshire

Farms were selected from post codes NG31, NG33, NG34 and PE10. The area was chosen due to the most recent record for this species on the NBN, from Old Somerby, Grantham (SK952328) from 02/03/2008 (NBN Gateway, 2010). This location was from a suitable soil type, slowly permeable, seasonally wet, slightly acid but base-rich loamy and clayey soil. The average area of over-wintered stubble per farm in the sample was 10.58 ha (Range 1.5 - 43 ha). Of these, 25 were in CSS (23 with OS3), with the remainder in ES (three in HLS). Gloucestershire

Farms were selected from within the post code areas GL8, GL7, GL54 and GL55. These localities were chosen due to several records from three different areas: 1) Tetbury, Stroud (ST863966); 2) Barnsley Wold, Cirencester (SP046058, SP045056), Sapperton, Cirencester (SO946023, SO943023); and 3) Aston Magna, Moreton-in-Marsh (SP188359, SP188358).

Areas 1) and 2) were predominantly shallow lime-rich soils, which were unsuitable. Within this were small patches of lime-rich loamy and clayey soils with impeded drainage which did also have some acid clay where W. squarrosa had been recorded. Area 3) was more suitable as it was predominantly slowly permeable seasonally wet, slightly acid but base-rich loamy and clayey soils, together with slightly acid loamy and clayey soils with impeded drainage.

The average area of over-wintered stubble per farm in the sample was 29.53 ha (range 2 - 90 ha). Of these, six were in CSS (One with OS3) and one also in the Cotswold Hills ESA, with the remainder in ES (two in HLS).

2.1.2 Weissia multicapsularis

Two visits to Cornwall were made to collect plant material for genetic studies and sporophytes for germination studies of W. multicapsularis and to gather information on the species autecology through soil samples. The initial visit was hosted by NE Cornwall, Devon and Isles of Scilly Team.

2.1.2.1 Surveys of existing sites

The species is found at only two sites in Cornwall, both of which are SSSIs; Carricknath Point to Porthbean Beach and Talland Barton Farm. To clarify the genetic status of the species, bryophyte material was collected, along with some sporophytes for spore germination studies from one of the sites, together with soil samples for autecology from both sites.

Ten soil samples (2.5 cm diameter x 6 cm depth) were collected and bulked from areas adjacent to W. multicapsularis. A further ten samples (2.5 cm diameter x 6 cm depth) were taken from other areas of the field to see if there was any differences in pH or texture from the W. multicapsularis sites.

The first visit was made in late March/early April 2010, to ensure that mature sporophytes were present to aid identification and allow collection. The purpose of the second visit to Cornwall in mid April 2011 was to collect plant material for genetic studies from Pentire Point East if the population was still present and in a sustainable state. It was also an opportunity to gather further information on the status of the species at the two SSSI sites.

2.1.2.2 Surveys of historic sites

Three historic sites were visited 30-31/03/2010, to try and rediscover the species and thereby increase the knowledge of its habitat requirement: Pentire Point East (SW7861, last record 2003); Lizard (SW7113, last record 1992); Wadebridge (SW9971, last record 1992).

7

2.2 pH AND TEXTURE OF SOIL

A soil sample of 500 g was taken from each field that was surveyed for bryophytes. These were stored in the dark at 4oC, the optimum conditions suggested for long term storage to maintain their stability.

For pH testing the procedure outlined in a publication from the BBS, ‘Soil pH measurement for the Bryophyte Habitats Survey’ (http://rbg-web2.rbge.org.uk/bbs/Activities/brecog/brecog.html) was followed. A 1:1 soil/solution ratio was used that was 15 g of soil to 15 ml of dilute 0.01 M CaCl2 solution. The use of CaCl2 solution has been recommended as a more appropriate medium for measurements of soil solution in fertilised temperate soils (Schofield and Taylor, 1955). It also gives a more stable reading over a wide range of soil/liquid ratio that was important for the small soil samples from Cornwall. However over a wide soil pH range its results are approximately 0.8 pH units lower than for deionised water (Emmett et al., 2008).

The soil and solution were placed in a plastic beaker, stirred for 15 seconds and then let stand for 30 minutes. pH readings were taken with a portable pH and temperature tester (Model HI 98127 (Hanna instruments, Woonsocket, RI, USA) which was calibrated with pH 4.01 (HI 70004 (Hanna instruments) and 7.01 (HI 70007 (Hanna instruments) buffer solutions. These were used at regular intervals throughout the testing of the soil samples to ensure the experimental readings were accurate.

The technique used for soil texture was the ‘Guide to Texture by Feel’ used by the USDA, modified from Thien (1979). Approximately 25 g of moistened soil was taken from each collected sample and a characterisation flow chart was followed with hand assessment throughout.

2.3 GENETIC STUDIES

2.3.1 Sampling of Weissia species for genetic testing

During all the field surveys, samples of any Weissia species present were collected to assist with species identification and comparison. Additional collections by Mr Bosanquet and a few subsamples from Dr Holyoak’s own herbarium have been analysed.

In 2011, W. condensa and W. sterilis, both BAP species, were also targeted for collection. Both species are difficult to separate from morphologically similar species except when mature sporophytes are present. The sporophytes begin to develop with the onset of winter and are frequent to common on both species in winter (Smith, 2004). Both species had been recorded in Gloucestershire and the objective was to collect these species from this area in mid February. A survey was done at Haresfield Beacon (SO8108, SO8208) and Painswick Beacon (SO8712, SO8612), with the help of Mr. R. V. Lansdown, who had submitted previous Gloucestershire records for these species to the NBN.

2.3.2 Molecular analysis

The molecular biological approach to differentiation of Weissia species was done initially using the nrITS (internal transcribed spacer) region that refers to non-functional RNA situated between structural ribosomal RNAs. This was done using the sequence data techniques of Werner et al. (2005) (Appendix 2). They used these methods to investigate the molecular phylogeny of Trichostomoideae (Pottiaceae, Bryophyta) that includes the genus Weissia. To increase the discrimination between species further, three other regions were also investigated:

1) trnL-trnF (Appendix 2), an intergenic spacer of the chloroplast DNA, proposed by Taberlet et al. (2007) as a universal barcoding region for plants, by Liu et al. 2010 for bryophytes, and was used by Rowntree et al. (2010) to separate the species within the bryophyte genus Orthodontium. There are also two sequences for W. controversa on GenBank® (Grundmann et al., 2006), and the primer sequences were readily available;

8

2) rbcL (Appendix 2), a plastid gene, is the region endorsed by the CBOL Plant Working Group (2009), Hollingsworth et al. (2009) and Newmaster et al. (2006), and there are two sequences for W. controversa on GenBank® (Grundmann et al., 2006);

3) trnH-psbA (Appendix 2), an intergenic spacer, gave good results for Liu et al. (2010) when separating bryophyte species and for Hollingsworth et al. (2009) for plants, and its primers are readily available.

DNA from bryophyte material was extracted using a standard DNA extraction kit, Qiagen DNeasy Plant Mini kit, following the manufacturer’s protocol, and which isolates 3 – 30 μg DNA from 100 mg wet weight of tissue. The combined length of the nrITS (18S ITS1 - 5.8S rRNA – ITS2) region (approximately 700 basepairs (bp)) was amplified using a polymerase chain reaction (PCR) and conserved primers 18S (Spagnuolo et al., 1999) and ITS4 (White et al., 1990), as described in Werner et al., (2005). The trnL-trnF region (approximately 500bp) was amplified using primers described in Taberlet et al., (1991). The rbcL and trnH-psbA regions (approximately 650bp) were amplified using primers described in Kress and Erickson (2007). PCR reactions comprised 3µl DNA template, 8.5μl water, and 12.5 μl JumpStart REDTaq ReadyMix reaction mix (Sigma-Aldrich Co., St. Louis, MO, USA) resulting in final concentrations of components as follows: 10mM Tris-HCl, pH 8.3; 50mM KCl; 2mM MgCl2; 0.001% gelatin; 0.2mM each dNTP (dATP, dCTP, dGTP, dTTP); 0.75 U Taq DNA polymerase; 4μM each primer in 25µl reactions. PCRs were performed on a Hybaid Multiblock thermocycler system with the following temperature programme for the nrITS region: 94°C for 2 min followed by 40 cycles of 94°C for 1 min, 50°C for 1 min, 72°C for 1 min with a final step of 72°C for 10 min and hold at 4°C. For the trnL-trnF, rbcL, and trnH-psbA regions, the thermocycler temperature programme was adjusted to 35°C, and annealing was at 55°C.

PCR products were visualised following electrophoresis through 1% agarose gels and ethidium bromide staining. These products were excised from the gel and the DNA eluted using a QIAquick® gel extraction kit (Qiagen Inc., Valencia, CA, USA) following the manufacturer’s protocol. PCR products were sequenced in both forward and reverse directions using BigDye dye-terminator (v3.1) chemistry (Applied Biosystems, Foster City, CA, USA) following the manufacturer’s protocol and the primers used to generate the PCR product. Sequencing reactions were electrophoresed through POP-7 polymer in a 36cm 16-capillary array mounted on an ABI Prism 3130xl genetic analyser (Applied Biosystems) and results captured using the data collection software. Sequences were base- called using Sequence Analysis software v5.2 (Applied Biosystems). Sequences generated using reverse primers were reverse complemented using EditSeq software (DNAstar Inc., Madison, WI, USA). These were used in conjunction with forward sequences to build contiguous sequences (contigs) for each primer pair and each sample. Contigs were aligned for sequence comparison using SeqMan and/or MegAlign software using a ClustalX algorithm (DNAstar). They were used to search GenBank®, the National Center for Biotechnology Information (USA) genetic sequence database, using the NCBI BLAST facility (http://blast.ncbi.nih.gov/Blast.cgi) for comparative sequences from previously mapped species. For nrITS 33 samples that included eight species of Weissia were sequenced. For the trnL-trnF, rbcL, and trnH-psbA regions, initially only 12 samples were used with representatives from five possible Weissia species to assess which region provided the best separation of the species. This was then extended to a further 45 samples with trnL-trnF when this was recognised as the best molecular marker to use.

2.4 SPORE GERMINATION STUDIES

2.4.1 Germination from sporophyte collections

Spore germination studies were all done in petri dishes (55 mm x 12 mm) using a Knops-based media (Sigma-Aldrich, Co., St. Louis, MO, USA) (Murashige and Skoog, 1962; Duckett, 1970). This contains a range of inorganic salts that are beneficial for germination in bryophytes (Duckett et al., 2004). This media was solidified with a gelling agent, gellan gum (Gelzan™ CM (Sigma-Aldrich Co., St. Louis, MO, USA)) which is better for germination of extreme calcifuge taxa than commercial agars (Duckett et al., 2004). This mixture was autoclaved to 121oC for 15 min to produce a sterile media. Each Petri dish was filled with 10 ml of media. The media consisted of 1.1 g Murashige and Skoog

9 media/l with 6 g/l Gelzan™ to solidify and 0.5 g of calcium chloride/l was required to promote the solidifying process, especially at the lower pH levels.

To ensure sterile propagules, all work with the spores was done under sterile air on a laminar flow bench. W. squarrosa and W. multicapsularis were assessed separately. Whole sporophytes were immersed in 1% Dichloroisocyanuric acid (DCC) (Sigma-Aldrich Co., St. Louis, MO, USA) for 5 min to achieve surface sterilisation and agitated (Rowntree and Ramsay, 2005). Then they were washed twice in sterile deionised water and dried. The sporophytes of each species, three for W. squarrosa and four for W. multicapsularis, were then fragmented on a microscope slide in 2 µl of deionised water and this was put into 500 µl of deionised water in a microfuge tube. A count of the number of spores/µl was assessed with a Fast-Read 102™ counting chamber (Immune Systems Ltd., Paignton, Devon UK), with 5 and 4 for W. squarrosa and W. multicapsularis respectively. This would give 150 and 120 spores per petri dish respectively for each species. After vorticing of the microfuge tube, 30 µl of the spore suspension was applied to the surface of the media and distributed evenly. The petri dishes were then sealed with Parafilm® to prevent desiccation during germination. These were placed in an Environmental Test Chamber at 20oC and 70% r.h. with a 16 h light/8 h dark lighting regime. 2.4.1.1 Effect of pH pH is one of the environmental factors that may limit the potential habitat available to that species. Some species are much more tolerant of this factor than others and this is often connected with the specialised nature of the species ecology. The requirement for an acid soil will always be a factor that would limit habitat availability in the arable environment as farmers are always aiming for a neutral soil through the addition of lime that is the optimum for crop growth.

The spores of each species were germinated against a range of pH: 4, 5, 6, 7 and 8. The pH of the media was adjusted to the target using HCl and NaOH. The five replicates for each species/pH combination were assessed after 11 months of growth for the number of protonemata and the number of leafy growths that had developed from these. 2.4.1.2 Effect of Fertilisers

Nitrate and phosphate are important fertilisers used by arable farmers, the former added annually with the latter every four or five years, to ensure a good yield. They are also nutrients which are found at low levels in semi-natural environments. Therefore it is very likely that they are affecting the survival of the target species either directly by limiting germination or indirectly through competition from species that are able to take advantage of the conditions.

Nitrate

Ammonium nitrate (NH4NO3) is the main compound used in these applications, with 100 kg giving 34.5 kg of N. Recommended annual average application rates for wheat are 180 kg N/ha, with 40% mid-March and 60% in April. It has been shown that bryophytes are capable of absorbing N from soil and wet deposition-derived nitrogen (Ayres et al., 2006).

