DOCSLIB.ORG

Mouse Btaf1 Knockout Project (CRISPR/Cas9)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mouse Btaf1 Knockout Project (CRISPR/Cas9) https://www.alphaknockout.com Mouse Btaf1 Knockout Project (CRISPR/Cas9) Objective: To create a Btaf1 knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Btaf1 gene (NCBI Reference Sequence: NM_001080706 ; Ensembl: ENSMUSG00000040565 ) is located on Mouse chromosome 19. 38 exons are identified, with the ATG start codon in exon 1 and the TGA stop codon in exon 38 (Transcript: ENSMUST00000099494). Exon 3~6 will be selected as target site. Cas9 and gRNA will be co-injected into fertilized eggs for KO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Embryos homozygous for a gene-trapped allele display growth retardation. Embryos homozygous for an ENU- induced allele show growth retardation, edema, abnormal blood circulation, myocardial trabeculae hypoplasia, and delayed head and brain development. Exon 3 starts from about 2.51% of the coding region. Exon 3~6 covers 10.1% of the coding region. The size of effective KO region: ~9442 bp. The KO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 3 4 5 6 38 Legends Exon of mouse Btaf1 Knockout region Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot (up) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section upstream of Exon 3 is aligned with itself to determine if there are tandem repeats. No significant tandem repeat is found in the dot plot matrix. So this region is suitable for PCR screening or sequencing analysis. Overview of the Dot Plot (down) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section downstream of Exon 6 is aligned with itself to determine if there are tandem repeats. No significant tandem repeat is found in the dot plot matrix. So this region is suitable for PCR screening or sequencing analysis. Page 3 of 8 https://www.alphaknockout.com Overview of the GC Content Distribution (up) Window size: 300 bp Sequence 12 Summary: Full Length(2000bp) | A(28.75% 575) | C(18.5% 370) | T(34.4% 688) | G(18.35% 367) Note: The 2000 bp section upstream of Exon 3 is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Overview of the GC Content Distribution (down) Window size: 300 bp Sequence 12 Summary: Full Length(2000bp) | A(29.55% 591) | C(16.75% 335) | T(32.2% 644) | G(21.5% 430) Note: The 2000 bp section downstream of Exon 6 is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Page 4 of 8 https://www.alphaknockout.com BLAT Search Results (up) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 2000 1 2000 2000 100.0% chr19 + 36947069 36949068 2000 browser details YourSeq 170 847 1737 2000 92.1% chr11 + 93954752 94376661 421910 browser details YourSeq 146 847 1019 2000 94.0% chr14 - 70590776 70590948 173 browser details YourSeq 144 794 1005 2000 93.9% chr1 - 132261556 132261842 287 browser details YourSeq 141 846 1010 2000 89.9% chr3 + 116823390 116823546 157 browser details YourSeq 138 851 1033 2000 93.8% chr11 - 54875398 54875585 188 browser details YourSeq 138 834 1007 2000 88.0% chr12 + 111847846 111848003 158 browser details YourSeq 138 849 1010 2000 93.2% chr10 + 43491282 43491445 164 browser details YourSeq 136 849 1010 2000 94.2% chr12 - 51023696 51023863 168 browser details YourSeq 136 847 1001 2000 91.8% chr19 + 37447040 37447184 145 browser details YourSeq 135 847 1004 2000 91.8% chr11 - 59765992 59766139 148 browser details YourSeq 134 850 1004 2000 91.1% chr7 - 80354329 80354473 145 browser details YourSeq 134 850 1004 2000 94.1% chr2 - 156408661 156408824 164 browser details YourSeq 134 850 1004 2000 91.2% chr3 + 28291891 28292039 149 browser details YourSeq 133 854 1010 2000 93.5% chr13 - 62787946 62788117 172 browser details YourSeq 133 619 1010 2000 90.3% chr12 - 51354416 51354897 482 browser details YourSeq 132 847 1004 2000 89.5% chr3 - 19998137 19998287 151 browser