DOCSLIB.ORG

ATG10 (Autophagy-Related 10) Regulates the Formation of Autophagosome in the Anti-Virus Immune Response of Pacific Oyster (Crassostrea Gigas) T

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
ATG10 (Autophagy-Related 10) Regulates the Formation of Autophagosome in the Anti-Virus Immune Response of Pacific Oyster (Crassostrea Gigas) T Fish and Shellfish Immunology 91 (2019) 325–332 Contents lists available at ScienceDirect Fish and Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi Full length article ATG10 (autophagy-related 10) regulates the formation of autophagosome in the anti-virus immune response of pacific oyster (Crassostrea gigas) T ∗ Zirong Hana,c, Weilin Wanga,c, , Xiaojing Lva,c, Yanan Zonga,c, Shujing Liua,c, Zhaoqun Liua,c, ∗ Lingling Wanga,b,c,d, Linsheng Songa,b,c, a Liaoning Key Laboratory of Marine Animal Immunology, Dalian Ocean University, Dalian, 116023, China b Functional Laboratory of Marine Fisheries Science and Food Production Processes, Qingdao National Laboratory for Marine Science and Technology, Qingdao, 266235, China c Liaoning Key Laboratory of Marine Animal Immunology and Disease Control, Dalian Ocean University, Dalian, 116023, China d Dalian Key Laboratory of Aquatic Animal Disease Prevention and Control, Dalian Ocean University, Dalian, 116023, China ARTICLE INFO ABSTRACT Keywords: Autophagy, a highly conserved intracellular degradation system, is involved in numerous processes in vertebrate Autophagy and invertebrate, such as cell survival, ageing, and immune responses. However, the detailed molecular me- ATG10 chanism of autophagy and its immune regulatory role in bivalves are still not well understood. In the present Autophagosome study, an autophagy-related protein ATG10 (designated as CgATG10) was identified from Pacific oyster Crassostrea gigas Crassostrea gigas. The open reading frame of CgATG10 cDNA was of 621 bp, encoding a polypeptide of 206 amino Anti-virus immunity acid residues with an Autophagy_act_C domain (from 96 to 123 amino acid), which shared high homology with that from C. virginica and Octopus bimaculoides. The mRNA transcripts of CgATG10 were widely expressed in all the tested tissues including mantle, gonad, gills, hemocytes and hepatopancreas, with the highest expression level in mantle. After the stimulation with poly (I:C), the mRNA expression level of CgATG10 in the mantle of oysters was significantly up-regulated (4.92-fold of that in Blank group, p<0.05), and the LC3-conversion from LC3-I to LC3-II (LC3-II/LC3-I) also increased. After an additional injection of dsRNA to knock-down the ex- pression of CgATG10 (0.33-fold and 0.10-fold compared respectively with Blank group and dsGFP group, p<0.05), the downstream conversion of CgLC3 was inhibited significantly compared with that of the control dsGFP group, while the expression level of autophagy-initiator CgBeclin1 did not change significantly. In ad- dition, the mRNA transcripts of interferon regulatory factor CgIRF-1 increased significantly in CgATG10- knockdown oysters at 12 h post poly (I:C) stimulation. All the results indicated that CgATG10 might participate in the immune response against poly (I:C) by regulating autophagosome formation and interferon system in oysters. 