To test the effect of nitrogen on the germination of the spores of the two species 25, 50, 100 and 200 mg/l of NH4NO3 were added to the media and adjusted to pH 5.8, the optimum pH for W. multicapsularis. 200 mg /l is equivalent to 70 mg N/l which is the upper limit of the ideal N range in an arable field. There were five replicates for each species at each N concentration. Five extra dishes for each species containing the media at pH 5.8 without added fertiliser acted as a control for both nitrate and phosphate. The sporophytes were prepared as for the pH experiments. A count of the number of spores/µl was assessed, with five counted for both species. This would give 150 spores per petri dish for both species. The sterilised spores were spread on the media, and the petri dishes were sealed with Parafilm®. The dishes were then placed in the same cabinet with the same conditions as for the pH tests. They were assessed after 8 months of growth as for pH.

Phosphate

10

Phosphorus is often scarce in natural ecosystems or else present in unavailable forma within organic matter (Bates, 2008). A significant negative relationship between total bryophyte species richness and phosphate concentrations has been found in specialist environments and most rare species were restricted to or most frequent in areas with low phosphate availability (Tyler, 2005).

To test the effect of phosphate on the germination of the spores of the two species, 12, 25, 50, and 100 mg/l sodium phosphate (NaH2PO4), were added to the media, adjusted to pH 5.8, the optimum pH for W. multicapsularis. 100 mg /l is equivalent to 24 mg P/l which is the upper limit of the ideal P range in an arable field. The rest of the procedure for testing was the same as for nitrate and pH.

2.4.2 Germination from Soil Samples

Samples were stored in the dark at 4oC, the optimum conditions suggested for long term storage of spores to maintain their viability. They were collected from the farms where possible W. squarrosa was found and at the sites for W. multicapsularis. Samples were taken from one farm (six samples) in Staffordshire and four (11 samples) from Surrey and Sussex. They were used to determine if any spores of the target species were present. Samples were taken with a 25 mm diameter cork borer to 60 mm depth. They were divided in half lengthways and then in half crossways. This gave a measure of the effect of depth on the presence of spores. Each sub-section of soil sample for the germination studies was spread over the bottom of a petri dish (55 mm x 12 mm) to a depth of 10 mm. The samples were moistened with deionised water and the petri dishes were sealed with Parafilm®. The dishes were then placed in the same conditions as for the pH germination tests. They were assessed after ten months of growth as for pH.

3. RESULTS

3.1 FIELD ASSESSMENTS

3.1.1 Weissia squarrosa

3.1.1.1 Staffordshire

Four farms were surveyed and the results of the survey are shown in Table 1. The pH of the fields and the soil texture were suitable (Table 1) but no Weissia spp. were found, although one field on Farm 3 was cultivated using minimum tillage, which was combined with the use of a graminicide and this field had a high cover of bryophytes (12%).

3.1.1.2 Gloucestershire and Worcestershire

Three farms were surveyed and the results of the surveys are shown in Table 1. The two farms from Worcestershire were suitable and each had a field with high mean cover of bryophytes (30.7 and 22.5%), but no Weissia spp. were found.

3.1.1.3 Surrey and Sussex

Three farms in Surrey and five in Sussex were surveyed (Table 2). All had suitable pH and soil except Farm 5. A probable W. squarrosa that could not be definitively identified morphologically as it was a small plant with few immature sporophytes, was collected from one field of Farm 1 (Surrey) and from three locations in a field of Farm 6 (Sussex). Unfortunately the fields of Farm 8 had been tined so deeply with soil inversion that it was not possible to complete a full assessment.

3.1.1.4 Lincolnshire

Nine farms were visited and a total of 15 fields were surveyed (Table 3). All the fields surveyed had pH in the ideal growth range for W. squarrosa and all were heavy soil, though some did have ‘brash’ (limestone fragments), such as field 1 on Farm 8. W. longifolia was found on Farms 4, 5, 7, 8 and 9. 11

W. brachycarpa was found on Farms 5 and 7. Both these samples were included in the DNA studies as well as some of the W. longifolia samples. The associated bryophyte population for Field 3, Farm 7 had seven other species (Appendix 3) and these were largely common generalist species. This field, an 18-month fallow, had only 26% mean higher plant cover and around 50% mean bare ground.

3.1.1.5 Gloucestershire

Table 4 shows the results of the surveys in Gloucestershire. Six farms were visited and a total of 16 fields were surveyed. All farms except Farm 1 had pH in the ideal growth range for W. squarrosa and heavy soil, though all had some degree of ‘brash’ present. The associated bryophyte populations were recorded (Appendix 3) and their records have been submitted to the NBN gateway via the BBS. Field 1, Farm 5 had the highest bryophyte diversity, and number and size of bryophytes. This may be due to its 18 month fallow. It had started in September 2009, followed by glyphosate application and light cultivation in May 2010. This regime had resulted in 13.1% mean bryophyte cover, the highest in the Gloucestershire survey.

12

Table 1 Results of field surveys of Staffordshire, Gloucestershire and Worcestershire

Field Grid % Bryophyte % Plant Farm County Stewardship Field Size (Ha) pH* Soil Texture Bryophytes Reference Cover Cover ELS SJ8511 1 5 6.7 Silty Loam 0.0 23.2 1 STAFFORDSHIRE ELS SJ8410 2 15 - 2.0 34.7 CSS SJ9009 1 10.7 - 0.1 9.8 CSS SJ9008 2 2.5 5.6 Clay Riccia glauca 0.6 5.2 2 STAFFORDSHIRE CSS SJ9109 3 11.7 - 1.3 4.8 CSS SJ9108 4 3.6 5.2 Sandy Clay R. glauca 0.0 7.5 SJ8813 1a 6.1 Sandy Clay 0.8 63.6 ELS 7.8 3 STAFFORDSHIRE SJ8813 1b - - 12 12.6 ELS SJ8913 2 12 6.8 - 1.3 19.9 4 STAFFORDSHIRE CSS SJ9215 1 2 6.2 Clay Loam 8.4 21.6 CSS SO9438 1 6.2 7.2 Sandy Clay Loam 3.3 21.2 CSS SO9438 2 3.2 7.4 Sandy Clay Loam 5 14.9 5 GLOUCESTERSHIRE CSS SO9438 3 3.3 - - - - CSS SO9436 4 3.5 - - - - ELS SO9453 1 6.6 5.1 Clay 2.2 23.4 ELS SO9453 2 4.2 6.4 Clay 3.5 14.8 6 WORCESTERSHIRE ELS SO9453 3 7 6.2 Clay 2.6 11.6 ELS SO9453 4 6.5 6.6 Clay 1.7 33.7 ELS SO9454 5 7.3 7.1 Silty Clay 30.7 19.9 HLS SO9251 1 4 5.9 Clay 1.7 28.7 HLS SO9351 2 3.6 7.0 Clay 8.9 17.9 7 WORCESTERSHIRE HLS SO9251 3 2.8 5.4 Silty Clay 22.5 11.7 HLS SO9251 4 8.6 5.4 Clay 11.7 20.2

*Measured in the laboratory

13

Table 2 Results of field surveys of Surrey and Sussex

Field Grid Size % Bryophyte Farm County Stewardship Field No. pH* Soil Texture Bryophyte Species % Plant Cover Reference (Ha) Cover CSS TQ1944 1 6.9 6.8 Sandy Clay Entosthodon fascicularis, Riccia glauca 8.5 29.7 CSS TQ1944 2 3.5 5.9 Sandy Clay Weissia. sp. 1.6 10.3 1 SURREY CSS TQ1944 3 5.3 6.5 Clay 0.1 21.3 CSS TQ1944 4 2.5 6.9 Sandy Clay 2.3 12.7 CSS TQ2045 5 3.2 6.7 Clay 0.2 17.2 2 SUSSEX CSS TQ5623 1 4 4.6 Sandy Clay Fossombronia sp. 4.1 34.1 3 SURREY CSS TQ3541 1 3.8 5.5 Sandy Clay 0 5.3 TQ3638 1a 5.5 Sandy Clay Loam 12.2 7.5 CSS TQ3638 1b 19.6 5.9 Sandy Clay Loam 16.8 10.5 4 SUSSEX TQ3638 1c 5.5 Sandy Clay Loam 12.5 11.4 CSS TQ3638 2 2.4 - - R. glauca 5 SUSSEX CSS TQ4311 1 3.6 7.1 Clay Loam 0 41.4 CSS TQ3619 1 4.3 5.0 Clay E. fascicularis, R. glauca 4.6 11.8 6 SUSSEX CSS TQ3619 2 5.3 5.8 Clay Fossombronia sp. 6.2 47.1 CSS TQ3719 3 3.8 6.2 Clay R. glauca, Weissia. sp. 4.5 16.6 CSS TQ2926 1 6.9 5.6 Sandy Clay 0.4 25.6 7 SUSSEX CSS TQ2926 2 3.5 5.6 Sandy Clay 0 17

*Measured in the laboratory

14

Table 3 Results of over-wintered stubble field surveys of Lincolnshire

Field Grid % Bryophyte Farm Stewardship Field No. Size (Ha) pH* Soil texture Bryophyte Species % Plant Cover % Litter Reference Cover 1 OS3 TF0522 1 2 6.1 Silty Clay loam - 4.8 <1 11

2 OS3 TF0520 1 2 6.5 Silty Clay 0.2 18 24

3 OS3 TF0630 1 2 6.2 Silty Clay - 1.7 65 2

OS3 TF0630 2 3 6.2 Silty Clay - 0.6 47 9

4 EF6 TF0533 1 9 5.6 Clay Loam Weissia longifolia 6.4 15 15

EF6 TF0534 2 3 6.9 Silty Clay - 4.5 24 31

5 HF6 SK9634 1 3.5 6.8 Silty Clay - 0.7 59 16

W. brachycarpa, HF6 SK9632 2 3.5 5.5 Silty Clay 6.4 25 23 W. longifolia

6 HF6 SK9629 1 17 7.2 Clay Loam - 0.0 71 5

7 HF6 TF0527 1 5 7.2 Silty Clay - 0 28 11

HF6 TF0527 2 7 6.5 Clay - 0.3 13 30

W. brachycarpa, OS3 TF0527 3 3 6.5 Clay 3.8 26 16 W. longifolia

W. longifolia, Riccia 8 EF22 SK9836 1 35 6.3 Clay Loam 10.8 22 11 glauca

EF22 SK9839 2 11 5.3 Silty Clay - 0.1 14 4

9 EF6 TF0234 1 10 5.5 Silty Clay W. longifolia 0.5 0 55

*Measured in the laboratory

15

Table 4 Results of over-wintered stubble field surveys of Gloucestershire

Field Grid Field No. % Bryophyte Farm Stewardship Size (Ha) pH* Soil Texture Bryophyte species % Plant Cover % Litter Reference Cover 1 HF6 SP1318 1 - Alkaline - - 0.0 Not done Not done 2 EF6 ST8392 1 7 7.2 Sandy Clay Loam W. longifolia 5.5 16 9 W. brachycarpa, EF6 ST8393 3 11 6.9 Clay Loam 4.3 24 4 W. longifolia W. brachycarpa, W. EF6 ST8194 4 12 6.7 Sandy Clay Loam longifolia, Riccia 11 11 10 glauca, R. sorocarpa EF6 ST8294 5 9 7.0 Clay Loam W. longifolia 4.5 14 8 3 EF6 ST8395 1 13 7.1 Clay Loam - 0.1 10 18 4 EF6 ST9997 1 7 7.2 Clay Loam W. longifolia 0.1 26 8 EF6 ST9898 2 5 6.7 Silty Clay Loam - 0.6 53 14 EF6 ST9898 3 14 6.8 Silty Clay Loam 0.3 32 7 W. brachycarpa, W. 5 18 month fallow SO9905 1 8 7.0 Sandy Clay Loam 13.1 24 25 longifolia ESA SO9905 2 5 7.0 Sandy Loam - 0.2 5 11 ESA SO9904 3 7 7.0 Sandy Loam - 1.8 48 14 W. longifolia, R. 6 OS3 SP1406 1 9 6.8 Clay Loam 2.1 14 23 sorocarpa

*Measured in the laboratory

16

3.1.2 Weissia multicapsularis

3.1.2.1 Surveys of existing sites

The species was found at two of the three known sites within Carricknath Point to Porthbean Beach SSSI and the population was the largest that had been recorded during previous surveys of this site. A sample of the bryophyte was collected with sporophytes. No disturbance of the bryophyte in situ was necessary as the sample was found loose on the ground. Soil samples were all acidic loam (

3.1.2.2 Surveys of historic sites

The two sites on Pentire Point East were surveyed (Table 5). Weissia multicapsularis was rediscovered at site 2. No sample of W. multicapsularis was taken for genetic study as it was not a large population. Weissia controversa was also found and collected at sites 1 and 2 and was included in the genetic studies. The surveys at the other sites failed to find the species. Weissia controversa and W. perssonii were found and collected at the Lizard site. These samples were included in the genetic studies.

Table 5 Results of soil sampling at sites for W. multicapsularis

No. of Location Position Grid Reference Mean pH Soil texture samples Site B - Top of Hedge SW8733 3 4.6 Loam Carricknath Point to Bank Porthbean Beach SSSI Site B -Field within 0.5 SW8733 4 4.8 Loam/Sandy Loam m of Hedgebank Pentire Point East Site 2 SW7861 3 5.3 Loam Site A, Field Soil SX2251 5 5.1 Clay Loam Site A Loam/Silty Clay SX2251 3 4.7 Talland Barton Farm W. multicapsularis Loam SSSI location Site B, Field Soil SX2251 5 4.5 Loam Site B, Bank Soil SX2251 3 5.4 Clay Loam/Loam

3.2 GENETIC STUDIES

3.2.1 nrITS

Initially, DNA was extracted from 33 samples of bryophyte material, encompassing seven morphological Weissia species. The samples comprised 30 fresh specimens, and three dried (sample numbers 31-33). A single amplification product was obtained for the majority of samples following PCR. Good sequence data was obtained for all the samples apart from samples 7, 9, 10, and 31 (the oldest dried sample from 2002). Comparisons of bp differences between the species were then made and the results are in Table 6. These include mismatches in sequence length which are evident by gaps in the sequence that are an artefact of the computer comparison method.

