DOCSLIB.ORG

Interconversion Between Active and Inactive TATA-Binding Protein

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Interconversion Between Active and Inactive TATA-Binding Protein 1446–1459 Nucleic Acids Research, 2012, Vol. 40, No. 4 Published online 19 October 2011 doi:10.1093/nar/gkr802 Interconversion between active and inactive TATA-binding protein transcription complexes in the mouse genome Mohamed-Amin Choukrallah, Dominique Kobi1, Igor Martianov1, W. W. M. Pim Pijnappel2,4, Nikolai Mischerikow2,3, Tao Ye1, Albert J. R. Heck3,4,5, H. Th. Marc Timmers2,4 and Irwin Davidson1,* 1Institut de Ge´ ne´ tique et de Biologie Mole´ culaire et Cellulaire, CNRS/INSERM/ULP, 1 Rue Laurent Fries, 67404 Illkirch Ce´ dex, France, 2Molecular Cancer Research, University Medical Center Utrecht, Universiteitsweg 100, 3Biomolecular Mass Spectrometry and Proteomics Group, Bijvoet Centre for Biomolecular Research and Utrecht Institute for Pharmaceutical Sciences, Utrecht University, 4Netherlands Proteomics Centre and 5Centre for Biomedical Genetics, Padualaan 8, 3584 CH Utrecht, The Netherlands Received June 10, 2011; Revised September 12, 2011; Accepted September 13, 2011 ABSTRACT preinitiation complex comprising B-TFIID that primes the promoter for productive preinitiation The TATA binding protein (TBP) plays a pivotal role complex formation in mammalian cells. in RNA polymerase II (Pol II) transcription through incorporation into the TFIID and B-TFIID complexes. The role of mammalian B-TFIID composed of TBP INTRODUCTION and B-TAF1 is poorly understood. Using a com- Accurate initiation of transcription by RNA polymerase plementation system in genetically modified mouse II (Pol II) requires the assembly of the multiprotein cells where endogenous TBP can be condi- preinitiation complex (PIC) on the core promoter around tionally inactivated and replaced by exogenous the mRNA start site (1–3). Amongst the basal transcrip- mutant TBP coupled to tandem affinity purification tion factors in this process is the TFIID complex com- and mass spectrometry, we identify two TBP prising the TATA binding protein (TBP) and a set of 13–14 TBP-associated factors (TAFs) (4–7). Two add- mutations, R188E and K243E, that disrupt the TBP– itional TBP-containing complexes involved in Pol II tran- BTAF1 interaction and B-TFIID complex formation. scription have been described, the B-TFIID complex, Transcriptome and ChIP-seq analyses show that where TBP is associated with BTAF1 and TAC, a loss of B-TFIID does not generally alter gene ex- complex found in undifferentiated embryonic stem cells, pression or genomic distribution of TBP, but posi- where TBP is associated with an unprocessed form of tively or negatively affects TBP and/or Pol II basal transcription factor TFIIA (8). BTAF1 and its recruitment to a subset of promoters. We identify yeast orthologue Mot1p belong to the SNF2 superfamily promoters where wild-type TBP assembles a of ATPases and they can dissociate TBP from DNA in an partial inactive preinitiation complex comprising ATP-dependent manner (9–12). While it was first proposed B-TFIID, TFIIB and Mediator complex, but lacking that Mot1p may be a transcriptional repressor, genome- TFIID, TFIIE and Pol II. Exchange of B-TFIID in wide studies show that it is associated with active pro- moters where it may use ATP hydrolysis to promote a wild-type cells for TFIID in R188E and K243E dynamic equilibrium of promoter occupancy between a mutant cells at these primed promoters completes transcriptionally inactive Mot1p–TBP–NC2 complex and preinitiation complex formation and recruits Pol II to an active TFIID complex (13–15). activate their expression. We propose a novel regu- The highly conserved TBP C-terminal core domain latory mechanism involving formation of a partial binds DNA and interacts with basal transcription *To whom correspondence should be addressed. Tel: +33 3 88 65 34 40 (45); Fax: +33 3 88 65 32 01; Email: [email protected] Present address: Mohamed-Amin Choukrallah, Friedrich Miescher Institute for Biomedical Research, Maulbeerstrasse 66, 4058 Basel, Switzerland The authors wish it to be known that, in their opinion, the first two authors should be regarded as joint First Authors. ß The Author(s) 2011. Published by Oxford University Press. This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/ by-nc/3.0), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. Nucleic Acids Research, 2012, Vol. 40, No. 4 1447 factors