1. Introduction involves different ATG genes. The induction of autophagy is first trig- gered typically by starvation, which requires the Beclin 1 (Atg6) com- Autophagy is an intracellular degradation pathway that is highly plex [10]. The autophagosome formation is sequentially conducted by conserved from yeast to plants and animals [1,2]. There are various two ubiquitin-like conjugation systems, the ATG12-ATG5 conjugate types of autophagy, including micro- and macroautophagy, as well as and the LC3 systems, which is the second and core step of autophagy chaperone-mediated autophagy, and the term “autophagy” usually in- [11]. Finally, the autophagosome is fused with lysosomes (in metazoan dicates macroautophagy unless otherwise specified [3–5]. Early in the cells) or vacuoles (in yeast and plant cells) to degrade macromolecules 1950s, autophagy was first morphologically characterized in mamma- with lysis ATGs (such as yeast lipase Atg15/Aut5/Cvt17) [5] into lian cells, but its molecular mechanism was unknown until the dis- monomeric units (e.g. amino acids) for reuse. ATG10 is an important covery of yeast autophagy-related (ATG) genes in 1990s [6]. So far, adaptor to recruit other molecules for complex conjugation and plays more than 30 ATG genes have been identified in yeast, and 15 of them the key roles in the second step of autophagosome formation. Previous (ATG1-10, 12–14, 16, 18) are conserved in mammals [7–9]. study has revealed that ATG10 is a new type of protein-conjugating There are three main steps for vertebrate autophagy, and each step enzyme to form the ATG12-ATG10 thioester intermediate, which then ∗ Corresponding authors. Liaoning Key Laboratory of Marine Animal Immunology, Dalian Ocean University, Dalian, 116023, China. E-mail addresses: [email protected] (W. Wang), [email protected] (L. Song). https://doi.org/10.1016/j.fsi.2019.05.027 Received 22 March 2019; Received in revised form 9 May 2019; Accepted 13 May 2019 Available online 22 May 2019 1050-4648/ © 2019 Elsevier Ltd. All rights reserved. Z. Han, et al. Fish and Shellfish Immunology 91 (2019) 325–332 Table 1 Sequences of the primers used in this study. Primer name Sequence (5′-3′) oligo (dT) GGCCACGCGTCGACTAGTACT CgATG10-RT-F GGACAATCGTAGACACCAAAGA CgATG10-RT-R TACAGAACTGGCACACCATAGC CgEF-RT-F AGTCACCAAGGCTGCACAGAAAG CgEF-RT-R TCCGACGTATTTCTTTGCGATGT CgATG10-F ATGGCGGCAGGTTCAATTTCGGA CgATG10-R GCTGACACAAAGTTTTCCATACTCCAGAGGA CgATG10-EHF CGCGATATCATGGCGGCAGGTTCAATTTCG CgATG10-EHR CCCAAGCTTGCTGACACAAAGTTTTCCATACTCCAG CgATG10-Fi GCGTAATACGACTCACTATAGGCAATGCCCACACACAAGG CgATG10-Ri GCGTAATACGACTCACTATAGGTTATATAACCATACACTATTTTTCAACA GFP-Fi GCGTAATACGACTCACTATAGGTGGTCCCAATTCTCGTGGAAC GFP-Ri GCGTAATACGACTCACTATAGGCTTGAAGTTGACCTTGATGCC CgLC3-RT-F CCGATGCTTGACAAGACCAA CgLC3-RT-R CCGTCCTCGTCTTTCTCCTG CgIRF-1-RT-F ATTCGTGTTTTCACATTCCCTACTC CgIRF-1-RT-R ATTTCCACCTGGTCCTCCTTATC CgBeclin-RT-F AAATGCTGCTTGGGGTCAGA CgBeclin-RT-R CGGAATCCACCAGACCCATA conjugates ATG5 to form the ATG12-ATG5 conjugation [12,13]. In Liaoning Province, China). The Pacific oysters were cultured in filtered Arabidopsis thaliana, the ATG10 gene mutation induces dysfunctions of and aerated seawater at 15 ± 2 °C and fed with commercial microalgae the ATG12-ATG5 conjugation and failures to accumulate autophagic for one week prior to use. The seawater was totally replaced every day. bodies inside the vacuole [14]. Compared with model organisms of Female mice (six-week old) were purchased from Dalian Institute of vertebrates and plants, the knowledge about autophagy molecular Drug Control. mechanisms and the detailed roles of ATGs in autophagy process is still Various tissues including hepatopancreas, gonad, mantle, gills and very limited in lower invertebrates. hemolymph were obtained from six oysters as parallel samples. Recently, the immune regulation roles of autophagy are receiving Hemolymph was centrifuged at 800 g, 4 °C for 10 min to harvest the increasing attentions, especially its molecular mechanisms in verte- hemocytes. All the samples were stored at −80 °C in 500 μL Trizol re- brates [14–16]. In humans, the autophagy has been documented to agent (Invitrogen) for the subsequent RNA extraction to clone cDNA function in anti-virus immunity [17,18]. Overexpression of ATG10 and detect the distribution of CgATG10 mRNA in tissues. could facilitate the formation of autophagolysosomes and suppress the replication of HCV virus in Huh 7.5 cell line [19]. The ATG12–ATG5 conjugate was reported to suppress the type I IFN production via in- 2.2. RNA isolation and cDNA synthesis hibition of retinoic acid-inducible gene I (RIG-I) and IFN-β promoter stimulator-1 (IPS-I) [20]. In Pacific oyster Crassostrea gigas, the anti- Trizol reagent was used to extract the total RNA from hemocytes virus autophagy was also reported to be significantly induced by ex- and other tissues according to manufacturer's instruction (Invitrogen, perimental infection of ostreid herpesvirus 1 (OsHV-1) [21]. However, USA). The RNase-free DNase I (Takara, Japan) was used to digest the the detailed molecular mechanism of autophagy and the roles of ATG10 genomic DNA from the total RNA. Integrities of representative RNA in anti-virus immunity of oyster are still not well understood. samples were visualized via agarose gel electrophoresis assays. The The Pacific oyster C. gigas is one of the important aquaculture bi- quality and concentration of total RNA were estimated using a Nano valves worldwide. In the past decades, the frequent outbreak of disease Drop 2000 Spectrophotometer (Thermo Fisher Scientific, Wilmington, has threatened the sustainable development of oyster aquaculture in- DE, USA). Only the RNA samples with an A260/A280 ratio between 1.8 dustry [22–25]. OsHV-1 is a virus in malacoherpesviridae family, which and 2.0 were used for the subsequent analysis. can infect oyster and cause mass mortality. The studies on anti-virus Total RNA was reverse transcribed by using the PrimeScript™ real- immunity in Pacific oyster are necessary to understand the pathological time PCR kit (Takara, Japan) for quantitative real-time PCR (qRT-PCR) mechanism and develop the strategy to control the disease. Recently, analysis. The first-strand cDNA synthesis was performed by primer the primitive anti-virus interferon (IFN) system containing IFN-like oligo (dT). One microgram of total RNA was added into the 20 μL re- protein (CgIFNLP) and its upstream interferon regulatory factor (CgIRF- action system, and the mixture was incubated at 37 °C for 15 min, and 1) has been reported in C. gigas [26,27]. The major objectives of the then 85 °C for 15 s. The obtained cDNA was stored at −80
Load more

Recommended publications
  • Mouse Atg10 Conditional Knockout Project (CRISPR/Cas9)
    https://www.alphaknockout.com Mouse Atg10 Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Atg10 conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Atg10 gene (NCBI Reference Sequence: NM_025770 ; Ensembl: ENSMUSG00000021619 ) is located on Mouse chromosome 13. 8 exons are identified, with the ATG start codon in exon 2 and the TGA stop codon in exon 7 (Transcript: ENSMUST00000022119). Exon 2 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Atg10 gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP23-326J5 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Exon 2 starts from about 100% of the coding region. The knockout of Exon 2 will result in frameshift of the gene. The size of intron 1 for 5'-loxP site insertion: 15505 bp, and the size of intron 2 for 3'-loxP site insertion: 54005 bp. The size of effective cKO region: ~605 bp. The cKO region does not have any other known gene. Page 1 of 7 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele gRNA region 5' gRNA region 3' 1 2 8 Targeting vector Targeted allele Constitutive KO allele (After Cre recombination) Legends Exon of mouse Atg10 Homology arm cKO region loxP site Page 2 of 7 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats.
