Activation of the ISR Mediates the Behavioral and Neurophysiological
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Interconversion Between Active and Inactive TATA-Binding Protein
1446–1459 Nucleic Acids Research, 2012, Vol. 40, No. 4 Published online 19 October 2011 doi:10.1093/nar/gkr802 Interconversion between active and inactive TATA-binding protein transcription complexes in the mouse genome Mohamed-Amin Choukrallah, Dominique Kobi1, Igor Martianov1, W. W. M. Pim Pijnappel2,4, Nikolai Mischerikow2,3, Tao Ye1, Albert J. R. Heck3,4,5, H. Th. Marc Timmers2,4 and Irwin Davidson1,* 1Institut de Ge´ ne´ tique et de Biologie Mole´ culaire et Cellulaire, CNRS/INSERM/ULP, 1 Rue Laurent Fries, 67404 Illkirch Ce´ dex, France, 2Molecular Cancer Research, University Medical Center Utrecht, Universiteitsweg 100, 3Biomolecular Mass Spectrometry and Proteomics Group, Bijvoet Centre for Biomolecular Research and Utrecht Institute for Pharmaceutical Sciences, Utrecht University, 4Netherlands Proteomics Centre and 5Centre for Biomedical Genetics, Padualaan 8, 3584 CH Utrecht, The Netherlands Received June 10, 2011; Revised September 12, 2011; Accepted September 13, 2011 ABSTRACT preinitiation complex comprising B-TFIID that primes the promoter for productive preinitiation The TATA binding protein (TBP) plays a pivotal role complex formation in mammalian cells. in RNA polymerase II (Pol II) transcription through incorporation into the TFIID and B-TFIID complexes. The role of mammalian B-TFIID composed of TBP INTRODUCTION and B-TAF1 is poorly understood. Using a com- Accurate initiation of transcription by RNA polymerase plementation system in genetically modified mouse II (Pol II) requires the assembly of the multiprotein cells where endogenous TBP can be condi- preinitiation complex (PIC) on the core promoter around tionally inactivated and replaced by exogenous the mRNA start site (1–3). Amongst the basal transcrip- mutant TBP coupled to tandem affinity purification tion factors in this process is the TFIID complex com- and mass spectrometry, we identify two TBP prising the TATA binding protein (TBP) and a set of 13–14 TBP-associated factors (TAFs) (4–7). -
INO80C Remodeler Maintains Genomic Stability by Preventing Promiscuous Transcription at Replication Origins
HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Cell Rep Manuscript Author . Author manuscript; Manuscript Author available in PMC 2020 October 07. Published in final edited form as: Cell Rep. 2020 September 08; 32(10): 108106. doi:10.1016/j.celrep.2020.108106. INO80C Remodeler Maintains Genomic Stability by Preventing Promiscuous Transcription at Replication Origins Salih Topal1,4, Christopher Van1,4, Yong Xue2,3,4, Michael F. Carey2,*, Craig L. Peterson1,5,* 1Program in Molecular Medicine, University of Massachusetts Medical School, 373 Plantation Street, Worcester, MA 01605, USA 2Department of Biological Chemistry, David Geffen School of Medicine, University of California, Los Angeles, Los Angeles, CA 90095, USA 3Jiangsu Key Laboratory of Marine Pharmaceutical Compound Screening, Jiangsu Ocean University, Lianyungang 222005, China 4These authors contributed equally 5Lead Contact SUMMARY The proper coordination of transcription with DNA replication and repair is central for genomic stability. We investigate how the INO80C chromatin remodeling enzyme might coordinate these genomic processes. We find that INO80C co-localizes with the origin recognition complex (ORC) at yeast replication origins and is bound to replication initiation sites in mouse embryonic stem cells (mESCs). In yeast· INO80C recruitment requires origin sequences but does not require ORC· suggesting that recruitment is independent of pre-replication complex assembly. In both yeast and ESCs· INO80C co-localizes at origins with Mot1 and NC2 transcription factors· and genetic studies suggest that they function together to promote genome stability. Interestingly· nascent transcript sequencing demonstrates that INO80C and Mot1 prevent pervasive transcription through origin sequences· and absence of these factors leads to formation of new DNA double-strand breaks. -
Open Huisinga Thesis Revisions Full All