and a host of other regulatory proteins (16). The and TBP expression verified by immunoblot. Cell prolif- structure of TBP bound to TATA-containing DNA, as eration analysis, Affymetrix microarrays, qPCR and well as with the basal transcription factors TFIIA, immunoblot were all performed by standard methods TFIIB, NC2, BRF and the N-terminal domain of TAF1 as previously described (28). TBP was detected using have all been described (17–21). Surfaces involved in these the 3G3 antibody that recognizes an epitope at the interactions have been mutated as part of a systematic extreme N-terminus shared between mouse and human mutagenesis of all solvent-exposed residues (22–25). The TBP (29). properties of the mutant TBPs have been evaluated in vitro with respect to transcription using various Pol II and Pol III promoters, binding to DNA, interaction with co- Chromatin immunoprecipitation -sequencing factors and the ability to form higher-order DNA Chromatin immunoprecipitation (ChIP) and ChIP-seq ex- complexes in vitro with its partners, and their ability to periments were performed according to standard proto- support activated transcription in transfected mammalian cells (22,26). cols as previously described (30,31). Briefly, ChIP-seq While previous studies provided considerable insight was performed using an Illumina GAIIx sequencer and into the structure–function relationships of TBP in mam- the raw data analysed by the Illumina Eland pipeline malian cells, their scope has been limited to in vitro assays V1.6. Peak detection was performed using the MACS or transfections with artificial promoters that may not re- software (http://liulab.dfci.harvard.edu/MACS/) (32) produce the complexity of the in vivo situation with the under settings where the GFP ChIP was used as a diversity of promoters in mammalian cells. We have de- negative control. Peaks were then annotated using veloped a unique approach to study TBP function in vivo GPAT [(33), http://bips.u-strasbg.fr/GPAT/Gpat_home using mouse embryonic fibroblasts (MEFs) where one .html] using a window of Æ10 kb with respect to the co- allele of the TBP gene has been inactivated and the ordinates of the beginning and end of RefSeq transcripts. other has been floxed such that endogenous TBP can be Global clustering analysis and quantitative comparisons inactivated by Cre-recombinase. We have performed com- were performed using seqMINER [(34) (http://bips.u- plementation assays showing that TBP mutations affect- strasbg.fr/seqminer/]. Further details are provided in the ing critical interactions in vitro can complement loss of Supplementary Data. ChIP was performed with the fol- endogenous TBP, but lead to impaired cell proliferation. lowing antibodies; TBP (Abcam, AB28175), Pol II, We identify TBP mutations which disrupt the TBP– MED6, XPB, TFIIB (Santa Cruz SC-9001, SC-9434, BTAF1 interaction and show that loss of B-TFIID C18-CS225, respectively), H3K4me3 (Upstate 07-473). complex formation does not affect the global genomic dis- The TAF1 antibody was a kind gift from Dr. L. Tora. tribution of TBP, but positively or negatively affects PIC formation and Pol II recruitment at a selected set of promoters. Proteomics analysis MEF cell nuclear extracts were prepared as previously MATERIALS AND METHODS described and subjected to tandem Flag-HA affinity immunopurification using Flag M2 beads, epitope peptide lox/À Isolation of the Tbp MEFs elution followed by reprecipitation with HA-beads as pre- Mouse ES cells with a null allele of TBP (27) were re- viously described (35). The precipitated proteins were targeted with a second vector to introduce LoxP sites digested with trypsin, and the tryptic peptides separated around exon III of the Tbp gene. These ES cells were by tandem strong cation exchange. Peptides were then used to generate mice with the corresponding genotype. analysed by nanoflow-LC coupled to an LTQ-FTICR MEFs were derived from E10.5 embryos by standard pro- mass spectrometer (Thermo Fisher Scientific). Spectra cedures and immortalized using large T antigen from were processed with Bioworks (version 3.1, Thermo SV40. Fisher Scientific) and the subsequent data analysis was carried out using Mascot (version 2.2.1, Matrix Science). Generation and characterization of cells expressing Mascot results files were filtered to contain only pep- mutant TBPs tides above a Mascot ion score of 15 using in-house Tbplox/À MEFs were first infected with pBABE retro- written software. Scaffold (version 2.01.02, Proteome viruses expressing WT or mutant N-terminal Flag-HA Software) was used to validate protein identifications. tagged TBP. After puromycin selection, cell extracts Protein identifications were accepted if they could be es- were prepared and expression of the exogenous TBP tablished at >99.9% probability and contained at least verified by immunoblot. Cells were reinfected with a two identified peptides. Human TBP and its variants second retrovirus vector expressing the tamoxifen indu- were identified following essentially the same procedure, cible Cre-ERT2. After blasticidine selection, cells were but using
