CONTRASTING ROLES OF C/EBPα AND NOTCH IN IONIZING RADIAITON-

INDUCED MULTIPOTENT HEMATOPOIETIC PROGENITOR CELL SELF-

RENEWAL DEFECTS

by

COURTNEY JO FLEENOR

B.S., University of Iowa, 2008

A thesis submitted to the

Faculty of the Graduate School of the

University of Colorado in partial fulfillment

of the requirements for the degree of

Doctor of Philosophy

Immunology Program

2015

This thesis for the Doctor of Philosophy degree by

Courtney Jo Fleenor

has been approved for the

Immunology Program

by

Philippa Marrack, Chair

John Cambier

Heide Ford

James Hagman

Jill Slansky

James DeGregori, Advisor

Date 12/31/14

ii Fleenor, Courtney Jo (Ph.D., Immunology)

Contrasting Roles of C/EBPα and Notch in Ionizing Radiation-Induced

Multipotent Hematopoietic Progenitor Cell Self-Renewal

Thesis directed by Professor James V. DeGregori.

ABSTRACT

Ionizing radiation (IR) is associated with persistent panhematopoietic defects and increased risk of carcinogenesis, although the mechanism underlying these relationship remains largely unknown. The increasing exposure of humans to man-made sources of IR, primarily through medical procedures, exemplifies a critical need to understand how IR elicits adverse health affects.

Mice exposed to IR develop a disease similar to human T-cell acute lymphoblastic lymphoma, of which over 50% are associated with activating Notch mutations. Furthermore, our lab has previously shown that the activated intracellular Notch mutant, ICN1, is selected for and promotes lymphomagenesis within previously irradiated mice. As pan-hematopoietic defects persist long after the exposure event, I hypothesized that IR reduces hematopoietic stem cell

(HSC) function, increasing selective pressure for activating Notch mutations that repair or circumvent the IR-mediated defect.

Consistent with this hypothesis, I observed that IR results in persistent, somatically heritable, cell-intrinsic reductions in multipotent hematopoietic progenitor cell (mHPC) self-renewal. mHPC from previously irradiated but homeostatically restored (IRP) mice exhibited reduced expansion and an

iii increased propensity to differentiate in vitro, as well as persistent oxidative stress. RNA-seq revealed persistent alterations in gene expression resulting from

IR, with decreased expression of HSC-associated genes, increased expression of myeloid differentiation-associated genes, including CEBPA, and a signature of antioxidant responses. Notch activation restored the expansion and reduced the precocious differentiation of IRP mHPC in vitro, as well as reversed a IR-induced gene expression changes. Loss of CEBPA expression is selected for within IRP

HSC and mHPC pools, reverses IR-dependent precocious differentiation and restores self-renewal. Finally, Notch-mediated restoration of mHPC self-renewal prevents selection for loss of C/EBPα expression within IRP mHPC pools. We propose that in response to environmental insults, HSC initiate a program limiting their self-renewal, preventing the damaged HSC from contributing long-term to hematopoiesis. This “programmed mediocrity” is beneficial in the case of sporadic genotoxic insults, but promotes tumorigenesis when the entire HSC compartment is damaged, such as during total body irradiation, by reducing the fitness of the entire HSC pool and thereby increasing selective pressure for adaptive oncogenic mutations.

The form and content of this abstract are approved. I recommend its publication.

Approved: James DeGregori

iv

This dissertation is dedicated to my supportive and loving family: my parents, Jeff and Sharyl, my sisters, Stephanie and Kelsey, and my fiancé Chris. Without their

love and support, I wouldn’t be the scientist or person I am today.

v ACKNOWLEDGEMENTS

I am forever in indebted to the many people who have provided advice, support, and encouragement throughout my graduate career. You all rock!

I would like to thank my thesis committee, Pippa Marrack, John Cambier,

Heide Ford, Jim Hagman, and Jill Slansky for all their support, advice, and encouragement.

I would like to thank the Department of Immunology for their support throughout my graduate education. I would also like to thank members of the

Cancer Research Institute Pre-doctoral Emphasis in Tumor Immunology

Fellowship for providing funding for part of my graduate career.

I would like to thank all the members of the flow core, sequencing core,

EH&S, and animal facility and staff for their help with experiments.

I would like to thank all the current and past members of the DeGregori lab for scientific discussion, experimental advice and technical help. Specifically, I want to thank Vadym Zaberezhnyy for help with all the bone marrow transplants and for being such a good sport whenever I was running behind schedule. I also want to thank Mark Gregory and Jen Salstrom for scientific discussions, for answering all my ridiculous questions sometimes pertaining to science, and for being both great friends and mentors. I’d like to thank Francesca Alvarez-

Calderon, Matias Casas-Selvez, and Melanie Bui for being my partners in crime in and out of the lab.

I would like to thank Matthew Divij, Kelly Higa, and Andrii Rozhok for their help on this project.

vi Big thanks to all my family and friends for their unconditional love, support, and for helping keep me sane.

Finally, I would like to thank my doctorate advisor, James DeGregori, for allowing me to pursue all my scientific hypotheses, no matter how wild. I can’t thank you enough for all your patience, advice, and encouragement over the years.

vii TABLE OF CONTENTS

CHAPTER

I. INTRODUCTION 1

Ionizing Radiation 2

Types of Ionizing Radiation 2

Quantification of Radiation 4

Human Exposure to Ionizing Radiation 5

Hematopoiesis 9

The Role of Notch in Hematopoiesis 11

Regulation of Myeloid Differentiation by C/EBPα 15

Biological Effects of Ionizing Radiation 17

IR-induced DNA Damage 18

Induction of Reactive Oxygen Species by IR 21

Nrf2 Response to Oxidative Stress 21

ATM Response to Oxidative Stress 22

PKCδ Response to Oxidative Stress 23

Persistent Effects of IR on HSC Function 24

Adaptive Oncogenesis 26

II. MATERIALS AND METHODS 29

Mice 29

Flow Cytometry 29

Fluorescence Activated Cell Sorting 30

mHPC cultures 31

viii Bone Marrow Transplantation 32

Bone Marrow Transplantation of Cultured mHPC 32

Retrovirus and Lentivirus 33

Generation of Virus 33

Viral Transduction Efficiency 34

Viral Transduction of Murine Bone Marrow Cells 34

Knockdown Efficiency of shRNA Targets 34

RT-qPCR 35

Mathematical Modeling 36

Probability of Differentiation 36

LSK Fitness 38

ROS Detection 39

Chemical Compounds 39

RNA Sequencing 40

In Vivo All-Trans Retinoic Acid Treatment 42

Subcutaneous ATRA Pellets 42

Oral Administration of ATRA 43

In Vivo Analysis of ATRA Treatment on mHPC Fitness 43

In Vitro Analysis of mHPC Self-Renewal After In Vivo ATRA Treatment 44

Statistical Analysis 44

ix III. NOTCH ACTIVATION RESTORES IONIZING RADIATION- REDUCED MULTIPOTENT HEMATOPOIETIC PROGENITOR CELL SELF-RENEWAL 45

Introduction 45

Ionizing Radiation and Human Disease 45

Hematopoietic Stem and Progenitor Cells 46

Effect of IR Exposure on HSC Function 47

Results 48

Ionizing Radiation Exposure Results in a Long-Term Reduction in the Number of Phenotypic Hematopoietic Stem and Progenitor Cells 48

IRP BM Possesses Decreased Long-Term HSC Function In Vivo 52

IRP mHPC Exhibit Reduced Self-Renewal In Vitro 55

LShiK Population Represents the Most Primitive mHPC Population In Vitro 57

IRP LT-HSC Possess Reduced Expansion Potential In Vitro 58

IR Exposure Does Not Alter Cell Culture Initiating Frequency of LSK 59

IRP LSK Lose Long-Term Multipotent Reconstitution Potential More Quickly In Vitro 60

Exposure to X-rays or γ-rays Elicits the IRP mHPC Defect 61

IR Dose Threshold Required for Generation of IRP mHPC Expansion Defect 62

IRP mHPC Expansion Defect In Vitro is Cell Intrinsic 63

Activation of Notch Restores IRP mHPC Self-Renewal In Vitro 64

x IRP LSK Have Slightly Reduced Surface Expression of Notch2 67

IRP mHPC Increased Probability of Differentiation and Reduced Fitness are Restored by Notch Activation 68

Discussion 70

IV. INHIBITING IR-INDUCED PRECOCIOUS DIFFERENTIATION RESTORES SELF-RENEWAL OF PREVIOUSLY IRRADIATED MHPC 74

Introduction 74

Regulation of HSC Self-Renewal 75

Regulation of HSC Differentiation 75

Results 77

IR Exposure Causes Long-Term, Notch-Reversible Alterations in mHPC Gene Expression 77

IRP LSK Express Decreased Levels of HSC-Associated Genes 79

Effect of IR on Expression of Notch-Regulated Genes in mHPC 80

Monocyte Differentiation Programs are Enriched Within IRP mHPC 83

Inhibition of C/EBPα Restores IRP LSK Self-Renewal In Vitro 86

Inhibition of C/EBPα is Selected for Within IRP mHPC In Vivo 90

Notch Activation Prevents Selection for C/EBPα Inhibition Within LSK In Vitro 92

Discussion 95

V. IONIZING RADIATION CAUSES PERSISTENT OXIDATIVE STRESS IN HEMATOPOIETIC PROGENITOR CELLS 99

xi Introduction 99

Ionizing Radiation Induces Oxidative Stress 99

Cellular Responses to Oxidative Stress 100

Effect of Elevated ROS on mHPC Function 101

Results 102

IRP LSK Possess Increased Lipid Peroxidation 102

IRP LSK May Possess Elevated NADPH Oxidase Activity 104

IRP LSK Possess Increased Gene Expression Signature of Nrf2, a Master Regulator of Antioxidant Activity 106

Nrf2 Activation is Sufficient to Reduce LSK Expansion In Vitro 108

Nrf2 is Not Required for IR-Mediated Induction or Notch-Rescue of IRP LSK Expansion Defect 110

Inhibition of ATM Restores IRP LSK Expansion In Vitro 113

Inhibition of PKC Restores IRP LSK Expansion In Vitro 115

Vitamin E Supplementation Does Not Restore IRP LSK Self-Renewal 119

Antioxidants 9cRA and ATRA Restore IRP LSK Expansion In Vitro 120

Treatment with the Antioxidant ATRA In Vivo Partially Restores IRP LSK Fitness 123

Discussion 127

VI. DISCUSSION AND FUTURE DIRECTIONS 135

Use of In Vitro mHPC Cultures to Explore IR-Mediated Effects on HSC 136

xii

Inhibition of Precocious Differentiation Restores IRP mHPC Expansion 138

IRP mHPC Possess Persistent Oxidative Stress 139

Mathematical Modeling: In Vitro Predictions for In Vivo Oncogenic Selection 142

Programmed Mediocrity: A Cell Intrinsic Program Limiting Contribution of Damaged mHPC to Long-Term Hematopoiesis 142

Tumor Suppressing and Promoting Roles of Programmed Mediocrity 145

Future Directions 147

REFERENCES 150

APPENDIX

A. FRESH mHPC RNA-seq 181

B. CULTURED mHPC RNA-seq 183

xiii LIST OF TABLES

TABLE

1.1: Common forms of ionizing radiation. 3

1.2: Effective doses used for diagnostic medical procedures. 7

2.1: Antibodies used for flow cytometry. 30

2.2: Universal ProbeLibrary primers and probes. 36

2.3: Chemical compounds used in mHPC cultures. 40

4.1: IR-induced gene expression changes. 79

xiv LIST OF FIGURES

FIGURE

1.1: Electromagnetic radiation spectrum. 4

1.2: Sources of radiation exposure in the U.S. 6

1.3: Hematopoietic hierarchy. 11

1.4: Structure of Notch receptors. 13

1.5: Canonical and non-canonical Notch signaling. 14

1.6: Structure of C/EBPα. 16

1.7: Dysregulation of C/EBPα in human AML. 17

1.8: Antioxidant signaling through Nrf2-Keap1. 22

1.9: Adaptive oncogenesis. 27

3.1: Generation of previously irradiated and homeostatically restored (IRP) mice. 49

3.2: IRP Mice exhibit reduced numbers of phenotypic mHPC. 50

3.3: IRP Mice exhibit reduced proportions and numbers of common myeloid progenitors. 51

3.4: IRP mice possess increased frequencies of myeloid biased mHPC. 52

3.5: IR reduces BM competitiveness long-term. 53

3.6: IR exposure reduces fitness of individual HSC. 54

3.7: IRP mHPC possess reduced fitness at steady-state. 55

3.8: IRP LSK exhibit reduced expansion in vitro. 56

3.9: LSK are the most primitive cell culture population. 57

3.10: IR alters expansion potential of LT-HSC. 58

xv 3.11: Culture-initiating frequency of LSK is unaltered by prior IR exposure. 59

3.12: IRP LSK lose multipotent reconstitution potential more quickly during culture. 61

3.13: Both X- and γ-radiation generate IRP mHPC expansion defect. 62

3.14: Dose threshold of 1.6Gy required for generation of IRP mHPC expansion defect. 63

3.15: IRP LSK expansion defect is cell intrinsic. 64

3.16: Notch activation restores IRP LSK expansion in vitro. 66

3.17: IRP LSK express slightly lower levels of Notch2. 67

3.18: Notch activation reverses the increased probability of differentiation and restores fitness of IRP LSK in vitro. 69

4.1: RNA-seq analysis on fresh and cultured LSK. 78

4.2: Expression of HSC-associated genes is decreased within IRP LSK. 80

4.3: Notch-repressed genes are enriched in cultured IRP LSK. 82

4.4: IRP LSK are enriched for myeloid-associated gene expression. 84

4.5: C/EBPα and PU.1 transcriptional signatures are changed in IRP LSK. 85

4.6: E2F and Myc signatures are reduced in IRP LSK. 86

4.7: Knock down efficiency of shCEBPA #1 and #2. 87

4.8: C/EBPα inhibition is selected for within IRP LSK in vitro. 88

4.9: C/EBPα inhibition restores IRP LSK expansion and fitness. 89

4.10: C/EBPα inhibition is selected for within IRP mHPC in vivo. 91

4.11: Notch activation prevents selection for C/EBPα inhibition in vitro. 94

xvi

5.1: Ctrl and IRP mHPC possess equivalent DCF-oxidation potential. 102

5.2: IRP LSK possess increased lipid peroxidation. 103

5.3: NOX activity is not responsible for IRP LSK expansion defect. 105

5.4: IRP LSK have increased Nrf2 gene expression signature. 107

5.5: Nrf2 activation is sufficient to reduce LSK expansion in vitro. 109

5.6: Nrf2 activation reduces LSK expansion in vitro. 110

5.7: Nrf2 inhibition does not rescue IR-mediated reductions in phenotypic mHPC in vivo. 111

5.8: Nrf2 inhibition does not rescue IRP LSK expansion defect. 113

5.9: ATM inhibition partially restores IRP LSK expansion in vitro. 115

5.10: Expression of PKC isoforms in LSK. 116

5.11: PKC inhibition may restore IRP LSK expansion in vitro. 118

5.12: PKC inhibition restores IRP LSK expansion in vitro. 119

5.13: Vitamin E is does not restore IRP LSK expansion in vitro. 120

5.14: Vitamin A derivatives do not fully rescue IRP LSK expansion in vitro. 122

5.15: ATRA treatment restores IRP BM fitness short term. 124

5.16: ATRA treatment reduces engraftment of Ctrl donors in IRP recipients. 126

5.17: ATRA treatment does not restore IRP mHPC fitness long-term. 128

6.1: Programmed mediocrity 144

xvii LIST OF ABBREVIATIONS

32D Immortalized myeloblast-like cell line 3T3 NIH 3T3; mouse embryonic fibroblast cell line 9cRA 9-cis retinoic acid AML Acute myeloid leukemia AML1 Acute myeloid leukemia 1 Anti-Anti Antibiotic/Antimycotic ARE Antioxidant response element ATRA all-trans retinoic acid ATM Ataxia telangiectasia mutated BATF Basic leucine zipper transcriptional factor ATF-like ΒME 2-mercaptoethanol BM Bone marrow BMT Bone marrow transplant bZIP Basic leucine zipper C/EBPα CCAAT/Enhancer binding protein alpha Chk2 Checkpoint kinase 2 c-mpl Cellular-myeloproliferative leukemia protein CMP Common myeloid progenitor cell Ctrl Control, non-irradiated DCF 2′,7′-di- chlorofluorescein DDR DNA damage response DMSO Dimethyl sulfoxide DPI Diphenyleneiodonium EDTA Ethylenediaminetetraacetic acid EGFR Epidermal growth factor-like repeats EtOH Ethanol FBS Fetal Bovine Serum Flt3L Fms-related tyrosine kinase 3 ligand GMP Granulocyte/macrophage progenitor cell Gpx Glutathione peroxidase Gstm Glutathione S-transferase mu (µ) G-CSFR Granulocyte colony stimulating factor receptor GM-CSFR Granulocyte-macrophage colony stimulating factor receptor Gy Gray H2O2 Hydrogen peroxide Hes1 Hairy and enhancer of split-1 Hey1 Hairy/enhancer-of-split related with YRPW motif protein 1 HSC Hematopoietic stem cell ICN Intracellular Notch IL-3 Interleukin-3 IL-6 Interleukin-6 IL-7 Interleukin-7 IL-11 Interleukin-11 IMDM Iscove’s Modified Dulbecco’s Medium

xviii IR Ionizing radiation IRP Previously irradiated LNR Lin-12-Notch repeats LSK LineagenegSca1+cKit+ (phenotypic mHPC) MAML Mastermind like protein LT-HSC Long-term hematopoietic stem cell M-CSFR Macrophage colony stimulating factor receptor MEP Megakaryocyte/erythroid progenitor cell mHPC Multipotent hematopoietic progenitor cell MPP Multipotent progenitor cell NFE2L2 Nuclear factor (erythroid-derived 2)-like 2 (gene) NOX NADPH oxidase Nrf2 Nuclear factor (erythroid-derived 2)-like 2 (protein) PEST Proline, glutamic acid, serine, threonine rich (domain) PKC Protein kinase C RT-qPCR Reverse transcription quantitative polymerase chain reaction RBP-Jκ Recombining binding protein suppressor of hairless ROS Reactive Oxygen Species SCF Stem cell factor SCL Transcription factor stem cell leukemia ST-HSC Short-term hematopoietic stem cell SV Sievert TACE Tumor necrosis factor alpha converting enzyme TAD Transactivation domain T-ALL T cell acute lymphoblastic leukemia TBI Total body irradiation TGFβ Transforming growth factor beta (β) TNFα Tumor necrosis factor alpha (α) TPO Thrombopoietin

xix CHAPTER I

INTRODUCTION

Human exposure to ionizing radiation (IR) continues to increase with technological advances, particularly in the medical and power industries, emphasizing a critical need to understand the associated adverse health effects.

IR largely exerts effects on the more rapidly turned over cellular compartments, including the hematopoietic system. Decreased peripheral immune cell numbers and function are evident up to 50 years after the initial IR exposure event.

Additionally, IR-exposed individuals exhibit increased risk of leukemia, particularly acute myeloid leukemia. Although IR exposure has been associated with these adverse health effects for over 100 years, the mechanism underlying this relationship remains poorly understood.

Investigation of IR-exerted effects on HSC function will provide insights into stress responses of HSC and general regulation of HSC maintenance.

Furthermore, IR-induced HSC defects and leukemogenesis serve as a good model system to study adaptive oncogenesis, allowing for experimental determination of parameters that influence selection for adaptive oncogenic mutations and a greater understanding for how these mutations repair or circumvent the defect. Additionally, identifying the potential of HSC function malleability, the extent and duration to which defects can be reversed, will be essential in moving forward with future therapeutics aimed to restore HSC function following environmental insults or disease.

1 Ionizing Radiation

Radiation is the emission of energy, in the form of particles or rays, upon the disintegration of unstable atoms [1]. Such atoms, termed radioactive, possess excess protons, neutrons, or internal energy, and can achieve stability by releasing radiation. The radiation released has the ability to excite and/or ionize atoms [2, 3]. Excitation occurs when an electron is moved from a ground state to higher energy state further from the nucleus, and ionization occurs when an electron is removed from an atom. IR can be either particulate radiation, including α and β particles, or electromagnetic radiation, including X-rays and γ- rays.

Types of Ionizing Radiation

Radioactive decay that results in the release of a positively charged α- particle is termed alpha-radiation, or α-decay. α-decay generally occurs with heavy ions, such as uranium, that have a high proton-to-neutron ratio. Consisting of 2 protons and 2 neutrons, α-particles are equivalent to a Helium (He) atom missing 2 electrons (Table 1.1). Able to travel only a few centimeters in air and shielded by as little as a piece of paper or the outer layer of skin, internal exposures to α-particles are considered more dangerous than external exposures.

In β-radiation, or β-decay, a neutron is transformed into a proton within the nucleus of an atom, resulting in the release of a negatively charged β-particle that has a mass and charge similar to that of an electron. As such, β-particles are commonly considered to be electrons. However, unlike electrons that generally

2 reside outside the nucleus, β-particles are generated within the nucleus. β- particles are capable of traveling hundreds of times the distance of α-particles and can be shielded by a few millimeters of aluminum.

Table 1.1. Common forms of ionizing radiation.

α-particle β-particle γ-ray

4 0 0 Symbol α β γ 2 −1 0 General � � − 4 4 � � − 0 0 � � 0 X ! X’ + α X ! X’ + β X* ! X’ + γ equation � � − 2 2 � � + 1 −1 � � 0 Mass 4 1/2000 ( = electron) 0 Charge +2 -1 0 Speed slow fast speed of light Shielding Paper Aluminum Lead/Concrete LET (QF) High 20 Low 1 Low (1)

X-ray or γ-radiation occurs as an excited nucleus falls back to the ground state or as electrons are rearranged. X- and γ-radiation are forms of electromagnetic radiation, which have no mass or charge, but instead behave as photons. X-rays and γ-rays differ from other forms of electromagnetic radiation, including microwaves and visible light, in their frequency and wavelength (Figure

1.1). Visible light contains wavelengths between 400-700 nm, whereas X-rays have wavelengths of 10nm and less, and γ-rays have even smaller wavelengths of less than 10-12m. There are two main differences between X- and γ-rays: 1) γ- rays originate from within the nuclei of unstable atoms, while X-rays originate from electron shells; 2) γ-rays generally have higher energy than X-rays. X rays are generated in X-ray machines by heating a cathode, which releases electrons

3 that travel rapidly to a tungsten anode where they are slowed down or collide with tungsten atoms. Either event results in the release of an X-ray. Despite differences in their generation, both X- and γ-rays are able to travel hundreds of meters in the air, are able to penetrate the entire human body, and require lead or several feet of concrete to be shielded. Thus, external exposure to X-radiation or γ-radiation is of particular health concern.

Figure 1.1 Electromagnetic radiation spectrum. X-rays and γ-rays are a form of electromagnetic radiation with differences mainly in their wavelengths, frequencies, and energies. The wavelength of both X-rays and γ-rays is shorter than visible light. Figure taken from http://www.mpoweruk.com/radio.htm.

Quantification of Radiation

There are multiple units of measurement for quantification of radiation and radiation exposure. The radiation absorbed dose (rad) is a measure of the energy deposited to matter by radiation per unit mass of matter. Similar to the metric system, there is the International System of Units (SI) for radiation. For the radiation absorbed dose, that unit is the gray (Gy). The equivalent of 1Gy is 100 rads, which is the absorption of 1 joule of energy per kilogram (kg) matter.

4 The rad or Gy measures the amount of radiation and not the biological effect of the radiation. Different forms of radiation deposit different amounts of energy into absorbing material per distance traveled (ionizing density), which is defined as the Linear Energy Transfer (LET) [4]. To denote the degree of LET, forms of radiation are assigned a Quality Factor (QF), of which values are recommended by the International Commission on Radiological Protection

(ICRP) [5]. The higher the LET, the greater the biological impact and more damage caused per distance traveled. The QF for α-particles is 20, and the QF for both β-particles and X- or γ-rays is 1. The biological damage caused by a particular radiation within tissue is measured as roentgen equivalent in man

(rem), or the SI unit the Sievert (1Sv = 100rem). The rem/SV takes into account the QF for each type of radiation, and is calculated by multiplying the dose (rads) by the QF. For example, a dose of 100 rads of γ-radiation would result in (100 rads)x(1QF) = 100 rems, whereas the same dose of α-radiation would result in

(100 rads)x(20QF) = 2,000 rems. Therefore, 1 rad of two different types of radiation are not equivalent, whereas 1 rem of two different types of radiation can be assumed to be equally damaging.

Human Exposure to Ionizing Radiation

Annually, humans are exposed to 2-3 mSV of natural radiation from sources in the air, soil, and water [6]. Radon, a gas commonly found in the air, rock, and soil, is responsible for the majority of natural radiation to which humans are exposed in the U.S. (Figure 1.2) [7, 8]. Additional natural radiation sources include UV rays from the sun as well as cosmic radiation.

5

Figure 1.2. Sources of radiation exposure in the U.S. Frequency of total yearly exposure due to natural and manmade sources of radiation. Natural sources include radon and thoron, space, internal, and terrestrial radiation. Manmade sources consist of medical sources, including CT scans, nuclear medicine, other medicine (conventional radiography/fluoroscopy and interventional fluoroscopy) as well as industrial, occupational, and consumer sources. Adapted from Schauer, D.A. and Linton, O.W. NCRP Report No. 160, 2009 [7].

In addition to natural sources, humans are increasingly being exposed to man-made sources of IR. The combination of medical, industrial, occupational and consumer radiation sources now accounts for about 50% of the annual radiation exposure in the U.S. The increasing use of radiation in the medical field is exemplified by the use of radiotherapy to treat roughly 60% of solid tumors and the increasing use of computed tomographic (CT) scans [9, 10].

The yearly dose estimate for medical radiation exposure (excluding radiotherapy) in the U.S. has increased drastically from 0.54 mSV in 1982 to roughly 3.0 mSV in 2006 [11-14]. The doses of radiation used for diagnostic medicine range drastically depending on procedure (Table 1.2; data obtained from [15]).

6 Table 1.2 Effective doses used for diagnostic medical procedures.

Procedure Effective Dose (mSV) Range Dental Intraoral radiography 0.0002-0.010 Panoramic radiography 0.007-0.090 Diagnostic Radiology Skull 0.3-0.22 Cervical Spine 0.07-0.3 Thoracic Spine 0.6-1.4 Lumber Spine 0.5-1.8 Abdomen 0.04-1.1 Mammography 0.10-0.60 Pelvis 0.2-1.2 CT Procedures Head 0.9-4.0 Chest 4.0-18.0 Spine 1.5-10 Abdomen 3.5-25 Pelvis 3.3-10

Exposure to high doses of radiation over a short period of time causes what is referred to as acute radiation syndrome (ARS) [16]. A minimum dose of

1-2 Gy is required for generation of ARS, whereas a dose of greater than 4 Gy will cause 50% mortality within 60 days of exposure (LD50/60) if medical treatment is not sought [17]. ARS onset is dependent upon the dose and duration of radiation received, but generally occurs within hours to days of the radiation exposure event. Early ARS symptoms include nausea, vomiting, lymphopenia, granulocytosis, fever, and redness of the skin [18]. Infection is a potential hazard of IR, as damage to the gastrointestinal (GI) system allows pathogens to cross the epithelial barrier, and hematopoietic damage reduces the ability to fight

7 infection. Treatment for ARS generally entails antibiotics, nutrient supplementation, as well as bone marrow or stem cell transplants.

In addition to the ARS, IR exposure results in persistent health effects within the hematopoietic compartment, including decreased immunity and increased risk of cancer. Atomic bomb survivors exhibit reduced hemoglobin levels, peripheral blood cytokine levels, and cellular immunity as long as 50 years after initial exposure [19, 20]. Decreased humoral immunity and peripheral blood

CD4+ T cell counts have been associated with occupational exposure [21].

Exposure to IR is highly associated with the development of malignancies, primarily myeloid leukemias, which has become more apparent as the numbers of long-term survivors of cancer treatments increases [22, 23]. Survivors of pediatric leukemia treated with chemo- or radiotherapy have increased risk for developmental defects and secondary malignancies [24]. Individuals exposed to

IR, including atomic bomb survivors, have an increased risk of developing acute myeloid leukemia (AML) that increases with increasing dose exposure [25-29].

Hromas and colleagues identified translocations in acute myeloid leukemia 1

(AML1) in each of 3 patients exposed to IR during World War II that developed pancytopenia and eventually AML [30]. Additionally, AML1 mutations were found in nearly 50% of atomic bomb survivors who developed myelodysplastic syndrome (MDS) [31]. Future studies will be important in exploring the mechanisms underlying IR-assiciated effects on hematopoietic cells and how this influences carcinogenesis.

8 Hematopoiesis

Hematopoiesis is largely regulated at the level of hematopoietic stem cells

(HSC). HSC are very rare cells, constituting only ~0.01% of the BM compartment

[32]. HSC reside within specialized microenvironments, termed niches [33, 34], located in vascular or in osteoblast-rich endosteal regions of the bone [35-41].

Although our knowledge of the cellular composition of the niche is incomplete, studies have suggested supporting niche cells may include CXCL12-abundant reticular (CAR) cells, skeletal stem cells, mesenchymal stem or stromal cells

(MSC) and osteoblasts [38, 42-49].

Generally, less than 2% of HSC within adult mice are cycling at any given time. The majority of HSC re-enter the cell cycle an average of once every 45 days, while about 15% of HSC largely remain quiescent and enter the cell cycle less than once every 145 days, or about five times in the life of an adult C57BL/6 mouse [50-54]. Human HSC are estimated to enter cell cycle on average once every 40 weeks [55]. Maintenance of HSC quiescence has been shown to require the interaction with thrombopoietin (TPO)-producing osteoblasts [49], and

TGF-β and Ang-1/Tie2 signaling have been shown to promote quiescence both in vitro and in vivo [56-63].

Stem cell factor (SCF), the ligand for the cKit receptor on HSC, was among the first soluble factors identified as required for HSC maintenance in vivo

[64-66]. Along with TPO and its receptor, c-mpl, SCF has been shown to promote

HSC survival and proliferation [67-69]. Finally, the Wnt/β-catenin pathway is known to play a major role in HSC self-renewal, as Wnt3a ligand promotes HSC

9 self-renewal in vitro, and activation of β-catenin in vivo results in transient increases in HSC, impaired multi-lineage differentiation, and finally, HSC exhaustion [70-73]. Interleukin (IL)-6, together with IL-3, promote HSC proliferation and self-renewal in vitro and in vivo; these cytokines also promote proliferation and differentiation of myeloid progenitors and terminally differentiated cells [74-80]. Similar to IL-6, IL-11 works in combination with IL-3 to promote megakaryopoiesis, but is also known to promote proliferation of HSC

[81, 82].

Each second, roughly 1x106 new hematopoietic cells are generated in the adult human [83]. To replenish such a highly turned over mature hematopoietic compartment, HSC differentiation generates increasingly lineage-restricted progeny (Figure 1.3). Long-term HSC (LT-HSC), defined by surface expression

LinnegSca1+cKit+CD34negCD135(Flk-2)neg, possess the ability to self-renew [84].

Short-term HSC (ST-HSC), defined as LinnegSca1+cKit+CD34+CD135(Flk-2)neg, are able to self-renew but contribute to hematopoiesis for a shorter period of time, as far out as 387 days [85, 86]. The ability to self-renew allows for maintenance of the HSC pool size.

Multipotent progenitors (MPP) possess reduced self-renewal potential but still maintain multi-potent differentiation potential [87-89]. Downstream of the

MPP are the oligopotent common myeloid progenitors (CMP;

LinnegSca1negcKit+CD34+CD16/32neg) and common lymphoid progenitors (CLP;

LinnegSca1lowcKitlowIL7R+). CMP give rise to granulocyte/macrophage progenitors

(GMP; LinnegSca1negcKit+CD34+CD16/32+), and megakaryocyte/erythroid

10 progenitors (MEP; LinnegSca1negcKit+CD34negCD16/32neg) through lineage- restricted progenitor intermediates. CLP produce lineage-restricted progenitors that eventually give rise to B cells, T cells, and NK cells.

Figure 1.3. Hematopoietic hierarchy. Long-term HSC (LT-HSC), short-term HSC (ST-HSC), multipotent progenitors cells (MPP), common myeloid progenitors (CMP), common lymphoid progenitors (CLP), megakaryocyte/erythroid progenitors (MEP), granulocyte/macrophage progenitors (GMP).

The Role of Notch in Hematopoiesis

Identification of Notch occurred shortly after the observation that a mutant of Drosophila melanogaster possessed “notched” wings [90-93]. Since then, 4

Notch receptors (Notch1-4) and 5 Notch ligands (Delta-like 1, 2, 4, and Jagged 1,

2) have been identified in mammals. Of the 4 Notch receptors, HSC have been shown to express Notch1 and Notch2 on their surface [94].

Notch proteins contain many different structural components integral to regulation of its signaling and stability (Figure 1.4). The N-terminal extracellular

11 domain (ECD) of Notch contains epidermal growth factor (EGF)-like repeats

(EGFR), which are involved in ligand binding [95, 96]. The EGFR domain is followed by a negative regulatory region, which is responsible for modulating ligand-mediated activation as well as interactions between the extracellular and membrane-tethered intracellular domains [97-100]. The negative regulatory region contains 3 Lin-12-Notch repeats (LNR), which are important in protection from ligand-independent cleavage by metalloproteases, and a short C-terminal tail that has been shown to be sufficient to form a stable complex between the extracellular and intracellular Notch domains [101]. The intracellular Notch domain (ICN) contains an RBPJκ-associated-module (RAM), and 7 ankyrin repeats (ANK), which are important in binding to CSL [102-106]. Flanking the

ANK domain are nuclear localization sequences (NLS). The transactivation domain (TAD) has been shown to be required for CSL transactivation and thereby transcriptional activation [107]. At the C-terminal end is a proline, glutamine, serine, threonine-rich (PEST) domain, which plays a role in Notch stability as it is responsible for binding of F-box and WD-40 domain protein 7

(Gbxw7). Ubiquitination of the PEST domain leads to subsequent degradation of

Notch [108-111].

Upon binding to a ligand, Notch undergoes two proteolytic cleavages; the first cleavage is catalyzed by the disintegrin-metalloproteases ADAM10/17 or tumor necrosis factor α (TNF-α) converting enzyme (TACE) [112-114]. This cleavage is followed by a second cleavage catalyzed by presenillin-γ-secretase

12 (γ-secretase), which releases the intracellular domain of Notch (ICN) into the cytoplasm [115-117].

Figure 1.4. Structure of Notch receptors. The extracellular domain (ECD) contains EGFR and LNR. Intracellular Notch (ICN) is composed of the RAM domain, an ANK domain flanked by nuclear localization signal (NLS), a transactivation domain (TAD) and a PEST degron domain. Adapted from Allman et. al. 2002. An invitation to T and more: Notch signaling in lymphopoiesis. Cell [118]

Once released, ICN translocates to the nucleus, forms a complex with

CSL (CBF1, RBPJκ, Suppressor of Hairless, and Lag) and MAML, and activates transcription [106, 119-123] (Figure 1.5). Notch-mediated repression of differentiation-associated genes is thought to occur primarily through Notch- mediated transcriptional activation of the downstream transcriptional repressors,

Hes1 and Hey1 [119, 124].

More recently, a non-canonical pathway whereby Notch influences cell signaling independently of CSL has been identified in multiple cell types [125-

129]. Additionally, this non-canonical pathway can be either ligand-dependent, or independent. Although the majority of mediators of the non-canonical Notch

13 signaling pathway are unknown, multiple studies have shown the ability of the non-canonical Notch pathway to antagonize the Wnt/β-catenin pathway [130-

133].

Figure 1.5. Canonical and non-canonical Notch signaling. A) Canonical Notch signaling. Upon ligand-binding, Notch undergoes two subsequent cleavages to release ICN into the cytoplasm. ICN then translocates to the nucleus, binds CSL and MAML cofactors and activates transcription. B) Non-canonical Notch signaling is CSL-independent, but can be ligand-dependent or -independent. Figure taken from Andersen et. al., 2012 Non-canonical Notch signaling: emerging role and mechanism. Trends in Cell Biology. [134]

Notch has been shown to promote the self-renewal of multiple stem cell populations, including neural stem cells [135, 136] and muscle satellite cells

[137-140]. Notch signaling has been implicated in HSC self-renewal, although the exact role is still debated. Conditional deletion of Notch1, the ligand Jagged-1, or the Notch binding partner CSL in adult mice have no apparent effects on HSC function [141, 142]. In contrast, Notch activation has been shown to promote

HSC maintenance and expansion in vitro, and conditional deletion of Notch2 but

14 not Notch1 impaired the long-term reconstitution potential of HSC [143-148].

Thus, the particular state in which HSC reside, quiescence versus stressed hematopoiesis, may influence the degree to which specific Notch receptors are involved.

Notch’s role in leukemogenesis was first identified in 1991 with the discovery of the chromosomal translocation t(7;9)(q34;q34.3) in a patient with T- cell acute lymphoblastic leukemia (T-ALL) [149]. The translocation resulted in continuous, ligand-independent activation of ICN by a translocation of the 3’ region of Notch (ICN) into the TCRβ locus. Since then, activating mutations in

Notch have been identified in >50% of human T-ALL patients [150]. The most common mutations in Notch are found in the HD domain, resulting in ligand- independent activation of Notch [150, 151], and the PEST domain, which results in decreased degradation of Notch [152].

Regulation of Myeloid Differentiation by CEBPα

CCAAT/enhancer binding protein α (C/EBPα), is one of the major transcription factors involved in myeloid differentiation, or myelopoiesis. C/EBPα is a basic leucine zipper transcription factor that binds DNA as an obligate hetero- or homodimer [153]. C/EBPα consists of a basic region and a series of heptad leucine repeats (leucine zipper domain), which are both required for proper DNA binding [154-158] (Figure 1.6). Due to alternate use of initiation codons or proteolysis, the C/EBPα gene can give rise to 2 separate protein products, of 42kDa and 30kDa [159-162]. The 30kDa protein lacks the most N-

15 terminal transactivation domains and is thought to act as a negative regulator of the 42kDa product [160, 161].

Figure 1.6. Structure of C/EBPα. CEBPA gene encodes a 42kDa and a 30kDa protein product. Both contain a negative regulatory domain (RD) followed by a transactivation domain (TAD), and possess an N-terminal bZIP domain. The 42kDa product also contains two TADs at its N-terminus. Figure adapted from Ramji and Foka, 2002, CCAAT/enhancer-binding proteins: structure, function and regulation, Biochem. J. [163]

C/EBPα is expressed in HSC, CMP, and GMP [164], and is the main

C/EBP isoform found in mature granulocytes [165, 166]. C/EBPα deficient mice lack granulocytes but still possess peripheral monocytes [167]. Conditional deletion of CEBPA in adult mice has been shown to result in a block in granulopoiesis at the CMP to GMP transition [168]. C/EBPα binds the promoters of and activates transcription of many myeloid-associated genes, including G-

CSFR, M-CSFR, GM-CSFR, myeloperoxidase, and lysozyme [169-177]. In addition, C/EBPα is able to bind and activate its own promoter [178], as well as that of PU.1, a transcription factor important in both myelopoiesis as well as B lymphopoiesis [179-181]. In addition to its roles in promoting myeloid differentiation, C/EBPα inhibition of cMyc and E2F results in the inhibition of cell cycle progression [182-184]. C/EBPα is negatively regulated by the phosphorylation of multiple serine residues by protein kinase C (PKC) [185] and

ERK [186, 187].

16 More recently, C/EBPα has been implicated in leukemogenesis, particularly in AML (Figure 1.7). AML1 translocations, associated with IR-induced

AML, have been shown to inhibit both C/EBPα and PU.1 function [188-191].

Additionally, mutations in C/EBPα have been identified in 7-11% of AML patients

[190, 192-194]. The mutations are inhibitory, impacting DNA binding, dimerization, or resulting in a truncated, dominant negative form of C/EBPα [190].

In fact, mice deficient in the p42 C/EBPα develop AML-like disease [195], and mice hypomorphic for PU.1 develop AML-like disease within 3-8 months [196].

Figure 1.7. Dysregulation of C/EBPα in human AML. Figure taken from Pabst and Mueller, 2009, Complexity of CEBPA dysregulation in human acute myeloid leukemia, Clin Cancer Res. [197]

Biological Effects of Ionizing Radiation

There have been many studies aimed to characterize the cellular responses to IR exposure. Major focus has been on the acute response to IR, encompassing the DNA damage response (DDR), widespread apoptosis, and

17 elevated levels of reactive oxygen species (ROS). However, in light of the newly available long-term follow up studies on survivors of radio-therapy and accidental

IR exposure incidents, more recent studies have begun to focus on the persistent effects of IR exposure within hematopoietic cells.

IR-induced DNA Damage

Deleterious effects exerted by IR have historically been attributed to its ability to damage DNA. DNA lesions induced by IR include base lesions, single- strand breaks (SSBs) and double-strand breaks (DSBs) [198-200]. Generation of

DSBs is likely to occur by two radicals resulting in separate but nearby breaks to each DNA strand [201]. IR induced mutagenesis was first suggested by Hermann

Mueller in the 1920’s. Currently, base damage and SSBs resulting from IR are not believed to play a major role in phenotypic effects of cancer resulting post IR exposure [202]. Instead, chromosomal aberration and DSBs are considered to be the more pertinent damage for IR-induced DNA mutagenesis [203, 204]. More recently, IR has been shown to also result in interstrand DNA crosslinking at sites of mismatched base pairs [205].

In addition to IR acting directly on a target cell, IR has also been shown to mediate effects on HSC function indirectly, through what are termed irradiation bystander effects [206-214]. Irradiation bystander effects are exerted by irradiated cells on local non-irradiated cells through soluble mediators, such as cytokines, or through gap junctions, and can result in altered cell function and genomic instability in cells that were not directly irradiated [215-218]. One study, whereby half of a mouse was exposed to X-radiation, identified DSB in non-

18 irradiated cells [219], indicating that DSBs can be generated both directly and indirectly through radiation bystander effects.

Genomic instability has been shown to persist within previously irradiated mice [220, 221]. One particular study following 2.5Gy irradiated C57BL/6 and

BALB/c mice showed increased genomic instability, as assessed by micronucleated reticulocytes, up to 1 year post radiation [220].

Both the DNA damage response (DDR) and apoptotic response following

IR have been shown to be p53-dependent, with the latter returning to baseline by

4 days post IR [222, 223]. In addition, the p53-mediated DDR has been experimentally shown to be linear with respect to IR doses up to 5 Gy [224, 225].

However, the type of DDR initiated is different within quiescent versus cycling

HSC. [226]. Cycling HSC preferentially undergo homologous recombination (HR) and quiescent HSC preferentially initiate the more error prone non-homologous end-joining (NHEJ). Furthermore, use of HR by proliferating HSC was shown to result in significantly fewer genomic aberrations as compared to NHEJ-utilizing quiescent HSC.

Earlier studies from our lab have indicated that loss of p53 at the time of radiation confers an immediate survival advantage to all hematopoietic cells, which is sustained long after the exposure event and promotes lymphomagenesis [227]. In contrast, reduced p53 function months after IR exposure did not confer a selective advantage to HSC. Finally, the presence of non-irradiated BM prevented expansion of p53-deficient cells and reduced the occurrence of the p53-mutant lymphoma. This study was corroborated by an

19 independent study, which further determined that competitiveness of p53- deficient cells following IR exposure was dependent upon the p53 status of the competitor cells [228]. Furthermore, no selection for p53 inhibition was found under homeostatic conditions. Collectively, these studies indicate that IR-induced stress increases the selective pressure for decreased p53 activity within a short window following IR exposure, the effect of which persists long after the exposure event.

Other studies have identified additional cellular factors that influence HSC activity during the acute IR response. A RNAi screen using telomere dysfunctional (mTerc-/-) cells identified a basic leucine zipper transcription factor,

ATF-like (BATF) as a mediator of short-term HSC responses to IR [229]. BATF mRNA and protein levels were elevated at 6-48 hours post IR exposure in a G-

CSF/STAT3 dependent manner, but decreased to background levels at 96 hours.

BATF deficiency, present at the time of IR exposure, was selected for in HSC of irraidated mice, but possessed significantly elevated levels of DNA damage.

Further analysis of IR-exposed mice revealed that IR results in a significant increase in IL-7 reporter activity in CD150low, and to a lesser extent within

CD150hi HSC populations, and that both CD150low and CD150hi HSC populations were significantly depleted wthin IR-exposed BM at 24 hours post IR. Further analysis revealed that 24 hours post IR, myeloid-biased CD150hiHSC were able to differentiate into lympoid biased CD150lowHSC. These results indicate that shortly after IR exposure, increased BATF expression results in reduced function and increased lymphoid differentiation of both CD150hiHSC and CD150lowHSC,

20 though the lymphoid-biased CD150lowHSC populations appears to be more sensitive to IR-induced lymphoid differentiation. Furthermore, early exhaustion of lymphoid-biased HSC pools and their replacement by myeloid biased HSC indicate the potential for a myeloid biased HSC compartment at later timepoints.

Induction of Reactive Oxygen Species by IR

IR also induces a significant increase in reactive oxygen species (ROS) within the BM compartment shortly following exposure, largely through H2O radiolysis [230]. The main product produced immediately following IR exposure of cells is the hydroxyl radical ("OH), which travels a very limited distance before reacting with DNA, proteins, or lipids [231]. The majority of cellular damage resulting both directly and indirectly through ROS occurs within milliseconds following the IR exposure event [232]. However, elevated levels of ROS have been shown to persist for months within the peripheral blood and bone marrow compartments and may result in continuous damage to cells [233, 234].

Nrf2 Response to Oxidative Stress: Due to the highly reactive and damaging nature of oxidative stress, cells have evolved numerous pathways in order to maintain their redox state. Nuclear factor (erythroid-derived 2)-like 2

(Nrf2) is a bZIP transcription factor and oxidative stress sensor [235, 236] (Figure

1.8). Under homeostatic conditions, Nrf2 is sequestered in the cytoplasm by

Keap1, which promotes ubiquitination and subsequent degradation of Nrf2. ROS directly oxidize cysteine residues on Keap1, leading to release of Nrf2 [237-244], or indirectly activate Nrf2 by activation of upstream signaling molecules, including p38 and JNK1, which phosphorylate Nrf2 and promote its release from Keap1

21 [245-247]. Once Nrf2 is free of Keap1, it translocates to the nucleus where it activates transcription of numerous antioxidant and detoxifying genes including enzymes involved in glutathione-mediated antioxidant activity [248-252].

Figure 1.8. Antioxidant signaling through Nrf2-Keap1. Keap1 sequesters Nrf2 in the cytoplasm, where it promotes ubiquitination and subsequent degradation of Nrf2. Under conditions of oxidative stress, Keap1 is oxidized and/or Nrf2 is phosphorylated by upstream protein kinases, which releases Nrf2 freely into the cytomplasm. Nrf2 translocates to the nucleus, binds to antioxidant response elements (AREs) and activates transcription of antioxidant and detoxifying enzymes.

ATM Response to Oxidative Stress: Ataxia-Telangiectasia mutated (ATM) is another protein involved in sensing oxidative stress. ATM was identified in patients with Ataxia-Telangiectasia (A-T), a rare disorder characterized by neurodegeneration, decreased immune function, and increased risk of cancer

[253, 254]. ATM is best known for its role in regulating the DDR via

22 serine/threonine phosphorylation of downstream target proteins, including p53 and checkpoint kinase 2 (Chk2) [255-258]. Incredibly, over 700 proteins are believed to be targets of ATM following DNA damage, many of which are involved in DNA repair and cell cycle regulation [259]. ATM exists as an inactive non-covalently-associated dimer, which converts to an active monomer in response to DSBs [260]. ATM deficiency in human A-T cells is associated with increased ROS, reduced levels of the antioxidants vitamin A, E, and reduced gluthathione biosynthesis [261-263]. Additionally, ATM-/- mice have elevated oxidative stress within HSC populations [263]. ATM is directly activated by H2O2 in the absence of DNA DSBs, and results in autophosphorylation as well as phosphorylation of downstream signaling components, including p53 and Chk2

[264]. The active ATM product resulting from H2O2-mediated activation is thought to be covalent-bound dimers [265].

PKCδ Response to Oxidative Stress: Upon oxidative stress, ATM has been shown to activate Nrf2 in a protein kinase C (PKC) δ-dependent manner, promoting transcriptional activation of downstream antioxidant genes [266]. PKC proteins, belonging to a family of serine/threonine kinases, play roles in numerous cellular processes, including proliferation and differentiation [267, 268].