The Pennsylvania State University The Graduate School Department of Biochemistry and Molecular Biology GLOBAL REGULATION OF GENE EXPRESSION IN SACCHAROMYCES CEREVISIAE VIA TATA BINDING PROTEIN REGULATORY FACTORS A Thesis in Biochemistry, Microbiology, and Molecular Biology by Kathryn L. Huisinga Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy August 2005 The thesis of Kathryn L. Huisinga was reviewed and approved* by the following: B. Franklin Pugh Professor of Biochemistry and Molecular Biology Thesis Advisor Chair of Committee Joseph C. Reese Associate Professor of Biochemistry and Molecular Biology Ross C. Hardison T. Ming Chu Professor of Biochemistry and Molecular Biology Naomi S. Altman Associate Professor of Statistics Robert A. Schlegal Professor of Biochemistry and Molecular Biology Head of the Department of Biochemistry and Molecular Biology *Signatures are on file in the Graduate School ABSTRACT The TATA Binding Protein (TBP) is a key component of gene regulation. It binds to the promoter region of eukaryotic genes and facilitates assembly of the transcription initiation machinery, including RNA Polymerase II. Many proteins interact with TBP to both positively and negatively regulate gene expression. My thesis utilized genome-wide expression profiling in Saccharomyces cerevisiae to define the target genes of, and relationships between, the factors that regulate transcription via TBP. I found the SAGA and TFIID co-activator complexes, both of which can deliver TBP to promoters, make overlapping contributions to the expression of nearly all yeast genes. The SAGA complex functions predominantly at ~10% of the genome, targeting genes that contain TATA boxes and are up regulated upon an environmental stress response. -
Mouse Atg10 Conditional Knockout Project (CRISPR/Cas9)
https://www.alphaknockout.com Mouse Atg10 Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Atg10 conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Atg10 gene (NCBI Reference Sequence: NM_025770 ; Ensembl: ENSMUSG00000021619 ) is located on Mouse chromosome 13. 8 exons are identified, with the ATG start codon in exon 2 and the TGA stop codon in exon 7 (Transcript: ENSMUST00000022119). Exon 2 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Atg10 gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP23-326J5 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Exon 2 starts from about 100% of the coding region. The knockout of Exon 2 will result in frameshift of the gene. The size of intron 1 for 5'-loxP site insertion: 15505 bp, and the size of intron 2 for 3'-loxP site insertion: 54005 bp. The size of effective cKO region: ~605 bp. The cKO region does not have any other known gene. Page 1 of 7 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele gRNA region 5' gRNA region 3' 1 2 8 Targeting vector Targeted allele Constitutive KO allele (After Cre recombination) Legends Exon of mouse Atg10 Homology arm cKO region loxP site Page 2 of 7 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats. -
Mechanisms Underlying Phenotypic Heterogeneity in Simplex Autism Spectrum Disorders
Mechanisms Underlying Phenotypic Heterogeneity in Simplex Autism Spectrum Disorders Andrew H. Chiang Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy under the Executive Committee of the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2021 © 2021 Andrew H. Chiang All Rights Reserved Abstract Mechanisms Underlying Phenotypic Heterogeneity in Simplex Autism Spectrum Disorders Andrew H. Chiang Autism spectrum disorders (ASD) are a group of related neurodevelopmental diseases displaying significant genetic and phenotypic heterogeneity. Despite recent progress in ASD genetics, the nature of phenotypic heterogeneity across probands is not well understood. Notably, likely gene- disrupting (LGD) de novo mutations affecting the same gene often result in substantially different ASD phenotypes. We find that truncating mutations in a gene can result in a range of relatively mild decreases (15-30%) in gene expression due to nonsense-mediated decay (NMD), and show that more severe autism phenotypes are associated with greater decreases in expression. We also find that each gene with recurrent ASD mutations can be described by a parameter, phenotype