17

Table 6 Species comparisons of nrITS sequences - Number of basepair differences (number of gaps in sequence)

No. of 1. W. 16. W. 2. W. 32. W. 12. W. 3. W. 33. W. basepairs 19. W. 24. W. 4. W. Sample no. & Species brachy brachy longifolia longifolia multicap multicap multicap in squarrosa perssonii contr Wales 1 Wales 2 Wales Lincs Cornwall 1 Cornwall 1 sequence Wales

1. W. brachycarpa Wales 1 746X

16. W. brachycarpa Wales 2 729 22 (78) X

19. W. squarrosa 746 0 (0) 3 (74) X

24. W. perssonii 764 43 (71) 16 (85) 43 (71) X

4. W. controversa 764 39 (73) 1 (82) 39 (73) 2 (1) X

2. W. longifolia Wales 761 36 (75) 18 (82) 36 (71) 3 (3) 3 (3) X

32. W. longifolia 761 36 (75) 18 (82) 36 (71) 3 (3) 3 (3) 0 (0) X Lincolnshire

12. W. multicapsularis 557 27 (51) 23 (59) 27 (51) 2 (4) 1 (3) 2 (2) 2 (2) X Cornwall 1

3. W. multicapsularis Wales 774 32 (59) 15 (84) 37 (69) 8 (10) 4 (5) 7 (7) 7 (7) 0 (3) X

33. W. multicapsularis 771 32 (57) 15 (81) 37 (71) 8 (9) 4 (4) 7 (6) 7 (6) 0 (1) 0 (3) X Cornwall 2

18

There was separation of the species as there were many bp differences and changes due to deletions and insertions that have occurred during the evolution of the species. These alterations over time have created different sequence lengths. The three W. multicapsularis samples (3, 12 and 33) showed good agreement with the only differences due to one or three extra bases. These may be due to an error in the method as these extra bases were in sequences of one base, guanine, repeated eight times and the technique used for amplification does not always match multiple repeats perfectly. A possible W. squarrosa (Sample 19) matched exactly to W. brachycarpa (Sample 1) but was completely different from another, Sample16. The other morphologically similar species to these, W. controversa (Sample 4) and W. perssonii (Sample 24) were similar to each other with only a 2 bp difference and a single gap but were completely different to W. brachycarpa and W. squarrosa. However there was a perfect match for the two W. longifolia samples (2 and 32).

Table 7 Initial samples of Weissia for genetic testing: their location, GenBank® comparisons using nrITS results and the species groupings from trnL- trnF and rbcL sequences

Results Sample nrITS GenBank® Site Species trnL-trnF Group rbcL Group No. analysis Dingestow Site 1 1 W. brachycarpa W. squarrosa W. brachycarpa W. brachycarpa/controversa/squarrosa (SO4409) 2 Chepstow (ST5292) W. longifolia W. rostellata W. longifolia W. longifolia W. multicapsularis Dingestow Site 2 3 W. multicapsularis W. multicapsularis Cornwall 2 & W. multicapsularis Cornwall 2 & Wales (SO4409) Wales Wales Llandegfedd 4 W. controversa W. controversa W. controversa W. brachycarpa/controversa/squarrosa Reservoir (ST3199) W. controversa var. 8 Chepstow (ST5292) W. controversa Not done Not done densifolia W. Lydstep Head W. controversa var. 11 multicapsularis/W. W. controversa Not done (SS091977) crispata brachycarpa Carricknath Point to Porthbean Beach W. multicapsularis 12 SSSI (Site B) W. multicapsularis W. multicapsularis W. multicapsularis Cornwall 1 Cornwall 1 (SW8733) Cornwall 1 St Clears W. brachycarpa var. 13 W. squarrosa W. brachycarpa W. brachycarpa/controversa/squarrosa (SN128157) brachycarpa W. brachycarpa var. W. squarrosa 16 Carmel (SN590161) W. brachycarpa W. brachycarpa/controversa/squarrosa obliqua (Match not good) Surrey/Sussex W. brachycarpa or W. squarrosa 17 W. squarrosa Not done Farm 1 (TQ1944) squarrosa (Match not good) Pentire Point East W. rutilans (Match 18 W. controversa Not done Not done site 1 (SW7861) not good) Surrey/Sussex W. brachycarpa or 19 W. squarrosa W. squarrosa W. brachycarpa/controversa/squarrosa Farm 6 (TQ3719) squarrosa Lizard site 1 24 W. perssonii W. controversa W. controversa W. brachycarpa/controversa/squarrosa (SW7113) W. rostellata (100% Newton on Trent W. longifolia var. 32 match with sample W. longifolia W. longifolia (SK8374) longifolia 2) Talland Barton W. multicapsularis Farm SSSI 33 W. multicapsularis W. multicapsularis Cornwall 2 & W. multicapsularis Cornwall 2 & Wales (SX2251) Wales Cornwall 2

19

The sequences were also compared to the published results of the GenBank®. The best matches for an example of each species are shown in Table 7 (remainder Appendix 4). Unfortunately the sample of W. squarrosa from Wales had been contaminated with another species. The results were varied and the percent matches were not good, with only one 100% match to a particular Weissia sp., sample 12, W. multicapsularis from Carricknath SSSI or the reverse sequence only; the forward sequence that would have provided additional confirmation of the match, did not work) (Table 7). The sample on GenBank® from Werner et al. (2005) was a sample from Talland Barton Farm SSSI. Therefore the two populations are the same species W. multicapsularis and they matched the sample collected in Dingestow, Wales. Werner et al. (2005) noted that collections of the same species from different regions and countries are dissimilar, most notably W. controversa, and, as all of the samples used in that study were not from the UK except W. multicapsularis, this may explain the mismatches with our collections.

3.2.2 trnL-trnF, rbcL, and trnH-psbA

As the results from nrITS species comparisons from GenBank® were not conclusive, three other molecular markers were tried. Single bands of amplified DNA were produced for the trnL-trnF and rbcL regions, of approximately 460 and 610 bp respectively. However multiple non-specific PCR products resulted from amplification with the trnH-psbA primers. It would be difficult to determine which of these the target product was without analysing each band. This would be very time- consuming process and therefore sequencing was not performed using this primer.

All 12 species samples generated equal length sequence data for trnL-trnF with only one exception sample 4 (W. controversa var. densifolia). Table 8 shows a paired comparison of the sequence data of analysis for each species showing the actual differences in numbers of basepairs. Weissia multicapsularis, samples 3 and 33, were identical with three unique bases, but W. multicapsularis, sample 12, did not share these differences, instead it had two unique bp changes of its own. W. longifolia, samples 2 and 32 were identical with one unique bp, as were samples 23 and 24 (W. controversa). Samples 1, 13, and 16 (W. brachycarpa) were identical and had no unique bp difference. Sample 19 (W. squarrosa) had one unique bp difference. Sample 4 (W. controversa var. densifolia), would be expected to have the same sequence as sample 23 and 24 (W. controversa) however it has a ten bp missing section that contains a basepair difference for W. controversa. Overall the separation agrees with the morphological species identifications above, apart from sample 12 that would be expected to have the same sequence as samples 3 and 33, as suggested by the results from nrITS analysis. Sample 24 W. perssonii would be expected to be different from sample 23 W. controversa, however it is very difficult to separate these species without microscopic examination and in this case, the field identification of W. perssonii may have been incorrect. Table 7 shows how the results from this analysis compared with the analysis with nrITS.

Further collections were than added to the initial samples (Appendix 5). These included W. levieri which was collected from the Gower Peninsular and two sequences that are probably Weissia species but which do not match any of the other sequences. Species 1 from Devil's Dyke (TL5864) may be W. longifolia var. angustifolia whilst Species 2 was collected from Pentire Point East site 2 (SW7861) as a probable W. multicapsularis but shows closer affinity to other species in the genus. Although the differences are small between the species, there has been complete replication between samples from varied geographic locations for each species with 17 samples of W. brachycarpa, 12 of W. controversa, 11 of W. longifolia, six of W. squarrosa, two of W. multicapsularis, and two of W. levieri. Full details of these groupings of samples are found in Appendix 6.

20

Table 8 Results of trnL-trnF sequence analysis for Weissia species: Number of basepair differences (number of gaps in sequence)

No. of basepairs Species Wbrac Wcont Wcontvdens Wsquar Wlong Wmulti WmultiRos Wlev Wlongvang WPen in sequence

W. brachycarpa 401 X (Wbrac)

W. controversa 401 1 X (Wcont)

W. controversa var. densifolia 391 0 (10) 1 (10) X (Wcontvdens)

W. squarrosa 401 1 2 1 (10) X (Wsquar)

W. longifolia 401 1 2 1 (10) 2 X (Wlong)

W. multicapsularis Cornwall 2 & Wales 401 3 4 3 (10) 4 4 X (Wmulti)

W. multicapsularis Cornwall 1 401 3 4 3 (10) 4 1 6 X (WmultiRos)

W. levieri (Wlev) 401 2 3 2 (10) 3 1 5 2 X

W. Species 1 401 1 2 1 (10) 2 2 4 4 3 X (Wlongvang)

W. Species 2 401 2 3 2 (10) 3 3 5 5 4 3 X (WPen)

21

This analysis did not include the two chalk grassland specialists. For W. condensa, two collections were made at Haresfield Beacon (SO8208, 25/02/2011) but their sequences were the same as W. controversa using this primer. Weissia sterilis was also not sequenced although four samples were collected at Painswick Beacon (SO8612, 25/02/2011) and one at Haresfield Beacon (SO8208, 25/02/2011) but no PCR product came from two samples and the other samples were W. longifolia. Unfortunately many of Weissia spp. found at these two sites had not developed sporophytes that are an essential aid for species identification and they often grew in mixed populations.

The samples could not be identified via BLAST searches of GenBank® as these regions have not been sequenced for most of these species apart from W. controversa and W. controversa var. densifolia. The two suspected W. controversa sequences (samples 4 and 23) were used to interrogate GenBank®. Sample 4 matched 100% to W. controversa var. densifolia (Grundmann et al., (2006), collected S.E. Yorks by R. Porley) even though it was collected as W. controversa var. controversa and sample 23 (plus sample 24 as it gave an identical sequence) matched only 99% (386bp/388bp) to W. controversa (Grundmann et al., (2006), collected Missouri, USA). This may show that the variety designation for var. densifolia may not be sufficient and suggests a separate species.

For rbcL all 12 species samples generated equal length sequence data. The resulting groupings of samples are shown as a comparison against the other markers in Tables 6 and showing the species base pair comparison in Table 9. A full comparison between nrITS, trnL-trnF and rbcL is shown in Appendix 5. Comparisons between species were all 99% similar or higher except those involving W. longifolia. The results agreed with those for trnL-trnF except that there was no separation of samples 1, 13, and 16 (W. brachycarpa), samples 4, 23 and 24 (W. controversa), and sample 19 (W. squarrosa). Therefore, as it was important to separate these species, no further samples were analysed with this region. However this region supported the separation of samples 3 and 33 for W. multicapsularis from sample 12. The latter had one unique bp which separated it from the samples 3 and 33 and all other species. The interesting aspect to this marker was that there were some shared bp differences between W. longifolia and W. multicapsularis suggesting a common ancestor whereas there had been no shared bp differences within trnL-trnF. W. longifolia had 6 bp differences and it shared one of these with W. multicapsularis (sample 12) and one with W. multicapsularis (samples 3 and 33). The latter samples did not have other unique differences from other Weissia spp..

Table 9 Results of rbcL sequence analysis: Number of basepair differences

Species Wbrac Wcont Wsquar Wlong Wmulti WmultiRos W. brachycarpa X (Wbrac) W. controversa 0 X (Wcont) W. squarrosa 0 0 X (Wsquar)

W. longifolia (Wlong) 6 6 6 X

W. multicapsularis Cornwall 2 & Wales 1 1 1 5 X (Wmulti) W. multicapsularis Cornwall 1 2 2 2 6 3 X (WmultiRos)

The results from all three molecular markers show the complexity of species identification within Weissia, and it is important to ensure that the sequencing results are reproducible, robust and can be relied upon. However all the regions do support the present morphological separation of the genus

22

Weissia. The trnL-trnF region is the best molecular marker used but the differences between the species are only a few basepairs however they do seem to be reproducible for UK species.

3.3 SPORE GERMINATION STUDIES

3.3.1 Effect of pH

For both species there was no germination at pH 4 (Figures 1 and 2) and none at pH 8 for W. multicapsularis. The optimum condition for growth of the latter species was pH 6 though only 23% of the spores produced protonemata. There was little protonemal development at pH 5, and although the germination at pH 7 was high initially, most protonema seemed to lack chlorophyll and did not multiply. However there was no significant difference between the means of pH 5, 6 or 7 for both aspects of development due to the variability in the data.

Weissia squarrosa may have a wider tolerance of pH with higher numbers of germinations of 41 and 37 at pH 6 and 7 respectively (Figure 2), which were significantly higher than the numbers of germinations of 7 and 6 at pH 5 and 8 respectively. However the subsequent production of leafy growths was the most interesting aspect as this increased significantly from pH 5 to 7. Also the increase in production of leafy growths per protonemata increased significantly from 1:1 at pH 6 to 1:10 at pH 8.

3.3.2 Effect of Fertilisers

The controls gave mean percentage of protonemata from spores applied of 15 and 67% for W. multicapsularis and W. squarrosa respectively (Figures 3 and 4). These results were the same as those for the pH assessment for W. multicapsularis but significantly higher for W. squarrosa.