The 11 PKC isoforms are divided into 3 groups, the conventional PKC isoforms

(α, βI, βII, and γ), which are Ca2+-dependent, the novel isoforms (δ, ε, η, and θ), which are Ca2+ independent, and the atypical isoforms (ζ and λ), which differ more structurally from the other two isoform classes [269]. It has previously been shown that H2O2 treatment of adipocytes from mice fed high fat diets resulted in

23 increased levels of phosphorylated, and thus activated, PKCδ, which was reversible by N-acetyl cysteine (NAC) treatment [270].

Persistent Effects of IR on HSC Function

Numerous studies have explored the extent to which IR results in persistent HSC defects, including survival, self-renewal, differentiation, and senescence. Wang and colleagues explored the source for persistence of oxidative stress within multipotent hematpoietic progenitor cell (mHPC) enriched

LinnegSca1+cKit+ cells (LSK) from previously irradiated and homeostatically restored (IRP) mice [234]. Significantly increased ROS, as well as increased

γH2AX and 8-OH-dG, markers of DNA damage, were identified within IRP LSK , indicating persistent oxidative stress and DNA damage following IR exposure.

IRP LSK exhibited no change in apoptosis relative to Ctrl LSK. Further studies determined that IRP LSK possess increased levels of the NADPH oxidase 4

(NOX4), a known generator of ROS. Treatment with the antioxidant NAC or the

NOX inhibitor DPI starting 6 hours post IR exposure slightly restored IRP HSPC in vivo long-term reconstitution potential, in vitro clonogenicity, and reduced ROS levels and DNA damage markers, but were unable to restore the frequency of

LSK in vivo.

Several studies have suggested that IR results in the induction of senescence within the HSC population long after the exposure event. One particular study suggests that persistent oxidative stress induces senescence within HSC months after IR exposure [234, 271]. Exposure of C57BL/6 mice to

6Gy Cs-137 γ-radiation resulted in sustained decreases in the frequency and

24 number of LSK. These IRP LSK exhibited increased expression of p16Ink4a, which has been implicated in the induction of senescence, growth arrest and loss of self-renewal in HSC [272-276]. Additionally, a portion of IRP LSK stained positive for SA-β-gal, a commonly used marked for cellular senescence [277]. However, it is important to note that only 33% of LSK exhibited elevated p16 protein levels and only a fraction of IRP LSK stained positive for SA-β-galactosidase. They concluded that IR-induced increases in cell cycle regulators, such as p16Ink4a, resulted in increased senescence, and thereby decreased the in vivo replication potential and in vitro clonogenic potential of HSC.

Previous studies from our lab have shown that IRP mice exhibit reduced numbers of HSC as well as a nearly 10-fold reduced function per HSC [233].

Elevated levels of oxidative stress in the peripheral blood, as measured by 15-F2- isoprostane in the plasma, were present months post IR exposure. Additionally,

DNA damage within total BM cells, measured by γH2AX staining, was significantly elevated 2 hours post IR, but fell to background levels by 7 days post

IR. Importantly, IR exposure was shown to alter the selective pressure for acquisition of and leukemogenesis driven by particular oncogenes. Specifically, selection for Bcr-Abl and Ras was significantly reduced in IRP mice relative to non-irradiated controls. In contrast, selection for and leukemogenesis driven by the activated Notch1 mutant ICN1 was enhanced within the context of IRP.

Furthermore, the presence of non-irradiated, healthy competitor cells abrogates the expansion of ICN+ within IRP BM, demonstrating that young, healthy, highly fit

BM can serve as a tumor suppressor mechanism by reducing selective pressure

25 for acquisition of adaptive oncogenic mutations. Collectively, these studies indicate that IR exposure results in persistent changes in the function and fitness of individual HSC, which thereby alters selection for or against particular oncogenes.

Adaptive Oncogenesis

Conventionally, oncogenes are considered to be universal inducers of carcinogenesis. It is widely accepted that the acquisition of multiple cooperating oncogenes is required for the ultimate development of cancers, including leukemias. Consistent with increased cancer incidence in the aged population, the rate limiting step in carcinogenesis has historically been attributed to the acquisition of mutations, of which 6-7 are believed to be required [278-282].

However, the majority of HSC cell cycles and mutation accumulation have been shown to occur primarily during ontogeny [283-285]. Additionally, the majority of experimentally introduced oncogenes have actually been shown to reduce HSC self-renewal [286].

Data from our lab and others support an alternative model of carcinogenesis, termed Adaptive Oncogenesis (Figure 1.9), in which carcinogenesis is rate-limited by selection for adaptive oncogenic mutations [227,

286-289]. Cells in young, healthy individuals are highly adapated to their environment, and thus possess near optimum fitness (ability to pass on genotype/epigenotype to subsequent cell generations). Oncogenic mutations acquired in such a healthy HSC pool are unlikely to provide a cell with any sort of advantage. Therefore, due to competition between HSC for nutrients and niche

26 space, mutant cells will be weeded out or maintained at low levels within the population, depending upon whether the mutation influences fitness negatively or neutrally, respectively. However, changes to the cell fitness landscape will alter selective pressure for particular adaptive oncogenic mutations, which are mutations that provide the cell with an advantage relative to neighboring cells.

Environmental insults, such as total body IR, will reduce the mean HSC pool fitness, increasing selective pressure for adaptive oncogenic mutations. Once acquired, the cell bearing such an adaptive oncogenic mutation will be selected for, clonally expand, and ultimately drive carcinogenesis.

Figure 1.9. Adaptive oncogenesis. See text for details.

27 Further studies are required to more clearly define the mechanisms whereby radiation reduces HSC function, which will provide a foundation on which to develop therapeutics to restore HSC function and potentially prevent leukemogenesis following exposure to IR.

28 CHAPTER II

MATERIALS AND METHODS

Mice

C57BL/6 and C57BL/6 -Ly5.1 mice were obtained from the National

Cancer Institute (NCI) at 6-8 weeks of age. Nrf2 KO (B6.129X1-Nfe212tm1Ywk/J) mice were obtained from The Jackson Laboratory. Irradiation was conducted using Cs-137 at a dose rate of 1.069 gray (Gy)/min. Previously irradiated, homeostatically restored (IRP) mice were generated by exposing mice to 2.5Gy total body irradiation and allowing the mice to recover for a minimum of 9 weeks.

Flow Cytometry

For analysis of bone marrow cells, bone marrow was harvested from the tibias, femurs, humerus, pelvis, radius, and ulnas of IRP mice a minimum of 9 weeks post radiation exposure as well as age- and gender-matched Ctrl mice.

Bone marrow samples were hemolyzed with 3 mL hemolysis buffer (8.3g NH4Cl,

1.0g NaHCO3, 0.04g EDTA-Na2 disodium salt in 1L ddH2O), after which 25mL

0.5%BSA in PBS was added to wash the cells. Samples were centrifuged, resuspended in 0.5% BSA in PBS, and counted on a Millipore Guava 8HT. 4-

5x107 BM cells were stained in 100ul FACS buffer (5% FBS, 4mM EDTA) with

5% anti-FC (24G2 hybridoma lysate) and antibodies at the indicated concentration (Table 2.1). For analysis of peripheral blood cells, 20uL of peripheral blood was harvested from the tail into 50uL heparin, 1mL hemolysis buffer was added for 20 minutes, and washed once with 1mL PBS before

29 staining. Peripheral blood cells were stained in 30uL FACS buffer with 5% anti-

FC and antibodies at the indicated concentrations (Table 2.1).

Table 2.1: Antibodies used for flow cytometry.

Antibody Clone Fluorophore Concentration Company B220 RA3-6B2 PE, APCcy7 1:200 BD Bioscience CD3 145-2C11 PE, APCcy7 1:200 BD Bioscience Gr1 PE, APC, RB6-8C5 1:200 eBioscience (Ly6G) APCcy7 CD11b M1/70 PE, APCcy7 1:200 BD Bioscience cKit 2B8 FITC, PEcy7 1:100 BD Bioscience Sca1 D7 FITC, APC 1:100 eBioscience CD150 TC13-12F12.2 AF488 BioLegend CD135 BD Bioscience, A2F10.1 PE 1:50 (Flk2) BioLegend CD16/32 93 PE 1: eBioscience CD34 RAM34 Ef660 1:50 eBioscience Thy1.2 53-2.1 APC 1:200 eBioscience (CD90.2) Ter119 TER-119 PE, APCcy7 1:200 eBioscience CD45.1 A20 PEcy7 1:200 eBioscience CD45.2 104 PE 1:200 BD Bioscience IgG HTK888 PE 1:20 BioLegend Notch1 HMN1-12 PE 1:20 BioLegend IgG1κ MOPC-21 PE 1:20 BD Bioscience Notch2 16F11 PE 1:20 eBioscience

Fluorescence Activated Cell Sorting

Bone marrow was harvested from tibias, femurs, humerus, pelvis, radius, and ulnas of IRP mice (> 9 weeks post radiation exposure) and age- and gender- matched Ctrl mice. Bone marrow samples were hemolyzed with 3 mL hemolysis buffer, after which 25mL 0.5% BSA in PBS was added to wash the cells.

Samples were centrifuged, resuspended in 0.5% BSA PBS, and counted on a

30 Millipore Guava 8HT. 4-5x107 BM cells were stained in 100ul FACS buffer (5%

FBS, 4mM EDTA) with 5% anti-FC (24G2 hybridoma lysate) and antibodies at the indicated concentration (Table 2.1). Cells were washed, re-suspended in

FACS buffer with 1ug/mL DAPI, and sorted using a MoFlo XDP 70 (Beckman

Coulter).

mHPC Cultures

For sorted cultures, Lineageneg (B220negCD3negGr1negCD11bnegTer119neg) cKit+ Sca1+ (LSK; mHPC) or Lineageneg cKit+Sca1+CD135negCD34neg (LT-HSC) were sorted using FACS into each well of a non-tissue culture treated 96-well U- bottom suspension plate. For cKit+ cultures, bone marrow cells were incubated with CD117 (cKit) microbeads (Miltenyi) for 30 min on ice, washed, and cKit+ cells were isolated using Magnetic-Activated Cell Sorting (MACS). cKit+ cells were counted using a Guava 8HT (Millipore) and 3x104-1x105 cKit+ cells were cultured per well in a non-tissue cultured 12 well plate. Cells were cultured as described previously [147]. In short, cells are cultured in Iscove’s Modified

Dulbecco’s Medium (MDM; Invitrogen), 20% fetal bovine serum (HyClone), 50uM

β-mercaptoethanol and 100ng/mL human interleukin (hIL)-6, hFlt3-L, murine stem cell factor (mSCF), and 10ng/mL hIL-11 (Peprotech and R&D). IgG-DL1, a gift from Dr. Irwin Bernstein (Fred Hutchinson Cancer Research Center), was coated at 2.5ug/mL in DPBS (Invitrogen) in 100uL per well of 96 well plate, or

1mL per well of 12 well plate, and incubated at 4°C overnight. IgG-DL1 coated wells were washed 5 times with DPBS, incubated with 2% BSA PBS for 1 hour at

31 37°C, and washed another 5 times with DPBS before culture media and cells were added.

Bone Marrow Transplantation

For myeloablative bone marrow transplants, recipient mice were sub- lethally irradiated 48 hours prior to transplantation with 5.0Gy Cs-137 or lethally irradiated on the day of transplantation with 2 doses of 5.0Gy Cs-137 separated by 4 hours. Congenic recipient mice were injected with the indicated number of donor cells. Bone marrow transplantation without concomitant myeloablation at the time of transplant were performed by injecting 6.6x105 total bone marrow cells from Ctrl or IRP CD45.2+ C57BL/6 into Ctrl or IRP congenic recipients without any myeloablation at the time of transplant. All transplantations were conducted by tail vein injection of cells in normal saline (0.9% NaCl).

Bone Marrow Transplantation of Cultured mHPC

600 LSK cells from CD45.2+ C57BL/6 mice were sorted and cultured for 6 days as described above. The total progeny on day 6, including HSPC and differentiated myeloid progeny, were resuspended in normal saline and transplanted into congenic (CD45.1+) recipients that were sub-lethally irradiated with 5Gy Cs-137. The multipotent long-term engraftment capacity of donor cells was measured by assaying peripheral blood for the proportion of CD45.2+ donor cells in the indicated hematopoietic lineages over time.

32 Retrovirus and Lentivirus

Generation of Virus

Retroviruses used include MSCV-ires-GFP (MiG) and MSCV-ires-GFP-

ICN1 (MiG-ICN1). The pCL-ECO packaging plasmid was used for generation of self-inactivating retroviruses. Lentivirus used contained the pLKO.1, pLKO1.5, and pLKO.2 backbone vector from The RNAi Consortium (TRC, Sigma, obtained through the Functional Genomics Facility at the University of Colorado Boulder), which express the puromycin selectable marker. For analysis of shRNAs in murine bone marrow cells, GFP was PCR-isolated from the MiG vector and cloned into each shRNA to replace the puromycin selectable marker. The pMDLg/pRRE (Gag), pMD.G (VSV G), and pRSV Rev (Rev) packaging plasmids were used for generation of self-inactivating lentiviruses. For generation of both self-inactivating retroviruses and lentiviruses, T25 flasks of 80% confluent 293FT cells were transfected in IMDM with 10% heat-inactivated FBS (heat inactivated at 56°C for 30 min; HI-FBS) and 1% Antibiotic-Antimycotic (Invitrogen) with 8.8ug of the plasmid encoding the oncogene or shRNA of interest, as well as a total of

8.8ug of packaging plasmid using the Fugene® HD Transfection Reagent instructions (Promega). After 24 hours, the media was replaced with 6.5mL new

IMDM, 10% HI-FBS, 1% Antibiotic-Antimycotic. At 48 hours post transfection, about 6mL of virus supernatant was collected, and filtered using 0.45um

Cellulose Acetate Membrane (WVR). Virus supernatant was stored in aliquots at

-80°C.

33 Viral Transduction Efficiency

The transduction efficiency of generated self-inactivating, GFP expressing retrovirus and lentivirus supernatant was assayed in the NIH 3T3 mouse embryonic fibroblast cell line. 2.5x105 NIH 3T3 cells were plated in each well of a tissue-cultured treated 24 well plate in a final volume of 500uL of IMDM, 10% HI-

FBS, 1% Antibiotic-Antimycotic, 8ug/mL polybrene and transduced with thawed virus at the following concentrations: 1/500, 1;100, 1/50, 1/25, 1/10, 1/5.

Expression of GFP was assessed at 48 hours post transduction and the dose curve was used to normalize viruses to be used in the same experiment.

Viral Transduction of Murine Bone Marrow Cells

Non-tissue culture treated 12 well plates were coated with 1mL of 5ug/cm2 retronectin (Takara) at 4°C overnight. Wells were blocked with 1mL 2% BSA PBS for 30 min at room temperature and washed once with 1mL DPBS prior to the addition of cells and virus. Bone marrow from Ctrl and IRP C57BL/6 mice was enriched for cKit+ cells using MACS as described above. 5-6x105 cKit+ cells were incubated in 1 mL IMDM (Invitrogen), 20% heat-inactivated FBS (HyClone), 10ng mSCF, and 1mL normalized retrovirus or lentivirus supernatant. Cells and virus were centrifuged for 2 hours at 1100 rpm, and incubated for an additional 3 hours

5 4 at 37°C and 5% CO2. 2x10 cells were transplanted per recipient or 5x10 –

1x105 cells were cultured in vitro, as described above.

Knockdown Efficiency of shRNA Targets

To determine the knock down efficiency of each shRNA used, the immortalized myeloblast-like 32D cell line was preferentially used, or if the gene

34 of interest was not expressed in 32D cells, the NIH 3T3 cell line was used. 1x106

32D or NIH 3T3 cells were cultured in 1mL media (IMDM, 10% HI-FBS, 1%

Antibiotic-Antimycotic, 8ug/mL polybrene) and 1mL freshly thawed virus supernatant generated using shRNA constructs expressing puromycin resistance. Cells and virus were spinfected for 30 min at 32°C at 800 rpm, and then incubated for an additional 24 hours at 37°C in 5% CO2. After 24 hours, cells were washed and resuspended in fresh media. At 48 hours, media was replaced with fresh media containing 1.5ug/mL puromycin (32D). Selection for transduced cells was carried out for 8 days, after which cells were counted on the

Guava 8HT (Millipore) and RNA was harvested for RT-qPCR.

RT-qPCR

Bone marrow was enriched for cKit+ cells by MACS separation, and cultured in vitro. After 6 days, LSK were sorted from the cultures and RNA was isolated using the RNeasy Micro Kit (Qiagen). For knock down efficiency from

NIH 3T3 or 32D cells, RNA was isolated from 1x106 cells using the RNeasy Mini

Kit (Qiagen). Purified RNA was then use for generation of single strand cDNA using the Transcriptor First Strand cDNA Synthesis Kit (Roche). qPCR was performed using LightCycler® 480 Probes Master Mix (Roche) and gene-specific primers and probes from the Universal ProbeLibrary (Roche) as indicated in

Table 2.2. To determine knock down efficiency for CEBPA, PrimeTime® qPCR

Assays (IDT) were used for the following murine genes: Actb

(Mm.PT.58.28904620.g) and CEBPA (Mm.PT.58.30061639.g). qPCR was performed using a LightCycler 480 (Roche).

35 Table 2.2 Universal ProbeLibrary primers and probes.

Gene Universal Primer sequences Symbol ProbeLibrary Probe For: aaatcagttatggttcctttggtc 18sRNA 55 Rev: gctctagaattaccacagttatccaa For: aaggccaaccgtgaaaagat Actb 56 Rev: gtggtacgaccagaggcatac For: aagcaccacctggatgga Gstm2 82 Rev: tgacctggttctccacaatg For: attgttcctggggaaattca Gstm5 2 Rev: gagaaaatccacaaaggtcagc For: gtgaacggggagaaagagc Gpx3 51 Rev: tgagcccaggagttctgc For: catgatggacttggagttgc Nfe2l2 3 Rev: cctccaaaggatgtcaatcaa For: catgatggacttggagttgc Nfe2l2 18 Rev: cctccaaaggatgtcaatcaa For: Caaacaagatgccttgtactttga Nfe2l2 53 Rev: atatccagggcaagcgact For: gagcaggacatggagcaagt Nfe2l2 51 Rev: gcttgttttcggtattaagacactg

Mathematical Modeling

Mathematical modeling was conducted in collaboration with Andrii

Rozhok. To mathematically model the probability of differentiation and LSK fitness, time course studies were performed. LSK from Ctrl and IRP LSK were sorted and cultured, cell population distribution and numbers were assessed on days 3 and 5 by flow cytometry.

Probability of Differentiation

Using the standard population doubling equation, the population size of

LSK at any given time (S(t)) can be calculated using the initial number of LSK

36 (S0) and the number of population doublings during a specific period of time

(C(t)):

!(!) �(�) = �!2

However, upon cell division, LSK have the ability to both self-renew and give rise to differentiated progeny. Therefore, the number of LSK is not doubled upon each cell division. If LSK commit to differentiation with a certain probability

(D), expansion of the undifferentiated LSK population would be 2(1-D). Growth of the undifferentiated LSK population within the total cell population as a function of time will then be:

!(!) �(�) = �! 2 1 − �

Using the total population size as a function of time (Pt) and the initial number of LSK in the culture (S0), one can calculate the number of population doublings as a function of time (C(t)):

�(�) �(�) = log! �!

The number of LSK in the total cell population as a function of time can then be described as:

!(!) !"# ! ! �(�) = �! 2 1 − � !

Finally, the probability of differentiation per LSK per cell division can be derived from culture population cell numbers at any given time (t) as:

!! �! !"#! = 2 1 − � !! �!

! !! �! !"#! 2 1 − � = !! �!

37 ! !! 1 �! !"#! � = 1 − !! 2 �!

LSK Fitness

LSK fitness is a measure of the ability of an LSK to self-renew under a set of experimental conditions. The number of new LSK per LSK per division

(LSKnew) can be derived using the probability of differentiation (D) and equations shown above:

���!"# = 1 − 2�

The value of LSKnew can represent a contracting (LSKnew < 0), expanding (LSKnew

> 0), or unchanged LSK pool over time (LSKnew = 0). An unchanged LSK population size (LSKnew = 0) is possible under D = 0.5, where upon cell division, the LSK gives rise to one LSK and one differentiated progeny, thereby neither increasing nor decreasing the LSK pool size. Altered differentiation probability per cell division towards 0 < D < 0.5 would result in an expansion of the LSK pool over time, while a change in differentiation probability per cell division towards

0.5 < D < 1 would result in a contraction of the LSK pool over time. We propose that the rate of change in LSK pool size over time can be used as a measure of

LSK fitness in the context of self-renewal. We therefore measured LSK fitness using an equation of stem cell fitness momentum (F’), expressed as the number of new LSK produced per LSK per hour, and cell division rate (C), expressed as the number of cell divisions per cell per hour:

�′ = (1 − 2�)�

It is important to note that fitness momentum (F’) is not equal to fitness (F), as F’

= 0 when D = 0.5 , denoting an unchanging LSK pool size over time, and F = 0 is

38 supposed to denote cell population death within an indefinitely small period of time. It is also important to note that the maximal fitness momentum (F’max) is not defined, as at D > 0.5, the fitness momentum of an LSK clone will be proportional to the cell division rate (F’max is limited only by speed of cell division (Cmax)).

Thus, for in vitro applications, we propose that stem cell fitness momentum (F’) serve as a measure of LSK fitness.

ROS Detection

For ROS detection using dichlorodihydrofluorescein (DCF, Invitrogen), bone marrow was stained with Lineage-PE (B220, CD3, Gr1, CD11b, Ter119),

Sca1-APC, and cKit-PEcy7 and incubated with 10uM DCF for 15 min at 37°C.

Cells were washed and analyzed using a Beckman Coulter Gallios 560 flow cytometer. For analysis of lipid peroxidation, cells were stained with Lineage-PE,

Sca1-APC, and cKit-PEcy7, and Linneg cells were sorted on the Beckman Coulter

MoFlow XDP 70. Linneg cells were then incubated with the lipid peroxidation sensor BODIPY 581/591 C11 (Invitrogen) for 30 min at 37°C, washed, and analyzed on the Gallios 560.

Chemical Compounds

Various vitamins and chemical compounds were used to explore the roles of Nrf2, NOX4, oxidative stress, ATM, and PKCδ in the IRP LSK function.

Treatment in vitro was conducted by culturing sorted Ctrl and IRP in mHPC media with a particular compound at the concentration(s) and durations listed in Table

2.3. As a vehicle control, DMSO or EtOH were used dependent upon the solubility of the compound.

39 Table 2.3 Chemical compounds used in mHPC cultures.

Concentration Catalog Compound Vehicle Company Used number AI-1 1, 10, 50, 100uM DMSO Calbiochem 492041

Chalcone 2, 10, 20, 50uM DMSO Calbiochem 492040

Tat-14 150uM DMSO Calbiochem 492042

Vas3870 (Noxi) 5uM DMSO Calbiochem 492000

9cRA 50nM DMSO Sigma R4643

ATRA 100nM DMSO Calbiochem 554720 DL-α-Tocopherol 2mM - Sigma T3376 acetate (Vitamin E) P38i (SB203580) 5,10uM DMSO Tocris 15121-47-6

MEKi (AZD6244) 5, 10uM DMSO Selleck S1008 Tocris MAPKi (SB203580) 5, 10uM DMSO 1402

JNKi (SP600125) 5, 10uM DMSO Sigma S5567

ATMi (KU55933) 5, 10uM DMSO Calbiochem 118500 GO6850 (broad 1, 5uM DMSO Calbiochem 203293 PKCi) GO6976 (PKCα,β i) 1, 5uM DMSO Calbiochem 365253

AEB071 (PKCθ,δ i) 1, 5uM DMSO Selleck S3791

RNA Sequencing

LSK from Ctrl or IRP mice were sorted and used immediately for RNA isolation and library preparation. For cultured LSK gene expression profiles, LSK from Ctrl or IRP mice were sorted and cultured for 6 days, after which LSK were resorted and used for RNA isolation and library preparation. 3 mice were pooled per sample for analysis of Fresh LSK, and 1 mouse per sample was used for

40 analysis of cultured LSK. RNA was extracted using the Qiagen RNeasy Micro kit, and RNA libraries were prepared using the Illumina TruSEQ Stranded mRNA

Library Kit and RNA-seq run on the Illumina platform. An average of 29 million

(16-35 million) and 29 million (29-45 million) single-end 50 nucleotide sequencing reads were obtained per cultured and fresh sample, respectively. Analysis of

RNA-seq data was performed as previously described [290, 291] by Jihye Kim and Aik-Choon Tan. Briefly, reads were mapped to the mouse genome using

Tophat (version 1.4.1) [292] using the NCBI reference annotation (NCBI mouse build 37.2) as a guide. A maximum of 2 mismatches for the initial alignment and

2 mismatches per segment with 25 bp segments were allowed. An average of

95.8% (89.2%-97.2%) of the reads aligned to the mouse genome. Cufflinks

(version 1.3.0) [293] was then used to assemble transcripts as guided by RefSeq annotation. Novel isoform discovery was allowed in each sample but isoforms were ignored if there was less than 30 supporting reads or if they represented less than 10% of the total reads for the gene. Fragment bias correction, multi- read correction, and normalization by the total number of reads was performed.

Cuffmerge was used to merge transcript assemblies for each sample. FPKM values for each transcript was computed by rerunning Cufflinks with the merged assembly as the guide. Gene expression was estimated by addition of all transcripts that represented the same gene. This matrix was used for all subsequent data analysis. All plots and R-squared values were obtained in

R/Bioconductor (R version 2.15.2). Gene set enrichment analysis (GSEA) [294] was performed by Jihye Kim and myself, using the derived FPKM values and

41 GeneSigDB (release 4) as genesets, which contains 3,515 gene signatures from

1,604 published articles. We also included our own assembled gene signatures collected from the literature. Pathway enrichment was identified by running

GSEA (version 2.0.12) using 1000 gene set permutations. The gene sets used for C/EBPα (V$CEBPA_01), PU.1 (V$PU1_Q6), and E2F (V$E2F_02) were from

MSigDB (c3.tft.v4.0.symbols).

In Vivo All-Trans Retinoic Acid Treatment

Subcutaneous ATRA Pellets

Two techniques were used to dose mice with all-trans-retinoic acid

(ATRA). For implantation of ATRA or placebo pellets, a 10mg 21-day slow release pellet (Innovative Research of America) was used because this dose had been shown to be effective and safe in a mouse model of acute promyelocytic leukemia (APL) [295]. The ATRA or placebo pellet was implanted subcutaneously at the lateral side of the neck of Ctrl or IRP congenic mice, and the incisions were closed with wound clips and Verbond. 8 days post implantation, 4x106 cKit-selected bone marrow cells from Ctrl C57BL/6 mice were transplanted without concomitant radiation into the Ctrl or IRP congenic mice containing pellet implants. Mice containing ATRA pellets developed large masses and lesions around the pellet by 2 weeks post transplant and the experiment was terminated early. Therefore, BM was harvested from the congenic recipient mice

2 weeks post transplant, hemolyzed, and 5x106 cells were stained and assessed by flow cytometry to determine the proportion of WT Ctrl donors within total BM and LSK populations. Recipient HSC fitness, with ATRA or placebo treatment,

42 was determined by the extent of Ctrl donor cell engraftment and expansion in the mHPC compartment, with higher Ctrl donor frequencies indicating more defective recipient HSPC function.

Oral Administration of ATRA

To assess ATRA treatment on mHPC function long-term, we orally administered ATRA or DMSO placebo daily. ATRA (Calbiochem) was prepared by diluting in vegetable oil for a dose of 0.4mg/mouse. Ctrl or IRP congenic

(CD45.1+) mice were treated daily with a single dose of 0.4mg/mouse by oral gavage. After 3 weeks, mice were euthanized and used for in vitro mHPC expansion assays, or used for in vivo assessment of mHPC fitness via bone marrow transplantations.

In Vivo Analysis of ATRA Treatment on mHPC Fitness: 1.35x106 cKit- enriched and 3.6x10 6 cKit-depleted bone marrow cells from Ctrl congenic

(CD45.2+) mice were combined and transplanted into the treated Ctrl or IRP

CD45.2+ mice without concomitant myeloablation at the time of transplant.

Recipient mice were then divided into 2 groups, those receiving ATRA or placebo up until the time of bone marrow transplantation, and those maintained on daily

ATRA or placebo treatment post transplant. Contribution of Ctrl donor cells to hematopoiesis of recipient mice was assessed by flow cytometric analysis of the proportion of donor CD45.2+ cells in the peripheral blood over time. At 17 weeks post transplant, mice were euthanized, bone marrow was harvested from the right tibia, right femur, and pelvis, hemolyzed, and 2x106 cells were strained and

43 assessed for CD45.2+ donor cell frequency within total bone marrow and LSK populations by flow cytometry.

In Vitro Analysis of mHPC Self-Renewal After In Vivo ATRA Treatment:

LSK were sorted from Ctrl and IRP congenic mice after 3 weeks of daily treatment with either ATRA or DMSO placebo by oral gavage. LSK were cultured in mHPC media with or without DL1, 100nM ATRA, or DMSO placebo. Total live cell numbers, cell population distribution, and LShiK cell numbers were assessed on day 6 of culture by flow cytometry.

Statistical Analysis

All statistical analysis as conducted using GraphPad Prism version 6.0. All statistics shown were generated using Unpaired T-tests unless otherwise specified. On graphs, statistics are indicated with asterisks: * p < 0.05, ** p <

0.01, *** p < 0.001, **** p < 0.0001.

44

CHAPTER III

NOTCH ACTIVATION RESTORES IONIZING RADIATION-REDUCED

MULTIPOTENT HEMATOPOIETIC PROGENITOR CELL SELF-RENWAL1

Introduction

Ionizing radiation (IR) has been associated with human disease, particularly increased risk of carcinogenesis, for over 100 years. However, the mechanism underlying this relationship remains poorly understood. Human exposure to sporadic IR has occurred naturally throughout our evolution, via environmental sources in the air, soil and water. However, exposure to man- made IR is becoming increasingly more common, as illustrated by the use of IR therapy to treat roughly 60% of solid tumors and the growing application of CT scans [9, 10]. The escalating occurrence of total body and higher dose IR exposure via man-made sources highlights the importance of understanding how

IR causes human disease.

Ionizing Radiation and Human Disease

The effect of IR on human health is becoming more evident as availability to long-term follow up studies and the number of long-term survivors of cancer treatment increase. Reduced hemoglobin levels, peripheral blood cytokines, and cellular immunity have been noted in atomic bomb survivors 50 years after exposure [19, 20]. Occupational IR exposure has been associated with decreased humoral immunity and peripheral blood CD4+ T cell counts [21]. IR exposure is also highly associated with the development of malignancies, primarily myeloid leukemia [22, 23]. Notably, pediatric leukemia patients treated

1 This chapter has been accepted for publication in Stem Cells.

45

with chemo- or radio-therapy have been found to be at increased risk for developmental defects and secondary malignancies [24]. The persistence and broad hematopoietic presentation of defects following IR exposure suggests that long-lived, pluripotent HSC may be the primary reservoir for IR-induced effects.

Hematopoietic Stem and Progenitor Cells

Generally quiescent, hematopietic stem cells (HSC) enter cell cycle whereby their capacity for multipotent differentiation provides a refill for the rapidly turned over hematopoietic compartment, and their ability to self-renew allows for maintenance of the HSC pool itself. Thereby, HSC are responsible for continuous replenishment of the whole hematopoietic system for the entirety of adult life.

Maintenance of HSC function is a highly regulated and complex processes heavily influenced by microenvironment. HSC reside primarily in the bone marrow within specialized niches composed of supporting cells, nutrients, and other structural, paracrine and autocrine factors that influence their behavior.

One particular receptor implicated in HSC self-renewal is Notch [141-148]. Notch is a transmembrane receptor expressed on the surface of mHPC, that undergoes proteolytic cleavages upon ligation, releasing the intracellular Notch domain, ICN, for nuclear translocation and trancriptional activation [296]. Of the 4 mammalian

Notch receptors, Notch1 and Notch2 are known to be expressed on the surface of HSC [297, 298]. In addition, expression of the Notch ligands Delta-like 1 (DL1) and Jagged-1 (Jag1) has been found on bone marrow cells, including on osteoblast and B cell progenitors [35, 146, 299-302]. However, the exact role of

46

Notch in HSC self-renewal remains controversial. Studies using knock out of

Notch1 or downstream signaling components revealed no effect on HSCs during homeostasis, but inhibition of Notch2 has been shown to significantly affect HSC self-renewal during stressed hematopoiesis [141-148].

Effect of IR Exposure on HSC Function

Former studies have identified various detrimental effects of IR exposure on HSC function immediately following and long-after the exposure event. IR has been shown to increase lymphoid differentiation of HSC within 24 hours post exposure [229]. Other studies have detected increased oxidative stress specifically within HSC as well as induced senescence in a subset of HSC months after exposure to IR [234, 271]. Studies in our lab have determined that prior radiation exposure reduces the frequency of HSC and increases selection for the activated intacellular Notch domain, ICN1, within previously irraidated and homeostatically restored (IRP) HSC [233].

We hypothesized that selection for ICN within IRP HSC occurs because

Notch activation repairs or circumvents a functional defect resulting from the initial IR exposure. In the following studies, we explored alterations in multipotent hematopoietic progenitor cell (mHPC) function following a single dose IR exposure. The designation mHPC, containing HSC as well as multipotent progenitor cells, is used throughout the studies because long-term transplant studies were not completed for every assay and thus the cells assayed cannot be strictly defined as true HSC. We show that IR exposure results in long-term, somatically heritable, cell-intrinsic reductions in mHPC self-renewal, which exhibit

47

a concomitant increase in differentiation potential. Remarkably, activation of

Notch restored the self-renewal of IRP HSPC in vitro. Through mathematical modeling, I provide evidence that the altered balance between self-renewal and differentiation results in sustained reductions in mHPC fitness (ability to contribute epigenotype/genotype to subsequent cell generations), which again is restored upon activation of Notch. Importantly, my results indicate that the long- term effects of IR on mHPC function are reversible, and thus potentially amenable to therapeutic intervention.

Results

Ionizing Radiation Exposure Results in a Long-Term Reduction in the

Number of Phenotypic Hematopoietic Stem and Progenitor Cells

Perturbations in the mHPC compartment can manifest as pan- hematopoietic and long-term alterations in the peripheral hematopoietic compartment. To determine whether a single dose exposure to IR alters the number of mHPC, we exposed C57BL/6 mice to 2.5Gy Cs-137 sub-lethal radiation dose. The mice were then allowed to rest for a minimum of 9 weeks in order to allow complete reconstitution of the hematopoietic compartment (Figure

3.1). It is important to note that the reconstituted hematopoietic compartment was derived entirely from residual mHPC that had survived the initial IR exposure event.

48

Figure 3.1: Generation of previously irradiated and homeostatically restored (IRP) mice. C57BL/6 mice at 6-11 weeks of age were irradiated with a sub-lethal dose of 2.5Gy Cs-137 and allowed to completely restore their hematopoietic compartment for a minimum of 9 weeks. Non-irradiated age- and gender- matched mice serve as control (Ctrl).

Bone marrow from previously irradiated but homeostatically restored (IRP) mice and non-irradiated age- and gender-matched control (Ctrl) mice was analyzed for the frequency of mHPC populations by flow cytometry. mHPC are enriched within the LineagenegcKit+Sca1+ (LSK) population. mHPC can be separated further by surface markers into multipotent progenitor cells (MPP) as

Lineage(Lin)negcKit+Sca1+CD135+CD34+, short-term hematopoietic stem cells

(ST-HSC) as LineagenegcKit+Sca1+CD135negCD34+, and long-term hematopoietic stem cells (LT-HSC) as LineagenegcKit+Sca1+CD135negCD34neg.

There was no difference in the total bone marrow cellularity between Ctrl and IRP mice (Figure 3.2A). However, IRP mice exhibited reduced frequencies and numbers of the HSC enriched LSK population as well as the LT-HSC, ST-

HSC, and MPP compartments (Figure 3.2B,C). These results indicate the presence of a defect in the earliest mHPC populations long after a single dose of sub-lethal IR.

49

Figure 3.2: IRP mice exhibit reduced numbers of phenotypic mHPC. A) Total bone marrow cellularity in Ctrl and IRP mice. B) Flow cytometric analysis of BM from Ctrl and IRP mice. Linneg cells were assessed for expression of Sca1 and cKit (left panels). LSK were then further enriched for LT-HSC, ST-HSC, and MPP via expression of CD135 and CD34 (right panels). Percentages in flow plots indicate percent of parent gate. C) Total number of LT-HSC, ST-HSC, MPP, and LSK cells. (n=3). * p < 0.05, ** p < 0.01, *** p < 0.001

To determine whether these defects persist in more differentiated BM populations, we assayed expression of myeloid progenitor populations, including

LineagenegcKit+Sca1negCD16/31negCD34+ common myeloid progenitors (CMP),

LineagenegcKit+Sca1negCD16/31+CD34+ granulocyte/macrophage progenitors

(GMP), and LineagenegcKit+Sca1negCD16/31negCD34neg megakaryocyte/ erythrocyte progenitors. Relative to Ctrl mice, IRP mice possessed decreased frequency and number of CMP and no change in GMP or MEP populations

(Figure 3.3). These results indicate that although IRP mice possess defects in their earliest mHPC populations, these defects are likely compensated for at later stages in hematopoietic differentiation, specifically in the myeloid compartment.

50

Figure 3.3: IRP mice exhibit reduced proportions and numbers of common myeloid progenitors. A-B) Bone marrow from Ctrl and IRP mice was assessed for CMP, GMP, and MEP populations by flow cytometric analysis. A) Myeloid progenitor cells in the LK population (left panel) were further enriched using CD16/32 and CD34 (right panels). B) The number of myeloid progenitor cells per mouse. (n = 3)

Previous studies identified an increase in lymphoid differentiation of HSC at 24 hours post IR. To determine whether HSC possess any alteration in differentiation potential at 9 weeks post sub-lethal IR, we assayed LSK for surface expression of CD150, which is expressed at high levels on the surface of myeloid biased HSC and at low levels on lymphoid biased HSC [303, 304]. IRP

LSK exhibited significantly increased expression of CD150 relative to Ctrl LSK

(Figure 3.4), indicating an increase in the frequency of myeloid-biased HSC within IRP mice. However, there was no difference in the frequency of B220+ and

CD11b+ cells in the BM of Ctrl and IRP mice. These results indicate that although

IRP mice possess increased frequency of myeloid biased HSC, there is no translation into a myeloid-biased differentiation of progeny.

51

Figure 3.4: IRP mice possess increased frequencies of myeloid biased mHPC. A) Surface expression of CD150 was analyzed on Ctrl and IRP LSK by flow cytometry to determine frequencies of myeloid biased (CD150hi) and lymphoid biased (CD150low) mHPC. B) Frequency of B220+ and CD11b+ cells in the BM of Ctrl and IRP mice. (n = 3)

IRP BM Exhibits Decreased Long-Term HSC Function In Vivo

Our lab has previously identified reduced LT-HSC function in the bone marrow of IRP BALB/c mice. To confirm that IR exposure reduces mHPC function long-term in C57BL/6 mice, bone marrow from Ctrl or IRP congenic (CD45.1+) mice was mixed 9:1 with competitor bone marrow from Ctrl C57BL/6 (CD45.2+) mice. The bone marrow mixture was transplanted into CD45.2+ mice lethally irradiated with 10Gy Cs-137, and the contribution of donor cells to hematopoiesis was monitored by flow cytometry over time (Figure 3.5A). The contribution of IRP

CD45.1+ cells to hematopoiesis was significantly reduced relative to Ctrl CD45.1+ cells, with IRP donors being almost completely outcompeted by Ctrl CD45.2+ competitor cells by 86 days (Figure 3.5B). These results indicate that IRP bone marrow has significantly reduced mHPC activity relative to Ctrl bone marrow.

52

Figure 3.5: IR reduces BM competitiveness long-term. A) Experimental design. BM from Ctrl or IRP CD45.1+ mice was mixed 9 : 1 with BM from Ctrl CD45.2+ mice and transplanted into lethally irradiated CD45.2+ recipients. B) The frequency of CD45.1+ cells within the PB over time was assessed by flow cytometry.

To assess HSC function in vivo on a per HSC basis, BM from Ctrl and IRP

CD45.2+ mice was normalized for 35 HSC (LSKCD34neg) and transplanted into sub-lethally irradiated CD45.1+ recipient mice (Figure 3.6A). The contribution of donor cells to hematopoiesis was monitored by flow cytometric analysis of peripheral blood. Hematopoietic contribution by Ctrl donors was maintained long- term (Figure 3.6B), with contribution to myelopoiesis being maintained at 150 days post transplant (Figure 3.6C). In contrast, hematopoietic contribution by IRP donors was significantly reduced, with contribution to myelopoiesis decreasing to levels near background at 150 days post transplant.

53

Figure 3.6: IR exposure reduces fitness of individual HSC. A) Experimental Design. BM was harvested from Ctrl or IRP CD45.2+ mice and normalized for the frequency of HSC (LSKCD34neg) so that 35 HSC would be transplanted per lethally irradiated CD45.1+ congenic recipient. Contribution to hematopoiesis was monitored by flow cytometric analysis of PB over time. B-C) Frequency of CD45.2+ donor in total PB (B) and in CD11b+ myeloid compartment (C). (n = 7) Statistical analysis using two-way ANOVA with multiple comparison test.

Lethal irradiation of recipient mice generates a highly inflammatory microenvironment that stimulates transplanted donor mHPC to rapidly proliferate and differentiate in order to replenish the hematopoietic compartment [271, 305].

To assess IRP LT-HSC activity under more homeostatic conditions, Ctrl or IRP

CD45.2+ BM was transplanted into Ctrl or IRP CD45.1+ recipients without myeloablation of recipients at the time of transplant (Figure 3.7A). Contribution to hematopoiesis was measured by flow cytometric analysis of the PB over time.

Expansion of Ctrl CD45.2+ donor cells transplanted into IRP CD45.1+ recipients was significantly greater than that of Ctrl CD45.2+ donor cells transplanted into

Ctrl CD45.1+ recipients (Figure 3.7B). In addition, IRP CD45.2+ donor cells did not expand after transplantation into either Ctrl or IRP CD45.1+ recipient mice.

54

Collectively, these in vivo studies indicate that IR results in long-term reductions in the frequency and number of mHPC as well as a decrease in the fitness of individual mHPC during both stressed hematopoiesis and at steady state.

Figure 3.7: IRP mHPC possess reduced fitness at steady-state. A) Experimental design. Ctrl or IRP CD45.2+ BM was transplanted into Ctrl or IRP CD45.1+ mice without concurrent myeloablation at the time of transplant. B) Contribution of CD45.2+ donor cells to hematopoiesis was determined by flow cytometric analysis of the PB over time.

IRP mHPC Exhibit Reduced Self-Renewal In Vitro

To further elucidate the IR-induced mHPC functional defect, we employed the use of in vitro mHPC expansion cultures. LSK were sorted from the BM of

Ctrl or IRP mice and cultured with cytokines, including mSCF, hFlt3-L, hIL-6, and hIL-11, that promote mHPC proliferation, self-renewal, differentiation, and survival. After 6 days in culture, the total cell number in IRP cultures was similar to that of Ctrl cultures, indicating no significant difference in total cell expansion potential between Ctrl and IRP LSK (Figure 3.8A). However, on day 12, the total number of live cells in the IRP cultures was significantly reduced relative to Ctrl cultures. Analysis of cell viability by DAPI exclusion revealed no difference in the

55

percentage of live cells between IRP and Ctrl cultures on either day 6 or 12

(Figure 3.8B). Examination of cell population distribution on day 6 revealed significantly increased proportions of differentiated myeloid cells with a concomitant decrease in the fraction of both LSlowK and LShiK cells in IRP cultures relative to Ctrl (Figure 3.8C). Furthermore, IRP cultures contain reduced numbers of LSlowK and LShiK cells on day 6 relative to Ctrl cultures (Figure 3.8D).

Collectively, these results indicate that IRP LSK possess decreased self-renewal potential and a concomitant increased propensity for differentiation in vitro.

Figure 3.8: IRP LSK exhibit reduced expansion in vitro. 200 LSK were sort purified from Ctrl or IRP C57BL/6 mice into mHPC cultured for 12 days. A) The total cell number in cultures on days 6 and 12. B) Frequency of Live cells in culture on days 6 and 12. C) Cell population distribution on day 6. Statistics shown for IRP vs. Ctrl, generated using Two-Way ANOVA. D) Number of LSlowK and LShiK cells in culture on day 6. (n = 5)

56

LShiK Population Represents the Most Primitive mHPC Population In Vitro

To determine which cell subpopulation is responsible for propagation of the culture and generation of all possible cell populations, sorted LSK from Ctrl

C57BL/6 mice were cultured for 4 days, at which point LSK, LK, LS, and

LnegSnegKneg were sorted and re-plated for an additional 2 days (Figure 3.9A). The frequency of cell populations was then assessed by flow cytometry. LSK and LS cells were capable of generating all cell populations possible, with LSK having the greater potential to produce additional LSK (Figure 3.9B). In contrast, LK and

LnegSnegKneg cells were only capable of giving rise to terminally differentiated myeloid progeny. Therefore, LSK and LS populations possess the ability to give rise to all cell populations, with the greatest culture propagating potential being possessed by the LSK population. It is important to note that the gate for LS cells is very close to the LSK population, and therefore may include some contaminant

LSK cells.

Figure 3.9: LSK are the most primitive cell culture population. LSK from Ctrl C57BL/6 mice were sorted and replated in mHPC media for 4 days. LSK, LS, LK, and L-S-K- cells were sorted and re-plated for an additional 2 days. Flow cytometry was used to assess cell population distribution. Statistics indicate significance of LSK-initiated culture relative to all others, generated using two- way ANOVA with multiple comparisons. (n=3)

57

IRP LT-HSC Possess Reduced Expansion Potential In Vitro

LSK are enriched for HSC, but still possess many multipotent progenitor cells. Therefore, to assess the expansion potential of a more HSC-enriched population, mHPC cultures were seeded with Ctrl and IRP LT-HSC (Figure

3.10A). The total cell number on day 6 was not different between Ctrl and IRP cultures (Figure 3.10B). The number of LSlowK cells was unchanged, but the number of LShiK and total LSK cells in IRP cultures was significantly reduced relative to Ctrl cultures (Figure 3.10C). These results indicate that IR exposure results in a reduction in the self-renewal of LT-HSC months after the exposure event.

Figure 3.10: IR alters expansion potential of LT-HSC. A) Gating strategy for sort purification of LT-HSC population. A-B) 50 LT-HSC were cultured per well and the number of total cells (B) and LSlowK, LShiK, and total LSK (C) were analyzed on day 6 by flow cytometry.

58

IR Exposure Does Not Alter Cell Culture Initiating Frequency of LSK

To verify that the difference in LSK expansion between Ctrl and IRP cultures was not due to a difference in the culture-initiating cell frequency, limiting dilution culture assays were performed. LSK from Ctrl and IRP were sorted and 3,

9, and 21 cells were cultured in mHPC media. After 8 days, the total cell number in each culture was measured (Figure 3.11A). The number of culture initiating cells was calculated by scoring wells with a minimum of 2x104 total cells/well using L-Calc™ software from Stem Cell Technologies (Figure 311B). Both Ctrl and IRP LSK contain 1/3 culture initiating cells, indicating that IR does not alter the number of culture initiating cells within the LSK population, but rather that mHPC fitness is reduced on a per-cell basis.

Figure 3.11: Culture initiating frequency of LSK is unaltered by prior IR exposure. BM was harvested from Ctrl or IRP C57BL/6 mice and 3, 9, or 21 sorted LSK were cultured for 8 days. A) The number of total cells on day 6 was analyzed by flow cytometry. B) The culture initiating cell frequency (CIC) was calculated by using the number of wells with greater than 2x104 total cell on day 6 and L-CalcTM software from Stem Cell Technologies.

59

IRP LSK Lose Long-Term Multipotent Reconstitution Potential More Quickly

In Vitro

To further examine the LT-HSC potential of cultured Ctrl and IRP LSK, long-term multi-lineage reconstitution in vivo was evaluated (Figure 3.12A). 600

LSK were sorted from the BM of Ctrl or IRP CD45.2+ C57BL/6 mice for culture.