Load more

Recommended publications
  • INO80C Remodeler Maintains Genomic Stability by Preventing Promiscuous Transcription at Replication Origins
    HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Cell Rep Manuscript Author . Author manuscript; Manuscript Author available in PMC 2020 October 07. Published in final edited form as: Cell Rep. 2020 September 08; 32(10): 108106. doi:10.1016/j.celrep.2020.108106. INO80C Remodeler Maintains Genomic Stability by Preventing Promiscuous Transcription at Replication Origins Salih Topal1,4, Christopher Van1,4, Yong Xue2,3,4, Michael F. Carey2,*, Craig L. Peterson1,5,* 1Program in Molecular Medicine, University of Massachusetts Medical School, 373 Plantation Street, Worcester, MA 01605, USA 2Department of Biological Chemistry, David Geffen School of Medicine, University of California, Los Angeles, Los Angeles, CA 90095, USA 3Jiangsu Key Laboratory of Marine Pharmaceutical Compound Screening, Jiangsu Ocean University, Lianyungang 222005, China 4These authors contributed equally 5Lead Contact SUMMARY The proper coordination of transcription with DNA replication and repair is central for genomic stability. We investigate how the INO80C chromatin remodeling enzyme might coordinate these genomic processes. We find that INO80C co-localizes with the origin recognition complex (ORC) at yeast replication origins and is bound to replication initiation sites in mouse embryonic stem cells (mESCs). In yeast· INO80C recruitment requires origin sequences but does not require ORC· suggesting that recruitment is independent of pre-replication complex assembly. In both yeast and ESCs· INO80C co-localizes at origins with Mot1 and NC2 transcription factors· and genetic studies suggest that they function together to promote genome stability. Interestingly· nascent transcript sequencing demonstrates that INO80C and Mot1 prevent pervasive transcription through origin sequences· and absence of these factors leads to formation of new DNA double-strand breaks.
    [Show full text]
  • Open Huisinga Thesis Revisions Full All
    The Pennsylvania State University The Graduate School Department of Biochemistry and Molecular Biology GLOBAL REGULATION OF GENE EXPRESSION IN SACCHAROMYCES CEREVISIAE VIA TATA BINDING PROTEIN REGULATORY FACTORS A Thesis in Biochemistry, Microbiology, and Molecular Biology by Kathryn L. Huisinga Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy August 2005 The thesis of Kathryn L. Huisinga was reviewed and approved* by the following: B. Franklin Pugh Professor of Biochemistry and Molecular Biology Thesis Advisor Chair of Committee Joseph C. Reese Associate Professor of Biochemistry and Molecular Biology Ross C. Hardison T. Ming Chu Professor of Biochemistry and Molecular Biology Naomi S. Altman Associate Professor of Statistics Robert A. Schlegal Professor of Biochemistry and Molecular Biology Head of the Department of Biochemistry and Molecular Biology *Signatures are on file in the Graduate School ABSTRACT The TATA Binding Protein (TBP) is a key component of gene regulation. It binds to the promoter region of eukaryotic genes and facilitates assembly of the transcription initiation machinery, including RNA Polymerase II. Many proteins interact with TBP to both positively and negatively regulate gene expression. My thesis utilized genome-wide expression profiling in Saccharomyces cerevisiae to define the target genes of, and relationships between, the factors that regulate transcription via TBP. I found the SAGA and TFIID co-activator complexes, both of which can deliver TBP to promoters, make overlapping contributions to the expression of nearly all yeast genes. The SAGA complex functions predominantly at ~10% of the genome, targeting genes that contain TATA boxes and are up regulated upon an environmental stress response.