details YourSeq 131 864 1010 2000 92.5% chr3 + 54785874 54786018 145 browser details YourSeq 131 854 1008 2000 93.5% chr14 + 25990545 25990703 159 browser details YourSeq 131 850 1008 2000 91.8% chr1 + 14261079 14261243 165 Note: The 2000 bp section upstream of Exon 3 is BLAT searched against the genome. No significant similarity is found. BLAT Search Results (down) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 2000 1 2000 2000 100.0% chr19 + 36958511 36960510 2000 browser details YourSeq 147 898 1228 2000 90.7% chr11 + 101429923 101483444 53522 browser details YourSeq 128 884 1202 2000 88.6% chr17 - 37065964 37097401 31438 browser details YourSeq 108 930 1222 2000 78.2% chr11 - 116734666 116734856 191 browser details YourSeq 107 890 1974 2000 88.5% chr1 + 155076635 155155761 79127 browser details YourSeq 101 794 975 2000 90.4% chr4 + 120931986 120932268 283 browser details YourSeq 101 1815 1982 2000 85.8% chr10 + 39282492 39282672 181 browser details YourSeq 100 791 1235 2000 87.7% chr17 + 23765875 23766577 703 browser details YourSeq 99 901 1227 2000 82.9% chr10 + 95537370 95537688 319 browser details YourSeq 93 1672 1979 2000 92.6% chr13 + 31062808 31063337 530 browser details YourSeq 92 1712 1979 2000 89.2% chr18 - 49860299 49860564 266 browser details YourSeq 92 1180 1891 2000 88.9% chr11 + 97255946 97494937 238992 browser details YourSeq 88 930 1259 2000 80.6% chr2 - 154653130 154653429 300 browser details YourSeq 88 1714 1984 2000 88.8% chr11 - 104569617 104569889 273 browser details YourSeq 87 1109 1224 2000 85.1% chr10 - 80091107 80091220 114 browser details YourSeq 85 1708 1982 2000 92.0% chr11 - 94617782 94618118 337 browser details YourSeq 84 834 1397 2000 73.6% chr1 - 74866677 74866844 168 browser details YourSeq 81 1109 1224 2000 82.5% chr1 - 23338262 23338375 114 browser details YourSeq 80 1679 1923 2000 92.6% chr1 - 193378516 193378764 249 browser details YourSeq 78 1111 1224 2000 87.5% chr8 - 105960813 105960924 112 Note: The 2000 bp section downstream of Exon 6 is BLAT searched against the genome. No significant similarity is found. Page 5 of 8 https://www.alphaknockout.com Gene and protein information: Btaf1 B-TFIID TATA-box binding protein associated factor 1 [ Mus musculus (house mouse) ] Gene ID: 107182, updated on 12-Aug-2019 Gene summary Official Symbol Btaf1 provided by MGI Official Full Name B-TFIID TATA-box binding protein associated factor 1 provided by MGI Primary source MGI:MGI:2147538 See related Ensembl:ENSMUSG00000040565 Gene type protein coding RefSeq status PROVISIONAL Organism Mus musculus Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus Also known as TAF170; AI414500; AI447930; E430027O22Rik Expression Ubiquitous expression in testis adult (RPKM 6.3), liver E14 (RPKM 5.8) and 28 other tissues See more Orthologs human all Genomic context Location: 19; 19 C2 See Btaf1 in Genome Data Viewer Exon count: 39 Annotation release Status Assembly Chr Location 108 current GRCm38.p6 (GCF_000001635.26) 19 NC_000085.6 (36926079..37014057) Build 37.2 previous assembly MGSCv37 (GCF_000001635.18) 19 NC_000085.5 (37000569..37088547) Chromosome 19 - NC_000085.6 Page 6 of 8 https://www.alphaknockout.com Transcript information: This gene has 3 transcripts Gene: Btaf1 ENSMUSG00000040565 Description B-TFIID TATA-box binding protein associated factor 1 [Source:MGI Symbol;Acc:MGI:2147538] Gene Synonyms E430027O22Rik Location Chromosome 19: 36,926,079-37,012,752 forward strand. GRCm38:CM001012.2 About this gene This gene has 3 transcripts (splice variants), 193 orthologues, 32 paralogues, is a member of 1 Ensembl protein family and is associated with 6 phenotypes. Transcripts Name Transcript ID bp Protein Translation ID Biotype CCDS UniProt Flags Btaf1-201 ENSMUST00000099494.3 7204 1848aa ENSMUSP00000097093.3 Protein coding CCDS37969 E9QAE3 TSL:1 GENCODE basic APPRIS P1 Btaf1-203 