After 6 days, the total progeny arising from the initial 600 LSK were transplanted into a single sub-lethally irradiated congenic (CD45.1+) recipient mouse. Long- term and multi-lineage contribution to hematopoiesis was assessed by flow cytometric analysis for CD45.2+ donor populations in the peripheral blood.

Cultured Ctrl cells were able to contribute to short-term multi-lineage hematopoiesis for up to 150 days, but were unable to contribute to long-term multi-lineage hematopoiesis, as indicated by the inability of culture Ctrl cells to contribute to myelopoiesis of all recipients at 150 days post transplantation

(Figure 3.12B,C). Therefore, Ctrl cultures maintain short-term but not long-term mHPC activity, as previously described [147]. In contrast, cultured IRP cells were unable to contribute to multi-lineage hematopoiesis of recipient mice past 27 days. These results indicate that IRP LSK lose their multilineage reconstitution potential in vitro more rapidly than Ctrl LSK, further supporting the hypothesis that IRP mHPC possess reduced self-renewal and increased differentiation.

60

Figure 3.12: IRP LSK lose multipotent reconstitution potential more quickly during culture. A) Experimental design. 600 LSK were sorted from CD45.2+ Ctrl or IRP mice and cultured for 6 days. The total progeny were then transplanted into sub- lethally irradiated recipient CD45.1+ congenic mice. B-C) Frequency of CD45.2+ donor cells within total cells (B) and CD11b+ myeloid cells (C) within PB.

Exposure to X-rays or γ-rays Elicits the IRP mHPC Defect

Medical procedures utilizing IR typically employ X-rays rather than γ-rays, and generally use low-dose or localized high-dose IR. To determine whether X- rays could also induce mHPC defects, C57BL/6 mice were exposed to 2.5Gy from an X-ray or Cs-137source, or non-irradiated for Ctrl. After 9 weeks, BM was harvested, lineage+ cells were depleted using magnetic activated cell sorting

(MACS), and purified cells were cultured in mHPC media. Flow cytometry was used to determine the frequency of LSK within the Lineage+-depleted populations in order to determine the number of LSK on day 0 (Figure 3.13A). After 6 days in culture, the total cell number in both X-ray and Cs-137 IRP cultures were reduced relative to Ctrl cultures (Figure 3.13B), likely due to the decrease in the frequency

61

of LSK within Lin-depleted BM of X-ray and Cs-137 IRP mice on day 0. As the frequencies of LSK was different between Ctrl, X-ray, and Cs-137 Lin-depleted populations, the fold increase from day 0 to day 6 was used to evaluate LSK expansion potential. The expansion of both X-ray and Cs-137 IRP LSK was significantly decreased relative to Ctrl LSK (Figure 3.13C), indicating that exposure of mice to either X-rays or γ-rays results in the IRP mHPC self-renewal defect in vitro.

Figure 3.13: Both X- and γ-radiation generate IRP mHPC expansion defect. BM from Ctrl or 2.5Gy X or Cs-137 irradiated mice was depleted for Lin+ cells. A) the number of LSK cells within the Lin-depleted BM at day 0 in culture. B) The total number of cells at day 6 of culture. C) The fold change in LSK from day 0 to day 6.

IR Dose Threshold Required for Generation of IRP mHPC Expansion Defect

To determine whether there is an IR dose threshold required to elicit the mHPC functional defect, mice were treated with 0, 0.2, 0.4, 0.8, and 1.6Gy Cs-

137. After 9 weeks, BM was harvested and sorted LSK were cultured in mHPC media. After 6 days, minor reductions in the total cell number were noted in 0.2 and 0.8 Gy IRP cultures relative to 0Gy (Ctrl) (Figure 3.14A). The frequency of

62

LShiK cells and differentiated Lin+ cells were significantly reduced and increased, respectively, in the 1.6Gy IRP cultures relative to 0Gy (Ctrl) (Figure 3.14B). The number of LShiK cells in culture on day 6 was significantly reduced in 1.6Gy IRP cultures relative to 0Gy (Ctrl) (Figure 3.14C). In contrast, LSK expansion in 0.2,

0.4, and 0.8Gy IRP cultures was no different from 0Gy (Ctrl). These results indicate that there is a minimum dose threshold of between 0.8 and 1.6Gy Cs-

137 required for IR to trigger the mHPC in vitro expansion defect.

Figure 3.14: Dose threshold of 1.6Gy required for generation of IRP mHPC expansion defect. C67Bl/6 mice were irradiated with 0, 0.2, 0.4, 0.8, or 1.6Gy Cs- 137 and after 9 weeks, LSK were sorted and cultured. A) The total cell number on day 6. B) Cell population distribution on day 6. Significance demarks 1.6Gy relative to 0 Gy. C) Number of LShiK cells in culture on day 6. (n = 9 - 10)

IRP mHPC Expansion Defect In Vitro is Cell Intrinsic

It has previously been reported that IR-exposed cells can exert effects on local non-damaged cells, a phenomenon termed the bystander effect. To determine whether the IRP mHPC expansion defect in vitro is mediated by cell extrinsic bystander effects or via cell-intrinsic factors, Ctrl or IRP congenic

(CD45.1+) LSK were sorted and co-cultured at 1:1 with competitor Ctrl or IRP

C57BL/6 (CD45.2+) LSK. After 6 days in culture, the total number of CD45.1+

63

cells was similar between all cultures (Figure 3.15A). The number of CD45.1+

LShiK cells was significantly reduced in IRP relative to Ctrl populations, regardless of whether the competitor CD45.2+ LSK was Ctrl or IRP (Figure 3.15B).

Conversely, the number of CD45.1+ Ctrl LSK was similar when cultured with either CD45.2+ Ctrl or IRP LSK competitors. Collectively, these results indicate that the IRP mHPC defect is cell intrinsic and does not influence neighboring non- irradiated LSK.

Figure 3.15: IRP LSK expansion defect is cell intrinsic. LSK from CD45.1+ Ctrl or IRP mice were cultured 1 : 1 with LSK from CD45.2+ Ctrl or IRP mice. A) The total number of CD45.1+ cells in culture on day 6. B) The number of CD45.1+ Gr1negSca1+ cells on day 6. (n = 5)

Activation of Notch Restores IRP mHPC Self-Renewal In Vitro

Mice exposed to total body IR eventually develop a disease similar to human T cell acute lymphoblastic leukemia (T-ALL) of which roughly 60% are associated with activating mutations in Notch [150, 306-308]. Additionally, previous studies in our lab have shown that the activated Notch1 mutant, ICN1, is selected for within IRP mHPC in vivo to a significantly greater extent than within

64

Ctrl mHPC populations [233]. In line with our adaptive oncogenesis model, we hypothesized that activating Notch mutations are selected for within an IRP mHPC compartment because they repair or circumvent an IR-mediated functional defect.

To determine whether Notch activation is able to restore IRP mHPC expansion in vitro, LSK were sorted from Ctrl and IRP C57BL/6 mice and cultured in mHPC media in non-coated or IgG-Delta-like 1 (DL1) coated wells. IgG-DL1 is a fusion protein of the Notch ligand DL1 and the Fc portion of IgG, which allows for immobilization of DL1 on the plate. The total cell number on day 6 was similar between Ctrl and IRP LSK cultures (Figure 3.16A). Activation of Notch resulted in a significant decrease in the total cell number for both Ctrl and IRP LSK cultures.

Analysis of cell population distribution on day 6 revealed a significant reduction in the proportion of LShiK cells in IRP cultures relative to Ctrl (Figure 3.16B).

Activation of Notch resulted in a significant increase in the proportion of LShiK cells in both Ctrl and IRP cultures. The number of IRP LShiK cells on day 6 was significantly reduced relative to Ctrl, but was completely restored upon Notch activation (Figure 3.16C).

It should be noted that Notch activation also resulted in a significant increase in the number of Ctrl LShiK. These results indicate that activation of

Notch rescues the IRP mHPC self-renewal defect in vitro.

65

Figure 3.16: Notch activation restores IRP LSK expansion in vitro. LSK were sorted from Ctrl and IRP C57BL/6 mice and cultures in mHPC media with and without the Notch ligand, DL1. A) The total cell number on day 6. B) Cell population distribution on day 6. Statistics shown for LShiK population, generated using two-way ANOVA. C) Number of LShiK cells on day 6. (n = 5) D) Cell cycle analysis of Ctrl and IRP LSK cultured with or without DL1 for 6 days. (n = 3 except 2 for Ctrl)

The decreased total cell number and increased proportion of LShiK cells in

Notch activated cultures is consistent with a role for Notch in promoting self- renewal of the more quiescent HSC compartment. To determine whether Notch activation slows cell cycle progression, cell cycle analysis was performed on Ctrl and IRP LSK cells after 6 days in culture with or without IgG-DL1. No difference in the profile of Ctrl or IRP LSK on day 6 of culture was identified (Figure 3.16D), indicating that IR does not results in long-term cell cycle defects within the mHPC population. However, Notch activation resulted in a small increase in the

66

proportion of LSK cells in G1 on day 6 for both Ctrl and IRP cultures. These results indicate that Notch activation marginally reduces S-phase progression of the mHPC population in vitro, further supporting a role for Notch activation restoring mHPC self-renewal in vitro.

IRP LSK Have Slightly Reduced Surface Expression of Notch2

Our data indicate that Notch activation restores the expansion of IRP LSK in vitro. However, IRP LSK cultured with DL1 still expanded to a lesser degree than Ctrl LSK cultured with DL1. Therefore, we sought to determine whether this difference occurs due to an IR-induced decrease in the surface expression of

Notch1 or Notch2, which are known to be expressed on HSC [297, 298]. No difference in the expression of Notch1 was detected between Ctrl and IRP LSK

(Figure 3.17A). In contrast, IRP LSK expressed a slight 10% reduction in Notch2 expression (Figure 3.17B). Therefore, the decreased expansion of IRP LSK cultured with DL1 may be due to slightly reduced surface expression of Notch2.

Figure 3.17: IRP LSK express slightly lower levels of Notch2. A) Freshly isolated LSK from Ctrl and IRP mice were assessed for surface expression of Notch1 (left panel) and Notch2 (right panel). B) Geometric Mean Fluorescent intensity of Notch2 PE on LSK.

67

IRP mHPC Increased Probability of Differentiation and Reduced Fitness are

Restored by Notch Activation

Culture expansion of mHPC allows for analysis of cell fate decisions at the single cell level. To analyze the cell-fate decision between self-renewal and differentiation at the single cell level, mathematical modeling of experimentally acquired data was employed. FACS-purified Ctrl or IRP LSK were cultured with or without DL1, and total cell number and cell population distribution were assessed on days 3 and 5 (Figure 3.18A,B). The probability of differentiation (D) per LSK

! !! ! !! !"#! per division was calculated as � = 1 − !! using the initial number of ! !!

LSK (S0), and experimentally acquired numbers of total cells (Pt) and LSK (St) on days 3 or 5. IRP LSK possess a significantly increased probability of differentiation (0.38) relative to Ctrl LSK (0.28) for both days 3 and 5 (Figure

3.18C).

Notch activation by DL1 resulted in a significantly reduced probability of differentiation for both Ctrl and IRP LSK on both days. The 40% increase in the probability of differentiation may appear small, but becomes amplified over numerous cell cycles, resulting in a substantial loss in IRP LSK fitness.

Importantly, the equivalent values for D on days 3 and 5 for each culture condition reveals that the probability of differentiation remains a static property over many cell divisions, even as the proportion of differentiated progeny increases in the cultures over time. Moreover, these results further support the hypothesis that the IRP mHPC fitness defect is cell intrinsic.

68

Figure 3.18: Notch activation reverses the increased probability of differentiation and restores fitness of IRP LSK in vitro. LSK from Ctrl and IRP C57BL/6 mice were sorted and cultured with or without DL1. A) The total cell number in culture on day 3 and 5. B) Cell population distribution on days 3 and 5. C-E) The probability of differentiation (C), Cell division rate (D) and fitness (E) of Ctrl and IRP LSK cultured with or without DL1. (n = 3)

69

In addition, we modeled the fitness of individual mHPC as a function of their ability to self-renew in vitro. The fitness of an LSK in vitro, defined as the number of new LSK per LSK per hour, was derived from the probability of differentiation equation. LSK fitness (F’) was calculated as ′ = (1 − 2�)� , where

D is the probability of differentiation and C is the cell division rate expressed as cell divisions per cell per hour (Figure 3.18D). IRP LSK exhibit reduced fitness relative to Ctrl on both days 3 and 5 (Figure 3.18E). Remarkably, activation of

Notch fully restored the fitness of IRP LSK to that of Ctrl LSK. Interestingly, activation of Notch did not seem to further augment the fitness of Ctrl LSK.

Discussion

Although the association between IR and human disease has been known for over a decade, the limited amount of data collected on patients and inaccurate dose estimates limit our understanding of the underlying mechanism.

Long-term follow-up of IR exposed individuals that has become recently available has provided more in depth analysis of the adverse health effects associated with

IR. Such studies have identified persistent, pan-hematopoietic defects evident as far out as 50 years post IR exposure, as well as increased incidence of malignancies.

The persistence and widespread presentation of hematopoietic defects post IR suggest a potential reservoir for IR-induced damage within a long-lived, multipotent mHPC population. In fact, multiple studies have found mHPC to exhibit increased differentiation within days of IR exposure and increased senescence and oxidative stress months after IR exposure [229, 234, 271]. Our

70

lab has previously shown that IRP mice possess nearly 10-fold reduced HSC function as assessed by limiting dilution BMT, and that the intracellular Notch domain ICN1 is selected for within IRP HSC but not in Ctrl HSC in vivo [233], suggesting that activation of Notch is selected for by repairing/circumventing an

IR-induced defect within the HSC compartment. I have expanded upon these studies to show that IR results in persistent, cell-intrinsic, somatically heritable reductions in mHPC self-renewal that are reversible by activation of Notch.

Analysis of phenotypic mHPC markers revealed that IRP mice possess reduced frequencies and numbers of HSC enriched LSK cells, LT-HSC, ST-HSC,

MPP, and CMP but no change in the frequency or number of GMP and MEP. In vivo reconstitution assays revealed that IRP BM contains significantly reduced numbers of mHPC. BMT assays using donor BM normalized to mHPC frequency revealed a significantly reduced ability of IRP mHPC to reconstitute sub-lethally irradiated recipients. Together, these data indicate that IR results in reduced numbers of mHPC as well as reduced function per mHPC.

In vitro cultures of LSK, an HSC enriched population, were used to further analyze the particular mHPC function altered by prior IR. IRP LSK exhibited no difference in total proliferative capacity, cell cycle, or survival during culture.

However, IRP LSK exhibited significantly reduced expansion and produced a significantly increased proportion of differentiated myeloid progeny relative to Ctrl

LSK. Importantly, exposure of mice to X-radiation or γ-radiation reduced mHPC function. These results suggest that IR results in decreased self-renewal and increased differentiation of mHPC months after the initial IR exposure event.

71

Mathematical modeling of cell fate decisions of cultured LSK revealed that IRP

LSK possess an increased probability of differentiation and a decreased fitness, measured as the generation of new LSK per LSK per hour.

The LSK differentiation in vitro consisted almost entirely of the myeloid lineage, and was significantly increased in IRP LSK relative to Ctrl. Previous studies have suggested increased lymphoid differentiation of HSC within 24 hours following IR exposure. Analysis of CD150 expression revealed significantly increased expression in IRP LSK, suggesting increased frequency of myeloid- biased HSC. Differences in the two studies are likely due to differences in the microenvironment contexts and HSC states. At early time points during reconstitution, HSC are induced to proliferate and differentiate to restore the hematopoietic compartment, whereas at time points months after the exposure event, hematopoiesis has been restored and HSC have returned to steady state.

Moreover, the dominance of myeloid differentiation in the mHPC cultures likely stems from the particular cytokine milieu, including mSCF, hFlt3-L, h-IL6, and hIL-11. These cytokines are important for mHPC proliferation, self-renewal, and survival, but many, particularly Flt3-L, IL-6, and hIL-11, are known to promote myeloid differentiation [309-316]. Additionally, IL-7, which is absent from our cultures, is required for both T and B cell lymphopoiesis [317-319].

Finally, we assessed the ability of Notch activation to restore the self- renewal of IRP LSK in vitro. Remarkably, Notch activation using an immobilized

Notch ligand, DL1, resulted in restored expansion of IRP LSK in vitro. However,

72

IRP LSK cultured with DL1 did not expand to the same extent at Ctrl LSK cultured with DL1, likely due to slightly reduced surface expression of Notch2.

Notch activation reduced the frequency of differentiated cells in culture, which likely stems from a reduced probability of differentiation per LSK calculated using mathematical modeling. Importantly, Notch activation resulted in restoration of the fitness of IRP LSK. Similar to IRP LSK, Notch activation in Ctrl

LSK also resulted in an increased expansion of LSK, decreased differentiation, and decreased probability of differentiation. However, Notch activation in Ctrl

LSK did not result in a further augmentation of Ctrl LSK fitness. It is possible that as an unperturbed mHPC population, Ctrl LSK already possess the maximum fitness obtainable in the particular culture conditions, and therefore Notch activation, though increasing their expansion, does not significantly increase the fitness of Ctrl LSK.

73

CHAPTER IV

INHIBITING IR-INDUCED PRECOCIOUS DIFFERENTIATION RESTORES

SELF-RENEWAL OF PREVIOUSLY IRRADIATED MHPC2

Introduction

We have shown that previously irradiated but homeostatically restored

(IRP) mice possess reduced numbers of phenotypic and functional multipotent hematopoietic progenitor cells (mHPC). We showed that mHPC -enriched LSK cells from IRP mice possess reduced expansion potential and increased differentiation in vitro. Moreover, our studies revealed that Notch activation restored the in vitro expansion of IRP LSK, resulting in a restoration of IRP LSK fitness. Importantly, the IR-mediated LSK in vitro expansion defect is cell intrinsic.

The balance between HSC self-renewal and differentiation is maintained by highly regulated and complex processes, with microenvironment information being relayed via numerous signaling pathways and ultimately being compiled into gene expression changes that influence cell fate decisions. Many of the key molecules influencing HSC function are transcription factors, which drive transcriptional activation or repression of genes required to carry out particular

HSC functions.

2 This chapter has been accepted for publication in Stem Cells.

74

Regulation of HSC Self-Renewal

Notch is a transmembrane receptor that upon ligation undergoes two subsequent proteolytic cleavages releasing the intracellular Notch domain, ICN, for translocation to the nucleus where, together with CSL and MAML, it regulates transcription of downstream target genes [106, 115, 119-121, 123]. Activation of

Notch results in the transcriptional activation of genes important in mHPC self- renewal. These genes include the Hes family genes, which are transcriptional repressors and are believed to function as inhibitors of cell differentiation [119,

124]. The requirement for Notch signaling for the generation of HSC during ontogeny has been well established [320, 321]. However, the role of Notch in adult HSC self-renewal has remained controversial, as the use of different genetic models and experimental assays have generated conflicting results.

Studies using mice lacking Notch1 or downstream co-activators, such as RBP-

Jκ, have revealed no requirement for Notch signaling in HSC maintenance during homeostasis [141, 142]. In contrast, in vitro cultures and genetic knock out studies have shown a requirement for Notch2, but not Notch1, in the self-renewal of HSC during stressed hematopoiesis [143-148]. Therefore, the context in which

HSC function likely influences the role particular Notch receptors play.

Regulation of HSC Differentiation

Promotion of HSC differentiation is also regulated by the expression, activation, and/or inhibition of transcription factors. C/EBPα is a basic leucine zipper transcription factor that binds DNA as an obligate hetero- or homodimer

[153]. C/EBPα is expressed in HSC, CMP, and GMP [164], and activates

75

transcription of downstream myeloid-associated genes, including GCSFR [174] and Spi-1, which encodes PU.1, another transcription factor involved in myelopoiesis as well as lymphopoiesis [179-181]. C/EBPα is even able bind and activate its own promoter [178], promoting a feed-forward commitment to myelopoiesis. C/EBPα-/- mice lack granulocytes but still possess peripheral monocytes [167], and conditional deletion of Cebpa in adult mice has been shown to result in a block in granulopoiesis at the CMP to GMP transition [168].

In addition to its roles in promoting myeloid differentiation, C/EBPα is known to inhibit cell cycle progression by inhibition of cMyc and E2F [182-184].

To determine how IR results in somatically heritable, cell-intrinsic reductions in mHPC function, we analyzed the gene expression profiles of both freshly isolated LSK as well as LSK cultured in the presence or absence of the

Notch ligand DL1. IR exposure resulted in a significant change in the expression of many genes, with a majority exhibiting increased expression post IR. Gene set enrichment analysis (GSEA) of RNA expression profiles revealed a significant decrease in the expression of genes known to be enriched within HSC. IRP LSK also possessed elevated expression levels of genes involved in differentiation, particularly myeloid differentiation. Importantly, activation of Notch reversed many of the IR-associated gene expression alterations.

76

Results

IR Exposure Causes Long-Term, Notch-Reversible Alterations in mHPC

Gene Expression

Our experimental results indicate that IR exposure results in long-term, somatically heritable, cell intrinsic reductions in mHPC self-renewal. To determine whether the mHPC self-renewal defect is due to long-term IR-induced alterations in gene expression, RNA-seq was performed on freshly isolated LSK sorted from Ctrl or IRP C57BL/6 mice (fresh, Figure 4.1A).

To assess whether Notch activation is able to restore IR-induced gene expression changes, LSK from Ctrl or IRP C57BL/6 mice were sorted and cultured with or without DL1 for 6 days, after which LSK were re-sorted and used for subsequent RNA library preparation (cultured). Analysis of both fresh and cultured RNA-seq data was conducted in collaboration with Dr. Aik-Choon Tan and Jihye Kim.

For both fresh and cultured LSK, hierarchical clustering revealed high correlation between biological replicates within each condition (Figure 4.1B).

Additionally, it is important to acknowledge that the Notch activation signature dominates over prior IR exposure. The IRPLSK + DL1 gene expression profiles are more closely related to Ctrl LSK+DL1 than to IRP LSK profiles.

77

Figure 4.1. RNA-seq analysis on fresh and cultured LSK. A) Experimental design. LSK from Ctrl or IRP mice were used directly for RNA-seq (Fresh, n=3, 3 pooled mice per sample) or cultured for 6 days with or without DL1, resorted for LSK, and then used for RNA-seq (Cultured, n = 3, 1 mouse per sample). B) Hierarchical clustering of Fresh and Cultured LSK samples.

A total of 58 and 886 genes exhibited altered expression in Fresh and

Cultured IRP, respectively, relative to control (Appendix A, Table 4.1). In Fresh

LSK, 43 genes (74%) were increased and 15 genes (26%) decreased in expression in IRP LSK relative to Ctrl. 596 genes (67%) were increased and 290 genes (33%) were decreased in expression in Cultured IRP LSK relative to cultured Ctrl LSK. Of the 290 genes that were down-regulated in cultured IRP

LSK relative to Ctrl, 47% (137/290) were increased upon Notch activation to levels equivalent to Ctrl and 39% (113/290) were increased upon Notch activation to levels significantly greater than Ctrl. Surprisingly, Notch activation resulted in an even further decrease in the expression of 13% (39/290) of IR- reduced genes.

78

Table 4.1 IR-induced gene expression changes.

Total IR-altered genes Up in IRP Down in IRP Fresh LSK 58 43 15 Cultured LSK 886 596 290

Of the 596 genes that exhibited significantly increased expression in

Cultured IRP LSK relative to Ctrl, ~36% (224/596) exhibited reduced expression upon Notch activation back to levels equivalent to Ctrl LSK. About 32% (193/596) of the IR-up-regulated genes were significantly reduced in IRP LSK upon Notch activation to levels significantly lower than in Ctrl LSK. Finally, 30% (176/596) of the IR-increased genes exhibited further increased expression upon Notch activation.

IRP LSK Express Decreased Levels of HSC-Associated Genes

To determine whether IR alters the expression of genes important for HSC function, gene expression was analyzed for previously identified HSC-specific gene expression signature [322]. Both Fresh and Cultured IRP LSK exhibited decreased expression of HSC-associated genes (Figure 4.2A). In fact, GSEA verified that the HSC-specific gene expression signature was significantly decreased in both Fresh and Cultured IRP LSK relative to Ctrl (Figure 4.2B).

These results indicate that IR exposure results in long-term reductions in HSC stemness. Importantly, DL1 activation of Notch partially restored the HSC signature in Cultured IRP LSK, indicating reversibility in IR-induced decreased expression of stemness genes.

79

Figure 4.2. Expression of HSC-associated genes is decreased within IRP LSK. A) HSC signature in Fresh and Cultured Ctrl or IRP LSK. B) GSEA for HSC- associated genes in Fresh (top) and Cultured (bottom) IRP LSK relative to Ctrl.

Effect of IR on Expression of Notch-Regulated Genes in mHPC

Our previous studies indicate that IRP mHPC expansion defect is rescued by activation of Notch, a transcription factor implicated in mHPC self-renewal.

Moreover, the expression of Notch2 was slightly decreased on the surface of IRP mHPC relative to Ctrl. We hypothesized that IR results in long-term alterations in

Notch transcriptional regulation, and that restoration of IRP mHPC self-renewal by Notch is due to a direct correction of the decrease in Notch transcriptional regulation.

80

GSEA was used to analyze expression of genes previously identified as activated or repressed upon Notch activation [323] within Cultured Ctrl or IRP

LSK. Unexpectedly, the expression of Notch-activated genes was unchanged in

Cultured IRP LSK (Figure 4.3A). In contrast, the expression of genes repressed by Notch, including CEBPA, was significantly elevated in Cultured IRP LSK relative to Cultured Ctrl LSK (Figure 4.3B).

These results suggest that restoration of IRP mHPC self-renewal in vitro is not through restoration of an IR-induced defect in Notch transcriptional activation.

Rather, IR may result in defects within Notch transcriptional repression that can be directly restored by DL1 activation of Notch in vitro. However, the transcriptional repression of downstream targets by Notch is generally attributed to Notch-mediated transcriptional activation of transcriptional repressors, most notably Hes1 [119, 124]. The expression of Hes1 and additional transcriptional repressors positively regulated by Notch were unchanged in Cultured IRP LSK relative to Cultured Ctrl LSK. An alternative explanation resides within the complexities of transcriptional regulation, whereby multiple transcription factors can independently or coordinately direct transcriptional activation or repression of target genes.

Finally, it is important to note that Ctrl LSK cultured with DL1 exhibited increased expression of genes activated by Notch and decreased expression of genes repressed by Notch (Figure 4.3C,D), indicating that DL1 stimulation of

Notch in vitro directionally modulates these target genes appropriately.

81

Figure 4.3. Notch-repressed genes are enriched in cultured IRP LSK. A-B) Expression of Notch-activated (A) or genes repressed by Notch activation (B) in Ctrl and IRP LSK cultured with or without DL1. C-D) GSEA for Notch-activated (C) and Notch-repressed (D) genes in Ctrl LSK cultured with DL1 (CTRL DL1) relative to Ctrl LSK cultured without DL1.

82

Monocyte Differentiation Programs are Enriched Within IRP mHPC

As my previous studies indicate that IRP LSK exhibit precocious differentiation, GSEA was used to determine whether IR alters expression of genes involved in mHPC differentiation. Both Fresh and Cultured IRP LSK were enriched for expression of monocyte-associated genes (Figure 4.4A,B) [322].

Cultured IRP LSK also possessed increased expression of genes associated with granulocytes (Figure 4.4C,D) [322].

To further elucidate the pathways involved, the gene expression profiles for key transcriptional regulators of myeloid differentiation were analyzed. Both

Fresh and Cultured IRP LSK exhibited altered expression of genes regulated by

C/EBPα (Figure 4.5A), with a subset of genes increased and a subset decreased. Additionally, IRP LSK also exhibited enrichment for genes regulated by PU.1 (Figure 4.5B,C). The increased expression of C/EBPα in cultured IRP

LSK was validated by qPCR (Figure 4.5B). However, the dramatic change in the

C/EBPα transcriptional program in IRP LSK suggests regulation of C/EBPα activity beyond that of elevated mRNA levels.

Gene signatures of E2F and Myc, both repressed by C/EBPα [183], were significantly decreased in Cultured IRP LSK (Figure 4.6A,B). Importantly, Notch activation largely counteracted these IR-dependent changes, inhibiting differentiation-associated target gene expression, and partially restoring E2F and

Myc target gene expression. Collectively, these results indicate that IRP LSK express increased myeloid and altered C/EBPα signatures in vivo and in vitro, all of which are to some extent reversible upon Notch activation.

83

Figure 4.4. IRP LSK are enriched for myeloid-associated gene expression. A) Expression of monocyte associated genes in Fresh and Cultured Ctrl and IRP LSK. B) GSEA for monocyte associated genes in Fresh (Top) and Cultured (Bottom) IRP relative to Ctrl Cultured LSK. C) Expression of granulocyte associated genes in Cultured Ctrl and IRP LSK. D) GSEA for granulocyte P associated genes in Culture IR LSK relative to Ctrl.

84

Figure 4.5. C/EBPα and PU.1 transcriptional signatures are changed in IRP LSK. A-B) Expression of C/EBPα (A) and PU.1 (B) transcriptional signatures in Fresh and Cultured Ctrl and IRP LSK. C) GSEA for PU.1 signature in Fresh (Left) and Cultured (Right) IRP LSK relative to Ctrl. D) Expression of C/EBPα mRNA in Ctrl and IRP LSK after culture for 6 days.

85

Figure 4.6. E2F and Myc signatures are reduced in IRP LSK. A-B) Gene expression of E2F (A) and Myc (B) targets in Ctrl and IRP LSK cultured with or without DL1. C-D) GSEA for E2F (C) and Myc (D) in Cultured IRP LSK relative to Ctrl.

Inhibition of C/EBPα Restores IRP LSK Self-Renewal In Vitro

To determine whether C/EBPα contributed to the IRP LSK self-renewal defect, small hairpin RNA (shRNA) were used to knock down CEBPA mRNA expression. The knock down efficiency of each shRNA was assessed in the murine myeloblast-like 32D cell line (Figure 4.7).

86

Figure 4.7. Knock down efficiency of shCEBPA #1 and #2. A) 32D cells were transduced with puromycin resistant shRNA constructs expressing a control shRNA (sh0) or one of two shRNAs against CEBPA (#1 and #2).

BM from Ctrl and IRP mice was enriched for cKit+ cells and transduced with lentivirus co-expressing GFP and an shRNA targeting C/EBPα

(shCEBPA#1) or a control shRNA (sh0). Selection for each shRNA was determined by analyzing the proportion of cells expressing GFP within the culture over time. Expression of sh0 was maintained at low levels in both Ctrl and IRP cultures whereas the frequency of shCEBPA#1+ cells continuously increased across days 4, 6, and 9 (Figure 4.8A). Within the LShiK population, sh0 was maintained at low levels on days 4, 6, and 9, indicating neutral selection for sh0

(Figure 4.8B). In contrast, shCEBPA+ LShiK cells continue to increase in frequency, particularly within IRP LShiK, demonstrating positive selection for inhibition of C/EBPα within the LShiK population.

87

Figure 4.8 C/EBPα inhibition is selected for within IRP LSK in vitro. A) Frequency of GFP+ cells within all cell populations on days 4, 6, and 9 of culture. B) Frequency of GFP+ cells within the LShiK population on days 4, 6, and 9 of culture. (n = 5)

To determine whether C/EBPα inhibition restored the expansion of IRP

LSK, cell population frequencies within the total GFPneg and GFP+ populations were analyzed on day 6. The frequency of LShiK cells in GFPneg IRP cells was significantly reduced relative to GFPneg Ctrl cells (Figure 4.9A). In addition, the frequency of LShiK cells in sh0 GFP+ IRP cells was significantly reduced relative to sh0 GFP+ Ctrl cells. These results confirm that non-transduced IRP LSK exhibit a self-renewal defect that is unaffected by expression of the control shRNA (sh0).

In contrast, the frequency of LShiK and differentiated progeny increased and

88

decreased, respectively, within the GFP+ populations of shCEBPA#1 cultures.

These results indicate that C/EBPα inhibition augments LSK expansion and inhibits precocious differentiation in vitro.

Figure 4.9. C/EBPα inhibition restores IRP LSK expansion and fitness. A) Cell population distribution in GFPneg and GFP+ populations on day 6 of culture. B) Probability of Differentiation assessed for GFP+ LSK on day 6. C) LSK fitness was assessed for GFP+ LSK on day 6.

Data collected in the above experiments were used to determine the effect of C/EBPα inhibition on the probability of differentiation and fitness of IRP LSK.

Similar to earlier studies of non-transduced LSK, the probability of differentiation

89

for sh0+ IRP LSK was significantly increased relative to sh0+ Ctrl LSK (Figure

4.9B). However, C/EBPα inhibition acted similar to Notch activation, significantly decreasing the probability of differentiation per LSK cell cycle. Congruently, inhibition of C/EBPα increased the relative fitness of IRP LSK (Figure 4.9C).

Together, these results indicate that C/EBPα inhibition is selected for within and rescues the precocious differentiation of IRP LSK in vitro.

Inhibition of C/EBPα is Selected for Within IRP mHPC In Vivo

To determine whether inhibition of C/EBPα restored long-term multilineage reconstitution potential of IRP mHPC, cKit-enriched BM from Ctrl and IRP

C57BL/6 (CD45.2+) mice was transduced with sh0 or shCEBPA#1 and transplanted into sub-lethally irradiated congenic (CD45.1+) recipient mice, and selection for or against each shRNA was assessed by within the peripheral blood and bone marrow (Figure 4.10A). Myeloid cells are rapidly turned over and their contribution at later time points is attributed to contribution by HSC [48].

Therefore, selection within the CD11b+ myeloid population can be used as a surrogate for selection within the HSC population.

The frequency of sh0+ cells was maintained at low levels in both Ctrl and

IRP total donor populations (Figure 4.10B) as well as donor CD11b+ myeloid populations (Figure 4.10C) in the peripheral blood, indicating neutral selection for sh0. In contrast, the frequency of shCEBPA#1+ cells within IRP donor populations, bot total donor and donor myeloid, progressively and significantly increased over time. The frequency of shCEBPA#1+ cells also increased over

90

time in Ctrl donor populations, both total donor and donor myeloid populations, but to a significantly lesser extent than in total IRP donor populations.

Figure 4.10 C/EBPα inhibition is selected for within IRP mHPC in vivo. A) Experimental design. CD45.2+ Ctrl or IRP LSK were cKit-enriched using MACS and then transduced with sh0 or shCEBPA#1. 4x105 cKit+ cells were transplanted into sub-lethally irradiated CD45.1+ recipient mice. Contribution to hematopoiesis was monitored by flow cytometric analysis for GFP expression in the PB and in BM populations at week 8. B-C) Frequency of GFP+ cells in total donor (B) and donor CD11b+ myeloid (C) cells over time. D) Frequency of WT donors in the BM at week 8. E-F) Frequency of GFP+ cells in donor B220+ and CD11b+ cells (E) and donor LSK cells (F).

91

Analysis of the BM at 8 weeks post transplant revealed that Ctrl donor cells expanded to a significantly greater extent than IRP donor cells, regardless of shRNA (Figure 4.10D). The frequency of GFP+ within donor B220+ lymphoid populations was low and equivalent for sh0 and shCEBPA#1 transduced Ctrl and

IRP donors (Figure 4.10E), indicating no selection for C/EBPα inhibition within

B220+ lymphoid cells. In contrast, the frequency of GFP+ within CD11b+ myeloid populations was significantly increased in shCEBPA #1 relative to sh0 transduced cells for both Ctrl and IR+ donor populations. Importantly, the frequency of GFP+ cells in the donor LSK population was significantly increased for shCEBPA #1 relative to sh0 transduced cells for both Ctrl and IRP donors

(Figure 4.10F). However, the frequency of GFP+ cells within IRP donor LSK was no different than within Ctrl donor LSK. Collectively, these results indicate that inhibition of C/EBPα is selected for within short-term IRP mHPC in vivo to a significantly greater extent than in short-term Ctrl mHPC, but may not be selected for on LT-HSC.

Notch Activation Prevents Selection for C/EBPα Inhibition Within LSK In

Vitro

Because activation of Notch reversed the enrichment for myeloid- associated gene expression within IRP LSK and restored IRP LSK expansion in vitro, we sought to determine whether activation of Notch would prevent selection for C/EBPα knockdown within LSK populations. A second, independent shRNA against C/EBPα (shCEBPA#2) with a more modest inhibition of C/EBPα expression (~44%; Figure 4.7) was used in these experiments. cKit-enriched

92

bone marrow from Ctrl or IRP mice was transduced with sh0 or shCEBPA#2. As before, the expansion or contraction of GFP+ cell frequency served as readout of selection for or against each shRNA, respectively.

A low frequency of sh0+ cells was maintained within the total cell population for both Ctrl and IRP cultures (Figure 4.11A). The frequency of shCEBPA#2+ cells was also maintained at a low frequency in total cells within

Ctrl cultures. However, shCEBPA#2+ cells progressively expanded in frequency within the total cells of IRP cultures. The frequency of shCEBPA#2+ cells was significantly elevated within Ctrl LSKhiK cells on day 6, but decreased by day 9

(Figure 4.11B). Conversely, within IRP LShiK, the frequency of shCEBPA#2+ cells was significantly elevated on day 6 and continued to increase through day 9.

Remarkably, selection for shCEBPA#2 within IRP LShiK was significantly blunted by DL1 activation of Notch. Therefore, Notch-mediated restoration of IRP LSK self-renewal prevents selection for C/EBPα inhibition.

Cell population distribution within GFPneg and GFP+ populations was conducted to determine whether the combination of C/EBPα inhibition and Notch activation resulted in a further increase in the proportion of LShiK cells as compared to Notch activation alone (Figure 4.11C). Again, GFPneg and sh0 GFP+

IRP cells contained significantly reduced fractions of LShiK cells relative to GFPneg and sh0 GFP+ Ctrl cells, respectively. Notch activation or C/EBPα inhibition alone restored the proportion of LShiK cells in IRP populations. However, Notch activation and C/EBPα combined did not result in a further enrichment in the

93

proportion of LShiK cells. These results suggest that C/EBPα inhibition and Notch activation function analogously to restore the self-renewal of IRP LSK.

Figure 4.11. Notch activation prevents selection for C/EBPα inhibition in vitro. A- B) Frequency of GFP+ cells in total cells (A) and LShiK cells (B) on days 4, 6, and 9 of culture. C) Cell population distribution in GFPneg (Left) and GFP+ (Right) populations on day 6 of culture.

94

Discussion

Our previous studies indicated a decrease in self-renewal and increase in myeloid differentiation of IRP LSK in vitro. To determine whether IRP mHPC functional changes are due to long-term, IR-induced gene expression changes,

RNA-seq was performed on Fresh Ctrl and IRP LSK. As our previous studies indicate that activation of Notch is able to restore the expansion and inhibition precocious differentiation of IRP LSK in vitro, RNA-seq was also performed on

Ctrl and IRP LSK cultured with or without DL1 activation of Notch.

Interestingly, the majority genes that were altered by prior IR exposure exhibited increased expression within IRP LSK. Moreover, Notch activation reversed the majority of IR-induced alterations. Of the 290 genes significantly down-regulated in Cultured IRP LSK, Notch activation elevated expression of

86% to levels comparable to or greater than in Ctrl. Of the 596 genes with significantly increased expression in Cultured IRP LSK, 68% were decreased by

Notch activation to levels equivalent to or lower than in Ctrl. These results suggest that the majority of the IR-mediated transcriptional changes are reversed by Notch activation.

RNA-seq analysis revealed that IRP LSK possess significantly decreased expression of HSC-associated genes and possess significant enrichment for myeloid-associated genes. Moreover, IRP LSK exhibit elevated gene signatures of C/EBPα and PU.1, transcription factor programs associated with myeloid differentiation. Increased expression of C/EBPα mRNA was confirmed in IRP LSK by RT-qPCR. These results confirm that IR results in long-term alterations to

95

gene expression within mHPC, specifically decreasing and increasing expression of genes associated with HSC and myeloid differentiation, respectively.

Due to the complexity of transcriptional regulation, RNA-seq data alone is insufficient to determine whether the IR-induced transcriptional changes result from defects in Notch transcriptional regulation, altered transcriptional regulation by other mHPC maintenance transcription factors, activation of differentiation- associated transcription factors, or a combination of these possibilities.

Additionally, these studies do not indicate how IR-alters the function of transcriptional factors, whether through altered cell signaling, epigenetic regulation, etc. Further studies will be required to identify the mechanism whereby IR persistently alters transcriptional regulation, particularly the continuous stimulation of C/EBPα and PU.1 expression.

Inhibition of C/EBPα (via shRNAs) was selected for within IRP LShiK to a significantly greater extent than within Ctrl LShiK, both in vitro and in vivo.

Although C/EBPα inhibition was selected for in Ctrl LSK in vitro, shCEBPA#1 was selected for within Ctrl LSK in vivo to a significantly lesser extent than within IRP

LSK. The discrepancy in the selection for shCEBPA#1 in vitro compared to in vivo within Ctrl LSK populations highlight potential caveats to in vitro culture system. The in vitro culture system does not completely recapitulate in vivo conditions, and is more representative of a stressed hematopoiesis context.

Differences in vivo and in vitro between the particular cytokine milieu, oxidative stress, and presence of absence of supporting niche cells, among others, likely influence selection for C/EBPα inhibition.

96

The studies analyzing selection for shRNAs against CEBPA in vivo has multiple caveats. First, the use of IR to condition the recipient mice for BMTs alters the microenvironment and thus may influence donor mHPC through bystander effects, such as increased ROS and inflammation. Analysis of Ctrl donors within the IR conditioned recipients is therefore not physiologically representative of a non-irradiated selective context. Additionally, IRP microenvironments may affect in vivo selection for shRNAs, and may explain why selection for shCEBPA occurs within Ctrl donors, albeit to a significantly lesser degree than in IRP donors. To address this concern, we will be conditioning recipient mice with Busulfan, a chemotherapeutic that has been used previously for BMT assays [324] and which our lab has determined to produce less inflammation and ROS while still allowing for significant engraftment of donor populations (data not shown).

A second complication with the in vivo shRNA selection experiments is the inability to maintain knockdown in vivo, which has limited the length of our experiments and prevented us from analyzing LT-HSC potential. To address this problem, future studies will employ an HSC-specific, tamoxifen-inducible Cre

(HSC-SCL-CRE-ERT) to conditionally knock out C/EBPα in vivo, with selection monitored by expression of YFP in Cre-induced cells (Rosa26-stop-EYFP).

Tamoxifen dosing will allow us to temporally inhibit C/EBPα months post IR exposure in a subset of mHPC, monitor selection by flow cytometric analysis of the PB, and should prevent any experimental loss in C/EBPα inhibition (outside

97

the potential for loss of the selective advantage conferred by C/EBPα inhibition at different points).

Importantly, activation of Notch completely prevents selection for shCEBPA#1 in vitro. This result suggests that restoration of IRP mHPC function

(such as with Notch activation) may prevent selection for adaptive oncogenic mutations (such as loss of function C/EBPα mutations). This is an important finding, because it implies that therapeutic restoration of mHPC function may be used as a therapeutic strategy to prevent leukemogenesis in IR-exposed individuals. As activating Notch mutations are found in many cancers, particularly in T-cell Acute Lymphoblastic Leukemia (T-ALL), focus has largely been on generation of therapeutics to inhibit Notch activity. Alternatively, our studies suggest that therapeutic activation of Notch be used as a therapeutic to prevent leukemogenesis. There is potential concern with the activation of a known oncogene, though our data would argue that selection for particular oncogenes is context specific. In the context of IR, exogenous activation of Notch would restore mHPC function and limit selection for otherwise adaptive oncogenic mutations, such as LOF C/EBPα. Unfortunately, the present lack of Notch- activating reagents makes experimentally assaying whether Notch activation in vivo would prevent selection for adaptive oncogenic mutations, such as loss of function C/EBPα mutations, unfeasible. Therefore, understanding the molecular mechanism(s) underlying IR-reduced mHPC function, and how Notch activation or C/EBPα inhibition restores IRP mHPC function, will be important to identify alternative targets for therapeutic restoration of mHPC function post IR.

98

CHAPTER V

IONIZING RADIATION CAUSES PERSISTENT OXIDATIVE STRESS IN

MULTIPOTENT HEMATOPOIETIC PROGENITOR CELLS

Introduction

Reactive oxygen species (ROS) are constantly being produced by cells under normal physiologic conditions as byproducts of the mitochondria [325], and by enzymes such as NADPH oxidases (NOX) [326-328]. Intracellular ROS are important mediators involved in cell signaling pathways, including cell growth, modulating intracellular calcium, and activating protein kinases such as Erk, p38, and Akt [329-332]. However, due to the highly reactive nature of ROS, elevated

ROS levels can lead to damage of nearly all molecules, including proteins, lipids, and DNA, if cellular antioxidant responses are unable to alleviate the oxidative stress [198, 333]. Thus, cells have evolved numerous pathways to maintain their redox state.

Ionizing Radiation Induces Oxidative Stress

Ionization defines the ability of radiation to remove an electron from atoms with which the ionizing radiation (IR) interacts. As tissues are primarily composed of water, IR largely results in the generation of ROS through H2O radiolysis [230].

The main product produced immediately following IR exposure of cells is the hydroxyl radical ("OH), which can only travel a very limited distance within the cell before it reacts with any available electron acceptor, including DNA, proteins, and lipids [231]. The majority of damage, including DNA damage, resulting from both IR directly and from IR-induced ROS occurs within milliseconds [232].

99

However, elevated levels of ROS have been shown to persist within the peripheral blood and bone marrow compartments for months post IR [233, 234].

Cellular Responses to Oxidative Stress

Due to the high capacity of ROS and free radicals to rapidly cause damage to cellular molecules, cells have evolved numerous mechanisms to deal with elevated oxidative stress. One of the key molecules involved in sensing oxidative stress is the nuclear factor erythroid related factor 2 (Nrf2). Under low

ROS conditions, Kelch-like ECH-associated protein 1 (Keap1) binds Nrf2 sequestering it in the cytoplasm and promoting ubiquitination and subsequent degradation of Nrf2 [334]. Upon oxidative stress, cysteine residues on Keap1 are oxidized and cause a conformational change in Keap1, releasing Nrf2.

Alternatively, upstream signaling molecules, such as p38, are able to phosphorylate Nrf2, promoting its release from Keap1 [247]. After Nrf2 is released from Keap1, Nrf2 translocates to the nucleus where it binds to antioxidant response elements (ARE) [335, 336] and drives transcription of downstream secondary antioxidant response enzymes, such as glutathione peroxidases (Gpx) and glutathione S-transferases (Gstm) [337, 338].

The protein kinase ataxia-telangiectasia mutated (ATM) has also been shown to serve as sensor of oxidative stress [265, 339]. During oxidative stress,

ATM promotes activation of Nrf2 via protein kinase C (PKC) δ [266].

In addition to glutathione as a major antioxidant within cells, many vitamins absorbed through the diet serve as antioxidants. Vitamin E is believed to be a major antioxidant for lipid peroxides [340]. Additionally, Vitamin A is

100

metabolized into several retinoic acid (RA) derivatives, including 9-cis RA (9cRA) and all-trans RA (ATRA) [341]. Both 9cRA and ATRA are able to quench lipid peroxidation. However, 9cRA and ATRA also induce differentiation, which has been taken advantage of and used to treat patients with acute promyelocytic leukemia (APL) [295, 342, 343].

Effect of Elevated ROS on mHPC Function

Multiple studies have examined the effects of oxidative stress on mHPC function. ATM deficient mHPC exhibit significantly reduced reconstitution capacity, due to elevated levels of endogenous ROS [272]. In addition, persistent

ROS has been implicated in the decline of mHPC function post IR, reducing LT-

HSC activity and promoting senescence [233, 234, 271]. BM from N- acetylcysteine (NAC) treated IRP mice outcompeted untreated IRP BM, but was unable to compete with non-irradiated Ctrl BM, indicating that antioxidant therapy partially restores fitness of IRP BM [233]. More specifically, continuous treatment of IRP mice with a NOX inhibitor, diphenyleneiodonium (DPI), starting 6 hours after exposure to 6.5Gy IR up until 8 weeks post IR when BM was harvested, also increased clonogenic function of IRP mHPC [234]. Thus, persistent oxidative stress may be a significant contributor to the reduced function of IRP mHPC, and inhibition of the generation of ROS or antioxidant therapy may promote restoration of IRP mHPC function. Currently, Vitamin E treatment is being explored as a potential radioprotector [344-346].