    [Show full text]
  • Mechanisms Underlying Phenotypic Heterogeneity in Simplex Autism Spectrum Disorders
    Mechanisms Underlying Phenotypic Heterogeneity in Simplex Autism Spectrum Disorders Andrew H. Chiang Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy under the Executive Committee of the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2021 © 2021 Andrew H. Chiang All Rights Reserved Abstract Mechanisms Underlying Phenotypic Heterogeneity in Simplex Autism Spectrum Disorders Andrew H. Chiang Autism spectrum disorders (ASD) are a group of related neurodevelopmental diseases displaying significant genetic and phenotypic heterogeneity. Despite recent progress in ASD genetics, the nature of phenotypic heterogeneity across probands is not well understood. Notably, likely gene- disrupting (LGD) de novo mutations affecting the same gene often result in substantially different ASD phenotypes. We find that truncating mutations in a gene can result in a range of relatively mild decreases (15-30%) in gene expression due to nonsense-mediated decay (NMD), and show that more severe autism phenotypes are associated with greater decreases in expression. We also find that each gene with recurrent ASD mutations can be described by a parameter, phenotype dosage sensitivity (PDS), which characteriZes the relationship between changes in a gene’s dosage and changes in a given phenotype. Using simple linear models, we show that changes in gene dosage account for a substantial fraction of phenotypic variability in ASD. We further observe that LGD mutations affecting the same exon frequently lead to strikingly similar phenotypes in unrelated ASD probands. These patterns are observed for two independent proband cohorts and multiple important ASD-associated phenotypes. The observed phenotypic similarities are likely mediated by similar changes in gene dosage and similar perturbations to the relative expression of splicing isoforms.
    [Show full text]
  • On Human Promoters
    Global distribution of negative cofactor 2 subunit-␣ on human promoters Thomas K. Albert*, Korbinian Grote†, Stefan Boeing*, Gertraud Stelzer*, Aloys Schepers‡, and Michael Meisterernst*§ Departments of *Gene Expression and ‡Gene Vectors, GSF–National Research Center for Environment and Health, Marchioninistrasse 25, 81377 Munich, Germany; and †Genomatix Software GmbH, Bayerstrasse 85a, 80335 Munich, Germany Communicated by Robert G. Roeder, The Rockefeller University, New York, NY, April 30, 2007 (received for review November 16, 2006) Negative cofactor 2 (NC2) forms a stable complex with TATA- of multiple sequence-specific transcription factors in mammalian binding protein (TBP) on promoters in vitro. Its association with TBP genomes. However, surprisingly little is known about the genome- prevents the binding of TFIIB and leads to inhibition of preinitiation wide location of GTFs and general cofactors in mammalian cells. complex formation. Here, we investigate the association of NC2 One exception is the investigation of the genome-wide location of subunit-␣ with human RNA polymerase II promoter regions by TAF1 conducted along with RNAPII (16). using gene-specific ChIP and genome-wide promoter ChIPchip In our analysis, the human cofactor NC2␣ occupied Ͼ20% of analyses. We find NC2␣ associated with a large number of human all human gene promoters. We observed a positive correlation promoters, where it peaks close to the core regions. NC2 occupancy of NC2 gene occupancy with mRNA levels. On the other hand, in vivo positively correlates with mRNA levels, which perhaps NC2 occupancy negatively correlated with the presence of BRE, reflects its capacity to stabilize TBP on promoter regions. In single the TFIIB core promoter recognition element.
    [Show full text]
  • Download Validation Data
    PrimePCR™Assay Validation Report Gene Information Gene Name TATA-binding protein-associated factor 172 precursor Gene Symbol Btaf1 Organism Rat Gene Summary Description Not Available Gene Aliases Not Available RefSeq Accession No. NM_001191917 UniGene ID Rn.1237 Ensembl Gene ID ENSRNOG00000017938 Entrez Gene ID 368042 Assay Information Unique Assay ID qRnoCID0007247 Assay Type SYBR® Green Detected Coding Transcript(s) ENSRNOT00000024465 Amplicon Context Sequence GGCCATTTTTACATCACACTATATCTTCAGTTCGAAGAGCAGCATTGGAAACTCT CTTTACATTATTATCAACACAGGACCAGAACTCGTCGTCTTGGCTTATCCCTATCC TGTCTGATATGCTGCGG Amplicon Length (bp) 98 Chromosome Location 1:263087966-263094475 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 100 R2 1 cDNA Cq 21.2 cDNA Tm (Celsius) 80 gDNA Cq 37.19 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Btaf1, Rat Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect. Details for each transcript can be found on the Ensembl website at www.ensembl.org.