The effect of nitrate was difficult to determine for W. multicapsularis. In the lowest concentration it was difficult to count the number of protonemata as their growths were not discrete but numbers were probably higher than the control and the higher concentrations of ammonium nitrate. Subsequent increases in concentration were not significantly different to the control until 200 mg/l level and therefore ammonium nitrate does increase production of protonemata at high concentrations (Figure 3). The mean numbers of leafy growths produced with ammonium nitrate were only significantly different from the control at the lowest concentration.

For W. squarrosa there was no effect due to the addition of ammonium nitrate (Figure 4). There was a general trend for a decrease in protonemata with increase in concentration but this was small and not significant. There was a trend for increased leafy growths with increasing concentration but again this trend was not significant.

The effect of phosphate was harder to determine for W. multicapsularis as there were protonemata present but the growths were not discrete (Figure 5). The lowest concentration increased leafy growth production but this was not significantly higher than the control due to high level of variability in the results. This variability removed the significance in the trend for decreasing mean numbers of leafy growths with increasing phosphate concentration

For W. squarrosa there was no effect due to the addition of sodium phosphate, though this was partly due to the high variability in the results (Figure 6). The highest concentration did show an increase in the number of leafy growths produced over the control and other concentrations.

23

Figure 1 Effect of pH on the germination of the spores of Weissia multicapsularis: average number (with SEMs) of protonemata and leafy growths produced after 11 month's growth at 20oC

Figure 2 Effect of pH on the germination of the spores of Weissia squarrosa: average number (with SEMs) of protonemata and leafy growths produced after 11 month's growth at 20oC

24

Figure 3 Effect of Ammonium nitrate on the germination of the spores of Weissia multicapsularis: average number (with SEMs) of protonemata and leafy growths produced after 8 month's growth at 20oC

Figure 4 Effect of Ammonium nitrate on the germination of the spores of Weissia squarrosa: average number (with SEMs) of protonemata and leafy growths produced after 8 month's growth at 20oC

25

Figure 5 Effect of Sodium phosphate on the germination of the spores of Weissia multicapsularis: average number (with SEMs) of leafy growths produced after 8 month's growth at 20oC

Figure 6 Effect of Sodium phosphate on the germination of the spores of Weissia squarrosa: average number (with SEMs) of protonemata and leafy growths produced after 8 month's growth at 20oC

26

Table 10 Location of soil sample, their number and number of leafy growths produced

Time at 20oC and 60 rh 2 months 10 months Total Section of core sample Survey Sample Location Top Bottom Top Bottom Top Bottom region Hedge A 1 Top 0.80 m from x x x x x x path Hedge A 2 Top 0.90 m from x x x 1 x 1 Carricknath path Point to Hedge A Porthbean 3 x x 1 x 1 x Beach SSSI Top 1.00 m from path 4 2 x x x 2 x 5 Hedge A x x x x x x 6 North side x x 26 x 26 x 7 x x 90 184 90 184 1 5 1 55 x 55 1 Pentire 2 Site B 12 9 x 126 12 126 Point East * 3 3 x 5 x 5 x 1 x 1 x 27 x 27 2 40 30 4 12 40 30 3 Site A, General 8 x 25 x 25 x 4 9 7 16 62 16 62 5 30 x 88 x 88 x 6 x x x x x x

7 Site A 2 x x x 2 x 8 W. multicapsularis x x x x x x 9 location x 2 x 31 x 31 Talland 10 x x x x x x Barton Farm SSSI 11 50 50 153 10 153 10 12 x 1 3 62 3 62 13 Site B, General x x 2 136 2 136 14 x 30 x 100 x 100 15 x x x x x x 16 5 18 x 61 5 61 17 5 x x x 5 x 18 Site B, Target x x x x x x 19 5 40 x 32 5 32 20 15 10 x 3 15 10

*Shallow soil over rock and therefore difficult to insert the soil sampler

27

3.3.3 Germination from Soil Samples

The combined results for W. squarrosa for all the farms were one positive sample with 1 leafy growth from the top section of the sample and four with a mean of 1.8 leafy growths from the bottom sections after two months. These were pale with little green content and they had disappeared by the 10 month assessment. The full results are shown in Appendix 7.

The number of positive samples was higher for the W. multicapsularis sites (Table 10). Carricknath Point to Porthbean Beach SSSI had only one positive sample from the top of the hedge bank and this had only one leafy growth. 50% of the samples from the base of the hedgebank in the permanent margin were positive with the largest count from a bottom sample (Table 9). There were a total of four species present and the leafy growths were mainly Bryum rubens and Tortula sp..

Only three samples were taken from Pentire Point East as it was difficult to take samples because the soil was very thin. Only one section had no germination but only three still had growths alive after 10 months (Table 10). Two of these had a Weissia sp. present, with five leafy growths in a top section and 71 in the bottom sample. A total of six bryophyte species were present.

There were 58 positive samples from Talland Barton Farm SSSI. 60% of the top sections and 55% from the bottom sections had leafy growths with a mean number of 30 and 51 for the sections respectively (Table10). The number of leafy growths from the bottom section was interesting as the field is a permanent pasture and there is no cultivation of the soil. There were at least five different species of bryophyte with Bryum rubens and Tortula sp. (probably Tortula modica due to shape of sporophytes) dominating but none had any Weissia sp. present.

4. DISCUSSION

1. Status of Weissia squarrosa

The surveys of agri-environment scheme options have found two likely sites for W. squarrosa and in both cases these finds are in counties where this species has not been recorded recently, Surrey and Sussex. These records will be submitted to the BBS for mobilisation to the NBN gateway. Prior to the selection of survey sites for 2011, Vice County recorders from the BBS with previous NBN records for the species were contacted to see if there were any new records or any suggestions for areas to survey. The recorders in Berkshire, Cambridgeshire, Gloucestershire, Shropshire, Staffordshire, Lincolnshire, and Worcestershire were contacted and all responded negatively. There are no new records for this species on the NBN Gateway for England since 2008. However this is a difficult species to identify and is restricted to moist acid clays within a habitat that is infrequently surveyed by experienced bryologists. The species remains a rare and difficult to find species. It is very difficult to determine whether there has been any change in the population of this species since SBAL by the BBS. However the identification of two potential new sites is a positive contribution to records for this species’ distribution.

2. Autecology of Weissia squarrosa

Weissia squarrosa requires clay soils with pH between 6 and 7. One of its main locations, Dingestow, Wales is a very moist field with small seeps visible. The most likely location for this species identified by this project (Sussex) was very similar with moist acid clay soil with the presence of surface water. Water availability is an important limiting factor for germination and more crucially for fertilisation (Porley, 2000). Therefore moisture may be one of the most important environmental factors limiting the presence of this species. As well as adequate surface water, it is likely that this population may have benefitted from a combination of the repeated spring cropping of the field as the farmer was unable to cultivate in the winter and the minimum tillage used for cultivation.

Weissia squarrosa has perennial life strategy which is different from the usual annual strategy of bryophytes found in the arable environment. It may require two full years of growth to reach maturity and the opportunity for sexual reproduction, but this is rare in the arable environment as it is managed presently. The change to a predominantly autumn sown cropping pattern that has occurred over the

28 past few decades, gives even autumn - germinating annual bryophytes little opportunity to establish due to competition from the developing crop (Porley, 2000; 2008). The changes in cropping patterns, the intensification of agriculture, and the decline of mixed farming systems, have been implicated in the decline of many arable bryophytes (Porley, 2000). The use of stubble options as part of agri- environment schemes would appear to alleviate this problem. However, as this is a rotational option and the proportion of the arable area committed may be small, the time period before each field becomes fallow again may be many years. In the interim period the spore bank is depleted due to the intervening repeated cultivations and the lack of replacement spore rain as the bryophytes never achieve maturity during this period. There was low germination of all bryophytes in the soil samples taken from the farms which were surveyed and these were an indication of a depleted spore bank. Clay soils, the habitat for W. squarrosa are not usually left as stubbles as they may be unworkable in the spring preventing soil preparation in time for sowing.

In general high populations of all arable bryophytes were found in two of the fields with extended fallow (18 months), a voluntary choice, where no cultivation of any sort has been done during that period. The only other field surveyed under a similar fallow regime had been lightly disced and had an extensive cover of perennial grasses as no herbicides had been applied. It also had very few bryophytes. The use of herbicides within this period as was the case for the first two fields was beneficial for bryophytes most probably due to a reduction in competition from higher plants. This is advantageous from an agronomic perspective, because the farmer is not prevented from treating any weed problems that develop. It may also be evidence for a tolerance to these compounds that would be worth investigating further. They also need bare ground for establishment, therefore low litter cover is beneficial. This study has shown that other frequently-used compounds, nitrate and phosphate fertilisers, to have no adverse effect on germination and development of protonemata, and may increase the development of leafy growths. However fertiliser application will benefit higher plants to a greater extent and therefore any potential habitat for bryophytes should not be fertilised.

Changes in cultivation techniques may also be affecting bryophyte populations. As well as the loss of stubbles, there has been a change from traditional ploughing to methods such as discing combined with a power harrow that involve less soil inversion and shallower cultivation. It would be useful to know whether these changes are altering bryophyte populations. The timing of different operations is potentially important in the survival of bryophytes. In some cases some form of minimum tillage is done in winter in preparation for spring sowing. This leaves an uncompressed surface that seems to limit bryophyte development. Direct drilling may represent the most beneficial method of crop establishment as there is limited surface disturbance.

3. Autecology of Weissia multicapsularis

The requirements of W. multicapsularis are fairly similar to W. squarrosa even though the habitats it is currently restricted to appear more stable. It too is a perennial bryophyte whose main method of expansion is through vegetative growth followed by sporophyte production. The plant needs bare acidic (pH 6) loam for establishment, followed by stable open habitat for at least three years to allow plants to expand, reach sexual maturity and produce sporophytes. A larger plant increases the chances of sexual reproduction and development of sporophytes. These sporophytes are immersed that suggests that its dispersal distance will be limited (Porley, 2000).

Although this species occupies three seemingly different habitats, they have similarities. The top and sides of hedgebanks, coastal grassland and steep banks in a grazed field all have thin well-drained acidic loams. They probably have low nutrient status though the hedgebanks do support higher plant populations that exhibit signs of a fertile environment. Laboratory experiments have shown that nitrate and phosphate fertilisers have no adverse effect on germination and development of protonemata, and may increase the development of leafy growths. However fertiliser application will benefit higher plants to a greater extent and therefore this should not be done where this species is present.

The habitats are all coastal probably with some salinity effect limiting competition. All three areas have bare earth for germination within them; however the problem is ensuring that there is an agent creating these ephemeral habitats. Intervention has been doing this over the past years and it is essential for the species’ survival to ensure that this continues. For the hedgebanks this has been

29 done with herbicides to limit the competition from higher plants although they do help to hold the soil on the top of the bank. The large colonies are also vulnerable as they increase in size to falling from their location and being lost as there is no chance to establish amongst the sward below. It may be beneficial to have a bare compacted area beneath hedge rather than grass sward. This would improve the survival of colonies dropping from the bank and would reduce competition from higher plants. It may also be necessary to create habitat further along the hedgebank by controlling patches of higher plant with herbicides, leaving for a time to weather out the accumulated humus content, followed by the translocation of the plants.

The coastal grassland is cropped short by rabbits which also provide bare areas for establishment by creating shallow scrapes in their search for roots. The main problem with this site is encroachment from gorse that, if not cut back, would shade out the bryophyte species. For the grazing field, horses have been introduced to reduce growth of higher plants and to create the bare areas necessary on the banks for establishment. This was done between the visits and it was noticeable how much shorter the sward was with many bare areas on the banks, the main sites for the bryophyte previously. It was too early to see any new growth but it was noticeable that the competition, particularly from carpeting bryophytes (Hypnales) was greatly reduced.

4. Taxonomic studies of the genus Weissia

The sequences used in this process are known as molecular markers. The sequences that start and end these sequences have been determined and these are used to detect the target sequence from within the whole DNA. The target sequence is then copied and amplified, and its sequence determined. A useful molecular marker is required to code for a region that provides sufficient sequence variation to distinguish between species. Initially the nrITS region was chosen as it is one of the five main markers used in bryophyte phylogenetics (Stech & Quandt, 2010). This is because it is easy to amplify even from small quantities of DNA, and has a high degree of variation even between closely related species. This can be explained by the relatively low evolutionary pressure acting on such a non-functional sequence. In addition, the phylogenetic study of Trichosomoideae by Werner et al. (2005) using this marker, meant there were sequences on GenBank® which could be compared to the results from the present study. However this study showed that Weissia were very closely related with relationships that were not always resolved using this marker. However it did support W. multicapsularis as a discrete species that was further supported by previously published research of Werner et al. (2005).

Genetic analysis of the samples’ genomes with the readily available molecular marker trnL-trnF has allowed separation of the genus Weissia. The differences may represent only a few bps but there has been good replication of sequences from many different geographical locations in the more common species: W. brachycarpa, W. controversa and W. longifolia. It would be useful to increase the replication of samples for the other species to support these initial separations. Five morphological species W. brachycarpa, W. controversa, W. levieri, W. longifolia, and W. multicapsularis of the genus are supported by this analysis. Furthermore for W. multicapsularis, a difference between the populations from the two SSSIs has been detected. The collection made at site in Dingestow, Wales gave a sequence that was the same as the population at Talland Barton Farm.

One of the samples collected as W. controversa produced a different sequence to others of this species, but produced an exact match with Weissia controversa var. densifolia on GenBank® for this marker (Grundmann et al., (2006), Collected S.E. Yorks by R. Porley). Our collection was not identified as this variety which is meant to have specialised habitat requirements, therefore Weissia controversa var. densifolia may be more widespread than previously thought.