101

Results

IRP LSK Possess Increased Lipid Peroxidation

IR is known to generate large amounts of ROS during the acute IR response. To determine whether oxidative stress persists within mHPC populations, fresh Ctrl or IRP bone marrow was stained for LSK and then incubated with the commonly used broad ROS sensor 2’, 7’- dichlorodihydrofluoroscein diacetate (DCF) [347-349]. Cells were incubated with the cell permeable, non-fluorescent 2',7'-dichlorodihydrofluorescein diacetate

(H2DCFDA), which is converted to fluorescent DCF after removal of acetate groups and oxidation. Flow cytometric analysis revealed that IRP LSK exhibited similar DCF Mean Fluorescent Intensity (MFI) as compared to Ctrl LSK (Figure

5.1A), indicating that IRP LSK do not possess elevated levels of ROS as assessed by DCF.

Figure 5.1. Ctrl and IRP mHPC possess equivalent DCF-oxidation potential. A) BM of Ctrl or IRP mice were surface stained to distinguish Linneg, LK, and LSK populations, and intracellular ROS was analyzed by DCF fluorescence via flow cytometry.

Given that DCF has been shown to require iron or cytochrome c, and is actually poorly oxidized by either superoxide or hydrogen peroxide alone [350], the basal levels of ROS might be underestimated. Additionally, uncharged

102

reactive oxygen species are cell permeable, and can be difficult to measure directly. Therefore, we sought to determine whether there were increased products of oxidation in IRP LSK. Lipid peroxidation occurs when a free radical or

ROS oxidizes lipids, preferentially lipids containing carbon-carbon double bonds, resulting in a lipid peroxide product [351]. This chain reaction amplifies the oxidative stress signal and the resulting lipid peroxidation products are generally more stable, allowing for detection of potential low levels of oxidative stress.

Analysis of lipid peroxidation in Linneg, LK, and LSK populations from Ctrl and IRP

C57BL/6 mice was conducted using the Image-iT® Lipid Peroxidation Kit

(Invitrogen), which uses a cell-permeable, membrane-localizing Bodipy® 581/591 reagent that shifts fluorescent emission from red to green upon oxidation by lipid hydroperoxides (Figure 5.2A). Calculated ratios of Oxidized (Green MFI) to

Reduced (Red MFI) Bodipy® 581/591 revealed no difference in lipid peroxidation in Linneg or myeloid progenitor LK populations (Figure 5.2B). However, IRP LSK possessed significantly elevated levels of lipid peroxidation relative to Ctrl.

Figure 5.2. IRP LSK possess increased lipid peroxidation. A) Lipid peroxidation was measured in sorted Linneg, LK, and LSK cells by flow cytometric analysis of Bodipy® 581/591 fluorescence. B) Ratios of green and red fluorescent MFIs used to assess degree of oxidation. (n=2, 1 of 3 experiments)

103

Detection of increased lipid peroxidation specifically within the LSK and not within the more committed differentiated progeny suggests that oxidative stress might be continuously and actively generated within LSK. Additionally, detection of lipid peroxidation products but not of ROS directly (via DCF) suggests a potential low-level or membrane-localized oxidative stress.

IRP LSK May Possess Elevated NADPH Oxidase Activity

The persistence of oxidative stress specifically within mHPC suggests that generation of ROS or free radicals is an active process. Additionally, detection of elevated lipid peroxidation but not increased general ROS (as measured by DCF) within IRP mHPC suggests that the persistent oxidative stress is very low or membrane localized. Cells endogenously make ROS as byproducts of various cellular processes and as intentional products of enzymes such as NADPH oxidase (NOX) [326-328]. Previous studies have shown that IRP LSK contain increased expression and activity of NOX4 [234]. These studies also indicated that treatment of mice with a NOX inhibitor, DPI, restored some IRP LSK function.

Although NOX4 expression was not detected in the RNA-seq data

(Appendix A), IRP LSK possessed significantly increased p22-phox (CYBA)

Figure 5.3A), which is required for membrane localization of and ROS generation by NOX4 [352]. To determine whether NOX4 activity is responsible for the IRP

LSK self-renewal defect, Ctrl or IRP LSK were cultured for 6 days with or without

DL1, DMSO, or the pan NOX inhibitor VAS2870 [353].

104

Figure 5.3. NOX activity is not responsible for IRP LSK expansion defect. A) Expression of p22-phox (CYBA) from RNA-seq expressed as Fragments Per kilobase of transcript per million fragments mapped (FPKM). B-D) Ctrl or IRP LSK were cultured with or without DL1, DMSO, or 5uM NOX inhibitor VAS2870 (NOXi). After 6 days of culture, the total cell number (B), cell populations distribution (C), and number of LShiK cells (D) were assessed by flow cytometry. Statistics generated using One-way ANOVA (B,D) or two-way ANOVA (C, only shown for LShiK populations).

The total cell number in Ctrl and IRP cultures on day 6 was unaffected by

VAS2870 treatment, but significantly reduced in DL1 cultures (Figure 5.3B). IRP cultures contained significantly decreased frequencies and numbers of LShiK cells, which was rescued by DL1 activation of Notch (Figure 5.3C,D). Importantly,

VAS2870 treatment resulted in a slightly reduced number, but not frequency, of

105

LShiK cells in Ctrl cultures, but had no effect on the frequency or number of LShiK cells in IRP cultures.

These results indicate that NOX inhibition is unable to rescue IRP LSK expansion in vitro, and suggest that NOX inhibition itself may actually reduce the expansion of Ctrl LSK. Additional VAS2870 doses of ≥12.5uM were assessed but no cells were detected in these cultures (data not shown). However, the previously reported IC50 for VAS2870 to inhibit ROS generation by NOX in the acute promyelocytic leukemia cell line HL-60 cells was 2uM [354]. Therefore, the

5uM dose would be expected to reduce NOX function in our cells and is near the high end of what LSK can tolerate in vitro. However, further studies are required to validate that VAS2870 reduces NOX activity within LSK in vitro.

IRP LSK Possess Increased Gene Expression Signature of Nrf2, a Master

Regulator of Antioxidant Activity

Gene Set Enrichment Analysis (GSEA) was employed to determine whether antioxidant pathways were enriched within IRP mHPC. Both Fresh and

Cultured IRP LSK possessed a significant increase in the expression of genes that are regulated by the oxidative stress sensor Nrf2. Importantly, transcript expression of NFE2L2, the gene encoding Nrf2, was reduced with Notch activation (Figure 5.4A,B).

106

Figure 5.4. IRP LSK have increased Nrf2 gene expression signature. A) Gene expression of Nrf2-regulated genes within Fresh (Left) and Cultured (Right) Ctrl and IRP LSK. B) GSEA of Nrf2 signature in Fresh (Top) and Cultured (Bottom) IRP LSK relative to Ctrl. C-E) cKit+ cells were MACS purified from the BM of Ctrl and IRP C57BL/6 mice and cultured with or without DL1. After 6 days, LSK were sorted from cultured and used for RT-qPCR analysis of Gpx3 (C), Gstm2 (D), and Gstm5 (E). Stats generated using student T test. (n = 3 or 4)

107

Nrf2 regulates the expression of enzymes involved in the glutathione detoxification pathway, including glutathione peroxidase 3 (Gpx3), glutathione S- transferase 2 (GSTM2) and GSTM5. RNA-seq revealed increased expression of

Gpx3 and Gstm2 but not Gstm5 in IRP LSK. Increased expression of Gpx3

Cultured IRP LSK was confirmed by RT-qPCR (Figure 5.4C,D), while the expression of Gstm2 and Gstm5 were unaltered (Figure 5.4E). The expression of all three enzymes was significantly reduced upon Notch activation, regardless of influence by IR. These results indicate that IRP LSK possess increased expression of key enzymes of a major oxidative stress response pathway.

Nrf2 Activation is Sufficient to Reduce LSK Expansion In Vitro

To determine whether Nrf2 activation is sufficient to reduce LSK self- renewal, sorted Ctrl and IRP LSK were cultured with Tat-14, a fusion peptide of a

14-mer of the Nrf2 binding site for Keap1 with HIV Trans-activating transcriptional activator (Tat), able to penetrate into cells [355]. Tat-14 binds and sequesters endogenous Keap1, allowing endogenous Nrf2 to translocate to the nucleus and activate transcription. Treatment with 150uM of Tat-14 resulted in a significant increase in the total cell number on day 6 for IRP LSK cultures (Figure 5.5A). DL1 activation of Notch resulted in significant decrease in the total cell number of all cultures on day 6. Tat-14 treatment increased the proportion of differentiated progeny and decreased the frequency LShi K on day 6 (Figure 5.5B). Finally, Tat-

14 treatment resulted in a significant reduction in the number of Ctrl LShiK cells on day 6, but did not further reduce the number of IRP LShiK (Figure 5.5C).

108

Interestingly, activation of Notch significantly increased the proportion of LShiK cells in all cultures, regardless of treatment.

Figure 5.5. Nrf2 activation is sufficient to reduce LSK expansion in vitro. LSK were sorted from Ctrl and IRP C57BL/6 mice and cultured for 6 days with 150uM Tat-14 (Nrf2 activator) or PBS control, with or without DL1. A) Total cell number on day 6. B) Cell population distribution on day 6. Statistics shown are for LShiK population only. C) Number of LShiK cells on day 6. Statistics for A and C Unpaired Student T test, for B two-way ANOVA with multiple comparisons. (n = 5)

To verify that off-target affects were not responsible for the Nrf2-mediated reduction in LSK expansion, two additional Nrf2 activators were used. Ctrl LSK were sorted and cultured with AI-1 or 2-trifluoromethyl-2’-methoxychalone

109

(Chalcone). AI-1 covalently modifies Keap1 Cys151, resulting in a disruption in the ability of Keap1 to bind the E3 ubiquitin ligase Cullin-3 ubiquitin ligase, preventing ubiquitination and subsequent degradation of Nrf2 [356]. The mechanism whereby Chalcone, a Michael Acceptor, activates Nrf2 is relatively unknown, although it is independent of ROS generation [357]. Similar to Tat-14, low doses of AI-1 and Chalcone did not significantly affect total cell numbers on day 6 (Figure 5.6A). However, AI-1 and Chalcone significantly reduced the number of LSK cells in culture on day 6 (Figure 5.6B). Collectively, these data indicate that Nrf2 activation is sufficient to reduce LSK expansion in vitro, and that activation of Notch is generally dominant over Nrf2 activation.

Figure 5.6. Nrf2 activation reduces LSK expansion in vitro. LSK were sorted and cultured with DMSO or 10uM AI-1 or Chalcone (Chal). After 6 days, the number of total cells (A) and LSK (B) were assessed by flow cytometry using the Millipore Guava. Statistics generated using Unpaired Student T test (n = 5)

Nrf2 is Not Required for IR-Mediated Induction or Notch-Rescue of IRP LSK

Expansion Defect

To determine whether persistent activation of Nrf2 is required for the IR- induced LSK self-renewal defect in vitro, WT and Nrf2KO mice were irradiated

110

with 2.5Gy Cs-137 to generate WT IRP and Nrf2KO IRP mice, or left non- irradiated for generation of WT Ctrl and Nrf2KO Ctrl mice. Bone marrow was harvested 9 weeks after radiation exposure of IRP mice, and analyzed for mHPC populations. The total bone marrow cellularity was no different between Ctrl or

IRP WT and Nrf2 KO mice (Figure 5.7A). The number of LSK and LT-HSC were decreased 1.8-fold and 1.5-fold, respectively, in Ctrl Nrf2 KO mice relative to Ctrl

WT mice, suggesting that Nrf2 is important for normal mHPC function (Figure

5.7B). The number of LSK and LT-HSC decreased roughly 3-fold and 2-fold, respectively, in WT IRP mice relative to Ctrl, and about 3-fold and 3-fold, respectively, in Nrf2KO IRP relative to Nrf2KO Ctrl. These results suggest that

Nrf2KO LT-HSC may be more sensitive to IR. These results are consistent with previous studies indicating increased radiosensitivity of Nrf2-/- HSC [358].

Figure 5.7. Nrf2 inhibition does not rescue IR-mediated reductions in phenotypic mHPC in vivo. WT or Nrf2 KO mice were left non-irradiated (Ctrl) or irradiated with 2.5Gy Cs-137 to generate IRP mice. A) Total BM cellularity at 9 weeks post IR exposure. B) Number of LT-HSC and LSK in the BM of Ctrl or IRP WT and Nrf2 KO mice. Statistics generated using Unpaired Student T test (n = 3)

111

To assess the impact of Nrf2 deficiency on LSK self-renewal more closely,

WT Ctrl, Nrf2KO Ctrl, WT IRP, and NRF2KO IRP LSK were sorted and cultured in mHPC media with or without DL1. After 6 days in culture, the total cell number in all cultures was similar (Figure 5.8A). Ctrl Nrf2 KO cultures contained similar proportions and numbers of LShiK cells relative to Ctrl WT cultures (Figure

5.8B,C), indicating that Nrf2 deficiency does not affect LSK self-renewal in vitro.

IRP WT cultures possessed decreased proportions and numbers of LShiK cells, with a concomitant increase in differentiated progeny, relative to WT Ctrl cultures.

IRP Nrf2 KO cultures closely resembled IRP WT cultures, with a significantly decreased LShiK population and increased frequency of differentiated progeny as compared to Ctrl Nrf2 KO cultures.

Activation of Notch significantly increased the proportion and number of

LShiK in all culture conditions. These results indicate that Nrf2 is in fact not required for the IR-induced mHPC self-renewal defect. Moreover, these results indicate that Notch activation does not rescue IRP LSK self-renewal through modulating transcription of Nrf2. However, Nrf2 is not the only oxidative stress sensor in mHPC, and therefore antioxidant mediators cannot be ruled out as a participant in IR-induced mHPC self-renewal defect. Further studies will be required to determine the involvement of additional oxidative stress sensors.

112

Figure 5.8. Nrf2 inhibition does not rescue IRP LSK expansion defect. LSK from Ctrl or IRP WT and Nrf2 KO mice were sorted and cultured with or without DL1 for 6 days. A) Total cell number in culture on day 6. B) Cell population distribution on day 6. Statistics shown are for LShiK population only. C) Number of LShiK cells in culture on day 6. Statistics generated using unpaired student T Test (A,C) and two-way ANOVA with multiple comparisons (B) (n = 4)

Inhibition of ATM Restores IRP LSK Expansion In Vitro

ATM was first proposed as a sensor of oxidative stress by Rotman and

Shiloh in 1997 [359]. Indeed, ATM deficiency has been shown to result in increased oxidative stress [339, 360], and oxidative stress has been shown to directly activate ATM, which then regulates downstream antioxidant pathways

[265]. Importantly, ATM-/- mHPC exhibit reduced reconstitution potential, which

113

can be rescued in part by treatment with antioxidants [272]. Alternatively, RAG- mediated DNA damage signaling through ATM is required for proper B cell differentiation [361]. Therefore, we sought to determine whether ROS activation of ATM was responsible for the IRP LSK expansion defect in vitro. Ctrl and IRP

LSK were sorted and cultured with 5uM or 10uM of the ATM inhibitor KU55933

(ATMi) for 6 days. The total cell number was significantly reduced by treatment with ATMi for both Ctrl and IRP LSK cultures (Figure 5.9A). The frequency of

LShiK cells was significantly increased by ATMi, most significantly by 5uM ATMi, for both Ctrl and IRP cultures (Figure 5.9B). The frequency of LShiK cells within

2.5uM and 5uM ATMi Ctrl cultures was significantly increased relative to Ctrl

DMSO cultures (Figure 5.9C). Although it was trending, the number of LShiK cells in IRP DMSO cultures was not significantly decreased relative to Ctrl DMSO cultures due to a single outlier. Additionally, although not significantly different, the number of IRP LShiK cells was trending toward an increase, in a dose dependent manner, with ATMi.

Additional studies, in which a significant decrease in the expansion of IRP

LSK is evident, are required to determine whether ATMi does fully restore IRP

LSK expansion. Further studies are required to assess whether these doses of

ATMi successfully inhibited ATM in LSK.

114

Figure 5.9. ATM inhibition partially restores IRP LSK expansion in vitro. Ctrl and IRP LSK were sorted and cultured for 6 days with 5uM or 10uM ATMi or with DMSO vehicle. A-C) The total cell number (A), cell population distribution (B), and number of LShiK cells (C) were assessed on day 6 by flow cytometry. Statists: For A and C – One-way ANOVA. For B – two-way ANOVA, only statistics for LShiK population shown. (n = 3 for DMSO and 5 for ATMi).

Inhibition of PKC Restores IRP LSK Expansion In Vitro

ATM has been shown to mediate its anti-oxidant response through activation of PKCδ [266]. Of the PKC isoforms, we were able to detect transcripts of PKCβ, PKCδ, PKCε, PKCη, PKCθ, and PKCι (Figure 5.10). The mRNA expression of PKCδ, which was roughly 8-fold higher than any other isoform, was slightly elevated in IRP LSK, and Notch activation resulted in a significant decrease in mRNA expression.

115

Figure 5.10: Expression of PKC isoforms in LSK. RNA-seq of Ctrl and IRP LSK cultured with or without DL1 for 6 days identified 6 PKC isoforms expressed within LSK. Values are plotted as Fragments Per kilobase of transcript per million fragments mapped (FPKM).

To determine whether activation of PKCδ is responsible for the IRP LSK expansion defect in vitro, Ctrl and IRP LSK were sorted and cultured with DMSO vehicle or 1 of 3 PKC inhibitors, GO6850, GO6976, or AEB071. GO6850 is a

PKC inhibitor selective for the conventional, calcium (Ca2+)-dependent α and β1 isoforms, but still capable of inhibiting the novel, Ca2+-independent isoforms, δ, ε, and ζ [362]. In contrast, GO6976 is highly selective for Ca2+-dependent PKC isoforms, α and β1, and does not inhibit novel isoforms. Finally, AEB071, also

116

known as Sotrastaurin, is another pan-PKC inhibitor, with the exception of PKCζ

[363].

Treatment with GO6850 or AEB071 significantly reduced the total cell number in Ctrl, but not IRP cultures on day 6 (Figure 5.11A). Treatment with

G06976 resulted in significantly reduced, almost non-existent total cell numbers for both Ctrl and IRP LSK cultures. IRP DMSO cultures possessed reduced frequencies and number of LShiK cells, which was increased to levels no different from Ctrl DMSO cultures upon treatment with GO6850 and, to a lesser extent, with AEB071 (Figure 5.11B,C). These results suggest that inhibition of one or more PKC isoforms is sufficient to partially restore IRP LSK expansion in vitro.

However, the concentrations used did reduce the total cell expansion of Ctrl cultures, and may therefore be too high.

To determine whether GO6850 restores IRP LSK expansion in vitro at concentrations that do not significantly affect total cell expansion, Ctrl and IRP

LSK were sorted and cultured for 6 days with DMSO vehicle or 0.25, 0.5, or 1uM of GO6850. Only treatment with 1uM GO6850 significantly reduced the total cell number of IRP cultures on day 6 (Figure 5.12A) and significantly increased the

hi P frequency of LS K cells within IR cultures (Figure 5.12B). The IC50 for GO6850 to inhibit PKC activity in rat brain is about 31nM and for purified PKCδ is 210nM

[362], indicating that the restoration of LSK expansion at 1uM GO6850 may be mediated by off-target effects. The significant decrease in the number of IRP

LShiK cells on day 6 was restored to levels no different from Ctrl culture by treatment with 1uM GO6850 only. Collectively, these results suggest that one or

117

more PKC isoforms may be responsible for the IRP LSK expansion defect. As

PKCδ is the predominant isoform in our LSK, and the PKCα/β-selective inhibitor

GO6976 abolished expansion of Ctrl or IRP LSK in vitro, we hypothesize that inhibition of PKCδ specifically by GO6850 and AEB701 is responsible for the restoration of IRP LSK expansion. However, all compounds used inhibit multiple

PKC isoforms, and therefore additional experiments will be required to determine which PKC isoforms specifically, and to what extent, are involved in the IRP LSK expansion defect.

Figure 5.11. PKC inhibition may restore IRP LSK expansion in vitro. Ctrl and IRP LSK were sorted and cultured with DMSO vehicle, 1uM of GO6850 (6850), GO6976 (6976), or AEB071 (AEB) for 6 days. A-C) The total cell number (A), cell population distribution (B), and number of LShiK cells was analyzed by flow cytometry.

118

Figure 5.12. PKC inhibition restores IRP LSK expansion in vitro. Ctrl and IRP LSK were sorted and cultured with DMSO vehicle, 0.25uM, 0.5uM, or 1uM of GO6850. A-C) After 6 days, the total cell number (A), cell population distribution (B), and number of LShiK cells (C) was analyzed by flow cytometry.

Vitamin E Supplementation Does Not Restore IRP LSK Self-Renewal

To determine whether more specific alleviation of membrane-associated oxidative stress can restore IRP LSK self-renewal, Ctrl and IRP LSK were treated in culture with 2mM Vitamin E, a cell membrane antioxidant thought to be the primary scavenger of lipid peroxyl radicals [364]. Previous studies have determined that the concentration of Vitamin E required to inhibit 50% of lipid peroxidation (IC50) rat retinal homogenates is 0.69mM [365]. The total cell

119

number as well as cell population distribution in culture on day 6 was unaffected by Vitamin E treatment (Figure 5.13A,B). Additionally, Vitamin E was unable to restore the expansion of IRP LSK by day 6 (Figure 5.13C). These results suggest that inhibition of membranous oxidative stress, such as lipid peroxidation, via

Vitamin E supplementation is unable to restore the self-renewal of IRP LSK in vitro. However, additional experiments are required to determine whether NOX activity is responsible for the generation of persistent oxidative stress within IRP

LSK.

Figure 5.13. Vitamin E is does not restore IRP LSK expansion in vitro. Ctrl and IRP LSK were sorted and cultured with or without 2mM Vitamin E. On day 6, the number of total cells (A), cell population distribution (B) and number of LShiK cells (C) were assessed by flow cytometry.

Antioxidants 9cRA and ATRA Restore IRP LSK Expansion In Vitro

In addition to Vitamin E, Vitamin A and it’s metabolic derivative, retinoic acid (RA), are also known to serve as anti-oxidants, particularly by quenching lipid radicals [340, 366, 367]. To determine whether Vitamin A rescues IRP LSK function, Ctrl and IRP LSK were cultured with Vitamin A metabolic derivatives, all-

120

trans RA (ATRA) or 9-cis RA (9cRA). 9cRA and ATRA treatment significantly reduced the number of total cells on day 6 for both Ctrl and IRP cultures (Figure

5.14A). Additionally, the DL1-mediated decrease in total cell number on day 6 in

Ctrl and IRP cultures was further reduced by addition of 9cRA or ATRA treatment.

The reduction in total cell expansion upon 9cRA and ATRA treatment may be due to decreased cell cycling, as it has previously been reported that RA causes cell cycle arrest [368, 369].

As we have previously shown, Notch activation significantly increased and decreased the proportion of LShiK cells and differentiated progeny, respectively, in both Ctrl and IRP cultures (Figure 5.14B). Neither 9cRA or ATRA significantly altered the proportion of LShiK cells or differentiated progeny in either Ctrl or IRP cultures, although there was a trend toward increasing the LShiK population.

However, the frequency of LShiK cells in DL1 cultures was significantly reduced with addition of 9cRA and ATRA.

IRP cultures contained significantly fewer LShiK cells than Ctrl cultures, which was again rescued by activation of Notch (Figure 5.14C). The decreased expansion of IRP LShiK cells was rescued by 9cRA, but not ATRA. Although the majority of the cultures were LShiK cells, addition of 9cRA or ATRA to DL1 significantly reduced the total number of LShiK on day 6. Collectively, these results indicate that alone, 9cRA or ATRA, increase the frequency of LShiK cells in culture but reduces the total cell expansion, whereas 9cRA and ATRA reduce the frequency of LShiK cells and the total cell expansion in DL1 cultures, preventing the Notch-mediated rescue of IRP LSK expansion in vitro.

121

Figure 5.14. Vitamin A derivatives do not fully rescue IRP LSK expansion in vitro. Sorted Ctrl or IRP LSK were cultured for 6 days with or without DL1, 50nM 9cRA, or 100nM ATRA. The total cell number (A), cell population distribution (B), and number of LShiK cells (C) were assessed by flow cytometry on day 6.

122

Treatment with the Antioxidant ATRA In Vivo Partially Restores IRP LSK

Fitness

To determine whether ATRA is capable of restoring IRP mHPC fitness in vivo, Ctrl and IRP CD45.1+ mice were generated and 8 weeks later, placebo or

ATRA pellets were implanted subcutaneously with 10mg, 21-day slow release placebo or ATRA pellets. After 8 days, each mouse received a BMT of Ctrl

CD45.2+ cKit+ BM without concomitant myeloablation at the time of transplant

(Figure 5.15A). Due to the development of large masses surrounding the ATRA pellets, mice were euthanized 2 weeks post BMT and BM was assessed for the frequency of CD45.2+ donor cells. Low CD45.2+ donor cell engraftment would indicate high recipient cell fitness, whereas high donor cell engraftment indicates low recipient fitness.

Ctrl and IRP mice treated with either placebo or ATRA exhibited similar BM cellularity (Figure 5.15B), but ATRA treatment increased the frequency of LSK within both Ctrl and IRP mice (Figure 5.15C). IRP recipients with placebo pellets contained significantly increased frequencies of total CD45.2+ donor cells compared to Ctrl placebo recipients, which was significantly reduced upon ATRA treatment (Figure 5.15D). For placebo treated recipients, the frequency of

CD45.2+ donor cells within the LSK population was significantly increased in IRP relative to Ctrl recipients (Figure 5.15E). Again, ATRA treatment resulted in a significant decrease in the frequency of Ctrl CD45.1+ donors within IRP mice, indicating that ATRA treatment may increase the fitness of IRP mHPC.

123

Figure 5.15. ATRA treatment restores IRP BM fitness short term. A) Experimental design. Ctrl or IRP CD45.1+ mice received a subcutaneous implant of an ATRA or 10mg 20-day slow release placebo or ATRA pellet. After 8 days, mice received 4x106 cKit+ BM cells from Ctrl CD45.2+ mice. After 2 more weeks, recipient mice were euthanized and the BM compartment was analyzed for the presence of CD45.2+ donor cells as a read out of recipient fitness (Increased donor engraftment = decreased recipient fitness). The total BM cellularity (B), frequency of total LSK (C), as well as the frequency of CD45.2+ donor cells within the total BM (D) and LSK (E) populations was assessed by flow cytometry.

124

To assess the effect of ATRA treatment on IRP mHPC function long-term, we administered ATRA or DMSO vehicle by oral gavage (Figure 5.16A). Ctrl and

IRP CD45.1+ mice were treated daily (5 days on, 2 days off each week) with

0.4mg/mouse ATRA or vehicle, starting at 6 weeks post radiation of IRP mice.

After 3 weeks of treatment, mice were transplanted with Ctrl CD45.2+ cKit+ BM cells to assess mHPC fitness in vivo. Recipients were then divided into two groups, those continuing to receive ATRA or DMSO treatment post BMT, and those whereby treatment was terminated immediately following BMT.

The frequency of CD45.2+ donor cells was significantly increased in IRP recipients relative to Ctrl recipients, regardless of type or duration of treatment

(Figure 5.16B). However, continuous ATRA treatment of IRP recipients significantly decreased the frequency of total CD45.2+ donor cells relative to continuous DMSO treatment (Figure 5.16B right), suggesting that ATRA treatment increases the fitness of IRP recipient BM. As frequencies of short-lived myeloid cells can be used as a surrogate for mHPC activity [48] the frequency of

CD45.2+ donor cells within the CD11b+ myeloid compartment was used as a read out for mHPC fitness. The frequency of CD45.2+ cells within the CD11b+ PB population was elevated in IRP recipients, regardless of treatment, relative to Ctrl recipients (Figure 5.16C). Continuous ATRA treatment slightly reduced the frequency of CD45.2+donor cells within the CD11b+ population in IRP recipients, although not significantly (Figure 5.16C right), suggesting slightly increased fitness of the recipient mHPC. These results suggest that in vivo ATRA treatment may partially restore the fitness of IRP mHPC.

125

Figure 5.16. ATRA treatment reduces engraftment of Ctrl donors in IRP recipients. A) Experimental design. Ctrl or IRP CD45.1+ mice were treated 40 days after IR exposure of IRP mice with 0.4mg ATRA or DMSO. After 3 weeks, the mice received a BMT of 1.35x106 cKit+ and 3.6x106 cKitneg BM cells from Ctrl CD45.2+ mice. Recipients were then split into two groups, where ATRA or DMSO treatment was continued (Continuous), or stopped (Discontinued). B) The frequency of CD45.2+ donors within total PB for recipient mice with discontinued (right) or continuous (left) treatment. C) The frequency of CD45.2+ donors within the CD11b+ myeloid PB compartment for recipient mice with discontinued (left) or continued (right) treatments. Statistics generated by two-way ANOVA: For IRP vs. Ctrl: * = p <0.05, **** = p <0.0001; for IRP DMSO vs IRP ATRA: & = p <0.0001. (n = 4)

126

At 17 weeks post BMT, recipient mice were euthanized and the BM compartment was analyzed. ATRA treatment resulted in significantly increased

BM cellularity in Ctrl mice (Figure 5.17A). Additionally, ATRA treatment, regardless of treatment duration, did not drastically alter the frequency of total

LSK within the BM (Figure 5.17B).

The frequency of CD45.2+ donor cells within the total BM was elevated in all IRP relative to Ctrl recipients (Figure 5.17C). Additionally, the frequency of

CD45.2+ donors within the LSK populations was increased in all IRP recipients relative to Ctrl recipients (Figure 5.17D), indicating that IRP mice have reduced mHPC fitness. Interestingly, both discontinued and continued ATRA treatment had no effect on the frequency of CD45.2+ donor cells within the total BM and

LSK populations of IRP recipients. Collectively, these results indicate that ATRA treatment, though it may have a positive effect short-term, does not restore IRP mHPC fitness long-term.

Discussion

IR is known to induce many immediate changes to the microenvironment, including increased inflammation and ROS, with some changes persisting for months post exposure. It has previously been shown that IRP LSK possess persistent increased ROS, as measured by DCF, and that inhibition of NOX activity results in restoration of IRP LSK function [234].

127

Figure 5.17. ATRA treatment does not restore IRP mHPC fitness long-term. For experimental design, see Figure 5.10A. At 17 weeks post BMT, the total BM cellularity (A), frequency of LSK (B), and frequency of CD45.2+ donors in the total blood (C) and LSK (D) populations was assessed by flow cytometry. Statistics generated by One-way ANOVA. (n = 4)

128

However, in the Wang et. al study, NOX inhibition was initiated at 6 hours post IR, and therefore the partial rescue of IRP HSC function may be due to reduced damage during the acute IR response rather than a through inhibition of persistent NOX activity long after the IR exposure event. We were unable to detect persistent ROS directly by DCF, though ROS are notoriously difficult to measure directly, due to rapid reaction with cellular components as well as dissipation across cell membranes. However, we did find that IR results in persistent lipid peroxidation specifically within IRP LSK. Detection of oxidized products at the membrane but an inability to measure total ROS and suggests that persistent ROS within IRP LSK may be slightly elevated and not detectable by DCF, and/or membrane localized. Although we did not detect increases in the expression of NOX4 mRNA as described previously, RNA-seq indicated a significant increase in the expression of the NOX4 binding partner, p22-phox.

Treatment of LSK with the pan-NOX inhibitor VAS2870 did not restore IRP LSK expansion in vitro. However, further studies are required to determine whether the doses we used in fact inhibits NOX activity and to determine whether NOX activity actively generates oxidative stress within IRP LSK.

RNA-seq data analysis identified significant increases in ROS detoxification components, including members of the Glutathione antioxidant pathway, Gpx3, Gstm2, as well as a major antioxidant response transcription factor, Nrf2. Importantly, Notch activation, which we have previously shown to restore IRP LSK expansion in vitro, resulted in decreased expression of the Nrf2 transcriptional signature. The reduced expansion of LSK in vitro caused by 3

129

separate Nrf2 activators suggests that excessive Nrf2 activation may reduce LSK self-renewal. Due to an inability to acquire a TAT control peptide, we were unable to assess any effect by the TAT peptide alone. These three Nrf2-activating compounds do have off-target effects and additional studies are needed to determine whether Nrf2 alone is sufficient to reduce LSK self-renewal. However,

IRP Nrf2 knock out (KO) mice possessed similar decreases in numbers of phenotypic LT-HSC and LSK in vivo, as well as a similar decrease in LSK expansion in vitro as compared to IRP WT mice. These results indicate that Nrf2 inhibition is unable to restore IRP mHPC function. However, these last experiments contain a large caveat – the absence of Nrf2 at the time of radiation.

Recent studies have shown that Nrf2 deficiency decreases LT-HSC survival post

IR, therefore making them more radiosensitive [358]. Additionally, activation of

Nrf2 has been shown to mitigate hematopoietic injury at 24 hours following IR via activation of Notch [370]. These studies indicate the importance of Nrf2 activation in the survival of mHPC as well as in initiation of programs involved in hematopoietic recover, such as Notch, shortly following IR exposure. Nrf2 activity may be required at the time of IR to initiate the persistent Nrf2-dependent program that we hypothesize would reduce LSK fitness, and without Nrf2 present at the time of IR, an alternative mechanism may be activated to protect mHPC.

Additionally, the absence of Nrf2 within the Nrf2 KO mouse is ubiquitous, and therefore it is also possible that the absence of Nrf2 within BM niche cells may alter their influence on mHPC and influence their response to IR. To address these concerns, future experiments will use conditional Nrf2 knock out

130

(cNrf2KO) mice to detect cell-intrinsic effects. cNrf2KO mice will be crossed with mice expressing an HSC-specific, tamoxifen-inducible Cre (HSC-SCL-CRE-

ERT), which will allow for HSC-specific, temporally controlled deletion of Nrf2 after exposure to IR. These mice will then be used for in vivo competitive BMTs and in vitro expansion assays to assess the function of IRP LSK at 9 weeks post

IR exposure.

In addition to Nrf2, both ATM and PKCδ have been shown to be activated in response to oxidative stress. Furthermore, RNA-seq identified an IR-induced and Notch-reversed increase in the expression of PKCδ mRNA within. To determine whether ATM and/or PKCδ mediate the IRP LSK expansion defect, sorted LSK were cultured with various ATM and PKCδ inhibitors. Low concentrations of the ATMi provided slight improvement in the expansion of IRP

LSK. Similarly, the pan-PKC inhibitors GO6850 and AEB701, but not the PKCα/β selective inhibitor GO6976, resulted in restoration of IRP LSK expansion to levels no different from Ctrl. These studies suggest that inhibition of ATM and/or PKC activity may restore IRP LSK expansion. However, ATM deficiency has been shown to drastically reduce HSC function in vivo [272], and therefore use of ATM-

/- mice or shRNAs may be problematic. Again, HSC-specific conditional knock out of ATM is likely the best approach short of treating mice with ATM inhibitors, which are also relatively non-specific. The compounds used to inhibit PKC target many of the isoforms, and therefore we were unable to determine which PKC isoform specifically is involved in IR-mediated LSK expansion defects. However,

RNA-seq showed that PKCδ mRNA is expressed nearly 8-fold higher than any

131

other PKC isoform within our LSK. Additionally, the PKCα/β selective inhibitor completely abolished Ctrl or IRP LSK expansion. Together these results suggest that inhibition of PKCδ primarily restored IRP LSK expansion in vitro. Further experiments with shRNA knock downs and HSC-specific conditional knock out mice are needed to experimentally determine which PKC isoform is involved in

IR-mediated mHPC functional defects.

There are many antioxidants used to alleviate lipid peroxidation, including

Vitamin E and Vitamin A derivatives. Vitamin E treatment was unable to restore the expansion of IRP LSK in vitro. This is not completely surprising, as treatment of IRP mice with the antioxidant NAC did not completely rescue IRP HSC fitness.

However, treatment of IRP LSK in vitro with one Vitamin A derivative, 9cRA, resulted in a modest restoration in LSK expansion. Both 9cRA and ATRA resulted in significantly reduced total cell numbers on day 6 of LSK cultures, which is in agreement with studies showing that these compounds can inhibit cell cycle progression. Importantly, 9cRA and ATRA reduced the total cell number and frequency and number of LShiK cells within DL1 cultures. Along with their role in cell cycle inhibition, both 9cRA and ATRA are known activators of differentiation, and have been used as a therapy to acute promyelocytic leukemia

[343, 371]. Therefore, 9cRA and ATRA’s roles in cell cycle inhibition and differentiation may outweigh any advantage provided by their antioxidant capacity.

A number of differences between the culture conditions and in vivo microenvironment may disparately influence the behavior of mHPC, and thus the

132

modest increase in IRP LSK expansion provided by 9cRA was sufficient for us to pursue supplementation with Vitamin A derivatives to attempt to restore IRP mHPC function in vivo. ATRA or placebo pellets were implanted in Ctrl or IRP recipients, and the impact of treatment on mHPC fitness was assessed by the degree of donor cell engraftment at 2 weeks. Ctrl donor cells transplanted into

IRP recipients expanded significantly greater than Ctrl donor cells transplanted into Ctrl recipients. Remarkably, ATRA treatment significantly reduced the engraftment of Ctrl donor cells in IRP recipients, suggesting that ATRA treatment may restore the fitness of IRP mHPC in vivo. Alternatively, because we had to assess BM chimerism at such an early, 2 week time point post BMT, it is possible that ATRA treatment reduces engraftment of donor mHPC. However, the frequency of Ctrl CD45.1+ donor cells in Ctrl recipients treated with either placebo or ATRA pellets was not different, suggesting that ATRA is unlikely to influence donor cell engraftment.

To assess the effect of ATRA treatment on mHPC fitness long-term, Ctrl and IRP mice were treated with ATRA or DMSO vehicle by oral gavage daily for 5 days, with 2 days rest, for a total of 6 weeks, and the effect of treatment on mHPC fitness was again assessed by the degree of donor cell engraftment and expansion over time. Ctrl donor cells expanded significantly more in IRP recipient than in Ctrl recipients, regardless of treatment. The frequency of Ctrl donor cells was reduced in IRP mice receiving ATRA treatment, and was more effective when ATRA treatment was continued post BMT. However, ATRA treatment did not significantly reduce the frequency of Ctrl donors within the myeloid population

133

of IRP recipients, indicating that it does not restore the fitness of the mHPC compartment. BM analysis at 17 weeks post transplant confirmed that ATRA treatment did not significantly reduce the frequency of Ctrl donors within the LSK population of IRP recipients. Collectively, these results indicate that ATRA treatment of IRP mice may be beneficial for a short period, but does not restore mHPC function long-term.

134

CHAPTER VI

DISCUSSION AND FUTURE DIRECTIONS

Humans have been exposed to natural sources of ionizing radiation (IR) throughout our evolution. However, recent technological advances have dramatically increased the average annual exposure dose, which in the United

States has increased from 0.54mSV in 1982 to 3.0mSV in 2006 [11-14]. Medical exposures are largely responsible for the nearly 6-fold increase in exposure to man-made sources of IR, as exemplified by the current use of radiotherapy to treat roughly 60% of tumors [9, 10].

The continual increase in exposures highlights the importance of understanding how IR causes adverse health effects. Long-term follow up studies of individuals exposed to IR are becoming more available, and with them a better understanding of IR effects on human health. Reduced hematopoietic cell function and numbers have been found to persist within IR-exposed individuals up to 50 years after the initial exposure event. IR is also associated with an increased risk of cancer, primarily myeloid leukemias. Importantly, IR- associated AML has been associated with translocations and mutations that reduce C/EBPα activity. The persistence of panhematopoietic defects and an increased risk of leukemia suggest that IR-mediated effects may persist in a long-lived, multipotent hematopoietic reservoir.

Immediate biological effects of IR have been well characterized and include direct and indirect induction of DNA damage and apoptosis. More recent studies have begun to focus on the persistent effects of IR on HSC, which

135

include persistent increases in oxidative stress, increased senescence and reduced reconstitution capacity [229, 233, 234, 271]. Understanding how IR mediates these alterations in HSC function will be essential to the development of therapeutics to treat IR-exposed individuals.

Use of In Vitro mHPC Cultures to Explore IR-Mediated Effects on HSC

Our lab has shown that IRP mice have decreased HSC function [233].

Additionally, we have shown that the activated intracellular Notch mutant, ICN1, is selected for in IRP BM to a significantly greater extent than in Ctrl BM.

Selection for ICN1 within the HSC compartment was reduced upon addition of non-irradiated Ctrl competitor cells, suggesting that cell competition serves as a sort of tumor suppressor. As Notch has been implicated in regulation of HSC self-renewal, I hypothesized that IR reduces the self-renewal of HSC, which increases selective pressure for adaptive oncogenic mutations, such as ICN1, that repair or circumvent this defect.

BMT assays revealed a defect in the number and function of the earliest multipotent hematopoietic progenitor cells (mHPC) in IRP mice, both at steady- state and within the highly proliferative context of hematopoietic reconstitution.

To evaluate the exact HSC functions affected by prior IR exposure, in vitro mHPC cultures were used.

Prior IR had no effect on the total cell expansion, survival, cell cycle, or colony initiating cell number in vitro. However, IRP mHPC and LT-HSC cultures exhibited significantly reduced self-renewal and increased differentiation relative to Ctrl cultures. Co-culture of Ctrl and IRP mHPC revealed no bystander effects

136

exerted from either population onto the other, indicating that the in vitro self- renewal defect is cell-intrinsic. RNA-seq identified significant decreases in expression of HSC-associated genes and increases in expression of myeloid- associated genes, including CEBPA, in IRP mHPC.

Remarkably, activation of Notch reduced precocious differentiation and increased self-renewal, restoring the expansion of IRP mHPC in vitro.

Additionally, Notch activation reversed a majority of the IR-induced gene expression changes. Collectively, these data indicate that IR results in persistent, somatically-heritable, cell-intrinsic defects in mHPC self-renewal and differentiation. These data also suggest that activating Notch mutants, such as

ICN1, are selected for within the context of prior radiation because they repair or circumvent IR-mediated reductions in mHPC self-renewal.

The most direct mechanism whereby Notch activation might restore IRP mHPC function would be the direct fix of an IR-mediated reduction in Notch activity. I was able to identify a minor 10% decrease in the surface expression of

Notch2 on IRP mHPC. However, there was no qualitative difference in the strength of Notch transcriptional activation in Ctrl and IRP mHPC identified through RNA-seq, indicating that IR does not reduce Notch transcriptional activation. However, the expression of genes negatively regulated by Notch was enriched within IRP mHPC, suggesting a potential defect in Notch-transcriptional repression. Notch-mediated transcriptional repression is generally attributed to

Notch activation of downstream transcriptional repressors, including Hes1 and

Hey1. However, no IR-mediated change in the expression of Hes1 or Hey1 was

137

evident, suggesting that Notch-dependent transcriptional repression is not altered by prior IR exposure.

Regulation of gene transcription is a complex coordination of collaborating and antagonistic signaling pathways and transcription factors. As such, many of the genes negatively regulated by Notch signaling are positively regulated by other transcription factors. Therefore, enrichment for these genes may indicate aberrant transcriptional activation by differentiation-associated transcription factors, such as C/EBPα, rather than a direct dysregulation of

Notch-mediated transcriptional repression.

Inhibition of Precocious Differentiation Restores IRP mHPC Expansion

RNA-seq identified significant enrichment for myeloid-associated genes in both fresh and culture-expanded IRP mHPC that were reversed upon Notch activation. Included in the upregulated genes was CEBPA, which encodes a bZIP transcription factor known to regulate myelopoiesis. shRNA-mediated knock down of CEBPA mRNA levels was selected for in IRP mHPC in vitro and in vivo.

Knock down of CEBPA resulted in increased self-renewal and decreased differentiation of IRP mHPC in vitro. Finally, activation of Notch prevented selection for knock down of CEBPA in vitro. These results indicate that C/EBPα inhibition and Notch activation act in a similar manner to restore IRP mHPC function: inhibition of precocious differentiation and restoration of self-renewal.

Importantly, these results recapitulate human patient data. Humans with

IR-associated AML possess loss of function CEBPA mutations and AML1 translocations, which have been shown to inhibit C/EBPα activity [188-194].

138

Extrapolation of my data to IR-associated human AML suggests that acquisition of mutations inhibiting C/EBPα function in these patients occurs due to IR- mediated reductions in mHPC self-renewal. Importantly, my data demonstrating an abrogation of selection for CEBPA knock down in IRP mHPC by Notch activation suggests that therapeutic restoration of IRP mHPC fitness may prevent selection for adaptive oncogenic mutations.

IRP mHPC Possess Persistent Oxidative Stress

RNA-seq revealed enrichment for antioxidant pathways in IRP mHPC, which is consistent with previous reports of persistent oxidative stress following

IR exposure [233, 234]. Analysis of ROS levels using DCF revealed no difference between Ctrl and IRP mHPC. However, due to cell permeability of intermediates, and detection of ROS species only in the presence of cytochrome c or ferrous iron, DCF measurement of oxidative stress alone provides limited information regarding the intracellular redox state of cells [347, 349, 372]. Therefore, we evaluated the level of lipid peroxidation, a product of oxidative stress. IRP mHPC possessed significantly elevated levels of lipid peroxidation as compared to Ctrl mHPC. Identification of increased lipid peroxidation only within the most primitive mHPC population, and not in more differentiated progenitor or terminally differentiated cell populations, suggests a persistent intracellular source of ROS production as opposed to an environmental source. Previous reports have indicated that IRP mHPC possess elevated expression of NOX4, a known generator of ROS [234]. According to our RNA-seq data, NOX4 levels were unaltered by prior IR exposure. However, mRNA levels of p22-phox, shown to be

139

required for NOX4 membrane localization and ROS production, were elevated in

IRP mHPC and decreased with Notch activation. However, treatment of mHPC in vitro with a pan-NOX inhibitor was unable to restore IRP mHPC expansion.

An alternative explanation for the elevated lipid peroxidation would be an inability of mHPC to clear ROS-induced damage, and lipid peroxidation thus simply serving as a marker of prior oxidative stress. Although mHPC proliferate and differentiate to restore the hematopoietic compartment, their membrane dilution of lipids will likely be less than that of more differentiated progenitors and terminally differentiated progeny. Thus, lipid peroxidation may simply serve as a reminder that the mHPC were present during the conditions of high oxidative stress following IR exposure. However, enrichment for antioxidant response pathways in IRP mHPC suggests that oxidative stress does in fact persist.

IRP mHPC exhibited enrichment for the gene expression signature of Nrf2, a transcription factor and oxidative stress sensor. Activation of Nrf2 using three independent compounds significantly reduced the expansion of Ctrl mHPC in vitro. However, Nrf2KO mice exhibited similar mHPC defects in vitro as WT mice after prior IR exposure. These results suggest that Nrf2 may not be required for the IR-mediated HSC self-renewal defect. These experiments do possess numerous caveats. The Nrf2-activating compounds likely have off-target effects, which may be the actual cause of decreased mHPC expansion. Additionally, expression of Nrf2 is ubiquitously absent in Nrf2KO mice. If Nrf2 activation has a role in initiation of the mHPC defects following IR exposure, the absence of Nrf2 at the time of radiation may completely alter the mHPC response.

140

Our lab has previously shown that p53 inhibition is selected for in mHPC at the time of radiation exposure, but not if introduced at time points long after exposure [227]. This study highlights the differences in contexts of selection at early time points and late time points following IR exposure. Therefore, future experiments should employ the use of HSC-specific conditional knock out mice to allow for temporal deletion of Nrf2 at various times following exposure to IR.

Remarkably, inhibition of both ATM and PKCδ partially restored the expansion of IRP mHPC in vitro, although restoration appeared limited by the dose-dependent reduction in total cell expansion. Restoration of IRP mHPC function by ATM inhibition appears contradictory, as ATM inhibition has previously been shown to drastically reduce the self-renewal and reconstitution capacity of HSC [272]. There is likely a range of ATM activity that restores IRP mHPC function in the context of radiation, with too little or too much ATM activity negatively impacting mHPC function.

Finally, treatment with antioxidants Vitamin E, 9cRA, and ATRA were unable to restore IRP mHPC function in vitro or in vivo. These antioxidants are known to play important roles in scavenging lipid oxidation products, and thus inhibition of more broad oxidative stress may restore IRP mHPC function. In agreement with this, our lab’s previous studies demonstrate that NAC treatment of IRP mice increased the fitness of IRP mHPC relative to untreated IRP mHPC

[233]. However, BM from NAC-treated IRP mice still exhibited significantly reduced fitness relative to Ctrl BM. Therefore, although oxidative stress may

141

persist within mHPC long after IR exposure, the degree to which it is involved in mediating the IRP mHPC fitness defects is still unknown.