    [Show full text]
  • The Role of SMARCAD1 During Replication Stress Sarah Joseph
    The role of SMARCAD1 during replication stress Sarah Joseph Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy under the Executive Committee of the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2020 © 2020 Sarah Joseph All Rights Reserved Abstract The role of SMARCAD1 during replication stress Sarah Joseph Heterozygous mutations in BRCA1 or BRCA2 predispose carriers to an increased risk for breast or ovarian cancer. Both BRCA1 and BRCA2 (BRCA1/2) play an integral role in promoting genomic stability through their respective actions during homologous recombination (HR) mediated repair and stalled replication fork protection from nucleolytic degradation. SMARCAD1 (SD1) is a SWI/SNF chromatin remodeler that has been implicated in promoting long-range end resection and contributes to HR. Using human cell lines, we show that SMARCAD1 promotes nucleolytic degradation in BRCA1/2-deficient cells dependent on its chromatin remodeling activity. Moreover, SMARCAD1 prevents DNA break formation and promotes fork restart at stalled replication forks. These studies identify a new role for SMARCAD1 at the replication fork. In addition to the work presented here, I discuss a method for introducing stop codons (nonsense mutations) into genes using CRISPR-mediated base editing, called iSTOP, and provide an online resource for accessing the sequence of iSTOP sgRNASs (sgSTOPs) for five base editor variants (VQR-BE3, EQR-BE3, VRER-BE3, SaBE3, and SaKKH-BE3) in humans and over 3 million targetable gene coordinates for eight eukaryotic species. Ultimately, with improvements to CRISPR base editors this method can help model and study nonsense mutations in human disease. Table of Contents List of Figures .................................................................................................................
    [Show full text]
  • Agricultural University of Athens
    ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΤΩΝ ΖΩΩΝ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ ΖΩΙΚΗΣ ΠΑΡΑΓΩΓΗΣ ΕΡΓΑΣΤΗΡΙΟ ΓΕΝΙΚΗΣ ΚΑΙ ΕΙΔΙΚΗΣ ΖΩΟΤΕΧΝΙΑΣ ΔΙΔΑΚΤΟΡΙΚΗ ΔΙΑΤΡΙΒΗ Εντοπισμός γονιδιωματικών περιοχών και δικτύων γονιδίων που επηρεάζουν παραγωγικές και αναπαραγωγικές ιδιότητες σε πληθυσμούς κρεοπαραγωγικών ορνιθίων ΕΙΡΗΝΗ Κ. ΤΑΡΣΑΝΗ ΕΠΙΒΛΕΠΩΝ ΚΑΘΗΓΗΤΗΣ: ΑΝΤΩΝΙΟΣ ΚΟΜΙΝΑΚΗΣ ΑΘΗΝΑ 2020 ΔΙΔΑΚΤΟΡΙΚΗ ΔΙΑΤΡΙΒΗ Εντοπισμός γονιδιωματικών περιοχών και δικτύων γονιδίων που επηρεάζουν παραγωγικές και αναπαραγωγικές ιδιότητες σε πληθυσμούς κρεοπαραγωγικών ορνιθίων Genome-wide association analysis and gene network analysis for (re)production traits in commercial broilers ΕΙΡΗΝΗ Κ. ΤΑΡΣΑΝΗ ΕΠΙΒΛΕΠΩΝ ΚΑΘΗΓΗΤΗΣ: ΑΝΤΩΝΙΟΣ ΚΟΜΙΝΑΚΗΣ Τριμελής Επιτροπή: Aντώνιος Κομινάκης (Αν. Καθ. ΓΠΑ) Ανδρέας Κράνης (Eρευν. B, Παν. Εδιμβούργου) Αριάδνη Χάγερ (Επ. Καθ. ΓΠΑ) Επταμελής εξεταστική επιτροπή: Aντώνιος Κομινάκης (Αν. Καθ. ΓΠΑ) Ανδρέας Κράνης (Eρευν. B, Παν. Εδιμβούργου) Αριάδνη Χάγερ (Επ. Καθ. ΓΠΑ) Πηνελόπη Μπεμπέλη (Καθ. ΓΠΑ) Δημήτριος Βλαχάκης (Επ. Καθ. ΓΠΑ) Ευάγγελος Ζωίδης (Επ.Καθ. ΓΠΑ) Γεώργιος Θεοδώρου (Επ.Καθ. ΓΠΑ) 2 Εντοπισμός γονιδιωματικών περιοχών και δικτύων γονιδίων που επηρεάζουν παραγωγικές και αναπαραγωγικές ιδιότητες σε πληθυσμούς κρεοπαραγωγικών ορνιθίων Περίληψη Σκοπός της παρούσας διδακτορικής διατριβής ήταν ο εντοπισμός γενετικών δεικτών και υποψηφίων γονιδίων που εμπλέκονται στο γενετικό έλεγχο δύο τυπικών πολυγονιδιακών ιδιοτήτων σε κρεοπαραγωγικά ορνίθια. Μία ιδιότητα σχετίζεται με την ανάπτυξη (σωματικό βάρος στις 35 ημέρες, ΣΒ) και η άλλη με την αναπαραγωγική
    [Show full text]
  • Content Based Search in Gene Expression Databases and a Meta-Analysis of Host Responses to Infection