For rbcL, only sequences from W. brachycarpa, W. controversa, W. longifolia, W. multicapsularis, and W. squarrosa were compared as an initial test of the suitability of this region. Weissia longifolia and W. multicapsularis were separated from each other and from the other species tested. However the sequences from W. brachycarpa, W. controversa, and W. squarrosa were identical and, as it was important to separate these species, no further species were analysed with this region. However this region supported the difference detected between the W. multicapsularis populations from the two SSSIs by trnL-trnF and the similarity between the sample from Dingestow Wales and the sample from Talland Barton Farm.

30

Weissia squarrosa is the species which has not been completely resolved. The analysis with trnL- trnF was done on a sample from Dingestow, Wales but this matched with all the W. brachycarpa collections. This was recently taken from the sample collected at the original visit to Dingestow that has been maintained in an open greenhouse. Therefore at present there is no sequence from Dingestow for any species of Weissia other than W. brachycarpa. Therefore although the two sequences from Surrey and Sussex are the same and different from the sequence for W. brachycarpa, it is not possible to confirm definitively the finding of W. squarrosa in these new locations. However they did possess a unique bp difference and therefore may constitute a separate species and are probably W. squarrosa. This conclusion is supported by the nrITS GenBank® sequence for this species.

Unique sequences for W. condensa, W. perssonii, W. rostellata, W. rutilans and W. sterilis have not been achieved with these three markers for a variety of reasons. Weissia condensa and W. rutilans were both collected but unfortunately the resulting sequences proved to be other morphologically- similar species, W. controversa and W. brachycarpa respectively. Weissia perssonii was also collected but the sequence was the same as for W. controversa. The former species may not have been collected as definitive morphological separation is only possible at the correct stage of sporophyte maturation with the aid of a microscope. For W. sterilis, some samples produced no PCR product and others proved to be W. longifolia. A morphological identification showed that W. sterilis had been collected. Therefore it is possible that there has been a mutation in the binding site of the molecular marker for this species. If the marker is unable to bind there would be no amplification and no product. The other possibility is that it was a mixed sample which would also affect the PCR product. In most cases two or three species of Weissia grew together along with other species that may have been sequenced in error. As there were few sporophytes on the Weissia spp. it was difficult to extract a pure sample of one species.

The results from trnL-trnF have provided the separation for the species of Weissia analysed so far. This study has confirmed the genetic sequence from the nrITS region for W. multicapsularis as published by Werner et al. (2005). However, it has brought into question the separation of other Weissia species using this marker. Three additional markers have been used in this study, although one proved to be useless, trnH-psbA. trnL-trnF has provided separation of more common Weissia species and both this marker and rbcL have affirmed the status of W. multicapsularis as a separate species. Although differences between species were based on only a very small number of base pairs, these sequences have been shown to be identical from a number of populations from different geographic locations. However, it would be useful to have an additional genus-specific separation method especially as there is the possibility that trnL-trnF may not be able to separate the species that have not been satisfactorily sequenced. This may be found through microsatellite analysis, which has been recommended for further research.

5. Creation of habitat for arable bryophytes

To provide additional habitat for arable bryophytes it may be necessary to introduce an option or a voluntary margin management regime that would benefit all arable bryophytes. The present ELS stubble options (EF6 Overwintered stubble, EF15 Reduced herbicide cereal crops followed by overwintered stubble, EF22 Extended overwintered stubble, EG4 Cereals for whole crop silage followed by overwintered stubble) do provide suitable habitat for bryophytes. However, these are rotational options and the proportion of arable area committed may be small and therefore the time period before each field becomes fallow again may be many years. In the interim period the spore bank is depleted due to the intervening repeated cultivations and the lack of replacement spore rain as the bryophytes never achieve maturity during this period. Also the stubbles are usually only present for six months, with 11 months for EF22. Bryophytes with a more perennial growth strategy such as W. squarrosa require extended periods of fallow for two or more years. A possible strategy for these bryophytes has been outlined in the text of an advisory leaflet for the conservation of arable bryophytes (Appendix 8). This would require the establishment of a margin for bryophytes. This could be introduced as part of the Habitat Action Plan (HAP) for Arable Field Margins, which are considered a priority habitat. A margin only 2 - 3 m wide would be sufficient due to the size of the plants and would be started after harvest as bryophyte establishment/growth will benefit from a firm surface. It would be located at the edge of field, ideally in a moist location such as its northern side or at the bottom of a slope. This would mean that only the least productive areas of a field, which may

31 be better for bryophytes, would be committed to conservation of these species. No cultivation should occur during this fallow period. The application of herbicides to reduce competition from higher plants especially grass weeds and volunteers may be required. An alternate option would be to have repeated spring cropping followed by overwintered stubble on same field. This would be a suitable cropping regime for wet fields that are favoured by W. squarrosa.

The findings from this project will be published in two articles (Appendix 9). One will cover the findings of the field work and will be submitted to Field Bryology and the other will deal with the results from the genetic studies on Weissia and will be submitted to the Journal of Bryology. Most of the bryophyte records from this project have been submitted to the NBN gateway via the BBS and the remainder will be done shortly (Appendix 9).

32

5. FURTHER RESEARCH

Microsatellite study of genus Weissia

Microsatellites (also known as Short Tandem Repeats (STR)) are repetitive regions of DNA. The repeat units can be two, three, four or more nucleotides long, but the most commonly used in population genetics are di- or tri-nucleotide repeats (e.g. GAGAGAGA or ATGATGATG). There are many different repeat regions in each individual, with unique flanking sequence regions for which primers can be designed. These can then be used in PCR to amplify the repeat region so that it can be detected via capillary electrophoresis. For example, for one particular region with a ‘GA’ repeat, one species may have 10 of these but another 12. Hence following PCR amplification, the second species will generate a product that is two times ‘GA’ repeats longer i.e. Four nucleotides longer. The advantage of analysing the PCR products via capillary electrophoresis is that this can resolve down to one bp difference, so that species that vary by just one di-nucleotide repeat (i.e. two bp) can be identified.

For Weissia where sequence data from the available molecular markers cannot discriminate between species, microsatellite analysis would be used with a number of primer pairs, to generate profiles specific to each species. Ideally, a search of the genome will produce so called ‘private alleles’ where each species generates a PCR product with a unique length for that region e.g. Species 1 = 150 bp, Species 2 = 170 bp. These private alleles are rare so it is more likely that a profile of allele sizes for a number of regions will be produced that differentiate each species (Table 10). Each species generates a unique profile from the suite of primers, even though there will be similarities in some regions across the species.

There would be a need to include samples of W. condensa, W. perssonii, W. rostellata, W. rutilans and W. sterilis that were not found during the present study in the microsatellite analysis.

Table 11 Example of the results of microsatellite analysis

Region

Species 1 2 3 4 5 6

1 150 240 186 300 260 124

2 150 240 190 302 260 126

3 150 280 186 302 260 124

Effect of herbicides on bryophytes

Observations made during this project suggest that there were increased populations of bryophytes in fields where herbicides were used. This may just be due to the removal of higher plant completion or it may suggest a tolerance of these pesticides. A test of a range of herbicides such as Glyphosate and the more selective graminicides, to assess which are the least damaging to bryophytes. Determine when the optimum time for application is. Prolonged periods of drought leave the plants in a contracted, desiccated state and this may alter the rate at which surface liquid is absorbed, the main water acquisition pathway for bryophytes.

33

Effect of cultivation on bryophyte populations

In the arable environment where winter cropping now predominates it would be useful to determine which method of cultivation would be most beneficial for bryophyte establishment and longevity. It would also allow the study of populations of species that develop under these different regimes. A comparison of different types of cultivation (e.g. ploughing, minimum tillage, direct drilling) would determine which method would be the most beneficial for the different life strategies used by bryophytes. This is particularly important now as there are many more approaches to soil preparation than the traditional ploughing. A consolidated soil surface may be better for establishment as it provides a firm substrate for anchorage, and ensures high soil moisture content.

34

BIBLIOGRAPHY

Ayres, E., van der Wal, R., Sommerkorn, M. and Bardgett, R. D. (2006) Direct uptake of soil nitrogen by mosses. Biology Letters 2, 286-288.

BBS (2010) Mosses and liverworts of Britain and Ireland – a field guide. British Bryological Society (Atherton, I., Bosanquet, S. and Lawley M. (eds.)), Latimer Trend and Co. Ltd., Plymouth.

Bates, J. W. (2008) Mineral nutrition and substratum ecology In: Bryophyte Biology: Second edition (Goffinet, B. & Shaw, A. J. eds.) Cambridge University Press, Cambridge, UK.

Bosanquet, S.D.S. and Preston, C.D. (2005) Weissia squarrosa in Britain: A re-evaluation of its identification and ecology in the light of recent records. Field Bryology 86, 2-13

CBOL Plant Working Group (2009) A DNA barcode for land plants. Proceedings of the National Academy of Sciences, USA 106, 12794-12797.

Church, J. M., Hodgetts, N. G., Preston, C. D. and Stewart, N. F. (2001) British Red Data Books: mosses and liverworts. Peterborough: Joint Nature Conservation Committee.

Duckett, J. G. (1970) Sexual behaviour of the genus Equisetum, subgenus Equisetum. Botanical Journal of the Linnean society 63, 327-352.

Duckett, J. G., Burch, J., Fletcher, P. W., Matcham, H. W., Read D. J., Russell, A. J. and Pressel, S (2004) In vitro cultivation of bryophytes: a review of practicalities, problems, progress and promise. Journal of Bryology 26, 3-20.

Emmett, B. A., Frogbrook, Z. L., Chamberlain, P. M., Griffiths, R., Pickup, R., Poskitt, J., Reynolds, B., Rowe, E., Rowland, P., Spurgeon, D., Wilson, J. and Wood, C. M. (2008) Countryside Survey Technical Report No.03/07 Soils Manual.

GenBank® (2010) http://www.ncbi.nlm.nih.gov/genbank/

Grundmann, M., Schneider, H., Russell, SJ. and Vogel, J. C. (2006) Phylogenetic relationships of the moss genus Pleurochaete Lindb. (Bryales: Pottiaceae) based on chloroplast and nuclear genomic markers. Org. Div. Evol. 6, 33-45.

Hollingsworth, M. L., Clark, A., Forrest, LL., Richardson, J., Pennington, R. T., Long, D. G., Cowan, R., Chase, M. W., Gaudeul, M. and Hollingsworth, P. M. (2009) Selecting barcoding loci for plants: evaluation of seven candidate loci with species-level sampling in three divergent groups of land plants. Molec Ecol. Resourc. 9, 439-457.

Holyoak, D. T. (1999) Distribution, status and conservation of the moss, Weissia multicapsularis. Final report to English Nature Species Recovery Programme March 1999.

Holyoak, D. T. (2004) Research on the endangered moss, Weissia multicapsularis, in Cornwall during 2003 and 2004. Report to English Nature, August 2004.

Kress, W. J. and Erickson, D. L. (2007) A two-locus global DNA barcode for land plants: the coding rbcL gene complements the non-coding trnH-psbA spacer region. Public Library of Science one 2: e508.

Liu, Y., Yan, H-F., Cao, T. and Ge, X-J. (2010) Evaluation of 10 plant barcodes in Bryophyta (Mosses). J. Sys. Evol. 48 (1) 36-46.

Murashige and Skoog (1962) A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiologia Plantarum 15, 351-353.

Newmaster, S.G., Fazekas, A. J. and Ragupathy, S. (2006) DNA barcoding in land plants: evaluation of rbcL in a multigene tiered approach. Can. J. Bot. 84 335-341.

35

Peak Ecology Ltd. (2009) Mechanisms for filling knowledge gaps for Biodiversity Action Plan Species. Report for the Joint Nature Conservation Committee. 24 p. http://www.ukbap.org.uk/library/UKBAPWorkshopDec2008/BRIG_BRAG_BAP_workshop_report_ Final_2220012009.pdf

Porley, R. (2000) Bryophytes of arable fields: current state of knowledge and conservation. In: Fields of vision: a future for Britain’s arable plants (eds. P. Wilson & M. King), pp.8-19, Plantlife, London.

Porley, R. (2008) Arable Bryophytes: A field guide to the mosses, liverworts and hornworts of cultivated land In Britain and Ireland. WILDGuides Ltd., Old Basing, Hants, UK.

Preston, C. D., Hill, M. O.; Porley, R. D. and Bosanquet, S. D. S. (2010) Survey of the bryophytes of arable land in Britain and Ireland 1: a classification of arable field assemblages. Journal of Bryology 32 (2). 61-79.

Rowntree, J. K. and Ramsay, M. M. (2005) Ex situ conservation of bryophytes: progress and potential of a pilot project. Bol. Soc. Esp. Briol. 26-27, 17-22.

Rowntree, J. K., Cowan, R. S., Leggett, M., Ramsay, M. M. and Fay, M. F. (2010) Which moss is which? Identification of the threatened moss Orthodontium gracile using molecular and morphological techniques. Conserv. Genet. 11 1033-1042.

Schofield, R. K. and Taylor, A. W. (1955) The measurement of soil pH. Proc. Soil Sci. Soc. Am. 19, 164-7.

Smith, A. J. E. (2004) The moss flora of Britain and Ireland. 2nd edn. Cambridge University Press, Cambridge.

Soilscapes (2010) an interactive website showing common soil types. National Soil Resources Institute, Cranfield University http://www.landis.org.uk/soilscapes/, developed with the help of Defra.

Spagnuolo, V., Caputo, P., Cozzolino, S., Castaldo, R., and de Luca, P. (1999) Patterns of Relationships in Trichostoimideae (Pottiaceae, Musci). Pl. Syst. Evol. 216, 69-79.

Stech, M. and Quandt, D. (2010) 20,000 species and five key markers: the status of molecular bryophyte phylogenetics. Phytotaxa 9, 196-228.