Mathematical Modeling: In Vitro Predictions for In Vivo Oncogenic

Selection

One major benefit of in vitro culture systems is the ability to trace cell fate decision at the single cell level. In collaboration with Andrii Rozhok, mathematical modeling was performed using experimentally acquired data in order to assess the probability of differentiation and the fitness of individual Ctrl and IRP LSK. IRP

LSK possessed an increased probability of differentiation per LSK per cell cycle.

The increased propensity for differentiation was accompanied by a decrease in the fitness of IRP LSK, defined as the generation of new LSK per LSK per hour.

This mathematical modeling will be beneficial for future studies to screen the potential for various oncogenes to restore IRP mHPC self-renewal and fitness. The ability to screen for potentially adaptive oncogenes in vitro will narrow down the list of candidate oncogenes on which to explore the effect of IR- altered selection in vivo, ultimately reducing the number of mice and cost required to perform such analyses.

Programmed Mediocrity: A Cell Intrinsic Program Limiting Contribution of

Damaged mHPC to Long-Term Hematopoiesis

Conventionally, IR-associated hematopoietic defects and oncogenesis have been attributed to the direct induction of function-impairing and oncogenic mutations, respectively, by IR-induced DNA damage [19, 373-375]. However, IR- induced DNA damage is random, and thus exerted effects should not be

142

reproducible or reversible. Using the data we have collected, we propose that IR- induced DNA damage instead induces a program reducing the self-renewal of the IR-exposed HSC as a means to maintain HSC pool fitness (Figure 6.1).

Young, healthy HSC are highly adapted to their environment and have high fitness (defined as ability to pass epigenotype/genotype on to subsequent cell generations). Constant competition between HSC for niche space and nutrients ensures that maximal HSC pool fitness is maintained.

After exposure to sporadic DNA damage, the rare damaged HSC initiate a program limiting their self-renewal and increasing their differentiation, promoting removal of the rare damaged HSC from the HSC pool while still allowing their temporary contribution to the rapidly turned over differentiated pool. Programmed mediocrity results in a restoration of pool fitness by replacement of damaged

HSC by local healthy HSC gradually, thereby preventing any unnecessary stress to the population.

While programmed mediocrity promotes maintenance of HSC fitness in the context of sporadic DNA damage, it reduces HSC pool fitness in the more modern context of system-wide DNA damage. During wide-spread genotoxic damage, such as total body IR, all HSC implement the program limiting their self- renewal and increasing their differentiation, which results in a decrease in the function of the entire HSC compartment.

143

Figure 6.1. Programmed Mediocrity.

144

Tumor Suppressing and Promoting Roles of Programmed Mediocrity

Depending on the context of the DNA damage, “Programmed Mediocrity” can be viewed as tumor suppressive or promoting. In healthy, undamaged HSC pools with high fitness, acquisition of random oncogenic mutations are unlikely to provide an individual cell with any benefit relative to neighboring competitor cells.

In fact, numerous oncogenic mutations experimentally induced in young, healthy

HSC actually decrease self-renewal or increase differentiation (as a cost of increased cell cycling), reducing the fitness of the mutant cells [286]. Therefore, in the case of sporadic DNA damage, programmed mediocrity is tumor suppressive by promoting removal of the rare damaged HSC, restoring HSC pool fitness, and thus limiting selection for adaptive oncogenic mutations.

In contrast, programmed mediocrity becomes tumor promoting in the context of system-wide injury by reducing the fitness of the entire HSC pool.

Such a decrease in mean-population fitness creates “room for improvement” and thereby increases selective pressure for acquisition of adaptive oncogenic mutations that repair or circumvent the fitness defect.

Together with previous data showing increased selection for ICN1 within

IRP HSC, my data indicates that total body IR-induced defects in HSC self- renewal/differentiation result in increased selective pressure for acquisition of adaptive oncogenic mutations, such as mutations activating Notch or inhibiting

C/EBPα, that restore self-renewal and reduce differentiation. In agreement, it has been shown that many early leukemia driver mutations typically inhibit cell differentiation [376-378]. Cells having acquired an adaptive oncogenic mutation

145

would preferentially expand, increasing the odds for acquisition of additional oncogenic mutations in the mutant cell pool, thus promoting leukemogenesis.

Moreover, IR-induced DNA damage will generate oncogenic events upon which

IR-mediated selection can act.

Programmed mediocrity likely acts in concert with other cellular programs, including senescence and apoptosis, to influence tissue maintenance and oncogenesis following cellular insults, such as IR. We and others have previously shown that reduced p53 function is selected for in HSC during the acute response to IR when apoptosis and DNA damage are prevalent. However, p53 inhibition was not selected for at time points long after the acute IR response has subsided [227, 228]. Additionally, IR-induced up-regulation of BATF has been shown to induce lymphoid differentiation and result in the exhaustion of HSC pools within hours post exposure [229]. Increased senescence in HSC months after IR exposure has also been reported [271]. It is conceivable that these processes act in series, potentially dependent on the degree of damage induced, to reduce HSC maintenance post-IR. Similar to programmed mediocrity, these programs would negatively affect HSC pool fitness following wide-spread genotoxic insults, resulting in the persistence of panhematopoietic defects, increased selective pressure for adaptive oncogenic mutations, and thereby leukemogenesis. Understanding how IR reduces HSC function and how functional defects alter selection for oncogenic mutations will be critical for the development of future therapeutics to treat IR-exposed individuals.

146

Future Directions

The work in this dissertation indicates that IR exposure results in decreased HSC self-renewal, at least in part, via persistent activation of C/EBPα.

Additionally, Notch activation restores the self-renewal and reduces the precocious differentiation of previously irradiated HSC in vitro. Future studies employing HSC-specific and temporally regulated genetic knock out of our candidate genes, including Nrf2 and C/EBPα, will be essential to assess the requirement for these proteins in the IR-mediated HSC defect in vivo. However, it is possible that complete ablation of a specific target will negatively affect IRP

HSC function whereas decreased activity of the target would be beneficial.

Additionally, though informative for elucidating the role of specific genes, studies employing genetic knock out to restore HSC fitness are not therapeutically relevant to humans. Therefore, the use of bioavailable therapeutics is more attractive. However, studies to determine whether restoration of HSC function in vivo can be achieved are currently not possible due to the absence of Notch activators or Nrf2 or C/EBPα inhibitors. Further studies into the mechanisms driving persistent activation of C/EBPα or oxidative stress will allow for the identification of potentially druggable targets, both upstream or downstream, that act to mediate the IR-induced HSC self-renewal defect. Such studies may also identify independent pathways important in mediating and/or restoring the IR- induced HSC self-renewal defects.

As mentioned above, one looming question that we have not yet addressed concerns how programmed mediocrity is being continuously

147

maintained within HSC. One hypothesis is that the persistent oxidative stress continuously activates or induces expression of activities that negatively impact mHPC self-renewal. Additionally, IR has been shown to result in persistent genomic instability, in part due to persistent oxidative stress. Persistence of either elevated ROS and/or DNA damage may result in the continuous activation of stress responses, which are thought to limit HSC function in order to prevent further damage to the cell. Due to highly destructive nature of ROS, cells have evolved numerous pathways to maintain their redox state. Thus, although one major antioxidant response transcription factor, Nrf2, was found to be unnecessary for the IRP HSC defect, there are many additional antioxidant sensors and responders that should be evaluated.

Though we did not find any significant IR-mediated changes in the expression of genes implicated in chromatin modification, we have not yet experimentally explored the possibility that IR results in decreased or increased expression of particular chromatin marks that would influence gene expression.

For example, oxidative stress-induced phosphorylation of the chromatin modifying complex member Bmi1 has been shown to regulate downstream gene expression via polycomb repressive complex 1 [379-381].

Another potential explanation is the presence of a self-perpetuating feed- forward transcriptional activation loop. For example, C/EBPα is able to activate its own transcription, and thus if left unchecked, a one-time, activation of C/EBPα in HSC may result in the continuous activation and increased expression of

C/EBPα.

148

At present, technical limitations and reagent quality have hindered complete analysis of the rare HSC population. As such, many experiments evaluating post-transcriptional protein modifications and metabolic profile analysis have been difficult with such a small cell pool size. Recent advances in mass spectrometry analysis will allow for such future studies to be performed with limited sample size. These studies will provide a wealth of information that can be used to address questions, such as those stated above, that we were to address before. Elucidation of the mechanism(s) whereby programmed mediocrity is maintained will be beneficial for identification of potentially druggable targets to restore mHPC function post total body IR exposure.

149

REFERENCES

1. Rutherford, E., Radio-activity. 2004: Dover Publications.

2. L'Annunziata, M.F., Radioactivity : introduction and history / Michael L'Annunziata. 2007, Oxford: Elsevier.

3. L'Annunziata, M.F., Handbook of Radioactivity Analysis. 2012: Elsevier Science.

4. Units, I.C.o.R. and Measurements, Linear energy transfer. 1970: International Commission on Radiation Units and Measurements.

5. Protection, I.C.o.R., Recommendations adopted September 17, 1965. 1966: Published for the International Commission on Radiological Protection by Pergamon Press.

6. Council, N.R., Health Risks from Exposure to Low Levels of Ionizing Radiation: BEIR VII Phase 2. 2006, Washington, DC: The National Academies Press. 424.

7. Schauer, D.A. and O.W. Linton, NCRP REPORT NO. 160, IONIZING RADIATION EXPOSURE OF THE POPULATION OF THE UNITED STATES, MEDICAL EXPOSURE—ARE WE DOING LESS WITH MORE, AND IS THERE A ROLE FOR HEALTH PHYSICISTS? Health Physics, 2009. 97(1): p. 1-5 10.1097/01.HP.0000356672.44380.b7.

8. United States. Environmental Protection Agency. Indoor Environmental, D., A citizen's guide to radon [electronic resource] : the guide to protecting yourself and your family from radon, ed. D. United States. Environmental Protection Agency. Indoor Environmental. 2007, Washington, D.C: U.S. Environmental Protection Agency, Indoor Environments Division.

9. Brenner, D.J. and E.J. Hall, Computed tomography--an increasing source of radiation exposure. N Engl J Med, 2007. 357(22): p. 2277-84.

10. Kim, I.A., et al., The influence of Ras pathway signaling on tumor radiosensitivity. Cancer Metastasis Rev, 2004. 23(3-4): p. 227-36.

11. Mettler, F.A., Jr., et al., Nuclear medicine exposure in the United States, 2005-2007: preliminary results. Semin Nucl Med, 2008. 38(5): p. 384-91.

12. National Council on Radiation Protection, M.N., Exposure of the U.S. Population from Diagnostic Medical Radiation: Recommendations of the National Council on Radiation Protection and Measurements, 1989: Bethesda, MD.

150

13. Reports, I.B., Nuclear Medicine, 2005, IMV Medical Information Division: Des Plains, IL.

14. Reports, I.B., 2005/06, PET, 2006, IMV Medical Information Division: Des Plains, IL.

15. Mettler, F.A., Jr., et al., Effective doses in radiology and diagnostic nuclear medicine: a catalog. Radiology, 2008. 248(1): p. 254-63.

16. Donnelly, E.H., et al., Acute radiation syndrome: assessment and management. South Med J, 2010. 103(6): p. 541-6.

17. National Council on Radiation Protection, M.N., Guidance on Radiation Received in Space Activities, 1989: Bethesda, MD.

18. Bushberg, J.T., et al., The Essential Physics of Medical Imaging. 3rd, North American Edition ed. 2011: Wolters Kluwer Health.

19. Kusunoki, Y. and T. Hayashi, Long-lasting alterations of the immune system by ionizing radiation exposure: implications for disease development among atomic bomb survivors. Int J Radiat Biol, 2008. 84(1): p. 1-14.

20. Wong, F.L., et al., Effects of radiation on the longitudinal trends of hemoglobin levels in the Japanese atomic bomb survivors. Radiat Res, 2005. 164(6): p. 820-7.

21. Godekmerdan, A., et al., Diminished cellular and humoral immunity in workers occupationally exposed to low levels of ionizing radiation. Arch Med Res, 2004. 35(4): p. 324-8.

22. Moloney, W.C., Radiogenic leukemia revisited. Blood, 1987. 70(4): p. 905- 8.

23. Weiss, H.A., et al., Leukemia mortality after X-ray treatment for ankylosing spondylitis. Radiat Res, 1995. 142(1): p. 1-11.

24. Mody, R., et al., Twenty-five-year follow-up among survivors of childhood acute lymphoblastic leukemia: a report from the Childhood Cancer Survivor Study. Blood, 2008. 111(12): p. 5515-23.

25. Bizzozero, O.J., Jr., K.G. Johnson, and A. Ciocco, Radiation-related leukemia in Hiroshima and Nagasaki, 1946-1964. I. Distribution, incidence and appearance time. N Engl J Med, 1966. 274(20): p. 1095-101.

26. Gluzman, D.F., et al., Acute leukemias in children from the city of Kiev and Kiev region after the Chernobyl NPP catastrophe. Pediatr Hematol Oncol, 1999. 16(4): p. 355-60.

151

27. Ishimaru, T., M. Otake, and M. Ischimaru, Dose-response relationship of neutrons and gamma rays to leukemia incidence among atomic bomb survivors in Hiroshima and Nagasaki by type of leukemia, 1950--1971. Radiat Res, 1979. 77(2): p. 377-94.

28. Kaldor, J.M., et al., Second malignancies following testicular cancer, ovarian cancer and Hodgkin's disease: an international collaborative study among cancer registries. Int J Cancer, 1987. 39(5): p. 571-85.

29. Thirman, M.J. and R.A. Larson, Therapy-related myeloid leukemia. Hematol Oncol Clin North Am, 1996. 10(2): p. 293-320.

30. Hromas, R., et al., A novel syndrome of radiation-associated acute myeloid leukemia involving AML1 gene translocations. Blood, 2000. 95(12): p. 4011-3.

31. Harada, H., et al., Implications of somatic mutations in the AML1 gene in radiation-associated and therapy-related myelodysplastic syndrome/acute myeloid leukemia. Blood, 2003. 101(2): p. 673-80.

32. Bryder, D., D.J. Rossi, and I.L. Weissman, Hematopoietic stem cells: the paradigmatic tissue-specific stem cell. Am J Pathol, 2006. 169(2): p. 338- 46.

33. Schofield, R., The relationship between the spleen colony-forming cell and the haemopoietic stem cell. Blood Cells, 1978. 4(1-2): p. 7-25.

34. Wilson, A. and A. Trumpp, Bone-marrow haematopoietic-stem-cell niches. Nat Rev Immunol, 2006. 6(2): p. 93-106.

35. Calvi, L.M., et al., Osteoblastic cells regulate the haematopoietic stem cell niche. Nature, 2003. 425(6960): p. 841-6.

36. Kiel, M.J., G.L. Radice, and S.J. Morrison, Lack of evidence that hematopoietic stem cells depend on N-cadherin-mediated adhesion to osteoblasts for their maintenance. Cell Stem Cell, 2007. 1(2): p. 204-17.

37. Kiel, M.J., et al., SLAM family receptors distinguish hematopoietic stem and progenitor cells and reveal endothelial niches for stem cells. Cell, 2005. 121(7): p. 1109-21.

38. Lo Celso, C., et al., Live-animal tracking of individual haematopoietic stem/progenitor cells in their niche. Nature, 2009. 457(7225): p. 92-6.

39. Nombela-Arrieta, C., et al., Quantitative imaging of haematopoietic stem and progenitor cell localization and hypoxic status in the bone marrow microenvironment. Nat Cell Biol, 2013. 15(5): p. 533-43.

152

40. Zhang, J., et al., Identification of the haematopoietic stem cell niche and control of the niche size. Nature, 2003. 425(6960): p. 836-41.

41. Sipkins, D.A., et al., In vivo imaging of specialized bone marrow endothelial microdomains for tumour engraftment. Nature, 2005. 435(7044): p. 969-73.

42. Mendez-Ferrer, S., et al., Mesenchymal and haematopoietic stem cells form a unique bone marrow niche. Nature, 2010. 466(7308): p. 829-34.

43. Morikawa, S., et al., Prospective identification, isolation, and systemic transplantation of multipotent mesenchymal stem cells in murine bone marrow. J Exp Med, 2009. 206(11): p. 2483-96.

44. Pinho, S., et al., PDGFRalpha and CD51 mark human nestin+ sphere- forming mesenchymal stem cells capable of hematopoietic progenitor cell expansion. J Exp Med, 2013. 210(7): p. 1351-67.

45. Roberts, E.W., et al., Depletion of stromal cells expressing fibroblast activation protein-alpha from skeletal muscle and bone marrow results in cachexia and anemia. J Exp Med, 2013. 210(6): p. 1137-51.

46. Sacchetti, B., et al., Self-renewing osteoprogenitors in bone marrow sinusoids can organize a hematopoietic microenvironment. Cell, 2007. 131(2): p. 324-36.

47. Tran, E., et al., Immune targeting of fibroblast activation protein triggers recognition of multipotent bone marrow stromal cells and cachexia. J Exp Med, 2013. 210(6): p. 1125-35.

48. Wright, D.E., et al., Physiological migration of hematopoietic stem and progenitor cells. Science, 2001. 294(5548): p. 1933-6.

49. Yoshihara, H., et al., Thrombopoietin/MPL signaling regulates hematopoietic stem cell quiescence and interaction with the osteoblastic niche. Cell Stem Cell, 2007. 1(6): p. 685-97.

50. Bowie, M.B., et al., Hematopoietic stem cells proliferate until after birth and show a reversible phase-specific engraftment defect. J Clin Invest, 2006. 116(10): p. 2808-16.

51. Cheshier, S.H., et al., In vivo proliferation and cell cycle kinetics of long- term self-renewing hematopoietic stem cells. Proc Natl Acad Sci U S A, 1999. 96(6): p. 3120-5.

52. Kiel, M.J., et al., Haematopoietic stem cells do not asymmetrically segregate chromosomes or retain BrdU. Nature, 2007. 449(7159): p. 238- 42.

153

53. Nguyen, T., P.J. Sherratt, and C.B. Pickett, Regulatory mechanisms controlling gene expression mediated by the antioxidant response element. Annu Rev Pharmacol Toxicol, 2003. 43: p. 233-60.

54. Wilson, A., et al., Hematopoietic stem cells reversibly switch from dormancy to self-renewal during homeostasis and repair. Cell, 2008. 135(6): p. 1118-29.

55. Catlin, S.N., et al., The replication rate of human hematopoietic stem cells in vivo. Blood, 2011. 117(17): p. 4460-6.

56. Arai, F., et al., Tie2/angiopoietin-1 signaling regulates hematopoietic stem cell quiescence in the bone marrow niche. Cell, 2004. 118(2): p. 149-61.

57. Batard, P., et al., TGF-(beta)1 maintains hematopoietic immaturity by a reversible negative control of cell cycle and induces CD34 antigen up- modulation. J Cell Sci, 2000. 113 ( Pt 3): p. 383-90.

58. Fortunel, N., et al., High proliferative potential-quiescent cells: a working model to study primitive quiescent hematopoietic cells. J Cell Sci, 1998. 111 ( Pt 13): p. 1867-75.

59. Garbe, A., et al., Transforming growth factor-beta 1 delays formation of granulocyte-macrophage colony-forming cells, but spares more primitive progenitors during ex vivo expansion of CD34+ haemopoietic progenitor cells. Br J Haematol, 1997. 99(4): p. 951-8.

60. Hatzfeld, J., et al., Release of early human hematopoietic progenitors from quiescence by antisense transforming growth factor beta 1 or Rb oligonucleotides. J Exp Med, 1991. 174(4): p. 925-9.

61. Puri, M.C. and A. Bernstein, Requirement for the TIE family of receptor tyrosine kinases in adult but not fetal hematopoiesis. Proc Natl Acad Sci U S A, 2003. 100(22): p. 12753-8.

62. Sitnicka, E., et al., Transforming growth factor beta 1 directly and reversibly inhibits the initial cell divisions of long-term repopulating hematopoietic stem cells. Blood, 1996. 88(1): p. 82-8.

63. Soma, T., J.M. Yu, and C.E. Dunbar, Maintenance of murine long-term repopulating stem cells in ex vivo culture is affected by modulation of transforming growth factor-beta but not macrophage inflammatory protein- 1 alpha activities. Blood, 1996. 87(11): p. 4561-7.

64. Nocka, K., et al., Expression of c-kit gene products in known cellular targets of W mutations in normal and W mutant mice--evidence for an impaired c-kit kinase in mutant mice. Genes Dev, 1989. 3(6): p. 816-26.

154

65. Reith, A.D., et al., W mutant mice with mild or severe developmental defects contain distinct point mutations in the kinase domain of the c-kit receptor. Genes Dev, 1990. 4(3): p. 390-400.

66. Zsebo, K.M., et al., Stem cell factor is encoded at the Sl locus of the mouse and is the ligand for the c-kit tyrosine kinase receptor. Cell, 1990. 63(1): p. 213-24.

67. Kimura, S., et al., Hematopoietic stem cell deficiencies in mice lacking c- Mpl, the receptor for thrombopoietin. Proc Natl Acad Sci U S A, 1998. 95(3): p. 1195-200.

68. Seita, J., et al., Lnk negatively regulates self-renewal of hematopoietic stem cells by modifying thrombopoietin-mediated signal transduction. Proc Natl Acad Sci U S A, 2007. 104(7): p. 2349-54.

69. Solar, G.P., et al., Role of c-mpl in early hematopoiesis. Blood, 1998. 92(1): p. 4-10.

70. Kirstetter, P., et al., Activation of the canonical Wnt pathway leads to loss of hematopoietic stem cell repopulation and multilineage differentiation block. Nat Immunol, 2006. 7(10): p. 1048-56.

71. Reya, T., et al., A role for Wnt signalling in self-renewal of haematopoietic stem cells. Nature, 2003. 423(6938): p. 409-14.

72. Scheller, M., et al., Hematopoietic stem cell and multilineage defects generated by constitutive beta-catenin activation. Nat Immunol, 2006. 7(10): p. 1037-47.

73. Willert, K., et al., Wnt proteins are lipid-modified and can act as stem cell growth factors. Nature, 2003. 423(6938): p. 448-52.

74. Bedard, K. and K.H. Krause, The NOX family of ROS-generating NADPH oxidases: physiology and pathophysiology. Physiol Rev, 2007. 87(1): p. 245-313.

75. Ikebuchi, K., et al., Interleukin 6 enhancement of interleukin 3-dependent proliferation of multipotential hemopoietic progenitors. Proc Natl Acad Sci U S A, 1987. 84(24): p. 9035-9.

76. Ishibashi, T., et al., Interleukin-6 is a potent thrombopoietic factor in vivo in mice. Blood, 1989. 74(4): p. 1241-4.

77. Ishibashi, T., et al., Human interleukin 6 is a direct promoter of maturation of megakaryocytes in vitro. Proc Natl Acad Sci U S A, 1989. 86(15): p. 5953-7.

155

78. Okada, S., et al., Synergistic effect of IL-3 and IL-6 on highly enriched murine hemopoietic progenitors. Exp Hematol, 1992. 20(5): p. 546-51.

79. Patchen, M.L., et al., Administration of interleukin-6 stimulates multilineage hematopoiesis and accelerates recovery from radiation- induced hematopoietic depression. Blood, 1991. 77(3): p. 472-80.

80. Pojda, Z. and A. Tsuboi, In vivo effects of human recombinant interleukin 6 on hemopoietic stem and progenitor cells and circulating blood cells in normal mice. Exp Hematol, 1990. 18(9): p. 1034-7.

81. Yonemura, Y., et al., Synergistic effects of interleukin 3 and interleukin 11 on murine megakaryopoiesis in serum-free culture. Exp Hematol, 1992. 20(8): p. 1011-6.

82. Audet, J., et al., Common and distinct features of cytokine effects on hematopoietic stem and progenitor cells revealed by dose-response surface analysis. Biotechnol Bioeng, 2002. 80(4): p. 393-404.

83. Ogawa, M., Differentiation and proliferation of hematopoietic stem cells. Blood, 1993. 81(11): p. 2844-53.

84. Challen, G.A., et al., Mouse hematopoietic stem cell identification and analysis. Cytometry A, 2009. 75(1): p. 14-24.

85. Ema, H., et al., Adult mouse hematopoietic stem cells: purification and single-cell assays. Nat Protoc, 2006. 1(6): p. 2979-87.

86. Liu, L., et al., Homing and long-term engraftment of long- and short-term renewal hematopoietic stem cells. PLoS One, 2012. 7(2): p. e31300.

87. Christensen, J.L. and I.L. Weissman, Flk-2 is a marker in hematopoietic stem cell differentiation: a simple method to isolate long-term stem cells. Proc Natl Acad Sci U S A, 2001. 98(25): p. 14541-6.

88. Morrison, S.J. and I.L. Weissman, The long-term repopulating subset of hematopoietic stem cells is deterministic and isolatable by phenotype. Immunity, 1994. 1(8): p. 661-73.

89. Yamamoto, R., et al., Clonal analysis unveils self-renewing lineage- restricted progenitors generated directly from hematopoietic stem cells. Cell, 2013. 154(5): p. 1112-26.

90. Dexter, J.S., The Analysis of a Case of Continuous Variation in Drosophila by a Study of Its Linkage Relations. The American Naturalist, 1914. 48(576): p. 712-758.

156

91. Kidd, S., M.R. Kelley, and M.W. Young, Sequence of the notch locus of Drosophila melanogaster: relationship of the encoded protein to mammalian clotting and growth factors. Mol Cell Biol, 1986. 6(9): p. 3094- 108.

92. Morgan, T.H., The Theory of the Gene. The American Naturalist, 1917. 51(609): p. 513-544.

93. Wharton, K.A., et al., Nucleotide sequence from the neurogenic locus notch implies a gene product that shares homology with proteins containing EGF-like repeats. Cell, 1985. 43(3 Pt 2): p. 567-81.

94. Walker, L., et al., The notch receptor and its ligands are selectively expressed during hematopoietic development in the mouse. Stem Cells, 2001. 19(6): p. 543-52.

95. Lawrence, N., et al., Structural requirements for notch signalling with delta and serrate during the development and patterning of the wing disc of Drosophila. Development, 2000. 127(14): p. 3185-95.

96. Rebay, I., et al., Specific EGF repeats of Notch mediate interactions with Delta and Serrate: implications for Notch as a multifunctional receptor. Cell, 1991. 67(4): p. 687-99.

97. Greenwald, I., Structure/function studies of lin-12/Notch proteins. Curr Opin Genet Dev, 1994. 4(4): p. 556-62.

98. Greenwald, I. and G. Seydoux, Analysis of gain-of-function mutations of the lin-12 gene of Caenorhabditis elegans. Nature, 1990. 346(6280): p. 197-9.

99. Rand, M.D., et al., Calcium depletion dissociates and activates heterodimeric notch receptors. Mol Cell Biol, 2000. 20(5): p. 1825-35.

100. Yochem, J., K. Weston, and I. Greenwald, The Caenorhabditis elegans lin-12 gene encodes a transmembrane protein with overall similarity to Drosophila Notch. Nature, 1988. 335(6190): p. 547-50.

101. Sanchez-Irizarry, C., et al., Notch subunit heterodimerization and prevention of ligand-independent proteolytic activation depend, respectively, on a novel domain and the LNR repeats. Mol Cell Biol, 2004. 24(21): p. 9265-73.

102. Aster, J.C., et al., Oncogenic forms of NOTCH1 lacking either the primary binding site for RBP-Jkappa or nuclear localization sequences retain the ability to associate with RBP-Jkappa and activate transcription. J Biol Chem, 1997. 272(17): p. 11336-43.

157

103. Diederich, R.J., et al., Cytosolic interaction between deltex and Notch ankyrin repeats implicates deltex in the Notch signaling pathway. Development, 1994. 120(3): p. 473-81.

104. Hsieh, J.J., et al., Epstein-Barr virus immortalization: Notch2 interacts with CBF1 and blocks differentiation. J Virol, 1997. 71(3): p. 1938-45.

105. Roehl, H., et al., Roles of the RAM and ANK domains in signaling by the C. elegans GLP-1 receptor. EMBO J, 1996. 15(24): p. 7002-12.

106. Tamura, K., et al., Physical interaction between a novel domain of the receptor Notch and the transcription factor RBP-J kappa/Su(H). Curr Biol, 1995. 5(12): p. 1416-23.

107. Dumont, E., et al., Neoplastic transformation by Notch is independent of transcriptional activation by RBP-J signalling. Oncogene, 2000. 19(4): p. 556-61.

108. Fryer, C.J., J.B. White, and K.A. Jones, Mastermind recruits CycC:CDK8 to phosphorylate the Notch ICD and coordinate activation with turnover. Mol Cell, 2004. 16(4): p. 509-20.

109. Gupta-Rossi, N., et al., Functional interaction between SEL-10, an F-box protein, and the nuclear form of activated Notch1 receptor. J Biol Chem, 2001. 276(37): p. 34371-8.

110. Oberg, C., et al., The Notch intracellular domain is ubiquitinated and negatively regulated by the mammalian Sel-10 homolog. J Biol Chem, 2001. 276(38): p. 35847-53.

111. Wu, G., et al., SEL-10 is an inhibitor of notch signaling that targets notch for ubiquitin-mediated protein degradation. Mol Cell Biol, 2001. 21(21): p. 7403-15.

112. Brou, C., et al., A novel proteolytic cleavage involved in Notch signaling: the role of the disintegrin-metalloprotease TACE. Mol Cell, 2000. 5(2): p. 207-16.

113. Hartmann, D., et al., The disintegrin/metalloprotease ADAM 10 is essential for Notch signalling but not for alpha-secretase activity in fibroblasts. Hum Mol Genet, 2002. 11(21): p. 2615-24.

114. Mumm, J.S., et al., A ligand-induced extracellular cleavage regulates gamma-secretase-like proteolytic activation of Notch1. Mol Cell, 2000. 5(2): p. 197-206.

158

115. Schroeter, E.H., J.A. Kisslinger, and R. Kopan, Notch-1 signalling requires ligand-induced proteolytic release of intracellular domain. Nature, 1998. 393(6683): p. 382-6.

116. Wolfe, M.S., Presenilin and gamma-secretase: structure meets function. J Neurochem, 2001. 76(6): p. 1615-20.

117. Wolfe, M.S., et al., Two transmembrane aspartates in presenilin-1 required for presenilin endoproteolysis and gamma-secretase activity. Nature, 1999. 398(6727): p. 513-7.

118. Allman, D., et al., An invitation to T and more: notch signaling in lymphopoiesis. Cell, 2002. 109 Suppl: p. S1-11.

119. Jarriault, S., et al., Signalling downstream of activated mammalian Notch. Nature, 1995. 377(6547): p. 355-8.

120. Kidd, S., T. Lieber, and M.W. Young, Ligand-induced cleavage and regulation of nuclear entry of Notch in Drosophila melanogaster embryos. Genes Dev, 1998. 12(23): p. 3728-40.

121. Kopan, R., et al., Signal transduction by activated mNotch: importance of proteolytic processing and its regulation by the extracellular domain. Proc Natl Acad Sci U S A, 1996. 93(4): p. 1683-8.

122. Nam, Y., et al., Structural requirements for assembly of the CSL.intracellular Notch1.Mastermind-like 1 transcriptional activation complex. J Biol Chem, 2003. 278(23): p. 21232-9.

123. Wu, L., et al., MAML1, a human homologue of Drosophila mastermind, is a transcriptional co-activator for NOTCH receptors. Nat Genet, 2000. 26(4): p. 484-9.

124. Kopan, R. and M.X. Ilagan, The canonical Notch signaling pathway: unfolding the activation mechanism. Cell, 2009. 137(2): p. 216-33.

125. Berechid, B.E., et al., Identification and characterization of presenilin- independent Notch signaling. J Biol Chem, 2002. 277(10): p. 8154-65.

126. Demehri, S., et al., Notch-deficient skin induces a lethal systemic B- lymphoproliferative disorder by secreting TSLP, a sentinel for epidermal integrity. PLoS Biol, 2008. 6(5): p. e123.

127. Gentle, M.E., et al., Noncanonical Notch signaling modulates cytokine responses of dendritic cells to inflammatory stimuli. J Immunol, 2012. 189(3): p. 1274-84.

159

128. Perumalsamy, L.R., et al., A hierarchical cascade activated by non- canonical Notch signaling and the mTOR-Rictor complex regulates neglect-induced death in mammalian cells. Cell Death Differ, 2009. 16(6): p. 879-89.

129. Ramain, P., et al., Novel Notch alleles reveal a Deltex-dependent pathway repressing neural fate. Curr Biol, 2001. 11(22): p. 1729-38.

130. Acosta, H., et al., Notch destabilises maternal beta-catenin and restricts dorsal-anterior development in Xenopus. Development, 2011. 138(12): p. 2567-79.

131. Hayward, P., et al., Notch modulates Wnt signalling by associating with Armadillo/beta-catenin and regulating its transcriptional activity. Development, 2005. 132(8): p. 1819-30.

132. Kwon, C., et al., Notch post-translationally regulates beta-catenin protein in stem and progenitor cells. Nat Cell Biol, 2011. 13(10): p. 1244-51.

133. Sanders, P.G., et al., Ligand-independent traffic of Notch buffers activated Armadillo in Drosophila. PLoS Biol, 2009. 7(8): p. e1000169.

134. Andersen, P., et al., Non-canonical Notch signaling: emerging role and mechanism. Trends Cell Biol, 2012. 22(5): p. 257-65.

135. Alexson, T.O., et al., Notch signaling is required to maintain all neural stem cell populations--irrespective of spatial or temporal niche. Dev Neurosci, 2006. 28(1-2): p. 34-48.

136. Hitoshi, S., et al., Notch pathway molecules are essential for the maintenance, but not the generation, of mammalian neural stem cells. Genes Dev, 2002. 16(7): p. 846-58.

137. Bjornson, C.R., et al., Notch signaling is necessary to maintain quiescence in adult muscle stem cells. Stem Cells, 2012. 30(2): p. 232-42.

138. Fukada, S., et al., Hesr1 and Hesr3 are essential to generate undifferentiated quiescent satellite cells and to maintain satellite cell numbers. Development, 2011. 138(21): p. 4609-19.

139. Mourikis, P., et al., A critical requirement for notch signaling in maintenance of the quiescent skeletal muscle stem cell state. Stem Cells, 2012. 30(2): p. 243-52.

140. Wen, Y., et al., Constitutive Notch activation upregulates Pax7 and promotes the self-renewal of skeletal muscle satellite cells. Mol Cell Biol, 2012. 32(12): p. 2300-11.

160

141. Maillard, I., et al., Canonical notch signaling is dispensable for the maintenance of adult hematopoietic stem cells. Cell Stem Cell, 2008. 2(4): p. 356-66.

142. Mancini, S.J., et al., Jagged1-dependent Notch signaling is dispensable for hematopoietic stem cell self-renewal and differentiation. Blood, 2005. 105(6): p. 2340-2.

143. Burns, C.E., et al., Hematopoietic stem cell fate is established by the Notch-Runx pathway. Genes Dev, 2005. 19(19): p. 2331-42.

144. Carlesso, N., et al., Notch1-induced delay of human hematopoietic progenitor cell differentiation is associated with altered cell cycle kinetics. Blood, 1999. 93(3): p. 838-48.

145. Duncan, A.W., et al., Integration of Notch and Wnt signaling in hematopoietic stem cell maintenance. Nat Immunol, 2005. 6(3): p. 314-22.

146. Karanu, F.N., et al., The notch ligand jagged-1 represents a novel growth factor of human hematopoietic stem cells. J Exp Med, 2000. 192(9): p. 1365-72.

147. Varnum-Finney, B., C. Brashem-Stein, and I.D. Bernstein, Combined effects of Notch signaling and cytokines induce a multiple log increase in precursors with lymphoid and myeloid reconstituting ability. Blood, 2003. 101(5): p. 1784-9.

148. Varnum-Finney, B., et al., Notch2 governs the rate of generation of mouse long- and short-term repopulating stem cells. J Clin Invest, 2011. 121(3): p. 1207-16.

149. Ellisen, L.W., et al., TAN-1, the human homolog of the Drosophila notch gene, is broken by chromosomal translocations in T lymphoblastic neoplasms. Cell, 1991. 66(4): p. 649-61.

150. Weng, A.P., et al., Activating mutations of NOTCH1 in human T cell acute lymphoblastic leukemia. Science, 2004. 306(5694): p. 269-71.

151. Malecki, M.J., et al., Leukemia-associated mutations within the NOTCH1 heterodimerization domain fall into at least two distinct mechanistic classes. Mol Cell Biol, 2006. 26(12): p. 4642-51.

152. Thompson, B.J., et al., Control of hematopoietic stem cell quiescence by the E3 ubiquitin ligase Fbw7. J Exp Med, 2008. 205(6): p. 1395-408.

153. Landschulz, W.H., P.F. Johnson, and S.L. McKnight, The DNA binding domain of the rat liver nuclear protein C/EBP is bipartite. Science, 1989. 243(4899): p. 1681-8.

161

154. Agre, P., P.F. Johnson, and S.L. McKnight, Cognate DNA binding specificity retained after leucine zipper exchange between GCN4 and C/EBP. Science, 1989. 246(4932): p. 922-6.

155. Chida, K. and P.K. Vogt, Nuclear translocation of viral Jun but not of cellular Jun is cell cycle dependent. Proc Natl Acad Sci U S A, 1992. 89(10): p. 4290-4.

156. Kouzarides, T. and E. Ziff, Leucine zippers of fos, jun and GCN4 dictate dimerization specificity and thereby control DNA binding. Nature, 1989. 340(6234): p. 568-71.

157. Mikaelian, I., et al., The DNA-binding domain of two bZIP transcription factors, the Epstein-Barr virus switch gene product EB1 and Jun, is a bipartite nuclear targeting sequence. J Virol, 1993. 67(2): p. 734-42.

158. O'Shea, E.K., R. Rutkowski, and P.S. Kim, Evidence that the leucine zipper is a coiled coil. Science, 1989. 243(4890): p. 538-42.

159. Descombes, P. and U. Schibler, A liver-enriched transcriptional activator protein, LAP, and a transcriptional inhibitory protein, LIP, are translated from the same mRNA. Cell, 1991. 67(3): p. 569-79.

160. Lin, F.T., et al., A 30-kDa alternative translation product of the CCAAT/enhancer binding protein alpha message: transcriptional activator lacking antimitotic activity. Proc Natl Acad Sci U S A, 1993. 90(20): p. 9606-10.

161. Ossipow, V., P. Descombes, and U. Schibler, CCAAT/enhancer-binding protein mRNA is translated into multiple proteins with different transcription activation potentials. Proc Natl Acad Sci U S A, 1993. 90(17): p. 8219-23.

162. Welm, A.L., N.A. Timchenko, and G.J. Darlington, C/EBPalpha regulates generation of C/EBPbeta isoforms through activation of specific proteolytic cleavage. Mol Cell Biol, 1999. 19(3): p. 1695-704.

163. Ramji, D.P. and P. Foka, CCAAT/enhancer-binding proteins: structure, function and regulation. Biochem J, 2002. 365(Pt 3): p. 561-75.

164. Traver, D., et al., Fetal liver myelopoiesis occurs through distinct, prospectively isolatable progenitor subsets. Blood, 2001. 98(3): p. 627-35.

165. Civin, C.I., Identification and positive selection of human progenitor/stem cells for bone marrow transplantation. Prog Clin Biol Res, 1992. 377: p. 461-72; discussion 473.

162

166. Scott, L.M., et al., A novel temporal expression pattern of three C/EBP family members in differentiating myelomonocytic cells. Blood, 1992. 80(7): p. 1725-35.

167. Zhang, D.E., et al., Absence of granulocyte colony-stimulating factor signaling and neutrophil development in CCAAT enhancer binding protein alpha-deficient mice. Proc Natl Acad Sci U S A, 1997. 94(2): p. 569-74.

168. Zhang, P., et al., Enhancement of hematopoietic stem cell repopulating capacity and self-renewal in the absence of the transcription factor C/EBP alpha. Immunity, 2004. 21(6): p. 853-63.

169. Faust, N., C. Bonifer, and A.E. Sippel, Differential activity of the -2.7 kb chicken lysozyme enhancer in macrophages of different ontogenic origins is regulated by C/EBP and PU.1 transcription factors. DNA Cell Biol, 1999. 18(8): p. 631-42.

170. Gombart, A.F., et al., Regulation of neutrophil and eosinophil secondary granule gene expression by transcription factors C/EBP epsilon and PU.1. Blood, 2003. 101(8): p. 3265-73.

171. Hohaus, S., et al., PU.1 (Spi-1) and C/EBP alpha regulate expression of the granulocyte-macrophage colony-stimulating factor receptor alpha gene. Mol Cell Biol, 1995. 15(10): p. 5830-45.

172. Khanna-Gupta, A., et al., Sp1 and C/EBP are necessary to activate the lactoferrin gene promoter during myeloid differentiation. Blood, 2000. 95(12): p. 3734-41.

173. Pan, Z., C.J. Hetherington, and D.E. Zhang, CCAAT/enhancer-binding protein activates the CD14 promoter and mediates transforming growth factor beta signaling in monocyte development. J Biol Chem, 1999. 274(33): p. 23242-8.

174. Smith, L.T., et al., PU.1 (Spi-1) and C/EBP alpha regulate the granulocyte colony-stimulating factor receptor promoter in myeloid cells. Blood, 1996. 88(4): p. 1234-47.

175. Verbeek, W., et al., C/EBPepsilon directly interacts with the DNA binding domain of c-myb and cooperatively activates transcription of myeloid promoters. Blood, 1999. 93(10): p. 3327-37.

176. Wang, Q.F. and A.D. Friedman, CCAAT/enhancer-binding proteins are required for granulopoiesis independent of their induction of the granulocyte colony-stimulating factor receptor. Blood, 2002. 99(8): p. 2776-85.

163

177. Zhang, D.E., et al., CCAAT enhancer-binding protein (C/EBP) and AML1 (CBF alpha2) synergistically activate the macrophage colony-stimulating factor receptor promoter. Mol Cell Biol, 1996. 16(3): p. 1231-40.

178. Christy, R.J., et al., CCAAT/enhancer binding protein gene promoter: binding of nuclear factors during differentiation of 3T3-L1 preadipocytes. Proc Natl Acad Sci U S A, 1991. 88(6): p. 2593-7.

179. McKercher, S.R., et al., Targeted disruption of the PU.1 gene results in multiple hematopoietic abnormalities. EMBO J, 1996. 15(20): p. 5647-58.

180. Nerlov, C. and T. Graf, PU.1 induces myeloid lineage commitment in multipotent hematopoietic progenitors. Genes Dev, 1998. 12(15): p. 2403- 12.

181. Scott, E.W., et al., Requirement of transcription factor PU.1 in the development of multiple hematopoietic lineages. Science, 1994. 265(5178): p. 1573-7.

182. Johansen, L.M., et al., c-Myc is a critical target for c/EBPalpha in granulopoiesis. Mol Cell Biol, 2001. 21(11): p. 3789-806.

183. Porse, B.T., et al., E2F repression by C/EBPalpha is required for adipogenesis and granulopoiesis in vivo. Cell, 2001. 107(2): p. 247-58.

184. Slomiany, B.A., et al., C/EBPalpha inhibits cell growth via direct repression of E2F-DP-mediated transcription. Mol Cell Biol, 2000. 20(16): p. 5986-97.

185. Mahoney, C.W., et al., Phosphorylation of CCAAT-enhancer binding protein by protein kinase C attenuates site-selective DNA binding. J Biol Chem, 1992. 267(27): p. 19396-403.

186. Jack, G.D., L. Zhang, and A.D. Friedman, M-CSF elevates c-Fos and phospho-C/EBPalpha(S21) via ERK whereas G-CSF stimulates SHP2 phosphorylation in marrow progenitors to contribute to myeloid lineage specification. Blood, 2009. 114(10): p. 2172-80.

187. Koleva, R.I., et al., C/EBPalpha and DEK coordinately regulate myeloid differentiation. Blood, 2012. 119(21): p. 4878-88.

188. Helbling, D., et al., The leukemic fusion gene AML1-MDS1-EVI1 suppresses CEBPA in acute myeloid leukemia by activation of Calreticulin. Proc Natl Acad Sci U S A, 2004. 101(36): p. 13312-7.

189. Pabst, T., et al., AML1-ETO downregulates the granulocytic differentiation factor C/EBPalpha in t(8;21) myeloid leukemia. Nat Med, 2001. 7(4): p. 444-51.

164

190. Pabst, T., et al., Dominant-negative mutations of CEBPA, encoding CCAAT/enhancer binding protein-alpha (C/EBPalpha), in acute myeloid leukemia. Nat Genet, 2001. 27(3): p. 263-70.

191. Zhuang, W.Y., et al., Epigenetic silencing of Bcl-2, CEBPA and p14(ARF) by the AML1-ETO oncoprotein contributing to growth arrest and differentiation block in the U937 cell line. Oncol Rep, 2013. 30(1): p. 185- 92.

192. Gombart, A.F., et al., Mutations in the gene encoding the transcription factor CCAAT/enhancer binding protein alpha in myelodysplastic syndromes and acute myeloid leukemias. Blood, 2002. 99(4): p. 1332-40.

193. Preudhomme, C., et al., Favorable prognostic significance of CEBPA mutations in patients with de novo acute myeloid leukemia: a study from the Acute Leukemia French Association (ALFA). Blood, 2002. 100(8): p. 2717-23.

194. Snaddon, J., et al., Mutations of CEBPA in acute myeloid leukemia FAB types M1 and M2. Genes Chromosomes Cancer, 2003. 37(1): p. 72-8.

195. Kirstetter, P., et al., Modeling of C/EBPalpha mutant acute myeloid leukemia reveals a common expression signature of committed myeloid leukemia-initiating cells. Cancer Cell, 2008. 13(4): p. 299-310.

196. Rosenbauer, F., et al., Acute myeloid leukemia induced by graded reduction of a lineage-specific transcription factor, PU.1. Nat Genet, 2004. 36(6): p. 624-30.

197. Pabst, T. and B.U. Mueller, Complexity of CEBPA dysregulation in human acute myeloid leukemia. Clin Cancer Res, 2009. 15(17): p. 5303-7.

198. Teoule, R., Radiation-induced DNA damage and its repair. Int J Radiat Biol Relat Stud Phys Chem Med, 1987. 51(4): p. 573-89.

199. Teoule, R. and A.M. Duplaa, Gamma-irradiation of homodeoxyoligonucleotides 32P-labelled at one end: computer simulation of the chain length distribution of the radioactive fragments. Int J Radiat Biol Relat Stud Phys Chem Med, 1987. 51(3): p. 429-39.

200. von Sonntag, C., The chemical basis of radiation biology. 1989, London; Philadelphia, PA: Taylor & Francis.

201. Milligan, J.R., et al., DNA repair by thiols in air shows two radicals make a double-strand break. Radiat Res, 1995. 143(3): p. 273-80.

165

202. Ward, J., Nature of Lesions Formed by Ionizing Radiation, in DNA Damage and Repair, J. Nickoloff and M. Hoekstra, Editors. 1998, Humana Press. p. 65-84.

203. Hoeijmakers, J.H., Genome maintenance mechanisms for preventing cancer. Nature, 2001. 411(6835): p. 366-74.

204. Rich, T., R.L. Allen, and A.H. Wyllie, Defying death after DNA damage. Nature, 2000. 407(6805): p. 777-83.

205. Dextraze, M.E., et al., DNA interstrand cross-links induced by ionizing radiation: an unsung lesion. Mutat Res, 2010. 704(1-3): p. 101-7.

206. Balajee, A.S., et al., Induction of replication protein A in bystander cells. Radiat Res, 2004. 162(6): p. 677-86.

207. Ballarini, F., et al., Cellular communication and bystander effects: a critical review for modelling low-dose radiation action. Mutat Res, 2002. 501(1-2): p. 1-12.

208. Baskar, R., A.S. Balajee, and C.R. Geard, Effects of low and high LET radiations on bystander human lung fibroblast cell survival. Int J Radiat Biol, 2007. 83(8): p. 551-9.

209. Baskar, R., et al., Isoform-specific activation of protein kinase c in irradiated human fibroblasts and their bystander cells. Int J Biochem Cell Biol, 2008. 40(1): p. 125-34.

210. Hall, E.J. and T.K. Hei, Genomic instability and bystander effects induced by high-LET radiation. Oncogene, 2003. 22(45): p. 7034-42.