    [Show full text]
  • Potential Sperm Contributions to the Murine Zygote Predicted by in Silico Analysis
    REPRODUCTIONRESEARCH Potential sperm contributions to the murine zygote predicted by in silico analysis Panagiotis Ntostis1,2, Deborah Carter3, David Iles1, John Huntriss1, Maria Tzetis2 and David Miller1 1Leeds Institute of Cardiovascular and Metabolic Medicine, University of Leeds, Leeds, West Yorkshire, UK, 2Department of Medical Genetics, St. Sophia’s Children Hospital, School of Medicine, National and Kapodistrian University of Athens, Athens, Attiki, Greece and 3Leeds Institute of Molecular Medicine, University of Leeds, Leeds, West Yorkshire, UK Correspondence should be addressed to D Miller; Email: [email protected] Abstract Paternal contributions to the zygote are thought to extend beyond delivery of the genome and paternal RNAs have been linked to epigenetic transgenerational inheritance in different species. In addition, sperm–egg fusion activates several downstream processes that contribute to zygote formation, including PLC zeta-mediated egg activation and maternal RNA clearance. Since a third of the preimplantation developmental period in the mouse occurs prior to the first cleavage stage, there is ample time for paternal RNAs or their encoded proteins potentially to interact and participate in early zygotic activities. To investigate this possibility, a bespoke next-generation RNA sequencing pipeline was employed for the first time to characterise and compare transcripts obtained from isolated murine sperm, MII eggs and pre-cleavage stage zygotes. Gene network analysis was then employed to identify potential interactions between paternally and maternally derived factors during the murine egg-to-zygote transition involving RNA clearance, protein clearance and post-transcriptional regulation of gene expression. Our in silico approach looked for factors in sperm, eggs and zygotes that could potentially interact co-operatively and synergisticallyp during zygote formation.
    [Show full text]
  • Mutation in ATG5 Reduces Autophagy and Leads to Ataxia With
    1 Mutation in ATG5 Reduces Autophagy and Leads to 2 Ataxia with Developmental Delay 3 4 Authors: Myungjin Kim1,14, Erin Sandford2,14, Damian Gatica3,4, Yu Qiu5, Xu Liu3,4, Yumei 5 Zheng5, Brenda A. Schulman5,6, Jishu Xu7, Ian Semple1, Seung-Hyun Ro1, Boyoung Kim1, R. 6 Nehir Mavioglu8, Aslıhan Tolun8, Andras Jipa9,10, Szabolcs Takats9, Manuela Karpati9, Jun Z. 7 Li7,11, Zuhal Yapici12, Gabor Juhasz9,10, Jun Hee Lee1*, Daniel J. Klionsky3,4*, Margit 8 Burmeister2,7,11, 13* 9 10 Affiliations 11 1Department of Molecular and Integrative Physiology, University of Michigan, Ann Arbor, MI 12 48109, USA. 13 2Molecular & Behavioral Neuroscience Institute, University of Michigan, Ann Arbor, MI 48109, 14 USA. 15 3Department of Molecular, Cellular, and Developmental Biology, University of Michigan, Ann 16 Arbor, MI 48109, USA. 17 4Life Sciences Institute, University of Michigan, Ann Arbor, MI 48109, USA. 18 5Department of Structural Biology, St. Jude Children’s Research Hospital, Memphis, TN 38105, 19 USA. 20 6Howard Hughes Medical Institute, St. Jude Children’s Research Hospital, Memphis, TN 38105, 21 USA. 22 7Department of Human Genetics, University of Michigan, Ann Arbor, MI 48109, USA. 23 8Department of Molecular Biology and Genetics, Boğaziçi University, 34342 Istanbul, Turkey. 1 24 9Department of Anatomy, Cell and Developmental Biology, Eötvös Loránd University, Budapest 25 H-1117, Hungary. 26 10Institute of Genetics, Biological Research Centre, Hungarian Academy of Sciences, Szeged H- 27 6726, Hungary 28 11Department of Computational Medicine & Bioinformatics, University of Michigan, Ann Arbor, 29 MI 48109, USA. 30 12Department of Neurology, Istanbul Medical Faculty, Istanbul University, Istanbul, Turkey.