Taberlet, P., Gielly, L., Pautou, G., and Bouvet, J. (1991) Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Mol. Biol. 17, 1105-1109.

Taberlet, P., Coissac, E., Pompanon, F., Gielly, L., Miquel, C., Valentini, A., Vermat, T., Corthier, G., Brochmann, C. and Willerslev, E. (2006) Power and limitations of the chloroplast trnL (UAA) intron for plant DNA barcoding. Nucl. Acids Res. 35, (3) e14.

Thien, S. J. (1979) A flow diagram for teaching texture by feel analysis. Journal of Agronomic Education 8:54-55. http://soils.usda.gov/education/resources/lessons/texture/

Tyler, T. (2005) The Bryophyte flora of Scanian sand-steppe vegetation and its relationship to soil pH and phosphate availability. Lindbergia 30, 11-20.

Werner, O., Ros, R. M., and Grundmann, M. (2005) Molecular Phylogeny of Trichostomoideae (Pottiaceae, Bryophyta) Based on nrITS Sequence Data. Taxon 54 (2), 361-368.

White, T. J., Bruns, T., Lee, S., and Taylor, J. (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M., Gelfand, D., Sninsky, J., and White, T. (Eds.), PCR Protocols: a Guide to Methods and Applications. Academic Press, San Diego pp315-322.

36

APPENDIX 1. PERSONNEL

Fera Surveys for Weissia squarrosa and W. multicapsularis

Mr. S. T. Conyers and Ms. S. R. Laybourn were present for all surveys.

Fera Genetic Studies

Mrs. C. M. Conyers and Mr. S. T. Conyers.

Fera Germination studies for W. squarrosa and W. multicapsularis

Mr. S. T. Conyers and Ms. S. R. Laybourn.

Weissia squarrosa

Main advisor: Mr. S.D.S. Bosanquet, Bryophyte expert for Countryside Council of Wales. Co author of paper on Weissia squarrosa, its identification and ecology: Bosanquet, S.D.S. and Preston, C.D. (2005) Weissia squarrosa in Britain: a re-evaluation of its identification and ecology in the light of recent records. Field Bryology 86, 2-13. BBS Vice-county recorder for Pembrokeshire.

Contacts in Natural England

Mr B. McCarthy of the Natural England (NE) Species Recovery Programme Manager provided contacts within the regional teams for NE.

Staffordshire

Initial contact through Mr. I. Diack, Senior Specialist with Evidence Team in Telford. Mr M. Lawrence, Team Leader, Land Management and Conservation, Staffordshire, Birmingham and the Black Country Team provided the addresses and option information.

Worcestershire

Addresses were provided by Ms. J. Hughes, Team Leader, Land Management and Conservation for Warwickshire & Worcestershire and Mr. M. Cotterrill, Geographic Information Coordinator, West Midlands.

Surrey

Addresses were provided by Ms. G. Terry, Land Management and Conservation Advisor, Ecological support in Surrey team.

Sussex

Addresses were provided by Mr. A. Hincks, South East Land Management Programme Coordinator. Contact was also made with Ms. C. Laing, Advisor supporting Weald and Pevensey Levels Land Management and BAP species coordinator for her team.

Gloucestershire and Lincolnshire

Mr. G. Measures, Species Recovery Programme Delivery Leader, Regulatory Services and Access Team, Natural England

Gloucestershire: Bryophyte identification

Mr. R. V. Lansdown: BBS Vice-county co-recorder for Gloucestershire

Weissia multicapsularis

Main advisor: Dr. D. Holyoak, past license holder for this species and the previous conservation advisor to NE for the last ten years. BBS Vice-county recorder for Cornwall.

37

Licensing Service

We received help and advice in this application from Mr. A. Tucker, Senior Licensing Officer, and Ms. N. Ewins, Wildlife Licensing Officer who dealt with our application at short notice.

Cornwall

Ms. B. Tonkin, NE Conservation Advisor for Carrick District and the NE lead for this BAP species. NE liaison for surveys of the SSSIs. She provided all the previous reports for this species which were done for NE by DH.

Ms. L. Griffiths, Conservation Adviser for NE in Roseland & Mevagissey areas with responsibility for Carricknath Point to Porthbean Beach SSSI.

Mr. R. Glasson, Adviser within NE Land and Sea Management Team, East Cornwall with responsibility for Talland Barton Farm SSSI.

38

APPENDIX 2. SEQUENCES OF PRIMERS

Primer Primer sequence Author nrITS Forward 5’ TCCTCCGCTTATTGATATGC 3’ 18S (Spagnuolo et al, 1999) Reverse 5’ GGAGAAGTCGTAACAAGGTTTC 3’ ITS4 (White et al, 1990)

trnL-trnF Forward 5’ CGAAATCGGTAGACGCTACG 3’ BryC (Taberlet, 1991) Reverse 5’ATTTGAACTGGTGACACGAG 3’ BryF (Taberlet, 1991)

rbcL Forward 5’ ATGTCACCACAAACAGAGACTAAAGC 3’ rbcLaF (Liu et al, 2010) Reverse 5’ CTTCTGCTACAAATAAGAATCGATCTC 3’ rbcLaR (Liu et al, 2010)

trnH-psbA Forward 5’ ACTGCCTTGATCCACTTGGC 3’ trnH-psbAF (Liu et al, 2010) Reverse 5’ CGAAGCTCCATCTACAAATGG 3’ trnH-psbAR (Liu et al, 2010)

39

APPENDIX 3. BRYOPHYTES RECORDED DURING SURVEY OF OVER-WINTERED STUBBLE FIELDS IN LINCOLNSHIRE AND GLOUCESTERSHIRE

Grid Farm Field No. Taxon reference Lincolnshire 3 TF0527 Barbula unguiculata Farm 7 3 TF0527 Fissidens bryoides 3 TF0527 Fissidens taxifolius var. taxifolius 3 TF0527 Funaria hygrometrica 3 TF0527 Oxyrrhynchium hians 3 TF0527 Tortula truncata 3 TF0527 Weissia brachycarpa var. obliqua 3 TF0527 Weissia longifolia var. angustifolia Gloucestershire 1-3 ST8393 Barbula convoluta var. convoluta Farm 2 1-3 ST8393 Barbula convoluta var. sardoa 1-3 ST8393 Barbula unguiculata 1-3 ST8393 Brachythecium rutabulum 1-3 ST8393 Bryum dichotomum 1-3 ST8393 Bryum rubens 1-3 ST8393 Calliergonella cuspidata 1-3 ST8393 Dicranella staphylina 1-3 ST8393 Dicranella varia 1-3 ST8393 Didymodon rigidulus 1-3 ST8393 Fissidens taxifolius var. taxifolius 1-3 ST8393 Oxyrrhynchium hians 1-3 ST8393 Phascum cuspidatum var. cuspidatum 1-3 ST8393 Phascum cuspidatum var. piliferum 1-3 ST8393 Tortula muralis 1-3 ST8393 Tortula truncata 4 ST8194 Amblystegium serpens var. serpens 4 ST8194 Anomodon viticulosus 4 ST8194 Barbula convoluta var. sardoa 4 ST8194 Barbula unguiculata 4 ST8194 Brachythecium rutabulum 4 ST8194 Dicranella schreberiana 4 ST8194 Dicranella staphylina 4 ST8194 Dicranella varia 4 ST8194 Fissidens taxifolius var. taxifolius 4 ST8194 Funaria hygrometrica

40

Appendix 3. (Continued) Bryophytes recorded during survey of over-wintered stubble fields in Gloucestershire Grid Farm Field No. Taxon reference Gloucestershire Farm 2 (Continued) 4 ST8194 Homalothecium sericeum 4 ST8194 Kindbergia praelonga 4 ST8194 Neckera complanata 4 ST8194 Oxyrrhynchium hians 4 ST8194 Phascum cuspidatum var. cuspidatum 4 ST8194 Porella platyphylla 4 ST8194 Rhynchostegium confertum 4 ST8194 Riccia glauca 4 ST8194 Riccia sorocarpa 4 ST8194 Tortula muralis 4 ST8194 Tortula truncata 4 ST8194 Trichodon cylindricum 4 ST8194 Weissia brachycarpa var. obliqua 4 ST8194 Weissia longifolia var. angustifolia 7 ST8294 Barbula unguiculata 7 ST8294 Bryum dichotomum 7 ST8294 Bryum rubens 7 ST8294 Dicranella staphylina 7 ST8294 Dicranella varia 7 ST8294 Didymodon sinuosus 7 ST8294 Grimmia pulvinata 7 ST8294 Homalothecium sericeum 7 ST8294 Neckera complanata 7 ST8294 Oxyrrhynchium hians 7 ST8294 Phascum cuspidatum var. cuspidatum 7 ST8294 Porella platyphylla 7 ST8294 Schistidium crassipilum 7 ST8294 Syntrichia montana 7 ST8294 Tortula muralis 7 ST8294 Tortula truncata 7 ST8294 Trichodon cylindricum 7 ST8294 Weissia longifolia var. angustifolia 7 ST8294 Weissia longifolia var. longifolia

41

Appendix 3. (Continued) Bryophytes recorded during survey of over-wintered stubble fields in Gloucestershire Farm Field No. Grid reference Taxon Gloucestershire Farm 3 1 ST8395 Amblystegium serpens var. serpens 1 ST8395 Barbula convoluta var. sardoa 1 ST8395 Barbula unguiculata 1 ST8395 Brachythecium rutabulum 1 ST8395 Bryum argenteum 1 ST8395 Bryum dichotomum 1 ST8395 Cryphaea heteromalla 1 ST8395 Dicranella staphylina 1 ST8395 Dicranella varia 1 ST8395 Didymodon sinuosus 1 ST8395 Funaria hygrometrica 1 ST8395 Grimmia pulvinata 1 ST8395 Homalothecium sericeum 1 ST8395 Kindbergia praelonga 1 ST8395 Microbryum floerkianum 1 ST8395 Neckera complanata 1 ST8395 Orthotrichum affine 1 ST8395 Oxyrrhynchium hians 1 ST8395 Phascum cuspidatum var. cuspidatum 1 ST8395 Porella platyphylla 1 ST8395 Rhynchostegium confertum 1 ST8395 Schistidium crassipilum 1 ST8395 Syntrichia montana 1 ST8395 Tortula muralis 1 ST8395 Tortula truncata

42

Appendix 3. (Continued) Bryophytes recorded during survey of over-wintered stubble fields in Gloucestershire Farm Field No. Grid reference Taxon Gloucestershire 1 and 2 ST9997 Barbula convoluta var. sardoa Farm 4 1 and 2 ST9997 Barbula unguiculata 1 and 2 ST9997 Brachythecium rivulare 1 and 2 ST9997 Brachythecium rutabulum 1 and 2 ST9997 Bryum argenteum 1 and 2 ST9997 Bryum capillare 1 and 2 ST9997 Bryum dichotomum 1 and 2 ST9997 Bryum rubens 1 and 2 ST9997 Bryum violaceum 1 and 2 ST9997 Cratoneuron filicinum 1 and 2 ST9997 Dicranella schreberiana 1 and 2 ST9997 Dicranella staphylina 1 and 2 ST9997 Dicranella varia 1 and 2 ST9997 Didymodon sinuosus 1 and 2 ST9997 Funaria hygrometrica 1 and 2 ST9997 Hypnum cupressiforme var. resupinatum 1 and 2 ST9997 Kindbergia praelonga 1 and 2 ST9997 Orthotrichum affine 1 and 2 ST9997 Orthotrichum diaphanum 1 and 2 ST9997 Oxyrrhynchium hians 1 and 2 ST9997 Phascum cuspidatum var. cuspidatum 1 and 2 ST9997 Phascum cuspidatum var. schreberianum 1 and 2 ST9997 Pohlia melanodon 1 and 2 ST9997 Rhynchostegium confertum 1 and 2 ST9997 Schistidium crassipilum 1 and 2 ST9997 Syntrichia montana 1 and 2 ST9997 Tortula muralis 1 and 2 ST9997 Tortula truncata 1 and 2 ST9997 Trichodon cylindricum 1 and 2 ST9997 Weissia longifolia var. angustifolia 1 and 2 ST9997 Zygodon viridissimus var. viridissimus

43

Appendix 3. (Continued) Bryophytes recorded during survey of over-wintered stubble fields in Gloucestershire Farm Field No. Grid reference Taxon Gloucestershire Farm 4 3 ST9898 Amblystegium serpens var. serpens (Continued) 3 ST9898 Barbula unguiculata 3 ST9898 Brachythecium rivulare 3 ST9898 Brachythecium rutabulum 3 ST9898 Bryum argenteum 3 ST9898 Bryum dichotomum 3 ST9898 Bryum rubens 3 ST9898 Calliergonella cuspidata 3 ST9898 Cinclidotus fontinaloides 3 ST9898 Cratoneuron filicinum 3 ST9898 Dicranella schreberiana 3 ST9898 Dicranella staphylina 3 ST9898 Dicranella varia 3 ST9898 Didymodon sinuosus 3 ST9898 Ephemerum minutissimum 3 ST9898 Fissidens taxifolius var. taxifolius 3 ST9898 Frullania dilatata 3 ST9898 Homalothecium sericeum 3 ST9898 Hygroamblystegium tenax 3 ST9898 Hypnum cupressiforme var. resupinatum 3 ST9898 Kindbergia praelonga 3 ST9898 Neckera complanata 3 ST9898 Orthotrichum anomalum 3 ST9898 Orthotrichum diaphanum 3 ST9898 Oxyrrhynchium hians 3 ST9898 Phascum cuspidatum var. cuspidatum 3 ST9898 Phascum cuspidatum var. piliferum 3 ST9898 Phascum cuspidatum var. schreberianum 3 ST9898 Pseudoscleropodium purum 3 ST9898 Rhynchostegium confertum 3 ST9898 Syntrichia laevipila 3 ST9898 Syntrichia montana 3 ST9898 Syntrichia virescens 3 ST9898 Thamnobryum alopecurum