211. Hamada, N., et al., Intercellular and intracellular signaling pathways mediating ionizing radiation-induced bystander effects. J Radiat Res, 2007. 48(2): p. 87-95.

212. Little, J.B., Genomic instability and bystander effects: a historical perspective. Oncogene, 2003. 22(45): p. 6978-87.

213. Little, M.P., Radiation: a dose of the bomb. Nature, 2003. 424(6948): p. 495-6.

214. Mothersill, C. and C. Seymour, Radiation-induced bystander effects: past history and future directions. Radiat Res, 2001. 155(6): p. 759-67.

215. Azzam, E.I., et al., High and low fluences of alpha-particles induce a G1 checkpoint in human diploid fibroblasts. Cancer Res, 2000. 60(10): p. 2623-31.

166

216. Barcellos-Hoff, M.H. and A.L. Brooks, Extracellular signaling through the microenvironment: a hypothesis relating carcinogenesis, bystander effects, and genomic instability. Radiat Res, 2001. 156(5 Pt 2): p. 618-27.

217. Harada, K., et al., Heavy-ion-induced bystander killing of human lung cancer cells: role of gap junctional intercellular communication. Cancer Sci, 2009. 100(4): p. 684-8.

218. Mothersill, C. and C.B. Seymour, Cell-cell contact during gamma irradiation is not required to induce a bystander effect in normal human keratinocytes: evidence for release during irradiation of a signal controlling survival into the medium. Radiat Res, 1998. 149(3): p. 256-62.

219. Koturbash, I., et al., Irradiation induces DNA damage and modulates epigenetic effectors in distant bystander tissue in vivo. Oncogene, 2006. 25(31): p. 4267-75.

220. Hamasaki, K., et al., Radiation sensitivity and genomic instability in the hematopoietic system: Frequencies of micronucleated reticulocytes in whole-body X-irradiated BALB/c and C57BL/6 mice. Cancer Sci, 2007. 98(12): p. 1840-4.

221. Watson, G.E., et al., In vivo chromosomal instability and transmissible aberrations in the progeny of haemopoietic stem cells induced by high- and low-LET radiations. Int J Radiat Biol, 2001. 77(4): p. 409-17.

222. Christophorou, M.A., et al., Temporal dissection of p53 function in vitro and in vivo. Nat Genet, 2005. 37(7): p. 718-26.

223. Christophorou, M.A., et al., The pathological response to DNA damage does not contribute to p53-mediated tumour suppression. Nature, 2006. 443(7108): p. 214-7.

224. Down, J.D., et al., Variations in radiation sensitivity and repair among different hematopoietic stem cell subsets following fractionated irradiation. Blood, 1995. 86(1): p. 122-7.

225. Ploemacher, R.E., et al., Murine haemopoietic stem cells with long-term engraftment and marrow repopulating ability are more resistant to gamma- radiation than are spleen colony forming cells. Int J Radiat Biol, 1992. 61(4): p. 489-99.

226. Mohrin, M., et al., Hematopoietic stem cell quiescence promotes error- prone DNA repair and mutagenesis. Cell Stem Cell, 2010. 7(2): p. 174-85.

227. Marusyk, A., et al., Irradiation selects for p53-deficient hematopoietic progenitors. PLoS Biol, 2010. 8(3): p. e1000324.

167

228. Bondar, T. and R. Medzhitov, p53-mediated hematopoietic stem and progenitor cell competition. Cell Stem Cell, 2010. 6(4): p. 309-22.

229. Wang, J., et al., A differentiation checkpoint limits hematopoietic stem cell self-renewal in response to DNA damage. Cell, 2012. 148(5): p. 1001-14.

230. Allen, A.O., Radiation Chemistry of Aqueous Solutions. The Journal of Physical and Colloid Chemistry, 1948. 52(3): p. 479-490.

231. Roots, R. and S. Okada, Protection of DNA molecules of cultured mammalian cells from radiation-induced single-strand scissions by various alcohols and SH compounds. Int J Radiat Biol Relat Stud Phys Chem Med, 1972. 21(4): p. 329-42.

232. EJ., H., Radiobiology for the Radiologist. 2000, Philadelphia: Lippincott Williams & Wilkins.

233. Marusyk, A., et al., Irradiation Alters Selection for Oncogenic Mutations in Hematopoietic Progenitors. Cancer Res, 2009. 69(18): p. 7262–7269.

234. Wang, Y., et al., Total body irradiation causes residual bone marrow injury by induction of persistent oxidative stress in murine hematopoietic stem cells. Free Radic Biol Med, 2010. 48(2): p. 348-56.

235. Kobayashi, M. and M. Yamamoto, Nrf2-Keap1 regulation of cellular defense mechanisms against electrophiles and reactive oxygen species. Adv Enzyme Regul, 2006. 46: p. 113-40.

236. Wasserman, W.W. and W.E. Fahl, Functional antioxidant responsive elements. Proc Natl Acad Sci U S A, 1997. 94(10): p. 5361-6.

237. Hong, F., et al., Specific patterns of electrophile adduction trigger Keap1 ubiquitination and Nrf2 activation. J Biol Chem, 2005. 280(36): p. 31768- 75.

238. Kobayashi, A., et al., Oxidative and electrophilic stresses activate Nrf2 through inhibition of ubiquitination activity of Keap1. Mol Cell Biol, 2006. 26(1): p. 221-9.

239. Cullinan, S.B., et al., The Keap1-BTB protein is an adaptor that bridges Nrf2 to a Cul3-based E3 ligase: oxidative stress sensing by a Cul3-Keap1 ligase. Mol Cell Biol, 2004. 24(19): p. 8477-86.

240. Furukawa, M. and Y. Xiong, BTB protein Keap1 targets antioxidant transcription factor Nrf2 for ubiquitination by the Cullin 3-Roc1 ligase. Mol Cell Biol, 2005. 25(1): p. 162-71.

168

241. Tong, K.I., et al., Different electrostatic potentials define ETGE and DLG motifs as hinge and latch in oxidative stress response. Mol Cell Biol, 2007. 27(21): p. 7511-21.

242. Zhang, D.D., Mechanistic studies of the Nrf2-Keap1 signaling pathway. Drug Metab Rev, 2006. 38(4): p. 769-89.

243. Zhang, D.D., et al., Keap1 is a redox-regulated substrate adaptor protein for a Cul3-dependent ubiquitin ligase complex. Mol Cell Biol, 2004. 24(24): p. 10941-53.

244. Zhang, D.D., et al., Ubiquitination of Keap1, a BTB-Kelch substrate adaptor protein for Cul3, targets Keap1 for degradation by a proteasome- independent pathway. J Biol Chem, 2005. 280(34): p. 30091-9.

245. Keum, Y.S., et al., Involvement of Nrf2 and JNK1 in the activation of antioxidant responsive element (ARE) by chemopreventive agent phenethyl isothiocyanate (PEITC). Pharm Res, 2003. 20(9): p. 1351-6.

246. Sun, Z., Z. Huang, and D.D. Zhang, Phosphorylation of Nrf2 at multiple sites by MAP kinases has a limited contribution in modulating the Nrf2- dependent antioxidant response. PLoS One, 2009. 4(8): p. e6588.

247. Yu, R., et al., Activation of mitogen-activated protein kinase pathways induces antioxidant response element-mediated gene expression via a Nrf2-dependent mechanism. J Biol Chem, 2000. 275(51): p. 39907-13.

248. Alam, J., et al., Nrf2, a Cap'n'Collar transcription factor, regulates induction of the heme oxygenase-1 gene. J Biol Chem, 1999. 274(37): p. 26071-8.

249. McMahon, M., et al., The Cap'n'Collar basic leucine zipper transcription factor Nrf2 (NF-E2 p45-related factor 2) controls both constitutive and inducible expression of intestinal detoxification and glutathione biosynthetic enzymes. Cancer Res, 2001. 61(8): p. 3299-307.

250. Moinova, H.R. and R.T. Mulcahy, Up-regulation of the human gamma- glutamylcysteine synthetase regulatory subunit gene involves binding of Nrf-2 to an electrophile responsive element. Biochem Biophys Res Commun, 1999. 261(3): p. 661-8.

251. Venugopal, R. and A.K. Jaiswal, Nrf1 and Nrf2 positively and c-Fos and Fra1 negatively regulate the human antioxidant response element- mediated expression of NAD(P)H:quinone oxidoreductase1 gene. Proc Natl Acad Sci U S A, 1996. 93(25): p. 14960-5.

169

252. Venugopal, R. and A.K. Jaiswal, Nrf2 and Nrf1 in association with Jun proteins regulate antioxidant response element-mediated expression and coordinated induction of genes encoding detoxifying enzymes. Oncogene, 1998. 17(24): p. 3145-56.

253. Lavin, M.F., Ataxia-telangiectasia: from a rare disorder to a paradigm for cell signalling and cancer. Nat Rev Mol Cell Biol, 2008. 9(10): p. 759-69.

254. Shiloh, Y., ATM and related protein kinases: safeguarding genome integrity. Nat Rev Cancer, 2003. 3(3): p. 155-68.

255. Banin, S., et al., Enhanced phosphorylation of p53 by ATM in response to DNA damage. Science, 1998. 281(5383): p. 1674-7.

256. Barlow, C., et al., Atm selectively regulates distinct p53-dependent cell- cycle checkpoint and apoptotic pathways. Nat Genet, 1997. 17(4): p. 453- 6.

257. Canman, C.E., et al., Activation of the ATM kinase by ionizing radiation and phosphorylation of p53. Science, 1998. 281(5383): p. 1677-9.

258. Matsuoka, S., M. Huang, and S.J. Elledge, Linkage of ATM to cell cycle regulation by the Chk2 protein kinase. Science, 1998. 282(5395): p. 1893- 7.

259. Matsuoka, S., et al., ATM and ATR substrate analysis reveals extensive protein networks responsive to DNA damage. Science, 2007. 316(5828): p. 1160-6.

260. Bakkenist, C.J. and M.B. Kastan, DNA damage activates ATM through intermolecular autophosphorylation and dimer dissociation. Nature, 2003. 421(6922): p. 499-506.

261. Barzilai, A., G. Rotman, and Y. Shiloh, ATM deficiency and oxidative stress: a new dimension of defective response to DNA damage. DNA Repair (Amst), 2002. 1(1): p. 3-25.

262. Dean, S.W., et al., Re: Impaired glutathione biosynthesis in cultured ataxia-telangiectasia cells. Cancer Res, 1988. 48(18): p. 5374-6.

263. Stern, N., et al., Accumulation of DNA damage and reduced levels of nicotine adenine dinucleotide in the brains of Atm-deficient mice. J Biol Chem, 2002. 277(1): p. 602-8.

264. Guo, Z., R. Deshpande, and T.T. Paull, ATM activation in the presence of oxidative stress. Cell Cycle, 2010. 9(24): p. 4805-11.

170

265. Guo, Z., et al., ATM activation by oxidative stress. Science, 2010. 330(6003): p. 517-21.

266. Li, B., et al., Distinct roles of c-Abl and Atm in oxidative stress response are mediated by protein kinase C delta. Genes Dev, 2004. 18(15): p. 1824-37.

267. Cutler, R.E., Jr., et al., Regulation of delta protein kinase C during rat ovarian differentiation. Biochim Biophys Acta, 1993. 1179(3): p. 260-70.

268. Murray, N.R., et al., Protein kinase C isotypes in human erythroleukemia (K562) cell proliferation and differentiation. Evidence that beta II protein kinase C is required for proliferation. J Biol Chem, 1993. 268(21): p. 15847-53.

269. Newton, A.C., Protein kinase C: structure, function, and regulation. J Biol Chem, 1995. 270(48): p. 28495-8.

270. Talior, I., et al., Increased glucose uptake promotes oxidative stress and PKC-delta activation in adipocytes of obese, insulin-resistant mice. Am J Physiol Endocrinol Metab, 2003. 285(2): p. E295-302.

271. Wang, Y., et al., Total body irradiation selectively induces murine hematopoietic stem cell senescence. Blood, 2006. 107(1): p. 358-66.

272. Ito, K., et al., Regulation of oxidative stress by ATM is required for self- renewal of haematopoietic stem cells. Nature, 2004. 431(7011): p. 997- 1002.

273. Lowe, S.W. and C.J. Sherr, Tumor suppression by Ink4a-Arf: progress and puzzles. Curr Opin Genet Dev, 2003. 13(1): p. 77-83.

274. Park, I.K., et al., Bmi-1 is required for maintenance of adult self-renewing haematopoietic stem cells. Nature, 2003. 423(6937): p. 302-5.

275. Serrano, M. and M.A. Blasco, Putting the stress on senescence. Curr Opin Cell Biol, 2001. 13(6): p. 748-53.

276. Sharpless, N.E. and R.A. DePinho, The INK4A/ARF locus and its two gene products. Curr Opin Genet Dev, 1999. 9(1): p. 22-30.

277. Dimri, G.P., et al., A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc Natl Acad Sci U S A, 1995. 92(20): p. 9363-7.

278. Armitage, P. and R. Doll, The age distribution of cancer and a multi-stage theory of carcinogenesis. Br J Cancer, 1954. 8(1): p. 1-12.

171

279. Armitage, P. and R. Doll, A two-stage theory of carcinogenesis in relation to the age distribution of human cancer. Br J Cancer, 1957. 11(2): p. 161- 9.

280. Kennedy, S.R., L.A. Loeb, and A.J. Herr, Somatic mutations in aging, cancer and neurodegeneration. Mech Ageing Dev, 2012. 133(4): p. 118- 26.

281. Nowell, P.C., The clonal evolution of tumor cell populations. Science, 1976. 194(4260): p. 23-8.

282. Vogelstein, B. and K.W. Kinzler, Cancer genes and the pathways they control. Nat Med, 2004. 10(8): p. 789-99.

283. Frank, S.A., Evolution in health and medicine Sackler colloquium: Somatic evolutionary genomics: mutations during development cause highly variable genetic mosaicism with risk of cancer and neurodegeneration. Proc Natl Acad Sci U S A, 2010. 107 Suppl 1: p. 1725-30.

284. Lynch, M., Evolution of the mutation rate. Trends Genet, 2010. 26(8): p. 345-52.

285. Vijg, J., et al., Aging and genome maintenance. Ann N Y Acad Sci, 2005. 1055: p. 35-47.

286. DeGregori, J., Challenging the axiom: Does the occurrence of oncogenic mutations truly limit cancer development with age? Oncogene, 2012. in press.

287. Fleenor, C.J., A. Marusyk, and J. DeGregori, Ionizing radiation and hematopoietic malignancies: altering the adaptive landscape. Cell Cycle, 2010. 9(15): p. 3005-11.

288. Henry, C.J., A. Marusyk, and J. DeGregori, Aging-associated changes in hematopoiesis and leukemogenesis: what's the connection? Aging (Albany NY), 2011. 3(6): p. 643-56.

289. Marusyk, A. and J. DeGregori, Declining cellular fitness with age promotes cancer initiation by selecting for adaptive oncogenic mutations. Biochim Biophys Acta, 2008. 1785(1): p. 1-11.

290. Keysar, S.B., et al., A patient tumor transplant model of squamous cell cancer identifies PI3K inhibitors as candidate therapeutics in defined molecular bins. Mol Oncol, 2013. 7(4): p. 776-90.

291. Ware, K.E., et al., A mechanism of resistance to gefitinib mediated by cellular reprogramming and the acquisition of an FGF2-FGFR1 autocrine growth loop. Oncogenesis, 2013. 2: p. e39.

172

292. Trapnell, C., L. Pachter, and S.L. Salzberg, TopHat: discovering splice junctions with RNA-Seq. Bioinformatics, 2009. 25(9): p. 1105-11.

293. Trapnell, C., et al., Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat Biotechnol, 2010. 28(5): p. 511-5.

294. Subramanian, A., et al., Gene set enrichment analysis: a knowledge- based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A, 2005. 102(43): p. 15545-50.

295. Sohal, J., et al., A model of APL with FLT3 mutation is responsive to retinoic acid and a receptor tyrosine kinase inhibitor, SU11657. Blood, 2003. 101(8): p. 3188-97.

296. Borggrefe, T. and F. Oswald, The Notch signaling pathway: transcriptional regulation at Notch target genes. Cell Mol Life Sci, 2009. 66(10): p. 1631- 46.

297. Bigas, A., D.I. Martin, and L.A. Milner, Notch1 and Notch2 inhibit myeloid differentiation in response to different cytokines. Mol Cell Biol, 1998. 18(4): p. 2324-33.

298. Milner, L.A., et al., A human homologue of the Drosophila developmental gene, Notch, is expressed in CD34+ hematopoietic precursors. Blood, 1994. 83(8): p. 2057-62.

299. Bertrand, F.E., et al., Notch-1 and Notch-2 exhibit unique patterns of expression in human B-lineage cells. Leukemia, 2000. 14(12): p. 2095- 102.

300. Li, L., et al., The human homolog of rat Jagged1 expressed by marrow stroma inhibits differentiation of 32D cells through interaction with Notch1. Immunity, 1998. 8(1): p. 43-55.

301. Nobta, M., et al., Critical regulation of bone morphogenetic protein- induced osteoblastic differentiation by Delta1/Jagged1-activated Notch1 signaling. J Biol Chem, 2005. 280(16): p. 15842-8.

302. Pereira, R.M., et al., Cortisol regulates the expression of Notch in osteoblasts. J Cell Biochem, 2002. 85(2): p. 252-8.

303. Challen, G.A., et al., Distinct hematopoietic stem cell subtypes are differentially regulated by TGF-beta1. Cell Stem Cell, 2010. 6(3): p. 265- 78.

173

304. Kent, D.G., et al., Prospective isolation and molecular characterization of hematopoietic stem cells with durable self-renewal potential. Blood, 2009. 113(25): p. 6342-50.

305. Cheng, T., et al., Hematopoietic stem cell quiescence maintained by p21cip1/waf1. Science, 2000. 287(5459): p. 1804-8.

306. Aster, J.C., W.S. Pear, and S.C. Blacklow, Notch signaling in leukemia. Annu Rev Pathol, 2008. 3: p. 587-613.

307. Kominami, R. and O. Niwa, Radiation carcinogenesis in mouse thymic lymphomas. Cancer Sci, 2006. 97(7): p. 575-81.

308. Tsuji, H., et al., Radiation-induced deletions in the 5' end region of Notch1 lead to the formation of truncated proteins and are involved in the development of mouse thymic lymphomas. Carcinogenesis, 2003. 24(7): p. 1257-68.

309. Boiers, C., et al., Expression and role of FLT3 in regulation of the earliest stage of normal granulocyte-monocyte progenitor development. Blood, 2010. 115(24): p. 5061-8.

310. Brashem-Stein, C., D.A. Flowers, and I.D. Bernstein, Regulation of colony forming cell generation by flt-3 ligand. Br J Haematol, 1996. 94(1): p. 17- 22.

311. Bruno, E., et al., Effects of recombinant interleukin 11 on human megakaryocyte progenitor cells. Exp Hematol, 1991. 19(5): p. 378-81.

312. Du, X.X., et al., Effects of recombinant human interleukin-11 on hematopoietic reconstitution in transplant mice: acceleration of recovery of peripheral blood neutrophils and platelets. Blood, 1993. 81(1): p. 27-34.

313. Hauser, S.P., O. Kajkenova, and D.A. Lipschitz, The pivotal role of interleukin 6 in formation and function of hematopoietically active murine long-term bone marrow cultures. Stem Cells, 1997. 15(2): p. 125-32.

314. Hudak, S., et al., Anti-IL-6 antibodies suppress myeloid cell production and the generation of CFU-c in long-term bone marrow cultures. Exp Hematol, 1992. 20(4): p. 412-7.

315. Paul, S.R., et al., Molecular cloning of a cDNA encoding interleukin 11, a stromal cell-derived lymphopoietic and hematopoietic cytokine. Proc Natl Acad Sci U S A, 1990. 87(19): p. 7512-6.

316. Teramura, M., et al., Interleukin-11 enhances human megakaryocytopoiesis in vitro. Blood, 1992. 79(2): p. 327-31.

174

317. Namen, A.E., et al., B cell precursor growth-promoting activity. Purification and characterization of a growth factor active on lymphocyte precursors. J Exp Med, 1988. 167(3): p. 988-1002.

318. Peschon, J.J., et al., Early lymphocyte expansion is severely impaired in interleukin 7 receptor-deficient mice. J Exp Med, 1994. 180(5): p. 1955-60.

319. von Freeden-Jeffry, U., et al., Lymphopenia in interleukin (IL)-7 gene- deleted mice identifies IL-7 as a nonredundant cytokine. J Exp Med, 1995. 181(4): p. 1519-26.

320. Hadland, B.K., et al., A requirement for Notch1 distinguishes 2 phases of definitive hematopoiesis during development. Blood, 2004. 104(10): p. 3097-105.

321. Kumano, K., et al., Notch1 but not Notch2 is essential for generating hematopoietic stem cells from endothelial cells. Immunity, 2003. 18(5): p. 699-711.

322. Chambers, S.M., et al., Hematopoietic fingerprints: an expression database of stem cells and their progeny. Cell Stem Cell, 2007. 1(5): p. 578-91.

323. Klinakis, A., et al., A novel tumour-suppressor function for the Notch pathway in myeloid leukaemia. Nature, 2011. 473(7346): p. 230-3.

324. Yeager, A.M., C. Shinn, and D.M. Pardoll, Lymphoid reconstitution after transplantation of congenic hematopoietic cells in busulfan-treated mice. Blood, 1991. 78(12): p. 3312-6.

325. Boveris, A. and B. Chance, The mitochondrial generation of hydrogen peroxide. General properties and effect of hyperbaric oxygen. Biochem J, 1973. 134(3): p. 707-16.

326. Rossi, F. and M. Zatti, Biochemical aspects of phagocytosis in polymorphonuclear leucocytes. NADH and NADPH oxidation by the granules of resting and phagocytizing cells. Experientia, 1964. 20(1): p. 21-3.

327. Royer-Pokora, B., et al., Cloning the gene for an inherited human disorder--chronic granulomatous disease--on the basis of its chromosomal location. Nature, 1986. 322(6074): p. 32-8.

328. Teahan, C., et al., The X-linked chronic granulomatous disease gene codes for the beta-chain of cytochrome b-245. Nature, 1987. 327(6124): p. 720-1.

175

329. Connor, K.M., et al., Mitochondrial H2O2 regulates the angiogenic phenotype via PTEN oxidation. J Biol Chem, 2005. 280(17): p. 16916-24.

330. Felty, Q., et al., Estrogen-induced mitochondrial reactive oxygen species as signal-transducing messengers. Biochemistry, 2005. 44(18): p. 6900-9.

331. Wang, F.S., et al., Ras induction of superoxide activates ERK-dependent angiogenic transcription factor HIF-1alpha and VEGF-A expression in shock wave-stimulated osteoblasts. J Biol Chem, 2004. 279(11): p. 10331- 7.

332. Waypa, G.B., et al., Mitochondrial reactive oxygen species trigger calcium increases during hypoxia in pulmonary arterial myocytes. Circ Res, 2002. 91(8): p. 719-26.

333. Yin, H., L. Xu, and N.A. Porter, Free radical lipid peroxidation: mechanisms and analysis. Chem Rev, 2011. 111(10): p. 5944-72.

334. Hayes, J.D. and M. McMahon, NRF2 and KEAP1 mutations: permanent activation of an adaptive response in cancer. Trends Biochem Sci, 2009. 34(4): p. 176-88.

335. Motohashi, H., et al., Integration and diversity of the regulatory network composed of Maf and CNC families of transcription factors. Gene, 2002. 294(1-2): p. 1-12.

336. Nguyen, T., P. Nioi, and C.B. Pickett, The Nrf2-antioxidant response element signaling pathway and its activation by oxidative stress. J Biol Chem, 2009. 284(20): p. 13291-5.

337. Chanas, S.A., et al., Loss of the Nrf2 transcription factor causes a marked reduction in constitutive and inducible expression of the glutathione S- transferase Gsta1, Gsta2, Gstm1, Gstm2, Gstm3 and Gstm4 genes in the livers of male and female mice. Biochem J, 2002. 365(Pt 2): p. 405-16.

338. Dong, J., K.K. Sulik, and S.Y. Chen, Nrf2-mediated transcriptional induction of antioxidant response in mouse embryos exposed to ethanol in vivo: implications for the prevention of fetal alcohol spectrum disorders. Antioxid Redox Signal, 2008. 10(12): p. 2023-33.

339. Kamsler, A., et al., Increased oxidative stress in ataxia telangiectasia evidenced by alterations in redox state of brains from Atm-deficient mice. Cancer Res, 2001. 61(5): p. 1849-54.

340. Burton, G.W. and K.U. Ingold, $\beta $-Carotene: An Unusual Type of Lipid Antioxidant. Science, 1984. 224(4649): p. 569-573.

176

341. Duester, G., F.A. Mic, and A. Molotkov, Cytosolic retinoid dehydrogenases govern ubiquitous metabolism of retinol to retinaldehyde followed by tissue-specific metabolism to retinoic acid. Chem Biol Interact, 2003. 143- 144: p. 201-10.

342. Huang, M.E., et al., Use of all-trans retinoic acid in the treatment of acute promyelocytic leukemia. Blood, 1988. 72(2): p. 567-72.

343. Makishima, M., et al., Induction of differentiation in acute promyelocytic leukemia cells by 9-cis retinoic acid alpha-tocopherol ester (9-cis tretinoin tocoferil). Blood, 1998. 91(12): p. 4715-26.

344. Nair, C.K., et al., Water soluble vitamin E (TMG) as a radioprotector. Indian J Exp Biol, 2003. 41(12): p. 1365-71.

345. Singh, V.K., L.A. Beattie, and T.M. Seed, Vitamin E: tocopherols and tocotrienols as potential radiation countermeasures. Journal of Radiation Research, 2013.

346. Srinivasan, V. and J.F. Weiss, Radioprotection by vitamin E: injectable vitamin E administered alone or with WR-3689 enhances survival of irradiated mice. Int J Radiat Oncol Biol Phys, 1992. 23(4): p. 841-5.

347. Brandt, R. and A.S. Keston, Synthesis of Diacetyldichlorofluorescin: A Stable Reagent for Fluorometric Analysis. Anal Biochem, 1965. 11: p. 6-9.

348. Keston, A.S. and R. Brandt, The Fluorometric Analysis of Ultramicro Quantities of Hydrogen Peroxide. Anal Biochem, 1965. 11: p. 1-5.

349. LeBel, C.P., H. Ischiropoulos, and S.C. Bondy, Evaluation of the probe 2',7'-dichlorofluorescin as an indicator of reactive oxygen species formation and oxidative stress. Chem Res Toxicol, 1992. 5(2): p. 227-31.

350. Karlsson, M., et al., What does the commonly used DCF test for oxidative stress really show? Biochem J, 2010. 428(2): p. 183-90.

351. Ayala, A., M.F. Munoz, and S. Arguelles, Lipid peroxidation: production, metabolism, and signaling mechanisms of malondialdehyde and 4- hydroxy-2-nonenal. Oxid Med Cell Longev, 2014. 2014: p. 360438.

352. von Lohneysen, K., et al., Mutational analysis reveals distinct features of the Nox4-p22 phox complex. J Biol Chem, 2008. 283(50): p. 35273-82.

353. Tegtmeier, F., et al., Compounds containing a n-heteroaryl moiety linked to fused ring moieties for the inhibition of nad(p)h oxidases and platelet activation, 2013, Google Patents.

177

354. ten Freyhaus, H., et al., Novel Nox inhibitor VAS2870 attenuates PDGF- dependent smooth muscle cell chemotaxis, but not proliferation. Cardiovasc Res, 2006. 71(2): p. 331-41.

355. Steel, R., et al., Anti-inflammatory Effect of a Cell-Penetrating Peptide Targeting the Nrf2/Keap1 Interaction. ACS medicinal chemistry letters, 2012. 3(5): p. 407-410.

356. Hur, W., et al., A small-molecule inducer of the antioxidant response element. Chem Biol, 2010. 17(5): p. 537-47.

357. Kumar, V., et al., Novel chalcone derivatives as potent Nrf2 activators in mice and human lung epithelial cells. J Med Chem, 2011. 54(12): p. 4147- 59.

358. Merchant, A.A., et al., The redox-sensitive transcription factor Nrf2 regulates murine hematopoietic stem cell survival independently of ROS levels. Blood, 2011. 118(25): p. 6572-9.

359. Rotman, G. and Y. Shiloh, Ataxia-telangiectasia: is ATM a sensor of oxidative damage and stress? Bioessays, 1997. 19(10): p. 911-7.

360. Barlow, C., et al., Loss of the ataxia-telangiectasia gene product causes oxidative damage in target organs. Proc Natl Acad Sci U S A, 1999. 96(17): p. 9915-9.

361. Bredemeyer, A.L., et al., DNA double-strand breaks activate a multi- functional genetic program in developing lymphocytes. Nature, 2008. 456(7223): p. 819-23.

362. Martiny-Baron, G., et al., Selective inhibition of protein kinase C isozymes by the indolocarbazole Go 6976. J Biol Chem, 1993. 268(13): p. 9194-7.

363. Evenou, J.P., et al., The potent protein kinase C-selective inhibitor AEB071 (sotrastaurin) represents a new class of immunosuppressive agents affecting early T-cell activation. J Pharmacol Exp Ther, 2009. 330(3): p. 792-801.

364. Burton, G.W. and K.U. Ingold, Vitamin E: application of the principles of physical organic chemistry to the exploration of its structure and function. Accounts of Chemical Research, 1986. 19(7): p. 194-201.

365. Siu, A.W., R.J. Reiter, and C.H. To, The efficacy of vitamin E and melatonin as antioxidants against lipid peroxidation in rat retinal homogenates. J Pineal Res, 1998. 24(4): p. 239-44.

178

366. Foote, C.S. and R.W. Denny, Chemistry of singlet oxygen. VII. Quenching by .beta.-carotene. Journal of the American Chemical Society, 1968. 90(22): p. 6233-6235.

367. Monaghan, B.R. and F.O. Schmitt, THE EFFECTS OF CAROTENE AND OF VITAMIN A ON THE OXIDATION OF LINOLEIC ACID. Journal of Biological Chemistry, 1932. 96(2): p. 387-395.

368. Lai, L., et al., Retinoic acid regulates endothelial cell proliferation during vasculogenesis. Development, 2003. 130(26): p. 6465-74.

369. Yu, Z., et al., Induction of cell-cycle arrest by all-trans retinoic acid in mouse embryonic palatal mesenchymal (MEPM) cells. Toxicol Sci, 2005. 83(2): p. 349-54.

370. Kim, J.-H., et al., NRF2-mediated Notch pathway activation enhances hematopoietic reconstitution following myelosuppressive radiation. J Clin Invest, 2014. 124(2): p. 730-741.

371. Degos, L., et al., All-trans-retinoic acid as a differentiating agent in the treatment of acute promyelocytic leukemia. Blood, 1995. 85(10): p. 2643- 53.

372. Rothe, G. and G. Valet, Flow cytometric analysis of respiratory burst activity in phagocytes with hydroethidine and 2',7'-dichlorofluorescin. J Leukoc Biol, 1990. 47(5): p. 440-8.

373. Little, J.B., Radiation carcinogenesis. Carcinogenesis, 2000. 21(3): p. 397- 404.

374. Rossi, D.J., et al., Deficiencies in DNA damage repair limit the function of haematopoietic stem cells with age. Nature, 2007. 447(7145): p. 725-9.

375. Yahata, T., et al., Accumulation of oxidative DNA damage restricts the self-renewal capacity of human hematopoietic stem cells. Blood, 2011. 118(11): p. 2941-50.

376. Gilliland, D.G. and J.D. Griffin, The roles of FLT3 in hematopoiesis and leukemia. Blood, 2002. 100(5): p. 1532-42.

377. Jan, M., et al., Clonal evolution of preleukemic hematopoietic stem cells precedes human acute myeloid leukemia. Sci Transl Med, 2012. 4(149): p. 149ra118.

378. Shlush, L.I., et al., Identification of pre-leukaemic haematopoietic stem cells in acute leukaemia. Nature, 2014. 506(7488): p. 328-33.

179

379. Kim, J., J. Hwangbo, and P.K. Wong, p38 MAPK-Mediated Bmi-1 down- regulation and defective proliferation in ATM-deficient neural stem cells can be restored by Akt activation. PLoS One, 2011. 6(1): p. e16615.

380. Molofsky, A.V., et al., Bmi-1 dependence distinguishes neural stem cell self-renewal from progenitor proliferation. Nature, 2003. 425(6961): p. 962-7.

381. Nakamura, S., et al., Bmi1 confers resistance to oxidative stress on hematopoietic stem cells. PLoS One, 2012. 7(5): p. e36209.

180

APPENDIX A

FRESH mHPC RNA-seq

GENE ID FPKM values gene Ctrl1 Ctrl2 Ctrl3 IR1 IR2 IR3 1700024P16Rik 1.21 8.18 0.59 0.62 0.54 0.15 2310057J16Rik 2.83 2.26 3.37 1.74 2.01 2.55 9630013D21Rik 1.15 0.52 1.47 4.29 4.12 2.85 Abcg3 5.40 6.44 7.33 2.78 2.69 2.47 AI894139,Zfp783 6.40 3.93 4.96 5.15 4.50 4.26 Apob 0.74 0.82 1.61 2.29 2.00 2.90 Armcx5,Gprasp1 18.15 17.23 18.60 16.16 16.29 16.12 Asph 19.40 20.75 18.06 14.75 16.36 15.73 Bace2 0.56 1.18 0.60 0.14 0.04 0.14 Bmpr1a 0.53 0.65 0.72 0.24 0.03 0.12 C130026I21Rik 1.99 2.89 2.19 3.96 3.66 3.99 Car1 49.49 90.44 69.81 71.15 142.04 112.53 Cd74 118.77 238.57 166.96 120.42 531.18 151.74 Ctla2b 90.69 101.15 109.87 77.44 74.95 64.45 Dnmt3a 20.21 19.21 18.79 19.78 17.52 19.92 Dntt 121.26 216.79 65.58 61.43 95.08 93.31 F2r 24.83 23.98 29.08 52.90 48.75 44.76 Fam120b 11.49 10.58 9.82 9.31 9.52 8.09 Fkbp5 38.25 41.12 33.17 20.23 21.64 18.58 Flt3 72.27 79.15 58.54 46.64 45.95 47.65 Fos 1.04 0.63 0.83 3.35 6.22 3.43 G3bp2 56.93 55.25 51.74 52.29 48.27 49.24 Gfi1b 12.39 15.19 12.74 23.00 24.35 25.62 Gm11428 146.42 139.43 96.08 52.96 81.48 91.16 Grb10 15.53 10.79 19.68 13.10 10.95 11.60 Hbb-b1 66.63 38.14 70.89 30.23 27.43 31.35 Ifitm1 493.82 369.72 403.04 306.26 314.71 377.54 Igf2r 3.76 4.62 4.83 2.18 2.04 2.37 Igj 33.74 108.68 46.07 58.72 177.74 106.57 Itga9 3.32 4.39 3.44 2.41 1.93 2.43 Itsn1 12.11 11.89 16.41 9.83 10.57 7.88 Jun 3.83 3.26 3.14 12.97 18.80 13.30 Ldhb 37.69 37.88 38.38 24.85 19.17 23.74 LOC100502704 5.09 6.10 7.43 5.10 61.57 21.59 LOC100503605 54.51 26.81 55.91 23.66 18.58 25.70 Lrrc9 1.80 1.23 1.38 0.81 0.87 0.42

181 GENE ID FPKM values gene Ctrl1 Ctrl2 Ctrl3 IR1 IR2 IR3 Mcart6 4.26 4.35 4.16 2.35 2.41 1.46 Meg3,Mir770 3.74 1.38 3.17 0.18 0.15 0.28 Mid1 15.30 7.34 2.68 2.99 2.71 3.50 Mpa2l 6.62 21.14 6.80 4.65 4.60 4.15 Ndn 2.78 2.21 3.83 0.95 0.44 0.78 Pf4 23.59 42.40 42.47 48.52 99.43 67.72 Pik3ip1 70.17 66.34 78.33 37.61 50.51 42.01 Plag1 3.61 4.00 5.82 1.74 1.73 1.55 Ppp2r3a 11.44 8.43 11.95 10.90 9.71 9.25 Selp 14.15 10.38 10.07 31.84 27.87 33.37 Serpinf1 32.66 31.32 29.00 13.84 13.89 14.52 Smox 8.97 6.32 7.66 8.53 5.40 6.38 Socs2 3.41 2.86 4.21 9.94 6.37 5.17 Sult1a1 17.96 15.39 22.78 8.04 11.49 6.14 Thbs1 2.42 17.93 3.39 1.82 1.79 1.07 Tjp1 4.07 2.87 4.61 14.22 12.69 12.87 Tlr7 9.97 14.95 9.46 3.88 6.21 2.98 Tsc22d3 109.61 148.24 161.23 75.70 96.53 61.59 Vegfa 5.21 7.63 3.18 3.04 3.07 2.86 Zfp1 19.54 18.71 19.49 15.10 17.07 15.10 Zfp821 4.41 2.52 3.48 3.47 2.80 3.36 Znrf1 48.92 40.60 38.94 38.16 36.65 27.88

182 APPENDIX B

CULTURED mHPC RNA-seq

GENE ID FPKM values

Ctrl Ctrl Ctrl IR IR IR DL1 Ctrl1 Ctrl2 Ctrl3 IR1 IR2 IR3 DL1 1 DL1 2 DL1 3 DL1 1 DL1 2 3 6-Sep 25.6 24.5 23.0 17.0 19.7 22.0 32.8 32.9 35.9 30.5 28.2 29.0 668101 34.2 28.2 39.9 78.6 58.1 46.5 6.0 8.1 4.7 12.6 14.6 10.2 1100001G2 0Rik 36.0 27.0 38.8 58.1 66.3 39.9 18.3 15.4 14.5 39.9 33.3 26.3 1190002H2 3Rik 24.3 23.9 21.0 48.7 51.9 38.5 19.4 20.9 20.5 32.7 37.2 30.0 1300014I06 Rik 1.5 1.3 2.6 4.5 2.6 2.8 3.0 3.3 3.0 4.2 3.4 3.7 1700020L24 Rik 10.2 10.9 10.4 18.5 18.7 17.4 9.4 9.8 8.2 13.1 14.8 12.2 1700025G0 4Rik 6.7 6.5 6.9 5.2 4.6 4.6 9.0 8.5 9.7 8.9 7.7 8.1 1810011H11 Rik 10.0 9.8 11.6 19.8 16.4 13.4 8.2 8.1 7.8 9.1 11.7 7.7 2010011I20 Rik 1.9 1.8 1.9 3.6 2.8 2.9 1.5 1.5 1.4 1.6 1.6 1.8 2210023G0 5Rik 0.2 0.3 0.4 1.1 1.1 1.0 0.2 0.2 0.2 0.4 0.4 0.4 2700094K1 3Rik 129.5 141.7 136.0 101.8 120.3 129.0 164.5 155.4 153.8 153.3 153.0 157.1 2810026P1 8Rik 64.3 77.2 69.1 38.3 51.1 61.3 68.5 68.8 61.3 54.5 63.1 61.6 2810405K0 2Rik 4.4 5.1 5.8 11.9 10.6 9.8 1.5 2.0 2.0 2.6 1.5 2.1 2810417H1 3Rik 104.5 101.6 100.8 64.3 71.0 75.0 113.6 119.8 122.0 115.6 107.6 100.3 4930438A0 8Rik 1.0 0.8 0.9 2.5 2.6 1.6 0.6 0.3 0.6 1.4 1.5 1.2 4930471M2 3Rik 7.9 7.3 9.1 15.3 11.3 10.5 4.9 4.8 4.3 5.7 6.2 5.4 5430435G2 2Rik 9.1 8.6 9.7 17.8 17.0 13.9 3.2 3.7 2.8 6.0 7.5 6.5 5730528L13 Rik 4.9 5.5 4.9 7.3 8.8 7.9 3.8 4.2 4.2 4.9 5.3 4.6 6430548M0 8Rik 2.2 1.8 2.5 3.6 2.8 2.2 1.0 1.1 0.9 1.2 1.9 1.3 6720401G1 3Rik 13.0 13.3 14.2 10.0 10.5 13.0 16.1 15.6 14.7 12.9 15.2 15.6 8430427H1 7Rik 1.5 1.4 1.3 2.6 2.6 2.7 1.7 1.5 1.8 1.9 1.9 2.0 9030617O0 3Rik 17.3 16.2 19.0 15.2 12.1 11.8 9.6 12.1 9.3 11.0 11.4 9.9 9030625A0 4Rik 12.8 11.0 15.0 21.7 16.8 17.4 10.6 12.1 9.1 12.8 13.6 11.5 9130014G2 4Rik 1.1 1.1 1.4 2.8 1.9 1.8 0.2 0.3 0.2 0.3 0.5 0.4 9430008C0 3Rik 7.8 7.9 8.5 5.4 6.4 8.2 9.5 9.7 8.6 7.2 8.6 7.9 9430015G1 0Rik 17.7 18.6 18.8 13.4 13.9 16.8 21.9 22.0 20.9 18.0 21.3 19.4

183 GENE ID FPKM values

Ctrl Ctrl Ctrl IR IR IR DL1 Ctrl1 Ctrl2 Ctrl3 IR1 IR2 IR3 DL1 1 DL1 2 DL1 3 DL1 1 DL1 2 3 A830080D0 1Rik 8.5 8.8 7.7 5.5 5.9 6.4 8.2 8.0 8.4 7.3 7.6 7.7 A930001N0 9Rik 3.0 2.3 2.4 4.8 3.6 3.3 2.2 2.3 2.4 3.0 2.5 2.5 Aatk 4.2 3.9 4.5 9.1 8.7 7.3 2.5 2.3 2.5 4.0 4.4 4.0 Abca1 2.9 2.1 3.3 8.6 6.2 3.9 1.4 1.2 1.3 1.8 1.9 1.7 Abca13 0.6 0.7 0.4 1.6 1.4 0.7 0.3 0.3 0.5 1.0 1.0 0.6 Abca9 1.4 0.9 1.7 3.7 3.1 2.0 0.1 0.2 0.1 0.3 0.2 0.1 Abcb1b 5.2 5.4 5.2 3.0 3.0 3.6 5.4 5.7 5.7 5.3 4.9 5.3 Abcc3 3.1 2.9 3.5 8.9 7.5 5.6 0.7 0.7 0.7 1.2 1.2 1.0 Abcc5 5.9 5.9 6.4 9.0 9.6 8.1 4.8 5.4 4.9 6.3 6.8 6.4 Abhd4 15.4 13.4 14.5 20.1 21.0 20.9 12.1 13.0 11.2 13.3 13.7 13.6 Acp2 9.9 9.0 10.5 17.4 13.9 12.7 5.8 6.7 6.1 7.7 7.5 7.3 Acpp 11.1 9.4 10.3 21.4 24.1 16.0 4.8 5.5 5.6 9.8 10.8 9.3 Acsl3,Utp14b 26.4 25.5 23.5 18.0 19.3 20.2 25.5 26.6 23.6 23.3 21.1 22.5 Adam15 36.8 32.3 39.9 54.1 46.2 45.0 19.8 22.8 20.3 23.7 24.6 24.2 Adam23 2.3 1.4 3.1 2.5 1.1 0.7 1.4 1.8 1.7 2.4 2.0 2.1 Adam8 37.6 29.8 46.1 67.8 50.0 44.1 17.2 20.1 16.9 24.1 25.7 21.9 Adamtsl4 2.3 2.3 3.1 7.0 6.3 4.1 0.5 0.6 0.5 0.8 1.1 0.8 Adap2 3.1 3.5 4.1 9.9 7.7 5.4 2.0 2.2 1.8 3.1 3.2 2.6 Adcy9 0.9 1.0 1.0 2.0 1.7 1.3 0.3 0.5 0.4 0.5 0.5 0.5 AF251705 30.0 27.1 40.8 76.7 58.0 48.2 19.5 20.5 16.7 28.6 30.9 23.9 Afap1 0.6 0.4 0.3 1.4 1.0 0.7 0.7 0.6 0.8 1.4 1.1 0.9 Afap1l1 22.6 24.8 24.6 10.4 13.8 17.6 33.2 32.3 36.8 23.0 23.3 27.5 Agtrap 12.2 10.7 11.6 17.0 17.1 15.6 9.4 9.4 9.5 10.9 12.4 11.4 Ahnak 15.5 14.7 16.2 28.7 18.0 15.9 5.7 6.3 5.2 9.7 11.1 9.1 Ahnak2,LO C10050360 6 0.4 0.3 0.3 0.8 0.7 0.8 0.1 0.2 0.2 0.2 0.2 0.2 AI451617 3.3 2.7 2.9 4.5 4.1 3.4 2.2 2.4 1.9 2.6 2.7 2.6 AI504432 7.4 6.4 6.6 4.3 4.9 5.4 8.0 7.4 6.9 6.3 6.6 5.9 AI607873 12.5 9.7 12.1 24.6 19.1 15.1 5.1 5.7 4.3 8.5 8.0 7.4 Aif1 3.5 4.2 5.8 14.0 11.6 8.0 2.5 2.1 2.6 3.9 4.4 3.8 Alcam 6.1 4.8 5.8 11.3 9.9 7.4 5.8 5.5 7.1 9.7 7.5 7.4 Aldh1l2 3.1 2.5 2.7 1.4 1.5 1.7 1.2 1.7 1.2 1.1 1.3 1.1 Aldh3b1 9.6 7.9 11.4 19.6 16.5 12.5 3.8 4.6 3.3 5.8 5.5 5.1 Alox5 3.8 4.0 4.3 7.2 7.1 5.9 6.9 6.9 11.2 9.4 8.5 8.6 Amot 5.2 5.1 4.7 3.3 3.4 3.1 3.8 3.9 3.9 4.0 3.9 3.3 Ang,Rnase4 12.0 10.1 13.3 29.5 24.3 19.0 2.6 3.4 2.5 3.4 4.1 4.2 Angptl2 1.1 1.1 0.9 0.4 0.4 0.6 0.1 0.1 0.1 0.0 0.1 0.1 Ankrd12 4.4 4.0 3.4 5.9 5.6 5.3 3.6 3.5 4.0 4.9 4.8 4.4