    [Show full text]
  • Open Moore Sarah P53network.Pdf
    THE PENNSYLVANIA STATE UNIVERSITY SCHREYER HONORS COLLEGE DEPARTMENT OF BIOCHEMISTRY AND MOLECULAR BIOLOGY A SYSTEMATIC METHOD FOR ANALYZING STIMULUS-DEPENDENT ACTIVATION OF THE p53 TRANSCRIPTION NETWORK SARAH L. MOORE SPRING 2013 A thesis submitted in partial fulfillment of the requirements for a baccalaureate degree in Biochemistry and Molecular Biology with honors in Biochemistry and Molecular Biology Reviewed and approved* by the following: Dr. Yanming Wang Associate Professor of Biochemistry and Molecular Biology Thesis Supervisor Dr. Ming Tien Professor of Biochemistry and Molecular Biology Honors Advisor Dr. Scott Selleck Professor and Head, Department of Biochemistry and Molecular Biology * Signatures are on file in the Schreyer Honors College. i ABSTRACT The p53 protein responds to cellular stress, like DNA damage and nutrient depravation, by activating cell-cycle arrest, initiating apoptosis, or triggering autophagy (i.e., self eating). p53 also regulates a range of physiological functions, such as immune and inflammatory responses, metabolism, and cell motility. These diverse roles create the need for developing systematic methods to analyze which p53 pathways will be triggered or inhibited under certain conditions. To determine the expression patterns of p53 modifiers and target genes in response to various stresses, an extensive literature review was conducted to compile a quantitative reverse transcription polymerase chain reaction (qRT-PCR) primer library consisting of 350 genes involved in apoptosis, immune and inflammatory responses, metabolism, cell cycle control, autophagy, motility, DNA repair, and differentiation as part of the p53 network. Using this library, qRT-PCR was performed in cells with inducible p53 over-expression, DNA-damage, cancer drug treatment, serum starvation, and serum stimulation.
    [Show full text]
  • Table S1. 103 Ferroptosis-Related Genes Retrieved from the Genecards
    Table S1. 103 ferroptosis-related genes retrieved from the GeneCards. Gene Symbol Description Category GPX4 Glutathione Peroxidase 4 Protein Coding AIFM2 Apoptosis Inducing Factor Mitochondria Associated 2 Protein Coding TP53 Tumor Protein P53 Protein Coding ACSL4 Acyl-CoA Synthetase Long Chain Family Member 4 Protein Coding SLC7A11 Solute Carrier Family 7 Member 11 Protein Coding VDAC2 Voltage Dependent Anion Channel 2 Protein Coding VDAC3 Voltage Dependent Anion Channel 3 Protein Coding ATG5 Autophagy Related 5 Protein Coding ATG7 Autophagy Related 7 Protein Coding NCOA4 Nuclear Receptor Coactivator 4 Protein Coding HMOX1 Heme Oxygenase 1 Protein Coding SLC3A2 Solute Carrier Family 3 Member 2 Protein Coding ALOX15 Arachidonate 15-Lipoxygenase Protein Coding BECN1 Beclin 1 Protein Coding PRKAA1 Protein Kinase AMP-Activated Catalytic Subunit Alpha 1 Protein Coding SAT1 Spermidine/Spermine N1-Acetyltransferase 1 Protein Coding NF2 Neurofibromin 2 Protein Coding YAP1 Yes1 Associated Transcriptional Regulator Protein Coding FTH1 Ferritin Heavy Chain 1 Protein Coding TF Transferrin Protein Coding TFRC Transferrin Receptor Protein Coding FTL Ferritin Light Chain Protein Coding CYBB Cytochrome B-245 Beta Chain Protein Coding GSS Glutathione Synthetase Protein Coding CP Ceruloplasmin Protein Coding PRNP Prion Protein Protein Coding SLC11A2 Solute Carrier Family 11 Member 2 Protein Coding SLC40A1 Solute Carrier Family 40 Member 1 Protein Coding STEAP3 STEAP3 Metalloreductase Protein Coding ACSL1 Acyl-CoA Synthetase Long Chain Family Member 1 Protein
    [Show full text]
  • Genome-Wide Analysis of Genetic Predisposition to Alzheimer's
    Nazarian et al. Alzheimer's Research & Therapy (2019) 11:5 https://doi.org/10.1186/s13195-018-0458-8 RESEARCH Open Access Genome-wide analysis of genetic predisposition to Alzheimer’s disease and related sex disparities Alireza Nazarian*, Anatoliy I. Yashin and Alexander M. Kulminski* Abstract Background: Alzheimer’s disease (AD) is the most common cause of dementia in the elderly and the sixth leading cause of death in the United States. AD is mainly considered a complex disorder with polygenic inheritance. Despite discovering many susceptibility loci, a major proportion of AD genetic variance remains to be explained. Methods: We investigated the genetic architecture of AD in four publicly available independent datasets through genome-wide association, transcriptome-wide association, and gene-based and pathway-based analyses. To explore differences in the genetic basis of AD between males and females, analyses were performed on three samples in each dataset: males and females combined, only males, or only females. Results: Our genome-wide association analyses corroborated the associations of several previously detected AD loci and revealed novel significant associations of 35 single-nucleotide polymorphisms (SNPs) outside the chromosome 19q13 region at the suggestive significance level of p <5E–06. These SNPs were mapped to 21 genes in 19 chromosomal regions. Of these, 17 genes were not associated with AD at genome-wide or suggestive levels of associations by previous genome-wide association studies. Also, the chromosomal regions corresponding to 8 genes did not contain any previously detected AD-associated SNPs with p <5E–06. Our transcriptome-wide association and gene-based analyses revealed that 26 genes located in 20 chromosomal regions outside chromosome 19q13 had evidence of potential associations with AD at a false discovery rate of 0.05.