    Content Based Search in Gene Expression Databases and a Meta-analysis of Host Responses to Infection A Thesis Submitted to the Faculty of Drexel University by Francis X. Bell in partial fulfillment of the requirements for the degree of Doctor of Philosophy November 2015 c Copyright 2015 Francis X. Bell. All Rights Reserved. ii Acknowledgments I would like to acknowledge and thank my advisor, Dr. Ahmet Sacan. Without his advice, support, and patience I would not have been able to accomplish all that I have. I would also like to thank my committee members and the Biomed Faculty that have guided me. I would like to give a special thanks for the members of the bioinformatics lab, in particular the members of the Sacan lab: Rehman Qureshi, Daisy Heng Yang, April Chunyu Zhao, and Yiqian Zhou. Thank you for creating a pleasant and friendly environment in the lab. I give the members of my family my sincerest gratitude for all that they have done for me. I cannot begin to repay my parents for their sacrifices. I am eternally grateful for everything they have done. The support of my sisters and their encouragement gave me the strength to persevere to the end. iii Table of Contents LIST OF TABLES.......................................................................... vii LIST OF FIGURES ........................................................................ xiv ABSTRACT ................................................................................ xvii 1. A BRIEF INTRODUCTION TO GENE EXPRESSION............................. 1 1.1 Central Dogma of Molecular Biology........................................... 1 1.1.1 Basic Transfers .......................................................... 1 1.1.2 Uncommon Transfers ................................................... 3 1.2 Gene Expression ................................................................. 4 1.2.1 Estimating Gene Expression ............................................ 4 1.2.2 DNA Microarrays ......................................................
    [Show full text]
  • Nucleic Acids Research, 2009, Vol
    Published online 2 June 2009 Nucleic Acids Research, 2009, Vol. 37, No. 14 4587–4602 doi:10.1093/nar/gkp425 An integrative genomics approach identifies Hypoxia Inducible Factor-1 (HIF-1)-target genes that form the core response to hypoxia Yair Benita1, Hirotoshi Kikuchi2, Andrew D. Smith3, Michael Q. Zhang3, Daniel C. Chung2 and Ramnik J. Xavier1,2,* 1Center for Computational and Integrative Biology, 2Gastrointestinal Unit, Center for the Study of Inflammatory Bowel Disease, Massachusetts General Hospital, Harvard Medical School, Boston, MA 02114 and 3Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 11724, USA Received April 20, 2009; Revised May 6, 2009; Accepted May 8, 2009 ABSTRACT the pivotal mediators of the cellular response to hypoxia is hypoxia-inducible factor (HIF), a transcription factor The transcription factor Hypoxia-inducible factor 1 that contains a basic helix-loop-helix motif as well as (HIF-1) plays a central role in the transcriptional PAS domain. There are three known members of the response to oxygen flux. To gain insight into HIF family (HIF-1, HIF-2 and HIF-3) and all are a/b the molecular pathways regulated by HIF-1, it is heterodimeric proteins. HIF-1 was the first factor to be essential to identify the downstream-target genes. cloned and is the best understood isoform (1). HIF-3 is We report here a strategy to identify HIF-1-target a distant relative of HIF-1 and little is currently known genes based on an integrative genomic approach about its function and involvement in oxygen homeosta- combining computational strategies and experi- sis.