ENSMUST00000238041.1 4876 No protein - Retained intron - - - Btaf1-202 ENSMUST00000236343.1 1400 No protein - Retained intron - - - 106.67 kb Forward strand 36.92Mb 36.94Mb 36.96Mb 36.98Mb 37.00Mb 37.02Mb Genes (Comprehensive set... Btaf1-201 >protein coding Btaf1-203 >retained intron Btaf1-202 >retained intron Contigs AC118931.8 > Genes < Fgfbp3-202protein coding < Cpeb3-201protein coding (Comprehensive set... < Fgfbp3-201protein coding < Cpeb3-203protein coding < Cpeb3-210protein coding < Cpeb3-212protein coding Regulatory Build 36.92Mb 36.94Mb 36.96Mb 36.98Mb 37.00Mb 37.02Mb Reverse strand 106.67 kb Regulation Legend CTCF Enhancer Open Chromatin Promoter Promoter Flank Transcription Factor Binding Site Gene Legend Protein Coding merged Ensembl/Havana Ensembl protein coding Non-Protein Coding processed transcript Page 7 of 8 https://www.alphaknockout.com Transcript: ENSMUST00000099494 86.67 kb Forward strand Btaf1-201 >protein coding ENSMUSP00000097... MobiDB lite Low complexity (Seg) Coiled-coils (Ncoils) Superfamily Armadillo-type fold P-loop containing nucleoside triphosphate hydrolase SMART Helicase superfamily 1/2, ATP-binding domain Helicase, C-terminal Pfam Domain of unknown function DUF3535 Helicase, C-terminal SNF2-related, N-terminal domain PROSITE profiles Helicase superfamily 1/2, ATP-binding domain Helicase, C-terminal PANTHER PTHR36498 Gene3D Armadillo-like helical 3.40.50.300 SNF2-like, N-terminal domain superfamily CDD cd17999 cd18793 All sequence SNPs/i... Sequence variants (dbSNP and all other sources) Variant Legend missense variant splice region variant synonymous variant Scale bar 0 200 400 600 800 1000 1200 1400 1600 1848 We wish to acknowledge the following valuable scientific information resources: Ensembl, MGI, NCBI, UCSC.
Load more

Recommended publications
  • Interconversion Between Active and Inactive TATA-Binding Protein
    1446–1459 Nucleic Acids Research, 2012, Vol. 40, No. 4 Published online 19 October 2011 doi:10.1093/nar/gkr802 Interconversion between active and inactive TATA-binding protein transcription complexes in the mouse genome Mohamed-Amin Choukrallah, Dominique Kobi1, Igor Martianov1, W. W. M. Pim Pijnappel2,4, Nikolai Mischerikow2,3, Tao Ye1, Albert J. R. Heck3,4,5, H. Th. Marc Timmers2,4 and Irwin Davidson1,* 1Institut de Ge´ ne´ tique et de Biologie Mole´ culaire et Cellulaire, CNRS/INSERM/ULP, 1 Rue Laurent Fries, 67404 Illkirch Ce´ dex, France, 2Molecular Cancer Research, University Medical Center Utrecht, Universiteitsweg 100, 3Biomolecular Mass Spectrometry and Proteomics Group, Bijvoet Centre for Biomolecular Research and Utrecht Institute for Pharmaceutical Sciences, Utrecht University, 4Netherlands Proteomics Centre and 5Centre for Biomedical Genetics, Padualaan 8, 3584 CH Utrecht, The Netherlands Received June 10, 2011; Revised September 12, 2011; Accepted September 13, 2011 ABSTRACT preinitiation complex comprising B-TFIID that primes the promoter for productive preinitiation The TATA binding protein (TBP) plays a pivotal role complex formation in mammalian cells. in RNA polymerase II (Pol II) transcription through incorporation into the TFIID and B-TFIID complexes. The role of mammalian B-TFIID composed of TBP INTRODUCTION and B-TAF1 is poorly understood. Using a com- Accurate initiation of transcription by RNA polymerase plementation system in genetically modified mouse II (Pol II) requires the assembly of the multiprotein cells where endogenous TBP can be condi- preinitiation complex (PIC) on the core promoter around tionally inactivated and replaced by exogenous the mRNA start site (1–3). Amongst the basal transcrip- mutant TBP coupled to tandem affinity purification tion factors in this process is the TFIID complex com- and mass spectrometry, we identify two TBP prising the TATA binding protein (TBP) and a set of 13–14 TBP-associated factors (TAFs) (4–7).