dosage sensitivity (PDS), which characteriZes the relationship between changes in a gene’s dosage and changes in a given phenotype. Using simple linear models, we show that changes in gene dosage account for a substantial fraction of phenotypic variability in ASD. We further observe that LGD mutations affecting the same exon frequently lead to strikingly similar phenotypes in unrelated ASD probands. These patterns are observed for two independent proband cohorts and multiple important ASD-associated phenotypes. The observed phenotypic similarities are likely mediated by similar changes in gene dosage and similar perturbations to the relative expression of splicing isoforms. -
Potential Sperm Contributions to the Murine Zygote Predicted by in Silico Analysis
REPRODUCTIONRESEARCH Potential sperm contributions to the murine zygote predicted by in silico analysis Panagiotis Ntostis1,2, Deborah Carter3, David Iles1, John Huntriss1, Maria Tzetis2 and David Miller1 1Leeds Institute of Cardiovascular and Metabolic Medicine, University of Leeds, Leeds, West Yorkshire, UK, 2Department of Medical Genetics, St. Sophia’s Children Hospital, School of Medicine, National and Kapodistrian University of Athens, Athens, Attiki, Greece and 3Leeds Institute of Molecular Medicine, University of Leeds, Leeds, West Yorkshire, UK Correspondence should be addressed to D Miller; Email: [email protected] Abstract Paternal contributions to the zygote are thought to extend beyond delivery of the genome and paternal RNAs have been linked to epigenetic transgenerational inheritance in different species. In addition, sperm–egg fusion activates several downstream processes that contribute to zygote formation, including PLC zeta-mediated egg activation and maternal RNA clearance. Since a third of the preimplantation developmental period in the mouse occurs prior to the first cleavage stage, there is ample time for paternal RNAs or their encoded proteins potentially to interact and participate in early zygotic activities. To investigate this possibility, a bespoke next-generation RNA sequencing pipeline was employed for the first time to characterise and compare transcripts obtained from isolated murine sperm, MII eggs and pre-cleavage stage zygotes. Gene network analysis was then employed to identify potential interactions between paternally and maternally derived factors during the murine egg-to-zygote transition involving RNA clearance, protein clearance and post-transcriptional regulation of gene expression. Our in silico approach looked for factors in sperm, eggs and zygotes that could potentially interact co-operatively and synergisticallyp during zygote formation. -
ATG10 (Autophagy-Related 10) Regulates the Formation of Autophagosome in the Anti-Virus Immune Response of Pacific Oyster (Crassostrea Gigas) T
Fish and Shellfish Immunology 91 (2019) 325–332 Contents lists available at ScienceDirect Fish and Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi Full length article ATG10 (autophagy-related 10) regulates the formation of autophagosome in the anti-virus immune response of pacific oyster (Crassostrea gigas) T ∗ Zirong Hana,c, Weilin Wanga,c, , Xiaojing Lva,c, Yanan Zonga,c, Shujing Liua,c, Zhaoqun Liua,c, ∗ Lingling Wanga,b,c,d, Linsheng Songa,b,c, a Liaoning Key Laboratory of Marine Animal Immunology, Dalian Ocean University, Dalian, 116023, China b Functional Laboratory of Marine Fisheries Science and Food Production Processes, Qingdao National Laboratory for Marine Science and Technology, Qingdao, 266235, China c Liaoning Key Laboratory of Marine Animal Immunology and Disease Control, Dalian Ocean University, Dalian, 116023, China d Dalian Key Laboratory of Aquatic Animal Disease Prevention and Control, Dalian Ocean University, Dalian, 116023, China ARTICLE INFO ABSTRACT Keywords: Autophagy, a highly conserved intracellular degradation system, is involved in numerous processes in vertebrate Autophagy and invertebrate, such as cell survival, ageing, and immune responses. However, the detailed molecular me- ATG10 chanism of autophagy and its immune regulatory role in bivalves are still not well understood. In the present Autophagosome study, an autophagy-related protein ATG10 (designated as CgATG10) was identified from Pacific oyster Crassostrea gigas Crassostrea gigas. The open reading frame of CgATG10 cDNA was of 621 bp, encoding a polypeptide of 206 amino Anti-virus immunity acid residues with an Autophagy_act_C domain (from 96 to 123 amino acid), which shared high homology with that from C. virginica and Octopus bimaculoides. -