    [Show full text]
  • Allele-Specific Mirna-Binding Analysis Identifies Candidate Target
    bioRxiv preprint doi: https://doi.org/10.1101/777318; this version posted September 20, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Allele-specific miRNA-binding analysis identifies candidate target genes for breast cancer risk Ana Jacinta-Fernandes1,2,3, Joana M. Xavier1,2,3, Ramiro Magno2,3, Joel G. Lage1,2,3, and Ana-Teresa Maia1,2,3,* 1Department of Biomedical Sciences and Medicine (DCBM), Universidade do Algarve, Faro, 8005-139, Portugal 2Centre for Biomedical Research (CBMR), Universidade do Algarve, Faro, 8005-139, Portugal 3Algarve Biomedical Center (ABC), Universidade do Algarve, Faro, 8005-139, Portugal *[email protected] ABSTRACT Most breast cancer (BC) risk-associated variants (raSNPs) identified in genome-wide association studies (GWAS) are believed to cis-regulate the expression of genes. We hypothesise that cis-regulatory variants contributing to disease risk may be affecting miRNA genes and/or miRNA-binding. To test this we adapted two miRNA-binding prediction algorithms — TargetScan and miRanda — to perform allele-specific queries, and integrated differential allelic expression (DAE) and expression quantitative trait loci (eQTL) data, to query 150 genome-wide significant (P ≤ 5 × 10−8) raSNPs, plus proxies. We found that no raSNP mapped to a miRNA gene, suggesting that altered miRNA targeting is an unlikely mechanism involved in BC risk. Also, 11.5% (6 out of 52) raSNPs located in 3’UTRs of putative miRNA target genes were predicted to alter miRNA::mRNA pair binding stability in five candidate target genes. Of these, we propose RNF115, at locus 1q21.1, as a strong novel target gene associated with BC risk, and re-inforce the role of miRNA mediated cis-regulation at locus 19p13.11.
    [Show full text]
  • Original Article Screening of Autophagy Genes As Prognostic Indicators for Glioma Patients
    Am J Transl Res 2020;12(9):5320-5331 www.ajtr.org /ISSN:1943-8141/AJTR0113418 Original Article Screening of autophagy genes as prognostic indicators for glioma patients Shanqiang Qu1,2*, Shuhao Liu3*, Weiwen Qiu4, Jin Liu5, Huafu Wang6 1Department of Neurosurgery, The First Affiliated Hospital of Sun Yat-sen University, Guangzhou 510080, China; 2Department of Neurosurgery, Nanfang Hospital, Southern Medical University, Guangzhou 510515, China; 3De- partment of Gastrointestinal Surgery, The Seventh Affiliated Hospital of Sun Yat-sen University, Shenzhen 518107, China; Departments of 4Neurology, 5Neurosurgery, 6Clinical Pharmacy, Lishui People’s Hospital (The Sixth Affili- ated Hospital of Wenzhou Medical University), Lishui 323000, China. *Equal contributors. Received April 27, 2020; Accepted July 31, 2020; Epub September 15, 2020; Published September 30, 2020 Abstract: Although autophagy is reported to be involved in tumorigenesis and cancer progression, its correlation with the prognosis of glioma patients remains unclear. Thus, the aim of this study was to identify prognostic au- tophagy-related genes, analyze their correlation with clinicopathological features of glioma, and further construct a prognostic model for glioma patients. After 139 autophagy-related genes were obtained from the GeneCards database, their expression data in glioma patients were extracted from the Chinese Glioma Genome Atlas data- base. Univariate and multivariate COX regression analyses were performed to identify prognostic autophagy-related genes. Ten hub autophagy-related genes associated with prognosis were identified. The autophagy risk score (ARS) was only positively correlated with histopathology (P = 0.000) and World Health Organization grade (P = 0.000). Kaplan-Meier analysis showed that the overall survival of patients with a high ARS was significantly worse than that of patients with a low ARS (hazard ratio = 1.59, 95% confidence interval = 1.25-2.03, P = 0.0001).