    [Show full text]
  • INO80C Remodeler Maintains Genomic Stability by Preventing Promiscuous Transcription at Replication Origins
    HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Cell Rep Manuscript Author . Author manuscript; Manuscript Author available in PMC 2020 October 07. Published in final edited form as: Cell Rep. 2020 September 08; 32(10): 108106. doi:10.1016/j.celrep.2020.108106. INO80C Remodeler Maintains Genomic Stability by Preventing Promiscuous Transcription at Replication Origins Salih Topal1,4, Christopher Van1,4, Yong Xue2,3,4, Michael F. Carey2,*, Craig L. Peterson1,5,* 1Program in Molecular Medicine, University of Massachusetts Medical School, 373 Plantation Street, Worcester, MA 01605, USA 2Department of Biological Chemistry, David Geffen School of Medicine, University of California, Los Angeles, Los Angeles, CA 90095, USA 3Jiangsu Key Laboratory of Marine Pharmaceutical Compound Screening, Jiangsu Ocean University, Lianyungang 222005, China 4These authors contributed equally 5Lead Contact SUMMARY The proper coordination of transcription with DNA replication and repair is central for genomic stability. We investigate how the INO80C chromatin remodeling enzyme might coordinate these genomic processes. We find that INO80C co-localizes with the origin recognition complex (ORC) at yeast replication origins and is bound to replication initiation sites in mouse embryonic stem cells (mESCs). In yeast· INO80C recruitment requires origin sequences but does not require ORC· suggesting that recruitment is independent of pre-replication complex assembly. In both yeast and ESCs· INO80C co-localizes at origins with Mot1 and NC2 transcription factors· and genetic studies suggest that they function together to promote genome stability. Interestingly· nascent transcript sequencing demonstrates that INO80C and Mot1 prevent pervasive transcription through origin sequences· and absence of these factors leads to formation of new DNA double-strand breaks.
    [Show full text]
  • Open Huisinga Thesis Revisions Full All
    The Pennsylvania State University The Graduate School Department of Biochemistry and Molecular Biology GLOBAL REGULATION OF GENE EXPRESSION IN SACCHAROMYCES CEREVISIAE VIA TATA BINDING PROTEIN REGULATORY FACTORS A Thesis in Biochemistry, Microbiology, and Molecular Biology by Kathryn L. Huisinga Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy August 2005 The thesis of Kathryn L. Huisinga was reviewed and approved* by the following: B. Franklin Pugh Professor of Biochemistry and Molecular Biology Thesis Advisor Chair of Committee Joseph C. Reese Associate Professor of Biochemistry and Molecular Biology Ross C. Hardison T. Ming Chu Professor of Biochemistry and Molecular Biology Naomi S. Altman Associate Professor of Statistics Robert A. Schlegal Professor of Biochemistry and Molecular Biology Head of the Department of Biochemistry and Molecular Biology *Signatures are on file in the Graduate School ABSTRACT The TATA Binding Protein (TBP) is a key component of gene regulation. It binds to the promoter region of eukaryotic genes and facilitates assembly of the transcription initiation machinery, including RNA Polymerase II. Many proteins interact with TBP to both positively and negatively regulate gene expression. My thesis utilized genome-wide expression profiling in Saccharomyces cerevisiae to define the target genes of, and relationships between, the factors that regulate transcription via TBP. I found the SAGA and TFIID co-activator complexes, both of which can deliver TBP to promoters, make overlapping contributions to the expression of nearly all yeast genes. The SAGA complex functions predominantly at ~10% of the genome, targeting genes that contain TATA boxes and are up regulated upon an environmental stress response.