44

Appendix 3. (Continued) Bryophytes recorded during survey of over-wintered stubble fields in Gloucestershire Farm Field No. Grid reference Taxon Gloucestershire 1 SO9906 Barbula convoluta var. convoluta Farm 5 1 SO9906 Barbula convoluta var. sardoa 1 SO9906 Barbula unguiculata 1 SO9906 Brachythecium rutabulum 1 SO9906 Bryum capillare 1 SO9906 Bryum dichotomum 1 SO9906 Bryum rubens 1 SO9906 Bryum violaceum 1 SO9906 Ceratodon purpureus 1 SO9906 Dicranella schreberiana 1 SO9906 Dicranella staphylina 1 SO9906 Dicranella staphylina 1 SO9906 Dicranella varia 1 SO9906 Dicranella varia 1 SO9906 Didymodon fallax 1 SO9906 Didymodon sinuosus 1 SO9906 Ephemerum minutissimum 1 SO9906 Ephemerum recuvifolium 1 SO9906 Funaria hygrometrica 1 SO9906 Grimmia pulvinata 1 SO9906 Homalothecium sericeum 1 SO9906 Hypnum cupressiforme var. lacunosum 1 SO9906 Hypnum cupressiforme var. resupinatum 1 SO9906 Kindbergia praelonga 1 SO9906 Microbryum floerkianum 1 SO9906 Neckera complanata 4 SO9906 Orthotrichum affine 4 SO9906 Orthotrichum cupulatum 4 SO9906 Oxyrrhynchium hians 4 SO9906 Oxyrrhynchium hians 4 SO9906 Phascum cuspidatum var. cuspidatum 4 SO9906 Phascum cuspidatum var. piliferum 4 SO9906 Porella platyphylla 4 SO9906 Pseudocrossidium hornschuchianum 4 SO9906 Tortula muralis 4 SO9906 Weissia longifolia var. angustifolia

45

Appendix 3. (Continued) Bryophytes recorded during survey of over-wintered stubble fields in Gloucestershire Farm Field No. Grid reference Taxon Gloucestershire 1 SP1406 Barbula unguiculata Farm 6 1 SP1406 Brachythecium rivulare 1 SP1406 Brachythecium rutabulum 1 SP1406 Bryum dichotomum 1 SP1406 Dicranella varia 1 SP1406 Ephemerum minutissimum 1 SP1406 Fissidens exilis 1 SP1406 Fissidens taxifolius var. taxifolius 1 SP1406 Kindbergia praelonga 1 SP1406 Oxyrrhynchium hians 1 SP1406 Phascum cuspidatum var. cuspidatum 1 SP1406 Riccardia chamaedryfolia 1 SP1406 Riccia sorocarpa 1 SP1406 Tortula muralis 1 SP1406 Tortula truncata 1 SP1406 Weissia longifolia var. angustifolia

46

APPENDIX 4. RESULTS OF GENETIC STUDIES WITH nrITS REGION

Collection Probable Match Base Sample Date Identification GenBank® Results Site Species (%) Differences Dingestow Site W. 1 28/01/10 SB W. squarrosa 98 2 1 (SO4409) brachycarpa W. hedwigii 97 4 W. artocosana 93 21

Chepstow 2 W. longifolia 28/01/10 SB W. rostellata 99 2 (ST5292) W. levieri 99 3 W. longifolia 99 4

Dingestow Site W. 3 28/01/10 SB W. multicapsularis 98 0 2 (SO4409) multicapsularis W. brachycarpa 97 6 W. condensa var. 97 7 armata

Llandegfedd W. 4 Reservoir 28/01/10 SB W. controversa 99 1 controversa (ST3199) W. condensa 99 1 W. levieri 99 2

Chepstow 5 Aloina aloides 28/01/10 SB No match - - (ST5292)

Dingestow Site 6 W. squarrosa 28/01/10 SB Didymodon vinealis - - 1 (SO4409)

Dingestow Site W. 7 28/01/10 SB No result - - 2 (SO4409) controversa

Chepstow W. W. controversa var. 8 28/01/10 SB 99 3 (ST5292) controversa densifolia W. condensa 99 3 W. levieri 98 4

W. Llanddowror 9 controversa 24/03/2010 Sent by SB No result - - (SW256146) var. crispata

47

Appendix 4. (Continued) Results of genetic studies with nrITS region

Collection Probable Match Bases Sample Date Identifier GenBank® Results Site Species (%) Difference Allt Tai-cid 10 W. rutilans 04/04/2010 Sent by SB No result - - (SN530319)

W. Lydstep Head 11 controversa 24/03/2010 Sent by SB W. controversa 97 6 (SS091977) var. crispata W. brachycarpa 97 8 W. multicapsularis 96 5 Carricknath Point to Porthbean W. 12 30/03/2010 DH W. multicapsularis 99 0 Beach SSSI multicapsularis (Site B) SW8733 W. controversa var. 99 1 densifolia W. longifolia 99 2

W. St Clears brachycarpa 13 24/03/2010 Sent by SB W. squarrosa 97 1 (SN128157) var. brachycarpa W. hedwigii 97 1 W. ludoviciana 95 9

W. Lizard Site 1 W. controversa var. 14 brachycarpa 31/03/2010 DH 99 2 (SW7113) densifolia var. obliqua W. levieri 99 3 W. condensa 98 5

Surrey/Sussex W. 15 Farm 6 brachycarpa or 16/02/2010 FERA Protobryum sp. (TQ3719) squarrosa

W. Carmel 16 brachycarpa 26/03/2010 Sent by SB W. squarrosa 96 9 (SN590161) var. obliqua W. hedwigii 96 10 W. rutilans 94 20

48

Appendix 4. (Continued) Results of genetic studies with nrITS region

Collection Probable Match Bases Sample Date Identifier GenBank® Results Site Species (%) Difference Surrey/Sussex W. 17 Farm 2 (Visit brachycarpa or 19/03/2010 FERA W. squarrosa 96 9 2) squarrosa W. hedwigii 96 10 W. rutilans 94 20

Pentire Point W. 18 East site 1 30/03/2010 DH W. rutilans 94 19 controversa. (SW7861) W. artocosana 93 22 W. squarrosa 89 35

Surrey/Sussex W. 19 Farm 6 brachycarpa or 18/03/2010 FERA W. squarrosa 98 3 (TQ3719) squarrosa W. hedwigii 97 5 W. rutilans 92 20

Surrey/Sussex W. 20 Farm 6 brachycarpa or 18/03/2010 FERA W. squarrosa 99 0 (TQ3719) squarrosa W. hedwigii 99 0 W. controversa 95 6

Pentire Point W. Fungal 21 East site 2 30/03/2010 DH - - controversa contamination (SW7861)

Surrey/Sussex W. 22 Farm 6 brachycarpa or 18/03/2010 FERA W. squarrosa 98 3 (TQ3719) squarrosa W. hedwigii 97 5 W. rutilans 92 20

Talland Bay W. W. condensa var. 23 01/04/2010 DH 99 2 (SX2251) controversa armata W. controversa 99 2 W. rostellata 98 2

49

Appendix 4. (Continued) Results of genetic studies with nrITS region

Collection Probable Match Base Sample Date Identifier GenBank® Results Site Species (%) Differences Lizard site 1 W. controversa var. 24 W. perssonii 31/03/2010 DH 99 3 (SW7113) densifolia W. controversa 99 5 W. condensa var. 99 23 armata

Surrey/Sussex W. 25 Farm 2 brachycarpa or 19/03/2010 FERA W. squarrosa 96 7 (TQ1944) squarrosa W. hedwigii 96 8 W. rutilans 94 18

Lizard site 1 W. W. controversa var. 26 30/03/2010 DH 98 2 (SW7113) controversa densifolia W. controversa 98 2 W. multicapsularis 98 2

Pentire Point W. W. controversa var. 27 East site 2 30/03/2010 DH 99 3 controversa densifolia (SW7861) W. controversa 99 5 W. levieri 99 3

W. Lizard site 2 W. controversa var. 28 brachycapra 31/03/2010 DH 99 2 (SW7113) densifolia var. obliqua W. controversa 99 4 W. condensa 98 5

Lizard site 2 W. W. controversa var. 29 31/03/2010 DH 99 2 (SW7113) controversa densifolia W. controversa 99 4 W. condensa 98 5

Pentire Point W. W. controvers var. 30 East site 2 30/03/2010 DH 99 1 controversa densifolia a (SW7861) W. controversa 99 3 W. levieri 98 2

50

Appendix 4. (Continued) Results of genetic studies with nrITS region

Collection Probable Match Base Sample Date Identifier GenBank® Results Site Species (%) Differences Brea Hill, E. W. longifolia Collected by 31 Cornwall var. 06/01/2002 No result - - DH (SW9277) angustifolia

Newton on W. rostellata (100 Trent, W. longifolia Collected by 32 20/03/2010 match with sample 99 2 Nottingham var. longifolia DH 2) (SK8374) W. levieri 99 3 W. longifolia 99 4

Talland Barton W. multicapsularis W. Collected by 33 Farm SSSI 30/04/2004 99 0 multicapsularis DH (match 99with (SX2251) sample 3) W. brachycarpa 98 6 W. condensa var. 97 7 armata

51

APPENDIX 5. INITIAL SAMPLES OF WEISSIA FOR GENETIC TESTING: THEIR LOCATION, COLLECTION DATE, VERIFIER, GENBANK® RESULT USING nrITS REGION AND GROUPINGS FROM trnL-trnF AND rbcL

Results Sample Collection trnL- Site Species Verifier* nrITS GenBank® rbcL No. Date trnF Dingestow 1 Site 1 W. brachycarpa 28/01/10 SB W. squarrosa 1 1 (SO4409) Chepstow 2 W. longifolia 28/01/10 SB W. rostellata 2 2 (ST5292) Dingestow W. 3 Site 2 28/01/10 SB W. multicapsularis 3 3 multicapsularis (SO4409) Llandegfedd 4 Reservoir W. controversa 28/01/10 SB W. controversa 4 1 (ST3199) Chepstow 5 Aloina aloides 28/01/10 SB No match - - (ST5292) Didymodon Dingestow vinealis (Error 6 Site 1 W. squarrosa 28/01/10 SB - - with sample (SO4409) collection) Dingestow 7 Site 2 W. controversa 28/01/10 SB No result - - (SO4409) Chepstow W. controversa Not Not 8 W. controversa 28/01/10 SB (ST5292) var. densifolia done done Llanddowror W. controversa Collected 9 24/03/2010 No result - - (SW256146) var. crispata by SB Allt Tai-cid Collected 10 W. rutilans (f) 04/04/2010 No result - - (SN530319) by SB W. Lydstep Head W. controversa Collected multicapsularis/W. Not Not 11 24/03/2010 (SS091977) var. crispata by SB brachycarpa done done (Match not good) Carricknath Point to Porthbean W. 12 30/03/2010 DH W. multicapsularis 5 4 Beach SSSI multicapsularis (Site B) (SW8733) W. brachycarpa St Clears Collected 13 var. 24/03/2010 W. squarrosa 1 1 (SN128157) by SB brachycarpa *SB = Mr S. D. S. Bosanquet; DH = Dr D. Holyoak. trnL-trnF : Group 1 = W. brachycarpa, Group 2 = W. longifolia, Group 3 = W. multicapsularis, Group 4 = W. controversa, Group 5 = W. multicapsularis; Group 6 = W. squarrosa. rbcL: Group 1 = W. brachycarpa, W. controversa, W. squarrosa; Group 2 = W. longifolia; Group 3 = W. multicapsularis. 52

Appendix 5. (Continued) Initial samples of Weissia for genetic testing Results Sample Collection nrITS trnL- Site Species Verifier* rbcL# No. Date GenBank® trnF W. Lizard Site 1 W. controversa Not Not 14 brachycarpa 31/03/2010 DH (SW7113) var. densifolia done done var. obliqua Surrey/Sussex W. 15 Farm 6 brachycarpa 18/03/2010 - Protobryum sp. - - (TQ3719) or squarrosa W. W. squarrosa Carmel Collected by 16 brachycarpa 26/03/2010 (Match not 1 1 (SN590161) SB var. obliqua good) Surrey/Sussex W. SB – W. squarrosa Not Not 17 Farm 1 brachycarpa 19/03/2010 possible W. (Match not done done (TQ1944) or squarrosa squarrosa good) Pentire Point W. rutilans W. Not Not 18 East site 1 30/03/2010 DH (Match not controversa done done (SW7861) good) Surrey/Sussex W. SB – 19 Farm 6 brachycarpa 18/03/2010 possible W. W. squarrosa 6 1 (TQ3719) or squarrosa squarrosa Surrey/Sussex W. SB – W. Not Not 20 Farm 6 brachycarpa 18/03/2010 W. squarrosa brachycarpa done done TQ3719 or squarrosa Pentire Point W. Fungal Not Not 21 East site 2 30/03/2010 DH controversa contamination done done (SW7861) Surrey/Sussex W. SB – W. Not Not 22 Farm 6 brachycarpa 18/03/2010 W. squarrosa brachycarpa done done (TQ3719) or squarrosa Talland Barton W. W. condensa/W. 23 Farm SSSI 01/04/2010 DH 4 1 controversa controversa (SX2251) Lizard site 1 24 W. perssonii 31/03/2010 DH W. controversa 4 1 (SW7113) Surrey/Sussex W. Not Not 25 Farm 1 brachycarpa 19/03/2010 - W. squarrosa done done (TQ1944) or squarrosa Lizard site 1 W. Not Not 26 30/03/2010 DH W. controversa (SW7113) controversa done done Pentire Point W. Not Not 27 East site 2 30/03/2010 DH W. controversa controversa done done (SW7861) *SB = Mr S. D. S. Bosanquet; DH = Dr D. Holyoak. trnL-trnF : Group 1 = W. brachycarpa, Group 2 = W. longifolia, Group 3 = W. multicapsularis, Group 4 = W. controversa, Group 5 = W. multicapsularis; Group 6 = W. squarrosa. rbcL: Group 1 = W. brachycarpa, W. controversa, W. squarrosa; Group 2 = W. longifolia; Group 3 = W. multicapsularis.