184 GENE ID FPKM values

Ctrl Ctrl Ctrl IR IR IR DL1 Ctrl1 Ctrl2 Ctrl3 IR1 IR2 IR3 DL1 1 DL1 2 DL1 3 DL1 1 DL1 2 3 Ankrd28 41.6 41.4 34.5 54.2 59.8 50.1 29.6 29.3 29.2 39.6 41.0 37.6 Anpep 4.3 2.1 5.9 13.6 7.4 6.8 8.7 7.7 9.5 14.4 9.9 9.6 Anxa1 138.8 126.9 139.4 228.2 207.7 183.4 98.4 99.4 91.2 152.3 159.6 131.2 Anxa4 23.0 21.6 25.2 37.6 30.5 31.2 20.9 20.8 23.4 24.1 24.4 22.0 Anxa5 69.9 61.4 73.2 103.6 86.9 88.2 61.8 59.3 60.3 76.9 69.9 68.1 Aoah 10.4 9.2 11.3 20.4 16.2 15.7 2.7 3.2 2.2 4.4 5.9 4.5 Aplf 5.5 5.2 4.8 4.2 4.5 4.9 5.5 5.4 6.2 5.3 5.6 5.8 Apobec1 23.2 19.0 25.0 44.1 36.4 34.6 6.8 9.1 6.0 8.7 11.7 10.9 Apoc2 14.1 11.2 14.9 39.5 36.8 26.2 1.3 2.1 1.8 2.8 4.3 2.7 Apoe 180.5 149.5 243.4 746.5 649.4 459.1 19.5 23.6 21.1 36.8 39.7 43.8 App 69.1 56.9 70.2 121.7 103.6 93.7 25.8 29.5 25.7 46.8 48.4 42.0 Aqp9 16.6 15.9 17.1 8.2 8.2 9.1 22.2 22.0 21.7 16.4 16.2 15.9 Arg1 2.5 1.2 3.3 11.7 12.2 5.1 0.2 0.2 0.5 0.5 0.5 0.4 Arhgap12 5.1 4.5 5.4 4.5 4.0 4.4 3.8 4.5 4.0 3.4 3.1 3.4 Arhgap22 2.5 3.0 3.7 6.3 4.5 3.9 1.2 0.9 0.9 1.2 1.3 1.1 Arhgap24 4.9 4.2 5.2 8.7 6.4 7.3 1.2 1.3 0.9 2.0 2.1 1.9 Arhgap25 14.2 13.5 14.8 17.9 15.2 16.7 14.3 14.5 15.3 15.5 14.4 14.0 Arl11 21.5 21.4 23.2 43.0 42.0 31.4 14.3 16.4 14.9 20.3 23.7 18.1 Arl4c 14.3 12.5 17.3 29.4 22.9 16.5 12.9 12.1 14.4 17.3 14.9 15.4 Arl5c 6.4 6.2 9.4 17.4 11.4 14.9 3.1 3.7 2.9 4.0 4.5 4.7 Arsb 15.9 15.2 13.0 28.8 31.7 23.8 10.0 11.4 11.9 18.4 17.7 15.1 Atg7 13.5 14.5 14.8 22.2 19.6 18.5 11.4 11.5 11.5 14.2 15.0 13.3 Atp2b1 19.3 16.7 18.7 31.9 26.1 22.1 10.5 11.1 10.9 13.9 13.1 12.2 Atp2b4 12.1 13.8 10.9 9.4 9.5 10.1 11.8 11.7 10.9 10.0 9.9 10.4 Atp6ap2 63.5 59.4 56.6 86.9 85.8 74.4 52.3 53.1 55.0 68.9 64.2 59.5 Atp8b4 75.2 67.4 57.7 104.6 109.1 86.3 49.8 54.8 50.1 76.7 75.2 62.5 Atrn 11.1 10.7 8.9 15.4 16.1 12.8 8.7 8.2 8.8 12.2 11.8 10.4 Aurka 54.6 55.3 55.4 37.7 40.7 47.8 59.4 55.4 58.6 54.4 54.3 55.7 Aven 16.9 17.2 15.3 11.7 12.5 15.0 17.1 17.7 17.5 16.5 13.5 15.1 B230206F22Rik 3.4 3.0 3.1 1.9 2.2 3.3 3.9 3.5 3.4 2.6 3.9 3.1 B430306N03Rik2.6 2.1 2.4 4.8 4.3 2.9 1.3 1.3 1.6 2.0 2.0 1.6 B4galt6 25.0 23.2 20.8 45.1 47.2 31.7 17.4 16.9 18.6 29.9 29.6 24.3 Baiap2 14.0 11.7 15.9 21.5 16.9 16.5 19.2 17.1 20.9 20.7 19.6 19.8 Bambi-ps1 1.4 1.4 1.4 3.5 3.9 3.4 1.9 1.8 1.7 2.8 3.4 2.3 Bard1 7.1 7.1 6.7 5.0 5.5 4.8 8.3 7.7 9.0 7.3 7.4 7.0 Batf2 0.8 0.8 1.0 2.7 2.1 1.4 0.6 0.6 0.5 1.3 1.5 1.3 BC055004 15.8 14.2 18.0 38.0 29.3 22.5 5.5 6.8 5.4 9.7 10.7 8.5 Bcar3 0.2 0.1 0.2 0.7 0.6 0.5 0.1 0.0 0.0 0.1 0.0 0.1 Bcat1 8.7 9.0 8.7 4.7 4.9 5.8 7.3 7.7 7.3 6.2 6.5 6.2

185 GENE ID FPKM values

Ctrl Ctrl Ctrl IR IR IR DL1 Ctrl1 Ctrl2 Ctrl3 IR1 IR2 IR3 DL1 1 DL1 2 DL1 3 DL1 1 DL1 2 3 Bdh1 5.7 5.7 5.4 3.9 3.4 3.4 7.3 6.9 8.0 7.3 5.3 5.8 Bex6 17.8 17.7 20.4 13.4 10.2 11.8 30.2 31.5 34.6 35.9 29.5 25.1 Birc5 113.4 121.9 117.3 79.7 91.1 100.3 135.3 127.7 134.3 124.1 122.4 128.2 Blvrb 12.7 12.0 20.9 30.3 22.2 25.8 8.1 8.4 6.6 8.8 9.9 9.8 Bmpr1a 2.7 2.8 2.5 1.7 1.5 1.2 2.3 2.0 1.9 0.9 1.0 0.8 Bpil2 1.3 1.2 1.0 4.8 5.9 5.2 1.0 1.2 0.7 1.8 2.5 1.8 Brca2 5.7 6.1 4.8 4.0 4.8 4.4 5.1 5.1 5.2 5.3 5.1 4.8 Bri3 18.0 17.5 19.1 26.1 24.9 24.5 18.4 16.7 19.3 17.0 18.5 20.4 Bst1 5.7 4.8 7.7 14.9 11.3 8.5 0.8 0.9 0.8 1.7 2.1 1.7 Btg1 24.6 21.2 25.7 41.9 34.3 30.5 16.5 17.6 15.8 20.7 21.5 19.3 Btla 4.6 3.5 5.0 3.3 2.1 2.3 3.9 3.8 3.9 5.7 5.5 4.3 Bub1b 54.6 53.0 54.3 35.7 37.1 42.7 60.9 59.9 66.5 59.6 55.0 61.3 Bzw2 105.0 110.3 102.3 66.4 81.8 92.5 119.6 118.3 113.2 97.0 99.0 102.9 C1qa 4.2 3.7 5.9 16.9 20.8 11.3 1.1 1.0 1.8 2.8 4.1 2.8 C1qb 21.1 15.9 31.9 101.7 92.9 65.3 3.3 4.2 5.8 11.1 9.7 9.7 C1qbp 233.2 249.9 233.9 160.1 185.3 206.9 243.8 237.1 227.4 207.4 212.2 241.4 C1qc 10.1 8.0 16.8 55.4 51.1 33.2 1.7 2.6 2.9 6.6 6.2 6.8 C3 46.6 41.6 45.0 91.8 80.8 61.9 13.8 16.6 14.1 33.3 34.2 25.2 C330027C09Rik29.9 28.4 27.3 18.8 22.6 22.8 28.9 28.2 30.3 27.3 27.2 26.7 C3ar1 18.9 14.9 22.3 56.3 38.6 32.3 3.5 4.6 2.6 5.9 6.2 6.7 C4a 0.2 0.2 0.3 0.6 0.7 0.3 0.1 0.2 0.2 0.2 0.2 0.2 C4b 0.5 0.5 0.4 2.5 1.6 1.1 0.0 0.0 0.0 0.1 0.1 0.1 C5ar1 9.5 8.7 11.0 33.4 29.0 19.1 0.8 0.7 0.9 1.7 1.7 1.5 C79407 21.4 20.0 19.1 13.1 13.9 16.9 21.0 19.3 19.8 18.8 18.5 18.5 Cables1 5.2 5.6 5.2 6.8 7.8 7.8 3.2 4.2 4.0 3.0 4.0 4.5 Camk1 15.0 14.1 15.6 28.3 24.1 23.6 9.8 8.5 8.1 8.8 11.1 8.9 Camk1d 3.9 3.1 4.3 8.9 6.5 5.2 2.8 2.7 2.6 3.6 3.1 3.1 Camkk1 2.3 2.7 2.8 1.4 1.3 1.5 7.1 5.8 6.8 5.2 5.4 4.5 Capn11 0.1 0.2 0.0 0.9 2.6 2.5 0.1 0.4 0.0 0.5 2.2 2.5 Cars 33.3 33.5 33.5 23.7 24.6 27.0 36.7 37.0 38.0 31.5 33.6 31.6 Casc4 5.4 5.3 5.6 4.3 4.7 5.0 7.0 6.6 7.1 6.1 5.5 5.8 Cbfa2t3 14.6 13.7 13.1 10.1 10.6 11.2 24.3 22.3 23.9 21.5 20.4 21.6 Cbr2 0.6 0.3 1.1 3.6 3.0 1.9 0.0 0.0 0.2 0.2 0.0 0.0 Cbx3 157.9 160.9 146.1 104.8 121.7 124.3 152.3 151.6 163.4 136.2 134.7 138.2 Cbx5 47.1 48.5 40.0 32.8 37.7 35.2 45.3 44.7 47.5 42.0 40.3 43.4 Ccdc125 5.5 5.3 4.9 9.8 10.9 8.3 5.7 5.4 6.0 9.4 9.4 7.3 Ccdc58 44.9 48.1 52.5 33.9 38.7 43.1 53.0 52.7 49.1 44.7 50.2 43.8 Ccl6 18.0 15.2 24.9 47.0 35.2 29.8 8.6 9.0 6.4 13.5 13.8 12.7 Ccna2 95.1 94.1 88.9 66.2 69.9 77.3 73.0 92.0 91.5 88.6 89.1 87.4

186 GENE ID FPKM values

Ctrl Ctrl Ctrl IR IR IR DL1 Ctrl1 Ctrl2 Ctrl3 IR1 IR2 IR3 DL1 1 DL1 2 DL1 3 DL1 1 DL1 2 3 Ccnd1 32.4 30.9 34.7 19.9 17.6 18.3 40.5 42.2 45.9 40.8 34.8 34.6 Ccne1 19.4 21.8 21.3 12.7 14.0 14.9 26.1 25.8 24.1 25.0 23.6 21.4 Ccno 1.3 1.4 1.0 2.5 3.3 2.1 0.8 1.0 1.2 1.2 1.8 1.4 Ccpg1 19.9 16.7 19.0 25.0 24.2 21.4 15.4 16.9 15.8 18.5 17.9 17.1 Ccr1 52.9 43.8 54.6 91.4 78.2 54.3 36.6 39.8 38.6 48.5 50.7 41.7 Cd14 16.1 13.7 17.1 28.3 23.3 21.8 6.3 7.1 4.5 7.7 9.7 8.9 Cd177 0.6 0.5 0.6 1.7 1.6 1.1 0.1 0.2 0.1 0.6 0.5 0.3 Cd200r4 1.9 1.6 2.3 4.9 3.6 3.1 2.0 1.5 2.3 1.9 1.5 2.1 Cd27 18.5 17.1 17.9 11.1 12.6 15.0 21.4 21.1 20.8 14.0 14.6 15.3 Cd28 6.8 5.5 7.1 12.3 10.1 8.7 1.0 1.3 0.8 1.5 2.0 1.7 Cd2ap 11.8 10.9 11.6 9.1 8.3 8.1 11.0 10.9 11.1 11.0 11.3 10.4 Cd300lb 20.5 17.6 22.9 33.6 26.8 28.1 12.2 14.9 10.9 17.0 19.5 17.9 Cd300ld 20.2 16.4 24.3 41.4 28.8 25.6 5.5 7.5 5.0 10.8 12.1 9.2 Cd63 94.0 91.1 98.6 246.8 241.0 214.2 94.6 88.0 108.0 134.4 139.2 132.7 Cd68 80.7 64.5 94.4 154.4 116.6 112.9 66.5 63.8 62.4 78.0 73.5 70.6 Cd69 25.0 27.2 24.0 14.5 18.8 17.8 31.0 33.6 27.7 23.9 29.3 24.8 Cd72 11.6 9.8 17.5 15.5 8.2 8.7 23.2 23.5 26.9 29.7 24.7 24.9 Cd74 451.5 346.6 630.6 987.8 556.5 572.4 527.8 499.3 527.7 792.3 695.2 647.4 Cd84 22.3 18.1 22.1 43.7 36.6 29.0 13.0 12.4 12.3 16.7 14.9 14.1 Cd93 33.8 28.3 28.6 47.5 45.4 34.3 14.8 16.8 15.7 17.0 17.6 16.9 Cdc25b 9.7 9.7 11.2 8.5 8.0 9.5 10.3 10.0 10.3 9.0 9.2 10.4 Cdc27 30.2 29.6 27.0 21.4 22.2 23.4 31.5 30.9 33.6 29.8 27.5 29.8 Cdca2 23.2 21.9 21.0 15.9 17.0 22.0 24.8 24.6 26.1 23.8 23.4 26.0 Cdk20 5.5 5.4 6.7 11.0 9.3 9.0 2.7 3.0 2.6 3.6 3.6 3.5 Ceacam2 1.1 1.0 1.1 2.1 2.1 1.6 0.8 0.9 0.8 1.6 1.8 1.2 Cebpa 50.4 55.3 49.5 73.1 79.8 76.8 44.0 44.3 41.1 50.1 57.6 65.9 Cebpe 13.1 13.3 13.0 32.2 37.7 26.7 15.5 13.1 15.7 29.3 30.3 20.1 Celsr1 2.6 2.7 2.1 4.5 4.4 3.6 2.5 2.2 2.7 3.3 3.2 3.1 Celsr3 1.3 1.4 1.3 2.3 2.5 2.3 1.1 1.0 0.9 1.6 1.8 1.5 Cenpe 21.7 20.7 17.9 14.1 15.8 16.3 20.8 19.8 21.3 21.4 21.6 21.0 Cep55 27.4 27.8 26.0 19.2 19.1 21.5 28.4 28.8 28.9 26.6 25.2 26.4 Cerk 15.2 14.9 16.1 30.2 27.9 24.2 10.5 11.2 11.7 15.0 15.1 14.2 Chchd7 26.5 31.0 29.3 22.4 24.1 26.1 28.1 23.7 25.3 18.8 22.4 22.0 Chdh 0.6 0.5 0.5 2.4 2.3 1.5 1.0 0.9 1.1 2.6 1.9 1.9 Chi3l1 0.8 0.8 1.1 2.5 2.3 1.3 0.3 0.4 0.3 0.9 0.8 0.6 Chi3l3 18.7 15.8 22.0 82.4 77.8 47.9 1.6 2.4 3.7 8.0 8.8 4.7 Chi3l4 1.5 1.5 2.1 8.1 7.6 4.5 0.2 0.2 0.3 0.7 0.7 0.6 Chpt1 5.4 4.5 4.8 7.4 8.4 5.8 3.0 3.5 3.9 4.6 4.7 4.3 Chst13 0.7 0.4 0.5 3.4 3.1 2.1 0.8 0.7 0.9 1.9 1.7 1.4

187 GENE ID FPKM values

Ctrl Ctrl Ctrl IR IR IR DL1 Ctrl1 Ctrl2 Ctrl3 IR1 IR2 IR3 DL1 1 DL1 2 DL1 3 DL1 1 DL1 2 3 Cisd1 30.3 33.5 34.6 18.3 21.5 25.8 34.8 35.0 36.6 30.0 32.9 32.7 Ckb 19.8 17.9 28.7 20.8 13.3 11.0 29.0 30.0 29.2 39.3 37.7 29.6 Clcn7 11.9 10.6 12.9 18.6 16.5 15.6 10.0 9.6 9.4 11.6 11.8 11.7 Cldn15 6.7 7.1 5.5 13.2 16.2 12.4 5.2 5.6 4.8 10.0 10.4 7.1 Clec10a 3.0 3.3 4.8 10.3 8.6 6.8 5.9 5.3 6.1 9.0 9.9 6.7 Clec12a 47.5 42.7 43.7 93.7 100.0 78.0 38.6 38.1 43.7 67.5 63.3 52.4 Clec4a1 60.1 47.2 73.0 115.6 75.8 69.1 45.6 52.2 37.9 72.3 66.0 60.9 Clec4a3 30.0 26.4 35.6 68.7 48.7 37.5 5.8 8.3 3.6 12.2 13.3 11.8 Clec4b1 4.8 4.3 5.4 9.4 6.7 6.4 2.9 2.9 1.8 5.3 4.4 4.1 Clec4b2 0.7 0.9 0.8 2.4 3.3 2.0 0.7 0.7 1.0 2.3 2.2 1.8 Clec7a 9.8 8.0 10.3 19.4 13.1 11.4 5.3 6.6 5.4 8.8 9.0 8.1 Cmah 23.0 21.5 16.4 11.8 14.6 13.0 14.4 14.2 12.9 13.4 11.8 10.3 Cmklr1 2.8 1.8 3.6 9.1 8.5 5.6 0.8 0.7 1.2 1.8 1.6 1.5 Cnn3 13.3 14.0 13.8 6.9 9.1 10.5 6.7 9.4 6.5 6.3 6.6 6.6 Cnnm2 1.9 2.0 2.0 3.5 3.1 2.4 1.3 1.5 1.3 2.1 2.1 1.8 Cnr2 5.2 5.1 4.8 8.9 7.9 6.8 2.6 2.6 2.2 3.2 3.9 3.6 Cntnap1 9.8 9.9 11.0 7.1 7.1 7.8 7.1 7.7 7.3 6.9 6.5 6.5 Cobll1 1.4 1.4 1.4 0.7 0.8 0.7 1.2 1.2 1.1 0.9 0.7 0.8 Col4a1 5.4 6.2 5.2 1.7 3.7 3.6 3.1 3.5 2.6 1.2 2.1 2.2 Col4a2 5.1 5.4 5.0 1.8 3.5 3.6 2.8 3.2 2.4 1.0 2.2 2.1 Cpa3 16.5 20.7 20.4 31.5 30.2 28.9 33.6 55.7 81.4 52.7 57.9 44.4 Cpne2 21.9 19.5 19.6 36.6 38.8 34.1 8.2 8.4 6.4 11.1 11.9 11.5 Crat 6.9 6.1 6.9 10.7 10.0 8.8 4.8 5.0 5.1 6.8 6.2 6.2 Creb5 1.4 1.3 1.5 3.7 2.4 2.2 0.3 0.3 0.3 0.7 0.9 0.7 Crlf2 20.7 21.5 25.4 33.3 27.6 29.8 27.7 25.5 24.8 26.2 25.7 28.5 Crocc 3.5 3.8 4.0 3.2 3.1 2.8 3.8 3.5 3.8 3.3 3.2 3.7 Csf1 0.7 0.7 0.9 1.4 1.4 1.2 0.4 0.5 0.6 0.7 0.6 0.6 Csf1r 153.0 120.9 181.3 296.9 218.3 198.9 52.3 65.5 46.5 82.3 86.0 79.4 Csf2ra 39.2 38.8 50.3 72.0 61.5 58.5 27.6 29.3 25.4 40.5 41.1 38.1 Csgalnact2 39.0 38.6 32.8 51.6 57.4 43.9 33.5 35.3 37.1 44.6 43.1 38.2 Cst7 54.2 49.4 49.8 81.8 78.5 71.8 43.6 45.3 46.8 65.8 66.6 54.3 Cstb 88.3 87.2 102.6 196.1 179.3 164.2 52.9 59.7 51.9 76.6 95.1 78.3 Ctsb 112.8 91.7 133.0 288.1 218.5 186.2 55.8 59.4 54.9 75.3 78.0 67.8 Ctsd 263.3 230.3 287.6 521.9 451.7 387.4 156.9 162.1 156.3 178.7 184.5 180.1 Ctse 1.9 2.4 1.9 3.9 3.5 3.1 0.8 0.9 0.4 1.1 1.2 1.2 Ctsg 774.3 833.8 677.4 1110 1288 1141 474.2 522.0 445.4 726.7 806.2 659.5 Ctsh 47.9 40.8 64.7 97.0 68.7 61.0 19.2 22.4 20.8 34.2 38.2 30.1 Ctsl 100.5 81.4 112.2 237.4 207.7 153.3 33.4 35.1 37.8 48.8 46.8 45.4 Ctss 314.7 251.6 394.2 793.5 589.6 455.4 119.1 131.1 124.1 205.6 200.5 167.8

188 GENE ID FPKM values

Ctrl Ctrl Ctrl IR IR IR DL1 Ctrl1 Ctrl2 Ctrl3 IR1 IR2 IR3 DL1 1 DL1 2 DL1 3 DL1 1 DL1 2 3 Cttnbp2nl 9.9 7.5 11.4 18.0 13.1 9.8 3.5 3.9 3.6 6.1 6.6 4.8 Cugbp1 26.5 25.0 22.7 18.5 20.4 21.7 22.3 23.2 24.7 24.6 22.4 23.4 Cxcl16 14.2 10.9 18.1 38.6 24.8 26.8 6.3 6.1 6.2 8.4 9.0 7.6 Cyba 224.6 227.6 291.5 382.0 320.9 309.4 185.1 202.9 172.0 227.2 248.6 221.9 Cyp11a1 0.4 0.6 0.3 1.0 1.6 0.8 1.0 1.3 2.3 1.0 1.7 1.4 Cyp4v3 6.5 5.5 7.0 14.6 12.3 10.5 2.2 2.5 2.3 3.4 4.1 2.9 Dab2 13.5 11.0 14.8 37.4 30.8 20.6 1.8 1.7 1.4 2.3 2.9 2.0 Dach1 3.5 3.0 3.0 5.4 6.1 4.5 1.9 1.9 1.6 2.3 2.6 2.2 Daglb 5.9 6.3 6.1 11.5 10.7 9.9 5.5 4.9 5.7 7.5 6.8 7.4 Dazap1 75.3 79.9 76.6 60.7 66.8 71.6 86.9 82.5 82.8 76.9 79.0 79.2 Dbf4 39.8 39.3 37.4 25.6 28.0 33.6 40.7 40.5 40.8 37.2 38.2 40.4 Dctd 20.4 20.7 19.2 12.4 14.3 16.3 19.1 17.5 17.6 13.5 15.3 13.3 Ddhd1 4.7 4.3 4.5 6.0 5.5 5.0 4.6 3.8 4.2 4.4 4.9 4.3 Degs2 1.8 1.6 1.5 3.5 3.3 2.7 2.3 2.5 2.5 2.8 2.7 2.5 Dennd2a 0.3 0.3 0.4 1.8 1.7 1.0 0.1 0.2 0.1 0.4 0.7 0.5 Depdc1a 10.3 9.6 9.5 7.2 7.6 8.2 11.2 9.9 10.8 9.4 10.0 9.6 Dgat2 14.8 15.8 15.0 22.6 24.2 17.6 13.7 13.3 13.9 19.5 21.5 15.9 Dhrs3 7.0 5.1 8.8 18.4 13.5 11.0 3.0 3.1 2.9 3.6 3.8 4.2 Dio2 5.4 5.1 3.8 10.8 12.9 10.1 3.1 3.4 3.1 6.3 6.3 5.1 Dmpk 2.6 2.3 3.6 5.3 4.5 3.8 1.3 1.5 1.0 1.7 2.0 1.6 Dmxl2 14.9 13.7 14.6 25.5 20.1 16.9 6.6 6.6 6.0 8.4 9.5 7.9 Dnajc2 98.8 102.3 89.4 64.5 74.6 79.1 101.4 102.0 99.6 92.3 88.0 96.7 Dnase1l1 20.1 18.4 24.1 34.7 25.6 29.4 10.3 10.2 8.3 12.9 14.4 12.7 Dnmt3a 13.4 14.2 13.2 12.2 12.1 11.0 18.4 17.5 20.9 16.9 14.0 15.1 Dnmt3b 14.2 14.8 13.2 7.9 9.8 11.0 15.8 14.5 16.8 11.2 11.4 13.0 Dok3 29.2 29.1 36.3 53.6 48.2 48.6 25.2 23.8 23.2 33.2 35.5 30.6 Dpep2 51.1 43.9 59.9 103.5 79.6 70.2 12.3 15.7 11.5 22.1 24.8 19.9 Dpp4 3.5 2.4 4.3 2.5 1.9 1.7 14.4 12.8 17.2 16.8 11.1 11.2 Dstn 110.2 103.7 99.2 168.7 184.8 139.9 84.4 82.8 85.3 123.8 129.1 101.1 Dynll2 35.7 40.4 35.3 30.3 33.2 34.1 47.8 45.0 46.3 41.4 39.1 43.8 Dyrk1b 2.4 2.2 2.6 4.2 3.0 3.3 3.0 3.0 3.4 3.1 3.4 2.5 Dzip3 7.2 7.1 7.0 5.7 6.1 5.7 6.6 7.0 7.6 6.8 6.5 6.2 E130112L23Rik 2.6 2.9 3.7 2.3 1.6 2.0 6.1 5.8 6.9 6.5 5.8 5.4 Ecm1 26.3 21.3 30.0 70.4 58.7 48.9 4.7 5.9 3.8 7.3 9.2 7.4 Ednrb 2.7 1.9 2.9 6.2 5.1 3.5 0.3 0.3 0.2 0.7 0.5 0.5 Efcab4a 2.1 1.5 2.0 3.9 4.4 3.3 0.9 1.0 1.0 1.3 1.7 1.2 Efhd2 80.3 76.4 92.8 133.0 110.2 97.1 73.1 74.2 75.5 82.9 84.8 83.8 Egfl7 58.1 64.6 63.6 26.5 31.8 43.7 56.3 58.5 48.3 34.1 40.6 38.0 Ehd4 29.9 30.1 30.2 45.6 42.5 36.2 20.7 20.5 20.2 24.3 25.6 22.9

189 GENE ID FPKM values

Ctrl Ctrl Ctrl IR IR IR DL1 Ctrl1 Ctrl2 Ctrl3 IR1 IR2 IR3 DL1 1 DL1 2 DL1 3 DL1 1 DL1 2 3 Elane 518.0 538.3 472.8 1205 1465 1032 299.2 301.2 369.4 708.5 767.2 542.5 Eltd1 46.4 47.7 43.5 23.6 29.1 35.8 31.5 33.4 30.2 19.5 19.9 23.4 Emp1 10.8 9.0 13.8 28.8 21.5 18.2 15.8 15.5 22.1 16.8 14.2 18.2 Emr1 29.0 20.4 35.0 80.0 53.9 39.7 9.2 11.2 9.1 17.1 16.2 14.4 Eno3 7.8 7.7 9.2 6.9 6.9 5.7 11.0 11.9 11.8 11.3 11.1 10.4 Enpp5 0.7 0.7 0.4 1.4 1.5 1.0 0.5 0.5 0.4 0.8 0.6 0.6 Entpd1 5.4 4.4 6.5 13.7 10.3 7.3 3.0 3.3 3.5 5.0 4.2 3.8 Epb4.1l1 0.4 0.4 0.4 0.8 0.7 0.5 0.2 0.2 0.2 0.1 0.1 0.2 Epb4.1l3 2.9 3.3 3.1 1.7 1.8 1.6 2.8 3.3 2.6 1.6 2.0 2.0 Epb4.1l4b 2.6 2.3 3.0 1.1 1.4 1.6 3.0 3.1 3.3 2.4 2.2 2.7 Ephb2 1.2 1.6 2.0 0.5 0.4 0.5 3.3 3.3 4.4 3.3 2.0 2.6 Esr1 1.1 0.9 0.8 1.7 2.1 1.8 0.5 0.8 0.6 1.1 1.1 1.2 Ets1 0.7 0.7 0.7 1.2 1.7 0.9 0.5 0.4 0.5 1.0 0.9 0.5 Ezh2 55.3 58.5 51.4 36.5 40.9 45.7 64.2 62.7 64.9 57.9 56.3 55.2 F10 40.1 36.6 42.5 87.9 69.5 58.5 11.0 11.2 10.7 22.1 24.1 18.7 F13a1 304.2 268.2 282.0 552.4 481.5 359.9 47.5 58.0 40.4 91.3 99.7 74.9 F7 10.1 9.2 12.4 28.6 29.6 22.6 1.5 1.6 1.6 2.5 3.3 2.8 F730016J06Rik 0.4 0.5 0.4 1.3 1.0 0.8 0.1 0.2 0.1 0.5 0.5 0.4 Fads2 66.6 63.9 68.8 44.4 46.5 54.5 97.1 93.6 99.0 84.2 81.1 83.2 Fam101b 2.9 2.8 3.1 5.4 6.0 3.8 3.8 3.6 4.8 6.5 5.7 5.0 Fam102a 6.0 5.6 6.3 3.7 3.5 4.7 11.2 10.7 11.5 7.8 7.6 9.7 Fam133b 35.9 33.5 32.9 22.7 23.9 27.2 36.3 37.8 32.7 29.6 30.5 31.8 Fam135a 1.0 0.9 0.9 0.5 0.6 0.5 1.1 1.0 1.2 0.8 0.8 0.9 Fam160a2 6.7 7.0 6.4 10.9 11.3 9.2 3.5 3.3 3.5 5.6 6.2 4.4 Fam20c 6.7 5.5 7.2 18.3 13.9 10.9 1.3 1.6 1.1 2.1 2.7 2.1 Fam46c 1.0 0.5 1.0 2.9 2.3 1.5 2.1 1.7 2.7 3.2 3.3 2.7 Fam54a 24.0 23.8 22.9 14.7 17.2 20.1 22.4 22.5 22.8 20.0 21.6 17.9 Fam60a 36.0 35.9 34.9 24.8 26.9 27.8 36.0 37.5 39.4 33.9 31.4 34.9 Fam65b 13.0 11.6 13.0 11.3 12.6 9.6 15.9 16.8 17.2 16.0 15.5 14.6 Fam84b 29.2 28.6 27.9 20.1 20.2 24.7 43.3 38.7 45.1 35.8 33.3 38.0 Far2 2.9 2.8 2.9 6.0 8.5 5.3 2.5 2.4 3.0 4.3 4.4 3.2 Fblim1 1.7 1.2 2.4 7.3 5.7 4.2 0.2 0.1 0.1 0.2 0.3 0.2 Fbxo9 17.8 18.3 15.6 19.6 21.6 21.3 18.6 18.4 17.1 18.8 18.8 19.3 Fcer1a 1.1 2.5 1.9 6.9 7.5 4.7 1.8 5.2 6.1 6.0 5.7 3.6 Fcgr1 10.6 9.0 13.8 27.5 19.6 15.4 5.1 5.2 4.4 6.6 8.0 6.8 Fcgr3 151.1 135.5 170.9 311.4 275.6 219.9 70.0 76.4 65.3 106.3 125.8 97.6 Fcgr4 18.5 15.0 22.9 38.6 30.3 23.4 5.4 6.1 4.8 10.3 12.3 7.5 Fcnb 17.3 16.1 17.0 57.4 54.2 28.1 11.5 10.3 13.1 31.8 38.8 17.2 Fcrls 3.0 2.0 4.7 20.1 17.5 10.6 0.3 0.4 0.4 0.5 0.8 0.5

190 GENE ID FPKM values

Ctrl Ctrl Ctrl IR IR IR DL1 Ctrl1 Ctrl2 Ctrl3 IR1 IR2 IR3 DL1 1 DL1 2 DL1 3 DL1 1 DL1 2 3 Fgd4 6.9 6.1 5.5 14.8 14.5 8.6 2.7 3.3 3.1 6.6 6.4 4.9 Fgf3 0.5 1.0 1.0 2.3 2.5 2.1 4.3 3.2 4.1 4.0 2.8 3.8 Fgfr1 0.9 0.8 1.0 0.4 0.5 0.4 1.6 1.4 1.8 1.5 1.1 1.0 Fgl2 28.4 23.3 27.8 53.0 48.6 29.7 33.0 34.6 41.6 62.5 52.0 41.5 Flrt3 0.2 0.3 0.3 0.9 0.5 0.4 0.1 0.1 0.2 0.3 0.1 0.2 Flt3 14.2 13.0 16.3 7.3 4.8 6.6 26.9 27.2 33.3 25.2 20.8 23.9 Fmn1 0.3 0.3 0.3 0.8 0.6 0.4 0.1 0.2 0.1 0.2 0.2 0.1 Fmo5 1.2 1.2 1.0 2.3 2.4 1.7 0.9 1.0 1.0 1.6 1.4 1.1 Fn1 21.6 18.0 19.7 43.9 37.7 24.0 0.6 0.9 0.5 1.1 1.3 1.2 Frmd4b 2.0 1.5 2.5 5.2 3.9 2.8 0.5 0.5 0.4 0.5 0.4 0.3 Fscn1 9.2 6.3 12.9 10.6 5.2 3.7 15.6 16.2 15.9 15.3 14.7 14.2 Fubp1 44.6 42.3 37.3 27.4 29.8 36.6 42.0 41.6 38.5 36.0 33.5 37.7 Furin 26.9 24.0 28.5 40.9 35.7 31.2 14.1 16.1 15.2 17.4 17.6 17.5 Fyn 9.4 10.4 11.1 6.4 6.9 7.0 14.0 14.2 15.1 14.2 12.9 13.2 Fzd6 1.6 1.2 1.4 0.7 1.1 0.9 1.4 1.3 1.5 1.2 1.1 0.9 G2e3 11.9 11.7 10.1 9.0 8.6 10.0 11.6 11.1 11.1 10.0 9.4 11.1 Gab1 3.0 2.8 3.0 5.3 4.6 3.7 0.9 1.1 0.9 1.1 1.2 1.1 Gabpb1 30.5 28.1 27.0 20.7 23.3 25.8 27.5 26.7 28.2 25.4 25.0 25.1 Galc 5.9 5.7 5.6 9.8 9.2 7.7 2.4 2.4 2.3 2.8 3.1 2.6 Galm 2.4 1.9 2.7 5.4 5.2 2.9 1.4 1.6 1.6 2.9 3.7 2.2 Galnt7 19.4 18.6 18.2 17.1 17.2 16.5 18.9 18.7 20.3 19.3 17.8 18.5 Galr3,Gcat 22.7 23.6 23.9 14.0 16.5 18.1 24.8 27.1 25.7 22.6 22.5 21.0 Gas2l1 3.7 2.8 4.3 5.9 5.2 4.2 2.8 2.2 2.9 3.0 2.6 3.2 Gas5 73.8 77.3 83.3 46.8 59.7 73.7 92.5 85.7 85.0 73.1 77.7 78.8 Gas6 1.3 0.9 2.0 7.8 6.7 5.1 0.0 0.1 0.1 0.2 0.2 0.1 Gatm 26.1 23.6 25.3 42.6 48.8 38.3 18.8 17.0 18.7 29.7 31.8 23.6 Gbgt1 1.2 0.8 1.8 4.1 3.1 2.6 0.1 0.4 0.3 0.4 0.9 0.3 Gca 7.3 7.3 6.0 10.3 11.0 9.1 5.4 5.3 5.9 7.9 8.0 6.7 Gda 57.2 52.3 48.7 90.2 83.9 66.8 22.6 23.8 21.8 39.9 38.8 34.8 Gem 13.0 13.7 11.2 3.2 6.7 7.9 10.1 11.0 8.8 3.7 5.3 5.6 Gfi1 22.9 24.3 19.7 42.9 50.8 39.3 13.7 13.9 15.3 24.9 26.7 22.0 Ggt1 1.5 1.9 1.7 0.3 1.0 0.8 3.7 3.2 4.3 2.6 2.1 2.5 Gimap1 5.9 6.7 5.7 2.7 4.1 4.7 11.3 11.5 12.2 7.4 6.6 8.5 Gimap6 5.3 5.2 5.4 1.5 2.7 3.2 8.3 9.2 8.8 4.0 4.3 4.5 Gja1 22.2 22.5 21.0 14.4 17.0 16.7 11.4 10.7 10.2 8.4 10.4 9.0 Glipr2 26.8 28.1 29.4 19.5 19.5 20.7 21.8 22.6 20.7 19.5 22.7 18.2 Gm10052 340.0 340.5 326.9 226.4 260.3 281.2 324.3 332.5 324.2 301.1 293.1 314.8 Gm11710 3.1 2.3 3.1 9.0 6.0 4.7 0.2 0.5 0.3 1.0 0.6 0.6 Gm14085 2.8 2.7 2.3 4.3 4.9 4.1 3.1 3.1 3.1 4.0 4.3 3.8

191 GENE ID FPKM values

Ctrl Ctrl Ctrl IR IR IR DL1 Ctrl1 Ctrl2 Ctrl3 IR1 IR2 IR3 DL1 1 DL1 2 DL1 3 DL1 1 DL1 2 3 Gm3903 970.8 1033 994.2 722.7 657.3 755.4 990.8 990.6 1107 942.2 1026 863.0 Gm5073 0.2 0.2 0.4 0.8 0.6 0.5 0.0 0.1 0.0 0.1 0.1 0.1 Gm5150 9.2 8.7 12.6 28.9 22.1 17.8 1.9 2.7 1.6 4.0 4.1 3.6 Gm5643 152.2 152.3 146.6 99.2 112.9 123.2 145.3 150.1 145.3 132.6 129.1 138.5 Gm5803 108.4 109.2 104.4 71.0 83.0 93.5 102.0 109.1 102.5 98.8 93.5 100.6 Gm6522 1.7 1.5 1.9 7.3 7.0 4.4 0.2 0.3 0.3 0.6 0.8 0.5 Gm6958 39.2 28.2 39.7 24.1 8.0 30.2 62.3 36.6 50.6 41.0 16.7 52.8 Gm8615 5.6 4.8 6.1 10.4 8.8 8.3 3.4 3.7 3.3 4.3 4.1 4.3 Gm9531 348.9 354.0 316.8 224.8 260.1 268.2 324.0 329.2 337.9 299.0 290.1 288.4 Gnpda1 13.5 12.2 14.3 25.6 22.2 19.4 8.2 8.7 7.7 10.7 10.1 10.2 Gns 26.9 23.0 28.5 46.4 39.5 34.2 14.6 15.3 14.7 19.7 18.9 20.2 Got1 27.7 30.1 29.8 17.8 21.3 22.0 28.0 28.7 28.0 22.8 22.8 22.1 Gp1bb,Sept5 1.0 0.7 0.9 2.2 2.1 1.2 0.7 0.6 0.5 1.3 1.7 0.9 Gp49a 80.7 66.3 94.3 139.7 112.6 105.7 31.9 34.7 23.9 39.5 50.5 42.1 Gpc1 7.7 6.0 6.3 18.6 15.5 12.4 9.3 10.1 11.7 17.3 16.8 15.9 Gpnmb 70.0 53.4 92.6 222.0 186.5 160.7 4.4 7.8 5.9 13.2 15.2 15.8 Gpr114 1.2 1.0 2.1 1.2 0.6 0.5 12.7 12.2 17.5 15.5 11.7 11.9 Gpr128 1.7 1.2 1.5 3.0 3.0 2.8 2.3 2.4 3.0 3.6 2.7 2.7 Gpr141 36.5 30.6 35.2 55.7 44.1 40.9 24.5 27.4 28.0 34.2 31.4 30.2 Gpr146 7.4 6.4 7.8 12.7 10.3 9.1 6.0 6.1 6.1 7.9 7.0 7.2 Gpr34 3.9 2.6 4.6 8.6 6.6 5.3 2.4 2.8 3.3 4.3 2.9 3.1 Gpr35 8.7 6.3 9.7 17.7 12.2 10.9 4.0 4.6 4.6 8.3 7.5 6.5 Gpr77 1.5 1.1 1.4 3.5 3.0 1.7 0.5 0.4 0.4 0.7 0.7 0.7 Gpx3 4.2 4.1 5.4 9.6 11.2 6.8 1.4 1.7 1.7 3.5 4.0 2.2 Grap 3.9 3.7 4.6 1.9 1.8 2.5 10.4 9.3 10.4 9.1 8.5 8.7 Grb14 0.3 0.2 0.2 0.9 0.9 0.7 0.2 0.2 0.3 0.7 0.5 0.2 Grina 57.0 55.0 70.2 93.3 85.1 87.5 32.3 35.8 30.8 40.2 46.9 39.5 Grn 137.6 117.2 152.3 256.0 209.1 190.2 78.9 83.2 82.7 118.4 115.8 113.2 Gsn 57.0 49.6 70.7 103.4 77.9 65.0 78.7 79.4 89.9 99.6 90.2 81.5 Gstm1 118.2 109.6 92.6 209.5 237.0 206.2 58.6 63.4 57.9 100.1 110.4 95.4 Gstm2 2.1 1.7 1.4 3.1 4.3 4.0 0.9 1.3 1.0 1.7 2.0 1.4 Gstm3 6.6 7.9 6.3 13.2 14.2 13.0 4.1 3.9 3.8 5.4 6.0 5.3 Gstm4 7.7 9.1 7.0 10.2 11.9 11.0 5.9 6.5 6.2 7.6 10.0 7.5 Gtse1 16.6 16.5 15.8 12.9 12.3 15.6 17.0 17.5 17.4 16.9 16.6 18.2 H2-Aa 162.8 122.5 227.4 354.3 173.1 188.9 226.7 208.4 222.9 357.2 306.5 268.8 H2-Ab1 124.9 111.5 189.5 282.3 150.5 162.9 177.2 160.4 190.5 290.7 243.0 215.9 H2-D1 259.8 261.2 286.9 450.0 392.4 397.4 141.3 156.1 134.3 176.6 180.8 184.1 H2-DMa 55.6 49.4 66.5 97.8 70.9 71.0 68.0 70.3 73.8 91.1 89.7 84.2 H2-gs10 31.7 33.7 33.5 47.1 43.6 50.9 23.3 25.1 21.2 25.0 25.5 28.3

192 GENE ID FPKM values

Ctrl Ctrl Ctrl IR IR IR DL1 Ctrl1 Ctrl2 Ctrl3 IR1 IR2 IR3 DL1 1 DL1 2 DL1 3 DL1 1 DL1 2 3 H2-K1 306.3 310.0 329.5 455.8 423.1 428.3 202.2 225.4 195.0 231.2 235.7 248.7 H2-Ke2 89.4 99.4 101.3 69.2 83.7 89.5 106.8 101.3 97.8 97.1 103.3 100.0 H2-Q6 13.1 12.9 13.4 24.2 20.6 21.2 7.0 8.3 6.9 9.5 8.9 10.0 H2-Q8 8.8 10.0 10.8 16.0 14.6 16.4 6.0 6.6 4.6 6.9 6.8 7.9 H2-Q9 12.4 14.2 13.8 25.6 22.8 22.8 7.4 8.4 6.2 9.4 9.8 10.4 Hagh 10.3 12.3 12.5 17.1 15.3 17.4 13.6 11.8 11.2 13.8 14.2 13.4 Havcr2 1.8 1.2 2.0 4.3 3.2 2.2 2.7 3.2 3.8 5.9 4.5 3.5 Hbb-b1 28.6 34.3 32.5 8.3 14.0 22.5 13.6 13.9 6.2 2.7 4.7 8.4 Hdac9 1.0 0.7 1.0 0.5 0.4 0.5 0.6 0.8 0.6 0.6 0.6 0.5 Hdc 8.3 8.0 8.8 15.5 18.1 15.8 10.0 11.1 11.7 15.6 13.4 13.5 Heatr7a 9.8 9.3 10.7 15.8 13.6 11.9 7.5 7.5 8.0 9.2 9.2 9.2 Hells 59.7 55.7 49.3 34.3 41.7 43.5 53.2 52.2 51.2 47.0 43.0 43.9 Hexa 78.9 71.2 89.4 152.3 126.8 110.3 47.5 46.9 46.0 64.0 67.9 57.2 Hexb 33.0 29.9 35.5 59.2 50.6 40.0 26.3 26.9 27.4 35.9 37.3 32.7 Hif3a 1.7 1.6 1.5 0.6 0.7 0.5 1.1 1.2 0.9 0.4 0.6 0.4 Hirip3 38.7 41.8 39.8 25.0 29.8 34.6 45.9 44.7 43.3 39.5 39.2 39.1 Hk3 47.1 46.8 46.1 103.0 104.4 93.8 33.2 39.5 31.8 62.3 69.3 61.8 Hmga2 5.3 5.2 5.0 2.2 3.7 3.8 1.4 1.3 1.3 0.9 1.2 1.2 Hmgn1 121.0 132.1 128.9 68.9 81.0 90.4 173.9 163.0 164.9 136.3 132.8 141.2 Hmox1 62.3 56.8 75.8 110.7 89.2 93.7 37.7 43.6 41.5 34.9 39.5 37.8 Hnmt 1.5 1.4 1.3 3.6 2.8 2.1 0.5 0.5 0.3 0.9 1.1 0.9 Hnrnpa1 351.1 352.7 335.9 229.6 263.5 286.3 335.7 343.9 336.4 307.7 301.3 320.9 Hnrnpa2b1 788.6 774.5 747.9 566.3 642.8 709.6 843.2 839.5 807.3 774.8 740.5 784.1 Homer2 0.5 0.5 0.4 0.6 0.8 0.6 0.4 0.4 0.5 0.3 0.5 0.4 Hpgd 2.0 1.8 2.6 1.0 0.7 0.7 1.3 1.7 1.6 2.4 2.4 1.9 Hpgds 7.3 6.2 8.2 13.8 10.6 8.3 11.4 10.0 14.0 16.1 13.9 10.2 Hpse 11.6 11.4 12.1 22.4 17.5 15.6 4.5 5.8 5.0 7.6 7.5 6.0 Hs1bp3 5.9 5.7 6.0 9.8 9.0 7.3 3.5 3.8 3.4 4.3 4.1 3.9 Hsd11b1 13.5 13.2 11.2 27.3 30.8 19.4 9.0 8.8 8.8 17.9 18.1 14.0 Hsd17b11 38.8 37.0 37.4 56.8 52.3 47.9 27.2 28.1 28.5 37.7 36.2 35.0 Hsd3b7 24.8 23.2 26.8 38.6 36.5 36.0 24.9 24.4 22.4 25.3 27.5 23.6 Hspa2 6.8 6.1 6.0 9.8 10.6 7.7 5.1 6.2 5.7 6.7 6.8 6.5 Hspd1 464.9 477.4 430.8 297.1 344.7 376.0 423.5 422.2 405.0 384.2 367.7 359.5 Hspe1 223.4 263.4 251.8 162.8 191.3 203.4 258.1 251.7 245.7 238.5 224.8 236.7 Hsph1 46.4 48.7 47.1 33.1 39.0 33.9 43.1 41.1 45.7 42.4 40.6 34.9 Hvcn1 16.4 15.0 17.0 37.8 34.5 28.9 25.7 23.5 30.3 40.0 34.1 32.4 I830127L07Rik31.5 29.1 31.4 77.6 77.0 58.2 18.0 19.6 18.3 34.8 47.1 25.9 Iars 73.4 69.7 65.5 48.7 56.5 56.9 70.4 70.3 70.7 63.6 61.7 63.2 Iffo1 5.3 5.1 6.2 6.9 6.0 7.1 5.5 5.9 4.9 6.0 5.5 6.5

193 GENE ID FPKM values

Ctrl Ctrl Ctrl IR IR IR DL1 Ctrl1 Ctrl2 Ctrl3 IR1 IR2 IR3 DL1 1 DL1 2 DL1 3 DL1 1 DL1 2 3 Ifi203 18.6 16.4 19.5 13.5 11.4 12.5 25.0 25.3 25.4 25.6 24.0 21.5 Ifi204 15.2 13.3 16.8 26.4 22.1 16.8 7.5 9.3 7.8 10.6 10.8 9.9 Ifi27l1 13.6 12.2 15.5 28.1 24.4 23.5 29.1 29.1 31.5 38.5 36.1 35.3 Ifngr1 134.2 124.0 135.7 205.5 195.1 170.1 68.5 76.3 69.1 99.2 108.8 94.2 Ifrd1 47.0 45.9 44.2 28.1 31.8 37.4 40.7 38.7 36.4 33.7 35.8 34.2 Igf2bp2 0.3 0.3 0.3 0.8 0.7 0.6 0.3 0.4 0.2 0.2 0.2 0.2 Igf2r 0.3 0.2 0.4 1.2 0.8 0.4 0.2 0.2 0.2 0.3 0.2 0.2 Igfbp7 0.4 0.6 1.4 2.4 2.0 1.6 0.7 1.1 0.7 0.7 1.3 1.1 Igsf6 96.9 87.3 94.3 144.5 146.7 123.4 56.9 59.8 50.9 83.3 102.7 73.8 Il10rb 32.0 31.2 35.5 50.9 43.2 41.4 19.7 21.8 18.0 21.4 23.0 21.3 Il12a 7.6 8.5 8.8 4.5 6.0 7.3 7.3 7.6 6.1 4.8 6.3 5.8 Il18bp 3.2 2.5 3.4 6.5 4.9 5.5 2.6 2.5 1.9 2.1 3.2 2.5 Il1r1 13.2 12.9 13.1 8.1 8.5 9.4 19.7 18.4 23.6 16.6 14.6 15.3 Il1rn 1.9 1.8 2.7 4.3 2.8 2.7 3.7 3.5 3.5 4.5 4.9 4.3 Il7r 1.3 1.0 1.9 3.1 2.3 2.1 0.8 0.6 1.1 1.2 0.7 0.8 Inpp5j 1.8 1.2 2.2 4.0 2.8 2.5 1.0 1.0 1.2 1.5 1.8 1.3 Inppl1 2.9 2.9 3.6 4.9 4.9 4.0 1.2 1.2 0.9 1.0 1.2 1.1 Irak2 7.0 6.1 7.8 10.7 9.8 9.2 6.5 6.8 6.5 8.3 8.9 7.9 Irgm2 4.5 4.1 4.7 7.8 5.9 6.2 6.3 6.3 6.5 7.5 7.0 7.6 Irs2 0.7 0.7 0.7 1.5 1.6 0.9 0.6 0.9 0.8 1.2 0.8 0.9 Itga2b 6.8 7.0 6.7 10.9 11.2 11.1 24.8 21.8 28.6 26.4 19.9 23.6 Itgb2 73.9 61.3 80.9 127.6 99.0 82.8 51.4 57.4 54.5 75.8 72.4 59.8 Itgb5 35.4 29.5 43.3 76.4 58.5 46.7 11.6 14.6 12.5 16.4 18.7 15.8 Itm2a 4.7 5.1 5.5 3.0 2.8 3.4 5.5 6.2 5.6 4.3 3.7 3.1 Itm2b 393.3 369.0 401.0 680.0 638.7 564.9 286.5 305.4 296.8 378.5 398.1 370.8 Itpr2 2.0 1.8 2.1 3.8 2.9 2.3 2.2 2.0 2.3 2.6 2.4 2.2 Itpr3 5.3 5.2 5.5 3.9 3.7 3.6 5.6 5.9 5.9 5.5 5.1 5.8 Jag2 2.3 2.3 2.0 1.2 1.7 1.2 2.6 3.3 2.9 1.6 2.0 2.2 Kars 125.6 133.4 126.7 94.5 104.0 120.6 142.0 140.6 138.8 124.3 126.8 131.7 Kcnk13 1.6 1.2 1.8 4.3 3.2 2.3 0.6 0.4 0.4 0.8 0.7 0.8 Kcnn3 0.2 0.2 0.2 0.8 0.6 0.3 0.0 0.0 0.0 0.0 0.0 0.0 Kctd12 36.4 30.0 34.1 58.6 47.6 36.1 21.6 23.4 21.9 26.8 25.9 24.8 Kctd12b 0.4 0.2 0.3 1.1 0.5 0.6 0.1 0.1 0.1 0.1 0.1 0.1 Kif1b 3.5 3.0 3.1 5.6 5.0 3.7 2.0 2.1 2.0 3.3 2.7 2.4 Kif20a 48.9 46.4 45.8 31.5 35.1 38.9 47.6 46.9 49.3 44.7 44.7 45.9 Kif23 32.0 30.1 31.8 22.0 22.6 26.2 45.1 42.2 48.9 45.8 42.9 46.5 Klk8 2.4 2.1 2.6 1.1 1.0 1.4 14.9 12.5 16.5 10.5 10.2 8.6 Krt5 1.6 0.1 0.1 0.2 0.0 0.0 0.1 0.7 0.3 0.0 0.0 0.0 Lair1 9.6 8.5 9.9 17.2 16.0 12.3 10.5 11.0 11.0 14.9 13.6 11.1