    [Show full text]
  • Mechanisms Underlying Phenotypic Heterogeneity in Simplex Autism Spectrum Disorders
    Mechanisms Underlying Phenotypic Heterogeneity in Simplex Autism Spectrum Disorders Andrew H. Chiang Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy under the Executive Committee of the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2021 © 2021 Andrew H. Chiang All Rights Reserved Abstract Mechanisms Underlying Phenotypic Heterogeneity in Simplex Autism Spectrum Disorders Andrew H. Chiang Autism spectrum disorders (ASD) are a group of related neurodevelopmental diseases displaying significant genetic and phenotypic heterogeneity. Despite recent progress in ASD genetics, the nature of phenotypic heterogeneity across probands is not well understood. Notably, likely gene- disrupting (LGD) de novo mutations affecting the same gene often result in substantially different ASD phenotypes. We find that truncating mutations in a gene can result in a range of relatively mild decreases (15-30%) in gene expression due to nonsense-mediated decay (NMD), and show that more severe autism phenotypes are associated with greater decreases in expression. We also find that each gene with recurrent ASD mutations can be described by a parameter, phenotype dosage sensitivity (PDS), which characteriZes the relationship between changes in a gene’s dosage and changes in a given phenotype. Using simple linear models, we show that changes in gene dosage account for a substantial fraction of phenotypic variability in ASD. We further observe that LGD mutations affecting the same exon frequently lead to strikingly similar phenotypes in unrelated ASD probands. These patterns are observed for two independent proband cohorts and multiple important ASD-associated phenotypes. The observed phenotypic similarities are likely mediated by similar changes in gene dosage and similar perturbations to the relative expression of splicing isoforms.
    [Show full text]
  • On Human Promoters
    Global distribution of negative cofactor 2 subunit-␣ on human promoters Thomas K. Albert*, Korbinian Grote†, Stefan Boeing*, Gertraud Stelzer*, Aloys Schepers‡, and Michael Meisterernst*§ Departments of *Gene Expression and ‡Gene Vectors, GSF–National Research Center for Environment and Health, Marchioninistrasse 25, 81377 Munich, Germany; and †Genomatix Software GmbH, Bayerstrasse 85a, 80335 Munich, Germany Communicated by Robert G. Roeder, The Rockefeller University, New York, NY, April 30, 2007 (received for review November 16, 2006) Negative cofactor 2 (NC2) forms a stable complex with TATA- of multiple sequence-specific transcription factors in mammalian binding protein (TBP) on promoters in vitro. Its association with TBP genomes. However, surprisingly little is known about the genome- prevents the binding of TFIIB and leads to inhibition of preinitiation wide location of GTFs and general cofactors in mammalian cells. complex formation. Here, we investigate the association of NC2 One exception is the investigation of the genome-wide location of subunit-␣ with human RNA polymerase II promoter regions by TAF1 conducted along with RNAPII (16). using gene-specific ChIP and genome-wide promoter ChIPchip In our analysis, the human cofactor NC2␣ occupied Ͼ20% of analyses. We find NC2␣ associated with a large number of human all human gene promoters. We observed a positive correlation promoters, where it peaks close to the core regions. NC2 occupancy of NC2 gene occupancy with mRNA levels. On the other hand, in vivo positively correlates with mRNA levels, which perhaps NC2 occupancy negatively correlated with the presence of BRE, reflects its capacity to stabilize TBP on promoter regions. In single the TFIIB core promoter recognition element.
    [Show full text]
  • Download Validation Data
    PrimePCR™Assay Validation Report Gene Information Gene Name TATA-binding protein-associated factor 172 precursor Gene Symbol Btaf1 Organism Rat Gene Summary Description Not Available Gene Aliases Not Available RefSeq Accession No. NM_001191917 UniGene ID Rn.1237 Ensembl Gene ID ENSRNOG00000017938 Entrez Gene ID 368042 Assay Information Unique Assay ID qRnoCID0007247 Assay Type SYBR® Green Detected Coding Transcript(s) ENSRNOT00000024465 Amplicon Context Sequence GGCCATTTTTACATCACACTATATCTTCAGTTCGAAGAGCAGCATTGGAAACTCT CTTTACATTATTATCAACACAGGACCAGAACTCGTCGTCTTGGCTTATCCCTATCC TGTCTGATATGCTGCGG Amplicon Length (bp) 98 Chromosome Location 1:263087966-263094475 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 100 R2 1 cDNA Cq 21.2 cDNA Tm (Celsius) 80 gDNA Cq 37.19 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Btaf1, Rat Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect. Details for each transcript can be found on the Ensembl website at www.ensembl.org.