    [Show full text]
  • Large-Scale Inference of Gene Function Through Phylogenetic Annotation Of
    Database, 2016, 1–11 doi: 10.1093/database/baw155 Original article Original article Large-scale inference of gene function through phylogenetic annotation of Gene Ontology terms: case study of the apoptosis and autophagy cellular processes Marc Feuermann1,†, Pascale Gaudet2,*,†, Huaiyu Mi3, Suzanna E. Lewis4 and Paul D. Thomas3 1Swiss-Prot group, 2CALIPHO group, SIB Swiss Institute of Bioinformatics, Centre Medical Universitaire, Switzerland 1 rue Michel Servet, 1211 Geneva 4, Switzerland, 3Division of Bioinformatics, Department of Preventive Medicine, Keck School of Medicine of USC, University of Southern California, Los Angeles, CA, USA and 4Lawrence Berkeley National Laboratory, Genomics Division, Berkeley, CA, USA *Corresponding author: Email: [email protected] †These authors contributed equally to this work. Correspondence may also be addressed to Paul D. Thomas. Email: [email protected] Citation details: Feuermann,M., Gaudet,P., Mi,H. et al. Large-scale inference of gene function through phylogenetic anno- tation of gene ontology terms: case study of the apoptosis and autophagy cellular processes. Database (2016) Vol. 2016: article ID baw155; doi:10.1093/database/baw155. Received 26 July 2016; Revised 10 October 2016; Accepted 1 November 2016 Abstract We previously reported a paradigm for large-scale phylogenomic analysis of gene fami- lies that takes advantage of the large corpus of experimentally supported Gene Ontology (GO) annotations. This ‘GO Phylogenetic Annotation’ approach integrates GO annota- tions from evolutionarily related genes across 100 different organisms in the context of a gene family tree, in which curators build an explicit model of the evolution of gene functions. GO Phylogenetic Annotation models the gain and loss of functions in a gene family tree, which is used to infer the functions of uncharacterized (or incompletely char- acterized) gene products, even for human proteins that are relatively well studied.
    [Show full text]
  • Prognosis-Related Autophagy Genes in Female Lung Adenocarcinoma
    Prognosis-Related Autophagy Genes in Female Lung Adenocarcinoma Zhongxiang Liu rst people's hospital of yancheng Haicheng Tang Shanghai Public Health Clinical Center Yongqian Jiang rst people's hospital of yancheng Xiaopeng Zhan Shanghai East Hospital Sheng Kang Shanghai East Hospital Koudong Zhang ( [email protected] ) First People's Hospital of Yancheng Li Lin Shanghai East Hospital Research Keywords: Autophagy genes, Prognosis, Female lung adenocarcinoma, Risk score Posted Date: August 10th, 2020 DOI: https://doi.org/10.21203/rs.3.rs-53994/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/15 Abstract Background: To screen the prognosis-related autophagy genes of female lung adenocarcinoma by the transcriptome data and clinical data from TCGA database. Methods: In this study, Screen meaningful female lung adenocarcinoma differential genes in TCGA, use univariate COX proportional regression model to select genes related to prognosis, and establish the best risk model. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) were applied for carrying out bioinformatics analysis of gene function. Results: The gene expression and clinical data of 260 female lung adenocarcinoma patient samples were downloaded from TCGA. 12 down-regulated genes: NRG3, DLC1, NLRC4, DAPK2, HSPB8, PPP1R15A, FOS, NRG1, PRKCQ, GRID1, MAP1LC3C, GABARAPL1. Up-regulated 15 genes: PARP1, BNIP3, P4HB, ATIC, IKBKE, ITGB4, VMP1, PTK6, EIF4EBP1, GAPDH, ATG9B, ERO1A, TMEM74, CDKN2A, BIRC5. GO and KEGG analysis showed that these genes were signicantly associated with autophagy and mitochondria (animals). Multi-factor COX analysis of autophagy-related genes showed that ITGA6, ERO1A, FKBP1A, BAK1, CCR2, FADD, EDEM1, ATG10, ATG4A, DLC1, VAMP7, ST13 were identied as independent prognostic indicators.