On Human Promoters
Global distribution of negative cofactor 2 subunit-␣ on human promoters Thomas K. Albert*, Korbinian Grote†, Stefan Boeing*, Gertraud Stelzer*, Aloys Schepers‡, and Michael Meisterernst*§ Departments of *Gene Expression and ‡Gene Vectors, GSF–National Research Center for Environment and Health, Marchioninistrasse 25, 81377 Munich, Germany; and †Genomatix Software GmbH, Bayerstrasse 85a, 80335 Munich, Germany Communicated by Robert G. Roeder, The Rockefeller University, New York, NY, April 30, 2007 (received for review November 16, 2006) Negative cofactor 2 (NC2) forms a stable complex with TATA- of multiple sequence-specific transcription factors in mammalian binding protein (TBP) on promoters in vitro. Its association with TBP genomes. However, surprisingly little is known about the genome- prevents the binding of TFIIB and leads to inhibition of preinitiation wide location of GTFs and general cofactors in mammalian cells. complex formation. Here, we investigate the association of NC2 One exception is the investigation of the genome-wide location of subunit-␣ with human RNA polymerase II promoter regions by TAF1 conducted along with RNAPII (16). using gene-specific ChIP and genome-wide promoter ChIPchip In our analysis, the human cofactor NC2␣ occupied Ͼ20% of analyses. We find NC2␣ associated with a large number of human all human gene promoters. We observed a positive correlation promoters, where it peaks close to the core regions. NC2 occupancy of NC2 gene occupancy with mRNA levels. On the other hand, in vivo positively correlates with mRNA levels, which perhaps NC2 occupancy negatively correlated with the presence of BRE, reflects its capacity to stabilize TBP on promoter regions. In single the TFIIB core promoter recognition element. -
Download Validation Data
PrimePCR™Assay Validation Report Gene Information Gene Name TATA-binding protein-associated factor 172 precursor Gene Symbol Btaf1 Organism Rat Gene Summary Description Not Available Gene Aliases Not Available RefSeq Accession No. NM_001191917 UniGene ID Rn.1237 Ensembl Gene ID ENSRNOG00000017938 Entrez Gene ID 368042 Assay Information Unique Assay ID qRnoCID0007247 Assay Type SYBR® Green Detected Coding Transcript(s) ENSRNOT00000024465 Amplicon Context Sequence GGCCATTTTTACATCACACTATATCTTCAGTTCGAAGAGCAGCATTGGAAACTCT CTTTACATTATTATCAACACAGGACCAGAACTCGTCGTCTTGGCTTATCCCTATCC TGTCTGATATGCTGCGG Amplicon Length (bp) 98 Chromosome Location 1:263087966-263094475 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 100 R2 1 cDNA Cq 21.2 cDNA Tm (Celsius) 80 gDNA Cq 37.19 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Btaf1, Rat Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect. Details for each transcript can be found on the Ensembl website at www.ensembl.org. -
Mutation in ATG5 Reduces Autophagy and Leads to Ataxia With
1 Mutation in ATG5 Reduces Autophagy and Leads to 2 Ataxia with Developmental Delay 3 4 Authors: Myungjin Kim1,14, Erin Sandford2,14, Damian Gatica3,4, Yu Qiu5, Xu Liu3,4, Yumei 5 Zheng5, Brenda A. Schulman5,6, Jishu Xu7, Ian Semple1, Seung-Hyun Ro1, Boyoung Kim1, R. 6 Nehir Mavioglu8, Aslıhan Tolun8, Andras Jipa9,10, Szabolcs Takats9, Manuela Karpati9, Jun Z. 7 Li7,11, Zuhal Yapici12, Gabor Juhasz9,10, Jun Hee Lee1*, Daniel J. Klionsky3,4*, Margit 8 Burmeister2,7,11, 13* 9 10 Affiliations 11 1Department of Molecular and Integrative Physiology, University of Michigan, Ann Arbor, MI 12 48109, USA. 13 2Molecular & Behavioral Neuroscience Institute, University of Michigan, Ann Arbor, MI 48109, 14 USA. 15 3Department of Molecular, Cellular, and Developmental Biology, University of Michigan, Ann 16 Arbor, MI 48109, USA. 17 4Life Sciences Institute, University of Michigan, Ann Arbor, MI 48109, USA. 18 5Department of Structural Biology, St. Jude Children’s Research Hospital, Memphis, TN 38105, 19 USA. 20 6Howard Hughes Medical Institute, St. Jude Children’s Research Hospital, Memphis, TN 38105, 21 USA. 22 7Department of Human Genetics, University of Michigan, Ann Arbor, MI 48109, USA. 23 8Department of Molecular Biology and Genetics, Boğaziçi University, 34342 Istanbul, Turkey. 