    [Show full text]
  • The Role of SMARCAD1 During Replication Stress Sarah Joseph
    The role of SMARCAD1 during replication stress Sarah Joseph Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy under the Executive Committee of the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2020 © 2020 Sarah Joseph All Rights Reserved Abstract The role of SMARCAD1 during replication stress Sarah Joseph Heterozygous mutations in BRCA1 or BRCA2 predispose carriers to an increased risk for breast or ovarian cancer. Both BRCA1 and BRCA2 (BRCA1/2) play an integral role in promoting genomic stability through their respective actions during homologous recombination (HR) mediated repair and stalled replication fork protection from nucleolytic degradation. SMARCAD1 (SD1) is a SWI/SNF chromatin remodeler that has been implicated in promoting long-range end resection and contributes to HR. Using human cell lines, we show that SMARCAD1 promotes nucleolytic degradation in BRCA1/2-deficient cells dependent on its chromatin remodeling activity. Moreover, SMARCAD1 prevents DNA break formation and promotes fork restart at stalled replication forks. These studies identify a new role for SMARCAD1 at the replication fork. In addition to the work presented here, I discuss a method for introducing stop codons (nonsense mutations) into genes using CRISPR-mediated base editing, called iSTOP, and provide an online resource for accessing the sequence of iSTOP sgRNASs (sgSTOPs) for five base editor variants (VQR-BE3, EQR-BE3, VRER-BE3, SaBE3, and SaKKH-BE3) in humans and over 3 million targetable gene coordinates for eight eukaryotic species. Ultimately, with improvements to CRISPR base editors this method can help model and study nonsense mutations in human disease. Table of Contents List of Figures .................................................................................................................
    [Show full text]
  • Agricultural University of Athens
    ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΤΩΝ ΖΩΩΝ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ ΖΩΙΚΗΣ ΠΑΡΑΓΩΓΗΣ ΕΡΓΑΣΤΗΡΙΟ ΓΕΝΙΚΗΣ ΚΑΙ ΕΙΔΙΚΗΣ ΖΩΟΤΕΧΝΙΑΣ ΔΙΔΑΚΤΟΡΙΚΗ ΔΙΑΤΡΙΒΗ Εντοπισμός γονιδιωματικών περιοχών και δικτύων γονιδίων που επηρεάζουν παραγωγικές και αναπαραγωγικές ιδιότητες σε πληθυσμούς κρεοπαραγωγικών ορνιθίων ΕΙΡΗΝΗ Κ. ΤΑΡΣΑΝΗ ΕΠΙΒΛΕΠΩΝ ΚΑΘΗΓΗΤΗΣ: ΑΝΤΩΝΙΟΣ ΚΟΜΙΝΑΚΗΣ ΑΘΗΝΑ 2020 ΔΙΔΑΚΤΟΡΙΚΗ ΔΙΑΤΡΙΒΗ Εντοπισμός γονιδιωματικών περιοχών και δικτύων γονιδίων που επηρεάζουν παραγωγικές και αναπαραγωγικές ιδιότητες σε πληθυσμούς κρεοπαραγωγικών ορνιθίων Genome-wide association analysis and gene network analysis for (re)production traits in commercial broilers ΕΙΡΗΝΗ Κ. ΤΑΡΣΑΝΗ ΕΠΙΒΛΕΠΩΝ ΚΑΘΗΓΗΤΗΣ: ΑΝΤΩΝΙΟΣ ΚΟΜΙΝΑΚΗΣ Τριμελής Επιτροπή: Aντώνιος Κομινάκης (Αν. Καθ. ΓΠΑ) Ανδρέας Κράνης (Eρευν. B, Παν. Εδιμβούργου) Αριάδνη Χάγερ (Επ. Καθ. ΓΠΑ) Επταμελής εξεταστική επιτροπή: Aντώνιος Κομινάκης (Αν. Καθ. ΓΠΑ) Ανδρέας Κράνης (Eρευν. B, Παν. Εδιμβούργου) Αριάδνη Χάγερ (Επ. Καθ. ΓΠΑ) Πηνελόπη Μπεμπέλη (Καθ. ΓΠΑ) Δημήτριος Βλαχάκης (Επ. Καθ. ΓΠΑ) Ευάγγελος Ζωίδης (Επ.