53

Appendix 5. (Continued) Initial samples of Weissia for genetic testing Results Sample Collection nrITS trnL- Site Species Verifier* rbcL No. Date GenBank® trnF W. Lizard site 2 Not Not 28 brachycarpa 31/03/2010 DH W. controversa (SW7113) done done var. obliqua Lizard site 2 W. Not Not 29 31/03/2010 DH W. controversa (SW7113) controversa done done Pentire Point W. Not Not 30 East site 2 30/03/2010 DH W. controversa controversa done done (SW7861) W. longifolia 06/01/2002 Brea Hill Collected by 31 var. (Dried No result - - (SW9277) DH angustifolia specimen) Newton on 20/03/2010 W. rostellata W. longifolia Collected by 32 Trent (Dried (100 match with 2 2 var. longifolia DH (SK8374) specimen) sample 2) Talland Barton 30/04/2004 W. Collected by W. 33 Farm SSSI (Dried 3 3 multicapsularis DH multicapsularis (SX2251) specimen) *SB = Mr S. D. S. Bosanquet; DH = Dr D. Holyoak. trnL-trnF : Group 1 = W. brachycarpa, Group 2 = W. longifolia, Group 3 = W. multicapsularis, Group 4 = W. controversa, Group 5 = W. multicapsularis; Group 6 = W. squarrosa. rbcL: Group 1 = W. brachycarpa, W. controversa, W. squarrosa; Group 2 = W. longifolia; Group 3 = W. multicapsularis.

54

APPENDIX 6. SAMPLES OF WEISSIA FROM trnL-trnF ANALYSIS: THEIR LOCATION, COLLECTION DATE, VERIFIER AND SAMPLE CODE

Sample code for Ref Location Probable species Date Identifier sequence comparison

Weissia brachycarpa Group

1 Dingestow (SO4409) W. brachycarpa 28/01/2010 SB WbracDin

W. brachycarpa var 13 St Clears (SN128157) 24/03/2010 SB WbracStC brachycarpa

W. brachycarpa var 16 Carmel (SN590161) 26/03/2010 SB WbracCar obliqua

Gloucs Farm 5 W. brachycarpa var C7 24/02/2011 RL, RLay&SC WbracDag obliqua 1(SO9905)

Gloucs Farm 2 C10(2) W. squarrosa 23/02/2011 RL, RLay&SC WbracVer4 4 (ST8194)

C17 Painswick Beacon (SO8612) W. condensa 25/02/2011 RL, RLay&SC WbracPain

C23 HaresBeacon (SO8208) W. brachycarpa 25/02/2011 RL, RLay&SC WbracHare

Lincs Farm 7 P5l W. brachycarpa 10/02/2011 RLay&SC WbracLinc 3 (TF0527)

P23A Devil's Dyke (TL5864) W. brachycarpa 17/02/2011 RLay WbracDev

T3 Pentire Point East site 1 (SW7861) W. controversa 30/03/2010 DH WbracPP

55

Appendix 6. (Continued) Samples of Weissia from trnL-trnF analysis: their location, collection date, verifier and sample code

Weissia controversa Group

Sample code for sequence Ref Location Probable species Date Identifier comparison

W. controversa var 11 Lydstep Head SS091977 24/03/2010 SB WcontLyd crispata

23 Talland Barton Farm SSSI SX2251 W. controversa 01/04/2010 DH WcontTal

24 Lizard site 1 (SW7113) W. perssonii 31/03/2010 DH WcontPers

26 Lizard site 1 (SW7113) W. controversa 30/03/2010 DH WcontLiz

27 Pentire Point East site 2 (SW7861) W. controversa 30/03/2010 DH WcontPenT

Carricknath Point to Porthbean Beach P1c W. controversa 16/03/2011 RLay&SC WcontRos SSSI (Site B) (SW8733)

30/3/2010, Carricknath Point to Porthbean Beach P19A W. multicapsularis resampled RLay&SC WcontRos2 SSSI (Site B) (SW8733) 26/09/2011

W. brachycarpa var. T2 Lizard site 2 (SW7113) 31/03/2010 DH WcontLiz2 obliqua

Weissia controversa var. densifolia Group

4 Llandegfedd Reservoir (ST3199) W. controversa 28/01/2010 SB WcontWal

56

Appendix 6. (Continued) Samples of Weissia from trnL-trnF analysis: their location, collection date, verifier and sample code

Sample code for sequence Ref Location Probable species Date Identifier comparison

Weissia squarrosa Group

Surrey/Sussex Farm 6 W. brachycarpa or W. 19 18/03/2010 SB – W. squarrosa possible WsquTow1 3 (TQ3719) squarrosa

Surrey/Sussex Farm 6 W. brachycarpa or W. SB - W. brachycarpa var. 22 18/03/2010 WsquTow3 3 (TQ3719) squarrosa brachycarpa probable

Surrey/Sussex Farm 1 W. brachycarpa or W. 25 19/03/2010 RLay&SC WsquFor1 2 (TQ1944) squarrosa

Surrey/Sussex Farm 6 W. brachycarpa or W. P6 18/03/2010 SB – W. brachycarpa WsquTow2 3 (TQ3719) squarrosa

Surrey/Sussex Farm 1 W. brachycarpa or W. Pm17 19/03/2010 SB – W. squarrosa probable WsquFor2 2 (TQ1944) squarrosa

Surrey/Sussex Farm 6 W. brachycarpa or W. SB - W. brachycarpa var. T5 18/03/2010 WsquTow 3 (TQ3719) squarrosa brachycarpa

57

Appendix 6. (Continued) Samples of Weissia from trnL-trnF analysis: their location, collection date, verifier and sample code

Sample code for sequence Ref Location Probable species Date Identifier comparison

Weissia longifolia Group

2 Chepstow (ST5292) W. longifolia 28/01/2010 SB WlongWal W. longifolia var. 32 Newton on Trent (SK8374) 20/03/2010 DH WlongLinc1 longifolia

Gloucs Farm 5 W. longifolia var. C3 24/02/2011 RL, RLay&SC WlongDag1 1 (SO9905) longifolia

Gloucs Farm 2 W. longifolia var. C4 23/02/2011 RL, RLay&SC WlongVern3 3 (ST8393) longifolia Gloucs Farm 5 C16 W. sterilis? 24/02/2011 RL, RLay&SC WlonDag2 1 (SO9905)

Gloucs Farm 2 W. longifolia var. C20 23/02/2011 RL, RLay&SC WlongVern7 7 (ST8393) longifolia

Gloucs Farm 2 W. longifolia var. C22 23/02/2011 RL, RLay&SC WlongVern5 5 (ST8393) longifolia Lincs Farm 5 P2 W. longifolia 10/02/2011 RLay&SC WlongSkel1 2 (SK9632) Lincs Farm 7 P5s W. longifolia 10/02/2011 RLay&SC WlongWrig 2 (TF0527) Lincs Farm 4 T4 W. longifolia 09/02/2011 RLay&SC WlongKnig 1 (TF0533) T12 Painswick Beacon (SO8612) W. sterilis? 25/02/2011 RL, RLay&SC WlongPain1

58

Appendix 6. (Continued) Samples of Weissia from trnL-trnF analysis: their location, collection date, verifier and sample code

Sample code for sequence Ref Location Probable species Date Identifier comparison Weissia multicapsularis Group 3 Dingestow (SO4409) W. multicapsularis 28/01/2010 SB WmultWal

33 Talland Barton Farm SSSI W. multicapsularis 30/04/2004 DH WmultTall

Weissia multicapsularis Rosteague Group Carricknath Point to 12 Porthbean Beach SSSI (Site W. multicapsularis 30/03/2010 DH WmultRos B) (SW8733)

Weissia levieri Group Rhossili Lookout Station, W. levieri 16/02/2011 SB WlevRhos Gower Peninsular SS4087

Tears Point Valley, Gower W. levieri 16/02/2011 SB WlevGow Peninsular SS4087

Additional Weissia samples that do match each other or any other group Pentire Point East site 2 P18 W. multicapsularis 13/04/2011 RLay&SC WmultiPen (SW7861)

P23B Devil's Dyke (TL5864) W. longifolia 17/02/2011 RLay Wlonvang

59

APPENDIX 7. LOCATION OF SOIL SAMPLE, THEIR NUMBER AND RESULTS OF GERMINATION AND SUBSEQUENT GROWTH AT 20OC AND 60 R.H.

Time at 20oC and 60 rh 2 months 10 months Total Section of core sample Farm Survey region Location Sample Top Bottom Top Bottom Top Bottom Number 1 x x x x x x 2 x x x x x x 2 (SJ9008) 3 x 2 x x x 2 Staffordshire 2 North boundary 4 x x x x x x Riccia sp. location 5 x x x x x x 6 x 2 x x x 2 2 (TQ1944) 1 1 x x x 1 x 1 near woodland edge 2 x x x x x x 1 (TQ5623) 2 1 x x x x x x Fossombronia sp. location 2 (TQ3638) 4 Wild Bird seed margin 1 x x x x x x Riccia sp. location Surrey/Sussex 1 x x x x x x 2 x 2 x x x 2 3 x 1 x x x 1 3 (TQ3719) 6 4 x x x x x x Weissia sp. and Riccia sp. locations 5 x x x x x x 6 x x x x x x 7 x x x x x x

60

APPENDIX 8: TEXT FOR ADVISORY LEAFLET FOR THE CONSERVATION OF ARABLE MOSSES

Mosses and their relatives are important and often overlooked constituents of the arable environment. They help to retain soil moisture and support a microscopic array of animals that are at the bottom of the food chain. Their presence helps to sustain some of the insects that are beneficial for crop protection. Many moss species are reliant upon the production of spores as their method of reproduction and their means of surviving cultivation. The spores of most of these mosses germinate in the autumn on open, bare soil, and then mature and produce sporophytes over the winter period from November to February. This growth strategy is well adapted to a cropping regime of spring-sown crops followed by over-wintered stubbles. The latter habitats are ideal for mosses with annual life cycles, as germination, growth and spore development can occur with minimum competition from higher plants, another factor limiting for mosses. However there are a group of arable mosses in need of conservation that have more extended perennial life cycles. These require two or three years of growth to reach maturity and spore production.

The change to a predominantly autumn sowing cropping pattern that has occurred over the past few decades, gives even annual mosses little opportunity to establish. These changes in cropping patterns have been implicated in the decline of many arable bryophytes. The spore ‘bank’ in the soil is depleted due to the repeated cultivations and there is a lack of replacement spores as any mosses that manage to germinate often fail to reach maturity during this period. The use of stubble within a cropping regime helps to alleviate this problem, but often the interim period between stubbles is too long. An even better habitat would be achieved with an extended period of fallow for at least three winters that would allow all moss species to achieve spore production. This could be achieved with the establishment of a narrow field-edge margin after harvest. It would be helpful if this strip was free from litter as this limits the availability of bare soil. No cultivation is necessary at the outset as a firm soil surface helps with the establishment of mosses, and none is required for the duration of the fallow period. Herbicide application may be carried out in the spring to remove any undesirable weed species or excessive growth of volunteers. At the end of the period the margin would be returned to cropping but it would be useful to re-establish it after the next harvest.

Beneficial cultivation practices to increase the population of mosses in the arable environment:

Environmental stewardship options:

EF6 Overwintered stubble

EF11 Uncropped cultivated margins for rare plants

EF15 Reduced herbicide cereal crops followed by overwintered stubble

EF22 Extended overwintered stubble

EG4 Cereals for whole crop silage followed by overwintered stubble

Voluntary methods for moss habitat creation: 1) An extended period of fallow for at least three winters to reach full maturity for sporophyte production. Establishment of a margin (2-3 m width) from stubble at the edge of a field selecting the wettest area, generally its northern edge next to a boundary feature or at the bottom of a slope. This would mean that only the least productive areas, which may be better for bryophytes, would be committed to conservation of these species. No cultivation should occur during this fallow period. The application of herbicides to reduce competition from higher plants especially grass weeds and volunteers may be required. Do not apply any fertilisers or manure. 2) Spring cropping followed by overwintered stubble. Repeated spring cropping followed by overwintered stubble on same field with establishment by direct drilling. The application of herbicides to control undesirable weeds reduce competition from higher plants especially grass weeds and volunteers may be required.

APPENDIX 9. DISSEMINATION OF RESULTS

Publications - Proposed journals and titles of publications 1) Field Bryology

Title: Status of Weissia squarrosa on farmland in agri-environment schemes in England 2) Journal of Bryology

Title: Species separation of the genus Weissia in England and Wales

Bryophyte records

Bryophyte records from farm surveys will be submitted to the NBN gateway via the BBS.

Bryophyte records of the surveys for W. multicapsularis in 2010 were submitted to the NBN Gateway via the BBS and those for 2011 will be submitted via this route as well..

The associated bryophyte populations from the surveys of farms in Gloucestershire were recorded (Appendix 3) and their records have been submitted to the NBN gateway via the BBS. This was also the case for records of the Weissia spp. found during the surveys of Haresfield Beacon (SO8108, SO8208) and Painswick Beacon (SO8712, SO8612).

62