    [Show full text]
  • Anti-ATG10 Antibody (ARG22622)
    Product datasheet [email protected] ARG22622 Package: 50 μg anti-ATG10 antibody Store at: -20°C Summary Product Description Rabbit Polyclonal antibody recognizes ATG10 Tested Reactivity Hu Tested Application WB Host Rabbit Clonality Polyclonal Isotype IgG Target Name ATG10 Antigen Species Human Immunogen Synthetic peptide around the center region of Human ATG10. Conjugation Un-conjugated Alternate Names EC 6.3.2.-; Autophagy-related protein 10; APG10-like; APG10; Ubiquitin-like-conjugating enzyme ATG10; APG10L; pp12616 Application Instructions Application table Application Dilution WB 1:1000 Application Note * The dilutions indicate recommended starting dilutions and the optimal dilutions or concentrations should be determined by the scientist. Calculated Mw 25 kDa Properties Form Liquid Purification Affinity purification with immunogen. Buffer PBS, 0.09% Sodium azide and 50% Glycerol. Preservative 0.09% Sodium azide Stabilizer 50% Glycerol Storage instruction For continuous use, store undiluted antibody at 2-8°C for up to a week. For long-term storage, aliquot and store at -20°C. Storage in frost free freezers is not recommended. Avoid repeated freeze/thaw cycles. Suggest spin the vial prior to opening. The antibody solution should be gently mixed before use. Note For laboratory research only, not for drug, diagnostic or other use. Bioinformation www.arigobio.com 1/2 Gene Symbol ATG10 Gene Full Name autophagy related 10 Background Autophagy is a process for the bulk degradation of cytosolic compartments by lysosomes. ATG10 is an E2-like enzyme involved in 2 ubiquitin-like modifications essential for autophagosome formation: ATG12 (MIM 609608)-ATG5 (MIM 604261) conjugation and modification of a soluble form of MAP-LC3 (MAP1LC3A; MIM 601242), a homolog of yeast Apg8, to a membrane-bound form (Nemoto et al., 2003 [PubMed 12890687]).[supplied by OMIM, Mar 2008] Function E2-like enzyme involved in autophagy.
    [Show full text]
  • Mir-369-3P Participates in Endometrioid Adenocarcinoma Via
    Liu et al. Cancer Cell Int (2019) 19:178 https://doi.org/10.1186/s12935-019-0897-8 Cancer Cell International PRIMARY RESEARCH Open Access MiR-369-3p participates in endometrioid adenocarcinoma via the regulation of autophagy Ping Liu1,2, Chengbin Ma2, Qiongwei Wu2, Wenying Zhang2, Cao Wang2, Li Yuan3* and Xiaowei Xi1* Abstract Background: The aim of this study is to examine miRNA profling and miR-369-3p participates in endometrioid adenocarcinoma (EEC) via the regulation of autophagy. Methods: EEC and its adjacent normal tissues were obtained from 20 clinical patients after surgery. MiRNA profling was performed using next generation sequencing (NGS) and was validated with quantitative real time PCR (qRT-PCR). qRT-PCR was also employed to measure miR-369-3p and autophagy-related protein 10 (ATG10) expression levels. Western blotting assay was performed to measure the expressions of ATG10 and LC3B. Luciferase reporter assay was conducted to confrm the direct targeting of ATG10 by miR-369-3p. Cell proliferation and migration assays were uti- lized to analyze the role of miR-369-3p in HEC-1-A cells. Results: We found that miR-369-3p expression levels were down-regulated in EEC compared to the control tissues. The overexpression of miR-369-3p inhibited cell proliferation and migration in EEC; furthermore, ATG10 expression increased in EEC tissues. ATG10 was found to be a potential target of miR-369-3p via a dual-luciferase reporter assay, and ATG10 was shown to be down-regulated by miR-369-3p in protein levels. Conclusions: This study revealed that miR-369-3p inhibited cell proliferation and migration by targeting ATG10 via autophagy in EEC.
    [Show full text]