Καθ. ΓΠΑ) Γεώργιος Θεοδώρου (Επ.Καθ. ΓΠΑ) 2 Εντοπισμός γονιδιωματικών περιοχών και δικτύων γονιδίων που επηρεάζουν παραγωγικές και αναπαραγωγικές ιδιότητες σε πληθυσμούς κρεοπαραγωγικών ορνιθίων Περίληψη Σκοπός της παρούσας διδακτορικής διατριβής ήταν ο εντοπισμός γενετικών δεικτών και υποψηφίων γονιδίων που εμπλέκονται στο γενετικό έλεγχο δύο τυπικών πολυγονιδιακών ιδιοτήτων σε κρεοπαραγωγικά ορνίθια. Μία ιδιότητα σχετίζεται με την ανάπτυξη (σωματικό βάρος στις 35 ημέρες, ΣΒ) και η άλλη με την αναπαραγωγική
    [Show full text]
  • Content Based Search in Gene Expression Databases and a Meta-Analysis of Host Responses to Infection
    Content Based Search in Gene Expression Databases and a Meta-analysis of Host Responses to Infection A Thesis Submitted to the Faculty of Drexel University by Francis X. Bell in partial fulfillment of the requirements for the degree of Doctor of Philosophy November 2015 c Copyright 2015 Francis X. Bell. All Rights Reserved. ii Acknowledgments I would like to acknowledge and thank my advisor, Dr. Ahmet Sacan. Without his advice, support, and patience I would not have been able to accomplish all that I have. I would also like to thank my committee members and the Biomed Faculty that have guided me. I would like to give a special thanks for the members of the bioinformatics lab, in particular the members of the Sacan lab: Rehman Qureshi, Daisy Heng Yang, April Chunyu Zhao, and Yiqian Zhou. Thank you for creating a pleasant and friendly environment in the lab. I give the members of my family my sincerest gratitude for all that they have done for me. I cannot begin to repay my parents for their sacrifices. I am eternally grateful for everything they have done. The support of my sisters and their encouragement gave me the strength to persevere to the end. iii Table of Contents LIST OF TABLES.......................................................................... vii LIST OF FIGURES ........................................................................ xiv ABSTRACT ................................................................................ xvii 1. A BRIEF INTRODUCTION TO GENE EXPRESSION............................. 1 1.1 Central Dogma of Molecular Biology........................................... 1 1.1.1 Basic Transfers .......................................................... 1 1.1.2 Uncommon Transfers ................................................... 3 1.2 Gene Expression ................................................................. 4 1.2.1 Estimating Gene Expression ............................................ 4 1.2.2 DNA Microarrays ......................................................