1 24 9Department of Anatomy, Cell and Developmental Biology, Eötvös Loránd University, Budapest 25 H-1117, Hungary. 26 10Institute of Genetics, Biological Research Centre, Hungarian Academy of Sciences, Szeged H- 27 6726, Hungary 28 11Department of Computational Medicine & Bioinformatics, University of Michigan, Ann Arbor, 29 MI 48109, USA. 30 12Department of Neurology, Istanbul Medical Faculty, Istanbul University, Istanbul, Turkey. -
The Role of SMARCAD1 During Replication Stress Sarah Joseph
The role of SMARCAD1 during replication stress Sarah Joseph Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy under the Executive Committee of the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2020 © 2020 Sarah Joseph All Rights Reserved Abstract The role of SMARCAD1 during replication stress Sarah Joseph Heterozygous mutations in BRCA1 or BRCA2 predispose carriers to an increased risk for breast or ovarian cancer. Both BRCA1 and BRCA2 (BRCA1/2) play an integral role in promoting genomic stability through their respective actions during homologous recombination (HR) mediated repair and stalled replication fork protection from nucleolytic degradation. SMARCAD1 (SD1) is a SWI/SNF chromatin remodeler that has been implicated in promoting long-range end resection and contributes to HR. Using human cell lines, we show that SMARCAD1 promotes nucleolytic degradation in BRCA1/2-deficient cells dependent on its chromatin remodeling activity. Moreover, SMARCAD1 prevents DNA break formation and promotes fork restart at stalled replication forks. These studies identify a new role for SMARCAD1 at the replication fork. In addition to the work presented here, I discuss a method for introducing stop codons (nonsense mutations) into genes using CRISPR-mediated base editing, called iSTOP, and provide an online resource for accessing the sequence of iSTOP sgRNASs (sgSTOPs) for five base editor variants (VQR-BE3, EQR-BE3, VRER-BE3, SaBE3, and SaKKH-BE3) in humans and over 3 million targetable gene coordinates for eight eukaryotic species. Ultimately, with improvements to CRISPR base editors this method can help model and study nonsense mutations in human disease. Table of Contents List of Figures ................................................................................................................. -
Agricultural University of Athens
ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΤΩΝ ΖΩΩΝ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ ΖΩΙΚΗΣ ΠΑΡΑΓΩΓΗΣ ΕΡΓΑΣΤΗΡΙΟ ΓΕΝΙΚΗΣ ΚΑΙ ΕΙΔΙΚΗΣ ΖΩΟΤΕΧΝΙΑΣ ΔΙΔΑΚΤΟΡΙΚΗ ΔΙΑΤΡΙΒΗ Εντοπισμός γονιδιωματικών περιοχών και δικτύων γονιδίων που επηρεάζουν παραγωγικές και αναπαραγωγικές ιδιότητες σε πληθυσμούς κρεοπαραγωγικών ορνιθίων ΕΙΡΗΝΗ Κ. ΤΑΡΣΑΝΗ ΕΠΙΒΛΕΠΩΝ ΚΑΘΗΓΗΤΗΣ: ΑΝΤΩΝΙΟΣ ΚΟΜΙΝΑΚΗΣ ΑΘΗΝΑ 2020 ΔΙΔΑΚΤΟΡΙΚΗ ΔΙΑΤΡΙΒΗ Εντοπισμός γονιδιωματικών περιοχών και δικτύων γονιδίων που επηρεάζουν παραγωγικές και αναπαραγωγικές ιδιότητες σε πληθυσμούς κρεοπαραγωγικών ορνιθίων Genome-wide association analysis and gene network analysis for (re)production traits in commercial broilers ΕΙΡΗΝΗ Κ. ΤΑΡΣΑΝΗ ΕΠΙΒΛΕΠΩΝ ΚΑΘΗΓΗΤΗΣ: ΑΝΤΩΝΙΟΣ ΚΟΜΙΝΑΚΗΣ Τριμελής Επιτροπή: Aντώνιος Κομινάκης (Αν. Καθ. ΓΠΑ) Ανδρέας Κράνης (Eρευν. B, Παν. Εδιμβούργου) Αριάδνη Χάγερ (Επ. Καθ. ΓΠΑ) Επταμελής εξεταστική επιτροπή: Aντώνιος Κομινάκης (Αν. Καθ. ΓΠΑ) Ανδρέας Κράνης (Eρευν. B, Παν. Εδιμβούργου) Αριάδνη Χάγερ (Επ. Καθ. ΓΠΑ) Πηνελόπη Μπεμπέλη (Καθ. ΓΠΑ) Δημήτριος Βλαχάκης (Επ. Καθ. ΓΠΑ) Ευάγγελος Ζωίδης (Επ.Καθ. ΓΠΑ) Γεώργιος Θεοδώρου (Επ.Καθ. ΓΠΑ) 2 Εντοπισμός γονιδιωματικών περιοχών και δικτύων γονιδίων που επηρεάζουν παραγωγικές και αναπαραγωγικές ιδιότητες σε πληθυσμούς κρεοπαραγωγικών ορνιθίων Περίληψη Σκοπός της παρούσας διδακτορικής διατριβής ήταν ο εντοπισμός γενετικών δεικτών και υποψηφίων γονιδίων που εμπλέκονται στο γενετικό έλεγχο δύο τυπικών πολυγονιδιακών ιδιοτήτων σε κρεοπαραγωγικά ορνίθια. Μία ιδιότητα σχετίζεται με την ανάπτυξη (σωματικό βάρος στις 35 ημέρες, ΣΒ) και η άλλη με την αναπαραγωγική