    [Show full text]
  • Assessing Mitochondrial Theory of Aging on the Transcriptome Level
    Supplemental Material MicroRNA, mRNA, and Protein Expression Link Development and Aging in Human and Macaque Brain Supplemental Tables......................................................................................................... 3 Table S1. Sample characteristics (human). ......................................................................................... 3 Table S2. Sample characteristics (macaque). ...................................................................................... 4 Table S3. Proportions of transition genes in mRNA, miRNA and protein datasets. ........................... 5 Table S4. miRNA changes with age in human and mouse.................................................................. 6 Table S5. miRNA-target pairs involved in human cortex development and aging............................. 7 Table S6. miRNA-target pairs overlapping with experimentally verified target sets........................ 10 Table S7. Gene Ontology categories enriched among gene groups. ................................................. 12 Table S8. KEGG pathways enriched among gene groups................................................................. 13 Supplemental Figures ..................................................................................................... 15 Figure S1. Age effect on expression and correlation between datasets............................................. 15 Figure S2. Correlation among genes within gene groups. ................................................................ 17 Figure
    [Show full text]
  • Mouse Btaf1 Knockout Project (CRISPR/Cas9)
    https://www.alphaknockout.com Mouse Btaf1 Knockout Project (CRISPR/Cas9) Objective: To create a Btaf1 knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Btaf1 gene (NCBI Reference Sequence: NM_001080706 ; Ensembl: ENSMUSG00000040565 ) is located on Mouse chromosome 19. 38 exons are identified, with the ATG start codon in exon 1 and the TGA stop codon in exon 38 (Transcript: ENSMUST00000099494). Exon 3~6 will be selected as target site. Cas9 and gRNA will be co-injected into fertilized eggs for KO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Embryos homozygous for a gene-trapped allele display growth retardation. Embryos homozygous for an ENU- induced allele show growth retardation, edema, abnormal blood circulation, myocardial trabeculae hypoplasia, and delayed head and brain development. Exon 3 starts from about 2.51% of the coding region. Exon 3~6 covers 10.1% of the coding region. The size of effective KO region: ~9442 bp. The KO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 3 4 5 6 38 Legends Exon of mouse Btaf1 Knockout region Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot (up) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section upstream of Exon 3 is aligned with itself to determine if there are tandem repeats. No significant tandem repeat is found in the dot plot matrix.
    [Show full text]
  • Novel and Highly Recurrent Chromosomal Alterations in Se´Zary Syndrome
    Research Article Novel and Highly Recurrent Chromosomal Alterations in Se´zary Syndrome Maarten H. Vermeer,1 Remco van Doorn,1 Remco Dijkman,1 Xin Mao,3 Sean Whittaker,3 Pieter C. van Voorst Vader,4 Marie-Jeanne P. Gerritsen,5 Marie-Louise Geerts,6 Sylke Gellrich,7 Ola So¨derberg,8 Karl-Johan Leuchowius,8 Ulf Landegren,8 Jacoba J. Out-Luiting,1 Jeroen Knijnenburg,2 Marije IJszenga,2 Karoly Szuhai,2 Rein Willemze,1 and Cornelis P. Tensen1 Departments of 1Dermatology and 2Molecular Cell Biology, Leiden University Medical Center, Leiden, the Netherlands; 3Department of Dermatology, St Thomas’ Hospital, King’s College, London, United Kingdom; 4Department of Dermatology, University Medical Center Groningen, Groningen, the Netherlands; 5Department of Dermatology, Radboud University Nijmegen Medical Center, Nijmegen, the Netherlands; 6Department of Dermatology, Gent University Hospital, Gent, Belgium; 7Department of Dermatology, Charite, Berlin, Germany; and 8Department of Genetics and Pathology, Rudbeck Laboratory, University of Uppsala, Uppsala, Sweden Abstract Introduction This study was designed to identify highly recurrent genetic Se´zary syndrome (Sz) is an aggressive type of cutaneous T-cell alterations typical of Se´zary syndrome (Sz), an aggressive lymphoma/leukemia of skin-homing, CD4+ memory T cells and is cutaneous T-cell lymphoma/leukemia, possibly revealing characterized by erythroderma, generalized lymphadenopathy, and pathogenetic mechanisms and novel therapeutic targets. the presence of neoplastic T cells (Se´zary cells) in the skin, lymph High-resolution array-based comparative genomic hybridiza- nodes, and peripheral blood (1). Sz has a poor prognosis, with a tion was done on malignant T cells from 20 patients. disease-specific 5-year survival of f24% (1).
    [Show full text]