    [Show full text]
  • Nucleic Acids Research, 2009, Vol
    Published online 2 June 2009 Nucleic Acids Research, 2009, Vol. 37, No. 14 4587–4602 doi:10.1093/nar/gkp425 An integrative genomics approach identifies Hypoxia Inducible Factor-1 (HIF-1)-target genes that form the core response to hypoxia Yair Benita1, Hirotoshi Kikuchi2, Andrew D. Smith3, Michael Q. Zhang3, Daniel C. Chung2 and Ramnik J. Xavier1,2,* 1Center for Computational and Integrative Biology, 2Gastrointestinal Unit, Center for the Study of Inflammatory Bowel Disease, Massachusetts General Hospital, Harvard Medical School, Boston, MA 02114 and 3Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 11724, USA Received April 20, 2009; Revised May 6, 2009; Accepted May 8, 2009 ABSTRACT the pivotal mediators of the cellular response to hypoxia is hypoxia-inducible factor (HIF), a transcription factor The transcription factor Hypoxia-inducible factor 1 that contains a basic helix-loop-helix motif as well as (HIF-1) plays a central role in the transcriptional PAS domain. There are three known members of the response to oxygen flux. To gain insight into HIF family (HIF-1, HIF-2 and HIF-3) and all are a/b the molecular pathways regulated by HIF-1, it is heterodimeric proteins. HIF-1 was the first factor to be essential to identify the downstream-target genes. cloned and is the best understood isoform (1). HIF-3 is We report here a strategy to identify HIF-1-target a distant relative of HIF-1 and little is currently known genes based on an integrative genomic approach about its function and involvement in oxygen homeosta- combining computational strategies and experi- sis.
    [Show full text]
  • Assessing Mitochondrial Theory of Aging on the Transcriptome Level
    Supplemental Material MicroRNA, mRNA, and Protein Expression Link Development and Aging in Human and Macaque Brain Supplemental Tables......................................................................................................... 3 Table S1. Sample characteristics (human). ......................................................................................... 3 Table S2. Sample characteristics (macaque). ...................................................................................... 4 Table S3. Proportions of transition genes in mRNA, miRNA and protein datasets. ........................... 5 Table S4. miRNA changes with age in human and mouse.................................................................. 6 Table S5. miRNA-target pairs involved in human cortex development and aging............................. 7 Table S6. miRNA-target pairs overlapping with experimentally verified target sets........................ 10 Table S7. Gene Ontology categories enriched among gene groups. ................................................. 12 Table S8. KEGG pathways enriched among gene groups................................................................. 13 Supplemental Figures ..................................................................................................... 15 Figure S1. Age effect on expression and correlation between datasets............................................. 15 Figure S2. Correlation among genes within gene groups. ................................................................ 17 Figure
    [Show full text]
  • Novel and Highly Recurrent Chromosomal Alterations in Se´Zary Syndrome
    Research Article Novel and Highly Recurrent Chromosomal Alterations in Se´zary Syndrome Maarten H. Vermeer,1 Remco van Doorn,1 Remco Dijkman,1 Xin Mao,3 Sean Whittaker,3 Pieter C. van Voorst Vader,4 Marie-Jeanne P. Gerritsen,5 Marie-Louise Geerts,6 Sylke Gellrich,7 Ola So¨derberg,8 Karl-Johan Leuchowius,8 Ulf Landegren,8 Jacoba J. Out-Luiting,1 Jeroen Knijnenburg,2 Marije IJszenga,2 Karoly Szuhai,2 Rein Willemze,1 and Cornelis P. Tensen1 Departments of 1Dermatology and 2Molecular Cell Biology, Leiden University Medical Center, Leiden, the Netherlands; 3Department of Dermatology, St Thomas’ Hospital, King’s College, London, United Kingdom; 4Department of Dermatology, University Medical Center Groningen, Groningen, the Netherlands; 5Department of Dermatology, Radboud University Nijmegen Medical Center, Nijmegen, the Netherlands; 6Department of Dermatology, Gent University Hospital, Gent, Belgium; 7Department of Dermatology, Charite, Berlin, Germany; and 8Department of Genetics and Pathology, Rudbeck Laboratory, University of Uppsala, Uppsala, Sweden Abstract Introduction This study was designed to identify highly recurrent genetic Se´zary syndrome (Sz) is an aggressive type of cutaneous T-cell alterations typical of Se´zary syndrome (Sz), an aggressive lymphoma/leukemia of skin-homing, CD4+ memory T cells and is cutaneous T-cell lymphoma/leukemia, possibly revealing characterized by erythroderma, generalized lymphadenopathy, and pathogenetic mechanisms and novel therapeutic targets. the presence of neoplastic T cells (Se´zary cells) in the skin, lymph High-resolution array-based comparative genomic hybridiza- nodes, and peripheral blood (1). Sz has a poor prognosis, with a tion was done on malignant T cells from 20 patients. disease-specific 5-year survival of f24% (1).
    [Show full text]