194 GENE ID FPKM values

Ctrl Ctrl Ctrl IR IR IR DL1 Ctrl1 Ctrl2 Ctrl3 IR1 IR2 IR3 DL1 1 DL1 2 DL1 3 DL1 1 DL1 2 3 Lamp1 208.1 186.4 223.6 352.3 300.4 269.9 131.2 132.1 130.5 165.2 167.3 157.6 Lars2 324.2 385.2 316.2 767.1 574.6 301.7 363.2 354.2 413.5 283.3 465.0 410.2 Lgmn 43.4 31.9 59.7 125.8 96.1 76.4 30.4 30.6 32.2 45.7 43.0 39.0 Lilrb4 117.2 95.2 133.6 195.0 152.5 143.6 49.2 59.4 39.4 62.1 81.4 66.3 Lin28b 0.4 0.5 0.4 0.1 0.1 0.1 0.2 0.1 0.2 0.0 0.0 0.1 Lipa 29.8 24.4 31.1 51.9 40.7 35.8 18.6 20.0 18.6 25.1 22.5 20.2 Lipe 8.1 7.1 9.3 10.3 9.1 9.5 10.7 10.3 11.0 13.2 10.9 12.2 Lmnb1 122.0 127.6 123.7 85.9 94.5 104.0 140.8 138.4 146.4 133.5 126.8 134.4 Lmo4 55.2 58.8 58.3 40.7 47.1 54.1 52.8 50.3 46.6 46.9 53.3 47.7 LOC10003894742.6 35.9 50.6 101.9 77.1 61.5 7.0 9.6 5.3 14.7 17.2 12.2 LOC10004475114.0 14.7 9.5 8.2 8.4 13.8 17.8 15.2 12.0 11.0 12.1 13.5 LOC100502615176.1 211.7 155.5 91.0 118.3 123.9 151.7 136.9 120.1 111.9 129.4 112.0 LOC1005026601381 1394 1230 851.7 918.0 1095 1263 1321 1270 1144 1113 999.3 LOC100502703219.0 225.1 323.1 481.7 369.5 355.0 98.9 110.4 92.2 139.2 144.9 134.5 LOC100502995108.8 119.0 101.4 57.6 62.0 90.3 152.0 130.8 127.7 95.6 140.3 125.1 LOC100503083 2.6 2.8 2.7 0.7 0.6 0.9 3.1 2.1 1.9 0.7 1.1 0.5 LOC10050311499.8 101.2 121.7 181.9 152.5 171.3 65.7 69.7 66.2 78.0 91.3 73.6 LOC100503203125.3 162.0 256.4 57.9 156.6 109.1 122.3 156.7 113.1 352.7 103.9 94.9 LOC10050338027.2 25.9 20.3 15.1 17.8 23.2 32.7 29.7 24.2 21.6 20.6 26.2 LOC10050360521.1 25.5 22.6 6.3 11.0 16.2 10.3 10.5 5.1 1.8 3.5 5.7 LOC100503910337.2 369.8 369.8 272.7 211.8 326.4 463.3 439.3 434.2 449.5 398.3 486.9 LOC100504177 2.7 2.2 2.2 7.7 7.9 3.8 1.2 1.3 1.4 3.5 3.4 2.4 LOC1005042724171 3783 4320 3862 4115 3523 3908 3851 4157 3903 3812 4459 LOC100504567546.3 606.1 597.3 457.9 504.4 572.4 719.4 687.0 661.0 655.8 641.2 628.8 LOC10050467010.8 9.6 52.5 125.6 131.9 91.4 40.2 55.4 30.6 64.0 32.5 138.1 LOC10050468629.8 30.8 26.4 18.1 19.6 25.5 37.8 32.3 29.9 27.7 32.6 31.9 LOC100504717 1.2 1.2 1.5 0.5 0.1 0.9 0.4 0.3 0.1 0.4 0.3 0.4 LOC236598 815.0 1055 945.0 2281 1678 856.5 1018 976.5 1293 857.8 1044 2508 LOC236598 3356 3912 3208 7824 5949 3111 3741 3552 4478 2837 4568 4690 LOC236598 1938 2523 2079 5150 3852 2007 2443 2337 2877 1928 3416 3886 LOC668727 3.9 3.0 2.6 5.4 5.7 8.4 9.4 8.5 7.7 14.1 13.4 18.0 Lpar6 31.5 29.9 32.9 49.2 49.9 44.2 28.6 28.2 27.7 32.9 36.2 32.9 Lpcat2 19.6 17.8 20.8 36.0 29.2 25.3 16.2 16.7 17.9 20.7 20.0 20.8 Lphn2 2.4 2.1 2.0 3.6 3.9 2.6 1.5 1.5 1.4 2.2 2.2 1.7 Lpl 9.4 6.5 10.7 21.0 15.2 12.4 5.6 6.7 5.4 7.7 7.8 7.1 Lpo 0.4 0.5 0.5 0.9 1.2 0.9 0.4 0.3 0.4 0.6 1.0 0.7 Lrg1 30.9 28.3 36.9 71.5 60.6 45.2 5.3 5.7 4.3 10.7 11.5 9.8 Lrp1 18.8 16.7 20.8 35.3 25.4 18.8 10.3 10.3 10.8 15.0 15.3 13.7 Lrp12 5.1 4.2 5.0 9.1 7.6 5.4 4.4 4.5 4.9 4.5 4.2 4.5

195 GENE ID FPKM values

Ctrl Ctrl Ctrl IR IR IR DL1 Ctrl1 Ctrl2 Ctrl3 IR1 IR2 IR3 DL1 1 DL1 2 DL1 3 DL1 1 DL1 2 3 Lrp4 0.5 0.5 0.5 1.1 1.1 0.8 0.4 0.4 0.5 0.6 0.8 0.7 Lsm2 72.3 75.2 70.7 44.0 57.1 65.3 73.4 73.3 70.4 66.3 65.6 75.3 Lta4h 161.7 161.3 154.1 227.6 246.5 224.0 169.6 172.9 180.3 226.8 226.7 204.6 Ltb 8.1 8.6 11.7 6.7 4.9 5.1 18.6 20.1 17.7 17.8 17.5 16.9 Ltb4r1 33.2 32.8 37.7 57.8 56.5 39.0 19.8 20.0 19.3 27.1 30.7 24.8 Ltf 4.7 4.8 5.5 8.6 11.6 5.4 0.3 0.4 0.4 1.4 1.1 0.9 Ly6c1 63.9 57.9 65.0 121.6 114.0 101.4 45.0 45.9 44.7 63.2 67.1 54.2 Ly6c2 168.5 155.9 150.0 363.0 364.4 297.0 55.3 64.5 57.1 131.6 161.3 94.6 Lyz1 243.6 211.8 293.9 565.5 449.6 382.7 47.5 63.7 42.8 88.9 118.6 90.0 Lyz2 1970 1629 2346 4548 3635 3073 386.9 509.9 340.4 724.9 909.3 669.4 Maf 10.3 7.6 12.1 31.5 25.5 16.6 2.4 3.1 2.6 4.0 4.4 3.9 Mafb 4.9 5.0 6.5 17.4 15.5 8.4 0.6 0.7 0.6 1.5 1.4 1.3 Man2b1 61.2 51.1 62.8 108.0 88.3 71.8 54.8 53.9 58.1 69.0 62.7 61.2 Map4k4 31.8 29.0 31.6 24.3 21.4 23.6 32.6 33.4 34.9 31.2 28.5 32.8 Marcks 9.5 7.7 11.6 19.5 14.8 11.2 10.8 10.9 11.8 12.5 11.6 12.0 Marveld1 5.2 5.7 5.1 7.5 8.8 7.8 3.5 3.7 3.8 4.4 4.3 4.9 Mat2a 136.4 138.8 116.5 86.3 103.5 111.3 135.1 130.0 119.4 106.4 106.1 113.1 Matk 9.3 10.0 10.0 14.8 15.5 13.9 10.0 11.3 9.7 12.7 13.8 11.4 Mboat2 4.8 4.9 4.3 2.1 3.1 2.8 6.9 6.6 7.5 5.6 5.3 5.3 Mcf2l 1.8 1.7 1.7 3.9 3.5 3.1 0.8 0.8 0.8 1.3 1.3 1.1 Mcfd2 51.8 49.6 46.3 68.0 71.7 68.7 42.4 40.1 39.1 46.1 51.8 47.2 Mcpt8 49.6 54.4 43.2 66.6 91.3 94.7 46.0 52.3 45.6 53.5 69.4 64.2 Mctp1 5.8 5.1 4.5 8.5 9.1 7.2 3.3 3.4 3.3 4.2 4.9 3.9 Mdfic 7.5 6.2 7.8 13.5 10.8 9.4 4.9 5.6 5.1 7.1 5.9 6.6 Mdm1 6.7 7.0 6.7 5.5 6.2 6.2 7.2 7.0 7.9 7.6 7.9 6.8 Mef2c 14.8 14.3 15.3 10.4 9.8 10.0 16.6 17.6 18.0 16.5 14.5 15.5 Megf9 4.0 3.6 3.2 7.6 7.7 4.4 2.6 3.0 2.9 5.7 4.2 4.3 Mertk 2.0 1.4 2.8 7.2 5.6 4.0 0.2 0.2 0.2 0.4 0.4 0.3 Metrnl 5.0 4.3 5.8 10.6 8.8 8.0 2.2 2.6 1.7 2.6 3.3 2.8 Mex3a 3.5 4.1 3.4 1.6 2.5 3.0 5.7 5.4 6.5 4.6 3.8 4.8 Mfap3l 0.6 0.4 0.4 0.8 0.9 0.8 0.3 0.3 0.3 0.4 0.6 0.5 Mfhas1 0.6 0.6 0.6 1.5 1.1 0.8 0.4 0.3 0.4 0.5 0.6 0.5 Mgam 2.2 1.7 1.4 3.1 3.0 2.5 1.4 1.0 1.2 2.2 2.0 1.7 Mgl2 1.4 1.2 1.6 4.9 5.8 3.4 1.2 1.0 1.4 2.2 2.5 1.6 Mgst1 45.4 46.2 47.4 76.3 69.1 64.5 23.3 27.6 23.4 40.4 42.5 34.3 Mgst2 35.6 34.7 32.8 63.8 75.0 63.1 30.7 35.3 37.1 60.2 62.3 50.2 Mid1 3.6 6.2 2.8 3.0 3.2 35.0 6.9 6.8 3.2 3.0 5.3 50.0 Mitf 2.3 1.9 2.3 4.3 3.2 3.1 1.1 1.2 1.2 1.5 1.7 1.7 Mki67 81.8 84.8 71.2 51.1 54.9 59.3 95.2 86.5 87.6 90.6 94.8 89.8

196 GENE ID FPKM values

Ctrl Ctrl Ctrl IR IR IR DL1 Ctrl1 Ctrl2 Ctrl3 IR1 IR2 IR3 DL1 1 DL1 2 DL1 3 DL1 1 DL1 2 3 Mmp14 19.8 15.3 25.3 46.8 30.0 28.8 4.8 6.7 6.0 8.8 9.3 8.3 Mocos 5.4 4.6 4.9 9.1 7.6 6.3 3.4 4.1 3.3 5.2 5.7 4.8 Mogat2 2.0 2.3 1.7 5.6 5.7 3.2 1.2 1.7 1.8 4.2 3.9 2.1 Mon1b,Syce1l 8.0 7.4 7.6 9.4 8.9 8.1 7.7 6.9 8.1 8.0 7.5 7.3 Moxd1 0.5 0.4 0.6 0.1 0.1 0.2 1.3 1.0 1.4 0.6 0.8 0.6 Mpeg1 110.7 82.7 115.5 252.2 182.4 138.9 32.8 39.8 33.4 58.7 55.9 48.5 Mpo 1647 1683 1334 2726 3218 2646 1003 1100 1049 1719 1814 1564 Mpp1 33.0 28.4 30.2 48.3 47.2 40.2 17.8 19.1 18.2 24.7 25.5 22.5 Mpzl1 4.0 3.8 3.8 2.1 2.0 2.3 3.4 3.0 3.1 2.4 2.6 2.0 Mrc1 6.3 3.9 8.6 33.6 27.6 14.0 0.1 0.3 0.3 0.9 0.7 0.5 Mrgpra2 4.3 3.6 2.8 6.1 6.6 10.0 10.3 8.9 8.2 15.3 14.2 19.5 Mrpl15 21.8 23.5 22.7 17.6 20.3 20.7 21.7 22.6 23.2 21.0 20.7 22.5 Ms4a14 0.8 1.0 1.0 2.4 2.0 2.9 0.1 0.2 0.1 0.2 0.2 0.2 Ms4a4a 68.4 53.6 77.7 165.7 121.6 98.1 17.0 19.2 15.1 28.3 35.7 28.6 Ms4a6d 59.7 45.1 71.0 114.8 85.3 67.1 17.3 21.8 18.1 31.2 35.1 27.9 Ms4a7 24.9 21.4 36.2 88.6 63.2 56.2 4.3 5.7 4.1 9.0 11.3 8.2 Msr1 16.6 11.4 17.6 35.4 30.9 18.6 1.3 1.3 1.6 2.7 3.1 2.1 Msra 13.1 14.0 12.5 18.0 18.8 20.2 10.0 10.8 10.4 13.9 14.0 13.7 Msrb3 3.2 3.8 3.3 1.3 1.8 1.7 2.4 3.2 2.6 1.6 2.0 1.8 Mtap 35.7 36.9 33.2 21.8 25.9 28.5 35.7 34.1 31.1 28.4 28.2 29.6 Mthfd2 64.1 65.8 69.5 49.6 48.5 51.9 77.0 75.8 79.2 67.9 67.9 65.9 Mtm1 4.7 3.8 4.2 7.5 7.0 5.8 3.1 2.8 2.9 4.5 4.4 3.9 Mtss1 7.5 6.9 7.8 11.8 9.8 8.6 6.4 6.8 7.8 7.2 6.6 6.9 Mxd4 8.6 8.7 8.9 14.7 14.4 14.2 10.2 11.1 11.7 15.0 12.5 14.3 Myl10 6.5 8.8 8.0 31.1 37.4 32.1 10.9 11.9 15.4 19.9 16.7 19.3 Myo18b 0.2 0.2 0.2 1.2 0.9 0.6 0.1 0.1 0.1 0.5 0.4 0.4 Myo1b 2.0 1.5 2.4 3.9 3.2 2.6 2.1 2.2 2.5 2.9 2.5 2.4 Myof 6.2 5.1 7.4 14.4 10.0 6.9 0.9 1.1 0.7 1.8 1.9 1.3 Naaa 9.9 8.5 12.4 25.2 18.8 13.8 3.4 4.7 4.5 7.8 7.4 5.7 Nacc2 0.7 0.6 0.9 1.9 1.8 1.2 0.3 0.2 0.2 0.2 0.3 0.3 Nagk 11.2 11.6 13.1 18.9 16.2 15.2 11.3 9.5 9.8 11.3 12.7 11.5 Naglu 9.4 8.6 10.6 16.8 15.3 13.5 5.2 5.4 5.1 6.1 7.3 6.3 Naip2 12.2 10.1 11.0 18.4 17.7 13.1 6.2 6.8 6.1 9.5 10.6 8.1 Nap1l1 485.7 476.8 454.1 319.4 370.4 396.2 506.2 510.0 494.9 487.0 471.8 476.2 Nasp 106.9 107.2 94.2 63.1 78.2 82.2 113.4 112.9 108.9 97.0 99.2 97.0 Nav2 2.2 2.1 1.7 3.1 3.4 2.7 0.9 1.0 0.9 1.9 1.9 1.6 Ncapg 36.5 34.5 32.0 24.1 25.7 29.7 36.1 35.5 35.1 32.7 31.9 33.9 Nceh1 10.4 9.2 10.9 18.0 16.0 13.7 10.1 9.6 11.6 14.9 13.6 11.0 Nde1 37.1 39.7 39.3 28.9 30.1 37.3 44.1 42.5 44.3 42.3 44.0 44.1

197 GENE ID FPKM values

Ctrl Ctrl Ctrl IR IR IR DL1 Ctrl1 Ctrl2 Ctrl3 IR1 IR2 IR3 DL1 1 DL1 2 DL1 3 DL1 1 DL1 2 3 Ndrg2 2.4 2.4 2.9 3.6 5.2 3.1 2.4 3.0 2.5 3.5 3.8 2.5 Ndufa4l2 2.5 2.5 1.5 0.2 1.0 1.2 0.2 0.3 0.3 0.0 0.2 0.2 Nedd9 5.9 5.4 5.2 8.4 8.8 6.3 5.5 5.6 6.0 7.2 7.2 6.1 Neu1 17.6 17.8 20.1 25.5 26.6 23.8 13.9 14.4 14.1 18.7 20.4 16.2 Nfic 8.6 9.2 8.0 11.0 11.8 11.7 5.1 5.4 5.1 5.9 6.3 6.1 Ngfrap1 48.7 57.3 55.1 33.7 38.2 49.8 56.4 59.9 54.4 47.8 51.0 54.9 Ngp 39.5 39.2 48.9 127.3 120.6 74.1 7.4 8.2 9.8 34.0 38.6 23.5 Nhsl2 4.6 4.7 3.8 6.9 7.0 4.9 2.3 2.4 2.1 3.8 4.0 3.4 Nin 35.3 34.5 28.5 42.9 44.2 35.8 27.8 28.6 30.1 40.8 37.7 34.0 Ninl 1.2 1.2 1.4 0.5 0.7 0.8 1.8 1.6 1.9 1.0 1.1 1.3 Nkg7 18.9 21.7 19.1 48.0 60.9 44.2 32.7 35.8 39.0 48.1 52.8 42.2 Nlrp1b 2.9 2.8 3.3 6.0 4.1 4.1 1.8 1.8 1.4 2.6 2.8 1.7 Nol11 29.8 28.3 26.6 20.2 22.8 24.7 26.9 27.5 26.2 24.9 22.3 25.1 Nop56 195.9 211.3 195.9 121.0 148.6 175.3 227.5 221.8 211.6 177.4 191.9 199.6 Nop58 145.8 153.2 128.1 86.0 109.9 125.3 149.3 146.2 138.8 129.1 131.9 133.8 Npc1 11.4 9.3 11.0 19.4 16.3 14.7 6.9 7.5 7.6 9.0 7.7 8.6 Nrp1 4.3 3.6 4.3 8.8 6.7 5.1 1.4 2.0 1.5 2.1 2.3 2.0 Ntn3,Tbc1d24 2.3 2.0 2.1 2.9 2.9 2.6 2.0 2.2 2.0 2.4 2.4 2.3 Nuak1 0.2 0.1 0.2 0.6 0.5 0.4 0.1 0.1 0.1 0.2 0.1 0.1 Nusap1 37.6 34.6 35.4 25.7 25.4 29.1 41.2 39.0 41.9 40.5 38.0 39.4 Odf2l 8.0 9.0 8.3 6.0 7.2 7.0 8.6 8.2 9.0 8.2 8.3 8.7 Ola1 86.6 80.5 81.8 69.0 68.7 76.5 78.8 80.8 76.9 78.5 77.7 73.5 Olfml2b 1.4 1.3 1.4 3.8 4.1 2.2 0.9 1.1 1.2 2.4 3.0 1.8 Olr1 1.7 1.8 1.2 3.2 3.5 2.6 1.1 1.1 1.2 2.3 2.5 1.6 Ophn1 1.3 1.2 1.5 3.4 3.4 2.2 0.7 0.5 0.8 0.8 0.6 0.7 Orc2l 38.2 37.1 35.0 28.8 30.1 35.0 35.4 37.0 35.2 34.3 32.1 33.2 OTTMUSG000000036063.4 2.8 3.7 10.5 6.7 5.6 0.3 0.5 0.2 1.1 0.8 0.6 P2ry6 7.7 7.4 10.3 24.3 18.7 14.1 1.0 1.2 0.9 2.1 2.4 2.0 P4ha2 3.6 3.0 4.3 2.9 3.0 2.2 5.3 5.1 5.3 3.6 3.5 2.2 Padi4 7.3 9.6 8.1 21.0 22.1 23.4 0.9 1.9 1.0 2.0 3.6 3.3 Papss2 7.1 6.4 6.1 13.1 13.4 12.0 3.2 3.9 4.6 6.8 7.7 6.0 Pcbp2 243.3 235.4 226.2 194.0 198.4 233.7 229.0 230.3 221.7 203.4 205.4 221.4 Pcbp4 4.2 4.2 6.2 3.6 2.5 2.4 6.2 6.0 6.6 4.4 4.9 4.5 Pcdhga1,Pcdhga10,Pcdhga11,Pcdhga12,Pcdhga2,Pcdhga3,Pcdhga4,Pcdhga5,Pcdhga6,Pcdhga7,Pcdhga8,Pcdhga9,Pcdhgb1,Pcdhgb2,Pcdhgb4,Pcdhgb5,Pcdhgb6,Pcdhgb7,Pcdhgb8,Pcdhgc3,Pcdhgc4,Pcdhgc59.7 10.0 9.1 7.2 8.3 8.6 8.1 8.2 7.6 6.9 6.7 7.0 Pcyt1a 19.0 16.7 17.1 27.3 26.1 23.6 14.6 15.2 15.2 20.9 19.1 18.8 Pde2a 3.3 3.4 3.1 5.2 5.9 4.1 1.5 1.4 1.3 2.0 2.7 1.6 Pde4b 14.3 12.5 14.1 12.4 10.6 14.0 10.7 12.2 9.9 9.8 11.5 10.8 Pde8a 4.1 3.5 4.4 8.4 7.7 5.7 1.5 1.7 1.5 2.4 2.2 2.0 Peli2 5.0 4.6 5.1 9.3 8.8 7.1 2.2 2.6 2.4 3.0 4.0 3.4

198 GENE ID FPKM values

Ctrl Ctrl Ctrl IR IR IR DL1 Ctrl1 Ctrl2 Ctrl3 IR1 IR2 IR3 DL1 1 DL1 2 DL1 3 DL1 1 DL1 2 3 Per3 2.0 2.2 2.0 3.6 3.9 3.9 2.1 2.0 2.3 2.7 2.9 2.7 Pf4 68.3 58.6 79.8 200.8 186.4 145.1 76.9 74.0 68.7 43.1 47.5 61.2 Pfdn4 31.1 29.9 29.4 22.0 24.6 23.7 32.5 33.7 35.1 29.7 30.2 26.7 Pfkfb4 6.3 5.3 6.8 10.4 9.9 7.6 3.8 4.5 3.9 5.3 5.3 5.4 Pglyrp1 40.4 44.8 41.3 84.5 89.3 77.1 29.5 28.5 29.1 48.6 48.3 43.0 Pglyrp2 5.5 5.2 5.1 2.2 3.5 4.4 15.0 13.0 17.3 9.0 8.3 8.0 Pgr 0.1 0.1 0.1 0.9 1.1 0.5 0.1 0.1 0.1 0.2 0.4 0.2 Phgdh 232.4 243.2 239.7 163.8 176.2 207.4 219.8 225.9 216.9 194.6 206.1 207.5 Phtf2 12.5 11.5 11.4 8.2 8.8 9.6 15.1 13.6 14.7 12.0 10.6 12.2 Pik3ip1 13.3 13.6 13.6 18.9 19.4 20.4 14.9 15.2 14.1 14.6 17.1 16.7 Pim2 21.1 21.7 22.0 12.7 11.6 18.4 32.3 31.4 29.3 19.6 21.0 23.0 Pink1 19.0 15.2 19.5 26.7 29.7 25.1 17.5 15.4 17.8 18.6 24.8 21.7 Pira3 10.1 7.6 11.4 16.9 11.6 10.7 3.4 4.4 2.7 5.7 6.7 5.2 Pira6 10.0 7.8 11.4 17.3 12.2 10.9 3.4 4.6 2.9 5.4 6.6 4.9 Pkib 0.9 0.8 1.1 1.8 1.3 1.1 0.5 0.6 0.8 0.8 0.6 0.7 Pkp2 0.7 0.5 1.0 0.3 0.4 0.3 0.8 0.7 1.0 0.6 0.7 0.4 Pla2g15 23.1 20.5 24.1 35.5 29.3 31.2 13.8 14.5 13.0 14.3 16.4 17.1 Pla2g7 53.2 38.0 59.6 152.4 126.3 98.2 13.5 15.9 17.4 29.9 30.6 26.6 Plcb1 0.5 0.4 0.4 0.9 0.9 0.6 0.1 0.1 0.1 0.2 0.2 0.1 Plcb2 26.4 25.7 25.5 37.1 37.3 31.8 24.2 23.7 23.2 30.6 29.4 27.0 Pld1 2.9 2.6 2.8 5.0 4.3 3.6 1.2 1.2 1.3 1.8 2.0 1.5 Pld2 4.1 3.4 5.5 8.3 5.8 5.5 3.0 3.0 3.6 4.2 4.2 3.7 Pld3 10.5 8.8 12.8 25.5 21.3 17.9 5.1 6.3 5.1 7.0 7.1 7.2 Plekhg1 0.9 0.8 0.9 2.2 1.9 1.4 0.2 0.2 0.2 0.4 0.5 0.4 Plin2 40.5 36.0 45.6 75.2 59.8 47.8 26.5 29.3 28.6 34.9 38.7 28.9 Plod1 15.9 12.6 14.4 33.6 26.5 18.8 8.7 7.7 8.3 12.8 11.5 10.0 Plod2 23.4 20.9 22.2 16.3 16.9 14.4 20.9 23.4 23.0 16.4 18.5 14.6 Pls3 3.4 3.3 2.9 2.4 2.5 2.7 1.8 1.8 1.9 1.9 2.0 1.8 Plxdc2 1.6 1.1 1.8 4.2 3.5 2.9 0.1 0.1 0.2 0.2 0.3 0.2 Plxna1 2.7 2.4 2.9 5.4 4.4 3.6 1.2 1.2 1.3 1.1 1.2 1.2 Plxnd1 8.2 7.3 8.5 15.8 12.9 10.8 5.6 5.2 6.1 9.1 9.2 7.3 Pnpla7 11.5 10.7 12.3 20.0 12.7 16.3 10.5 10.6 10.8 13.7 9.9 12.4 Pogk 3.5 3.7 3.5 2.6 2.9 2.9 3.2 3.2 3.3 2.6 2.9 2.5 Pola2 38.6 40.8 40.6 30.3 35.9 36.6 43.5 44.4 43.5 40.7 40.2 40.4 Poli 10.4 10.6 9.8 8.4 8.8 10.4 10.8 11.7 11.2 10.5 11.7 10.9 Polm 1.4 1.1 1.4 2.7 2.9 2.0 0.8 0.8 0.7 1.2 1.0 0.7 Polr3d 9.6 9.4 9.9 7.3 7.9 9.1 11.5 10.5 9.3 9.6 9.0 9.0 Ppa1 86.3 93.3 88.5 59.8 70.5 74.5 93.7 88.4 86.1 80.6 83.7 78.3 Ppbp 17.8 12.3 19.9 59.9 55.3 38.3 12.7 14.7 16.9 9.1 7.6 11.5

199 GENE ID FPKM values

Ctrl Ctrl Ctrl IR IR IR DL1 Ctrl1 Ctrl2 Ctrl3 IR1 IR2 IR3 DL1 1 DL1 2 DL1 3 DL1 1 DL1 2 3 Ppm1h 8.0 7.3 8.2 14.3 13.4 10.6 5.7 5.3 6.5 8.2 7.8 7.3 Prc1 50.2 45.7 45.6 32.5 33.4 40.2 47.4 45.3 46.0 46.1 41.3 46.9 Prdm1 1.5 1.2 1.8 3.5 2.8 2.2 1.2 1.6 1.4 1.8 1.8 1.8 Prdx5 224.2 222.4 245.6 365.0 345.1 316.3 176.1 183.6 170.4 224.0 243.6 223.5 Prg2 1.1 0.8 2.2 7.8 8.6 3.0 0.1 0.3 0.7 2.2 0.9 0.4 Prkcb 8.4 7.0 8.3 14.5 12.7 8.8 8.9 10.0 11.1 14.9 13.3 11.6 Prom1 2.9 2.6 2.0 6.5 7.2 4.7 1.5 1.5 2.0 4.0 4.3 3.2 Prr11 19.3 17.4 17.1 12.6 12.7 15.1 19.3 18.5 19.2 18.2 16.9 19.6 Prss34 0.7 1.1 1.8 3.4 3.7 1.7 0.3 0.3 0.5 1.7 1.1 0.6 Prssl1 15.0 16.3 14.7 28.3 32.2 26.2 13.1 13.1 13.9 22.6 23.7 19.5 Prtn3 957.4 1035 933.2 1305 1515 1375 781.4 837.0 777.0 1054 1166 1031 Prune2 1.4 1.3 2.0 3.6 2.6 1.7 0.5 0.5 0.5 1.0 1.1 0.8 Psip1 43.2 40.5 37.5 28.1 33.5 32.7 43.9 47.0 47.9 40.6 37.8 41.4 Psrc1 6.8 6.5 7.0 5.0 5.6 6.3 7.7 6.1 6.8 5.9 7.0 6.7 Ptcd3 50.1 49.9 45.9 32.7 39.2 40.8 47.4 47.5 44.6 40.3 43.5 40.6 Ptges3 177.6 175.3 164.4 120.1 134.2 143.9 165.5 169.2 172.6 147.4 149.1 146.6 Ptgr1 19.3 18.5 17.0 26.1 30.1 25.1 10.5 12.0 11.7 17.6 20.9 16.6 Ptk2 3.5 3.1 3.3 1.8 1.9 1.5 5.7 5.5 6.2 5.0 4.5 4.0 Ptk7 9.5 10.3 10.0 4.6 4.2 4.7 12.0 12.9 14.4 10.0 8.9 10.3 Ptplad2 13.8 11.8 14.2 25.9 20.1 15.8 5.2 6.1 5.0 8.6 8.0 7.9 Ptprk 2.3 2.4 1.6 0.6 1.2 0.9 1.8 1.7 1.4 0.6 1.1 1.4 Ptpro 4.0 3.3 4.6 6.6 4.4 4.2 1.0 1.1 0.8 1.8 2.4 1.5 Pvrl4 1.2 1.1 1.4 2.4 2.3 1.4 0.3 0.3 0.3 0.4 0.6 0.5 Pygl 89.6 80.3 85.0 125.4 119.4 104.4 60.0 66.7 62.8 76.3 83.3 77.8 Rab20 3.1 2.8 3.2 6.2 5.5 6.4 3.2 2.9 2.7 3.9 3.3 3.0 Rab32 53.5 49.2 59.6 92.4 74.3 67.1 26.7 29.4 26.1 38.5 43.0 34.7 Rab3d 13.4 12.2 12.3 21.1 19.9 17.0 9.2 9.8 8.4 13.4 14.6 12.0 Rab3il1 11.8 10.5 14.3 28.5 22.4 19.6 5.4 5.2 5.2 6.6 5.6 6.0 Rad18 17.4 18.2 15.7 13.6 14.5 15.1 15.1 16.2 16.0 14.9 15.6 15.1 Ramp1 22.4 23.2 20.1 29.8 29.5 30.6 15.4 16.5 12.7 17.5 18.6 20.0 Ranbp1 308.8 332.7 313.4 206.8 237.5 275.0 355.1 338.1 334.3 311.1 319.3 332.6 Rasgrp1 0.2 0.2 0.4 0.8 0.8 0.3 0.2 0.2 0.2 0.3 0.1 0.2 Rbm9 1.3 1.2 1.3 0.9 0.8 0.8 1.1 1.2 1.0 0.7 1.0 1.0 Rbmx 33.3 32.5 29.4 22.9 24.7 30.5 35.4 33.2 32.2 28.6 29.6 31.6 Rcbtb2 31.0 27.1 33.1 60.1 50.8 41.4 17.9 17.5 18.3 19.9 21.9 17.9 Renbp 11.5 11.3 13.8 23.0 18.6 20.4 12.5 11.5 12.4 14.4 14.3 13.6 Rgag4 6.7 6.0 7.9 8.7 7.6 7.4 3.8 4.7 3.4 3.6 3.9 3.2 Rhob 19.3 19.6 19.6 31.1 31.1 24.9 14.8 14.1 14.4 18.6 19.0 18.9 Rhou 2.2 2.4 1.9 4.3 5.1 3.7 1.2 1.2 1.2 2.8 2.7 2.1

200 GENE ID FPKM values

Ctrl Ctrl Ctrl IR IR IR DL1 Ctrl1 Ctrl2 Ctrl3 IR1 IR2 IR3 DL1 1 DL1 2 DL1 3 DL1 1 DL1 2 3 Rmnd5b 21.4 20.8 23.7 31.6 28.5 31.9 24.0 25.2 28.2 29.3 29.3 29.8 Rnase10 0.2 0.2 0.2 0.6 1.0 0.7 0.2 0.2 0.3 0.3 0.9 0.3 Rnf128 1.1 0.9 1.3 2.7 2.3 2.0 0.6 0.7 0.9 0.8 1.1 0.8 Rnf138 15.5 15.0 13.3 11.3 13.1 13.4 15.9 16.2 16.0 14.0 13.9 12.6 Rnf144b 0.8 0.7 0.8 1.8 1.4 1.0 0.5 0.5 0.7 1.1 0.8 0.7 RP23-331L12.8 4.0 3.4 4.9 13.1 8.1 6.9 0.3 0.6 0.3 1.3 1.0 0.8 Rps4y2 4.7 3.8 4.4 2.0 1.9 1.8 2.1 1.3 1.9 2.2 1.0 0.7 Rps6ka2 0.7 0.6 0.7 1.9 1.4 1.2 0.9 0.7 0.7 1.1 1.2 1.3 Rsl1d1 153.3 165.0 150.9 103.3 120.9 134.0 154.3 156.3 146.9 140.1 140.9 139.1 Rusc2 1.9 1.6 2.2 4.2 3.2 3.3 0.6 0.7 0.5 1.0 1.0 1.1 Rxra 1.9 1.8 2.0 3.7 3.2 2.3 1.1 1.1 0.9 1.2 1.2 1.1 S100a1 25.7 29.8 35.1 44.5 43.4 44.5 18.1 18.5 18.6 28.8 27.0 24.7 S100a6 61.9 57.5 83.5 117.5 98.5 83.9 21.5 27.5 24.2 32.8 36.7 34.4 S100a8 436.7 471.3 458.5 1230 1557 924.1 311.0 289.5 356.8 765.8 841.2 540.6 S100a9 290.3 300.1 320.6 923.8 1091 571.5 244.6 213.3 273.1 578.2 642.6 441.7 Saa1 4.1 4.2 5.8 11.6 8.2 7.0 0.3 0.8 0.3 0.7 0.9 0.9 Saa3 508.3 479.6 724.2 1346 1022 905.5 52.3 77.8 39.4 109.5 142.6 114.6 Samd5 0.3 0.3 0.3 1.0 1.2 1.1 0.0 0.2 0.1 0.3 0.3 0.3 Samsn1 90.9 86.7 92.8 63.9 64.2 75.5 80.9 87.4 79.4 73.6 76.8 78.7 Sash1 3.2 2.8 3.3 6.9 5.6 3.8 4.7 4.3 5.5 7.3 5.6 4.9 Sat1 97.3 86.8 112.7 176.0 151.7 148.6 71.4 75.0 60.3 97.6 103.4 97.6 Satb1 3.5 3.2 3.7 2.7 2.1 2.5 7.1 7.4 8.7 7.4 7.3 8.1 Scamp5 0.9 0.7 1.1 2.6 2.2 1.7 0.5 0.4 0.6 0.4 0.5 0.5 Scd1 7.9 6.9 7.7 4.3 4.4 4.8 8.0 9.8 7.4 7.6 8.6 6.8 Scnn1a 1.8 1.9 2.0 4.0 4.3 3.6 1.3 1.5 1.6 2.9 3.2 2.1 Scoc 16.2 17.0 14.7 11.9 13.9 14.8 15.7 17.4 15.1 14.9 14.6 13.5 Sdc3 10.3 8.0 12.1 23.4 15.3 12.1 2.0 2.7 1.9 3.5 3.6 3.2 Sdc4 16.3 15.3 20.8 33.2 25.4 23.8 2.8 3.9 2.7 4.2 4.6 4.9 Sdsl 0.5 0.6 0.7 1.6 1.5 1.6 0.0 0.2 0.3 0.3 0.2 0.6 Sec22c 3.6 3.6 3.3 4.9 5.0 4.8 3.3 3.0 3.7 3.8 4.0 4.0 Sec24d 15.4 13.9 13.5 21.0 20.4 18.4 10.3 11.5 11.7 16.2 15.0 14.5 Selm 8.4 6.0 7.0 14.2 12.5 10.9 7.9 6.4 5.7 8.0 10.3 7.1 Sema4a 28.2 26.9 28.8 50.0 44.7 39.6 11.5 13.2 11.6 20.4 21.2 19.3 Sepp1 73.9 58.7 88.8 200.9 163.5 123.1 25.6 27.5 27.6 35.5 37.4 30.7 Sepx1 121.8 117.8 134.2 192.3 184.8 167.7 99.2 104.5 94.2 145.8 157.3 130.6 Serpina3f 1.9 1.8 2.2 0.9 1.1 1.6 3.0 2.7 2.0 1.9 2.1 2.5 Serpina3g 32.8 33.0 33.5 19.9 22.8 30.6 52.2 50.2 49.7 44.0 42.4 44.3 Serpinb10 3.7 3.2 3.5 6.0 7.5 5.3 1.2 1.5 1.3 2.0 2.6 1.9 Serpinb8 4.7 4.2 4.7 9.5 6.8 4.3 0.9 0.9 0.7 1.3 1.8 1.1

201 GENE ID FPKM values

Ctrl Ctrl Ctrl IR IR IR DL1 Ctrl1 Ctrl2 Ctrl3 IR1 IR2 IR3 DL1 1 DL1 2 DL1 3 DL1 1 DL1 2 3 Set 326.7 334.0 299.2 209.3 242.4 252.1 304.0 311.8 325.1 275.6 272.0 268.2 Sfrs13a 77.7 74.8 70.0 56.4 61.8 63.0 83.4 81.1 80.0 73.1 69.6 71.9 Sgk1 5.0 4.0 6.1 11.9 10.8 7.8 1.6 2.5 2.0 3.0 4.1 3.1 Sgms1 5.7 5.1 4.6 4.7 4.2 4.1 4.9 4.8 4.6 3.8 4.7 3.8 Sgms2 7.4 6.2 5.3 11.4 12.4 8.4 3.5 3.6 3.8 6.6 6.6 5.2 Sgol2 13.1 11.5 10.8 9.6 10.3 10.6 11.7 11.3 11.8 10.8 11.0 11.8 Sgpl1 25.2 22.3 27.2 45.8 36.9 32.1 12.9 13.8 13.7 18.7 18.5 17.2 Sgsh 3.6 3.8 3.7 6.9 6.4 5.9 3.8 3.9 4.2 4.3 4.1 4.3 Sh3bp4 3.8 3.6 5.3 3.6 1.7 2.5 5.0 5.2 4.5 5.0 4.7 5.0 Sirpb1 21.3 17.9 27.0 52.3 39.2 30.9 3.5 5.8 3.3 7.5 9.7 6.4 Skil 8.5 7.8 9.1 14.8 10.7 8.4 5.2 5.5 5.4 6.6 5.8 5.1 Slc11a1 3.3 2.5 4.8 12.2 9.2 7.1 1.0 1.1 0.8 1.4 1.4 1.2 Slc15a3 19.8 18.1 27.2 42.6 29.0 24.4 14.4 15.7 13.4 22.0 21.3 18.4 Slc18a2 2.1 2.6 2.4 3.7 4.3 3.5 2.3 2.9 3.0 3.1 2.9 3.5 Slc1a4 5.8 6.2 6.2 3.5 4.3 3.9 5.8 5.7 6.3 4.3 4.9 4.5 Slc20a1 26.9 25.6 27.3 18.6 20.6 22.3 30.9 31.5 31.1 27.6 27.8 26.4 Slc26a11 2.7 2.5 3.4 6.1 4.6 6.1 4.7 4.1 4.9 4.3 3.6 4.6 Slc27a1 5.7 5.0 6.4 9.9 7.7 7.9 3.0 3.8 3.5 3.0 3.3 3.0 Slc28a2 9.4 9.2 7.4 13.7 17.4 13.6 9.6 9.5 9.4 11.5 12.1 11.8 Slc2a3 58.2 56.5 57.4 34.0 36.8 43.8 90.1 101.6 89.4 62.1 69.7 70.9 Slc31a2 8.8 7.9 9.2 14.9 11.0 12.9 5.8 6.7 5.0 7.3 8.0 7.3 Slc37a2 4.3 3.6 5.2 10.9 7.8 6.7 1.4 1.6 1.4 2.1 2.3 2.3 Slc38a7 5.5 4.9 6.2 10.2 8.4 8.9 4.3 4.3 4.6 5.1 4.4 5.6 Slc39a8 5.1 4.4 4.7 3.6 4.4 3.7 4.8 4.5 5.0 4.7 4.8 4.3 Slc40a1 4.9 3.6 5.6 15.9 14.1 11.6 2.2 2.2 2.7 5.4 4.9 4.6 Slc41a2 0.3 0.1 0.3 0.7 0.5 0.6 0.0 0.1 0.1 0.1 0.2 0.0 Slc43a2 29.9 24.3 29.9 51.2 39.7 36.3 19.7 21.9 22.3 23.6 22.2 23.5 Slc6a8 0.3 0.4 0.4 0.9 0.7 1.0 0.2 0.2 0.3 0.2 0.3 0.3 Slc7a1 28.1 28.5 26.4 19.4 22.3 20.9 27.5 27.9 29.2 26.3 24.2 23.3 Slc7a3 2.8 2.5 3.2 1.2 1.6 1.8 4.0 4.6 4.3 3.3 3.4 3.8 Slc7a5 96.6 98.1 95.2 68.4 71.2 76.9 105.9 101.3 109.6 96.9 91.3 98.2 Slc7a8 13.9 11.0 13.5 31.0 26.0 22.8 6.8 7.4 6.9 9.6 10.2 9.5 Slc8a1 2.2 1.7 2.4 4.2 3.0 2.0 2.1 2.1 2.5 3.4 2.8 2.7 Slc9a9 2.3 2.0 3.1 6.9 5.4 4.2 1.7 1.7 2.0 2.6 1.8 2.0 Slfn2 43.5 36.1 50.4 78.4 63.3 50.0 36.4 37.4 35.4 50.7 48.6 41.7 Slfn5 5.2 4.9 6.4 11.2 8.8 6.3 4.9 4.1 4.5 6.3 5.9 4.9 Slpi 111.5 121.4 97.0 133.8 153.4 174.0 25.4 35.7 19.9 37.5 49.1 42.0 Smpdl3a 25.7 21.3 28.4 50.2 46.3 35.5 5.0 5.7 5.3 10.5 12.6 9.5 Sms 28.2 29.7 27.3 17.7 20.6 21.5 29.7 30.0 29.4 26.3 26.8 25.6

202 GENE ID FPKM values

Ctrl Ctrl Ctrl IR IR IR DL1 Ctrl1 Ctrl2 Ctrl3 IR1 IR2 IR3 DL1 1 DL1 2 DL1 3 DL1 1 DL1 2 3 Snx9 14.5 13.3 14.7 23.5 19.2 17.8 16.4 16.7 19.6 20.4 18.3 18.6 Sorbs1 1.3 1.1 1.1 0.8 0.8 0.8 1.2 1.3 1.5 1.4 1.1 1.1 Sorl1 22.4 20.1 19.3 44.7 39.7 24.2 13.9 15.9 16.2 27.3 24.7 21.0 Sort1 15.5 13.9 13.5 23.4 23.7 18.0 10.2 10.0 11.0 15.3 14.9 12.4 Sox4 16.3 16.6 15.4 10.0 10.7 13.4 26.0 26.5 32.9 26.6 17.0 28.2 Sp100 22.0 20.4 21.7 31.6 33.5 28.1 19.1 21.1 20.3 28.2 28.5 25.0 Spint1 23.5 18.6 27.4 47.0 38.5 24.2 18.3 16.6 21.0 31.9 31.6 24.1 Spire1 5.7 5.3 5.4 3.9 3.6 3.9 4.5 4.4 4.3 3.7 3.6 3.2 Spp1 217.8 169.7 215.7 339.0 312.9 264.5 39.6 43.9 30.0 50.7 54.2 48.3 Spsb4 1.2 1.2 1.1 2.3 2.8 1.9 0.7 0.8 0.6 1.0 1.0 0.8 Sqrdl 21.5 20.2 20.8 29.0 27.1 25.5 10.0 11.3 8.9 13.3 16.1 13.2 Srgn 557.8 559.6 529.7 793.9 888.3 741.7 463.5 488.4 470.4 619.8 640.2 561.1 Ssbp1 43.6 46.0 43.1 30.2 35.7 40.6 50.1 49.5 46.1 40.6 45.3 43.7 Ssbp2 8.1 8.2 7.7 5.5 6.0 7.5 8.5 8.7 8.5 7.3 7.5 8.4 Ssh3 11.9 10.4 15.2 21.0 16.9 16.7 6.5 7.7 5.9 7.7 8.2 8.6 Stab1 18.2 14.5 21.3 53.6 44.9 31.9 1.9 2.4 1.6 3.0 3.7 3.0 Stom 63.5 56.5 59.1 87.8 83.7 77.4 33.2 35.1 32.2 48.3 51.1 46.8 Sulf2 0.9 0.7 0.9 3.3 1.9 1.7 0.1 0.2 0.1 0.4 0.3 0.2 Sun2 88.4 86.6 81.1 145.1 161.9 129.2 70.4 76.6 78.1 102.3 100.1 102.5 Svip 15.7 15.6 12.7 24.2 27.9 22.8 11.6 11.9 11.3 15.7 17.4 15.5 Syncrip 98.6 97.0 88.3 73.2 81.2 82.2 91.2 94.1 91.0 86.7 81.7 86.4 Syne1 0.3 0.1 0.1 0.5 0.3 0.3 0.1 0.1 0.1 0.1 0.2 0.1 Tanc2 1.3 1.3 1.3 2.9 2.3 1.7 0.5 0.5 0.5 0.6 0.5 0.5 Tap2 52.2 54.0 55.3 73.6 78.4 78.5 39.3 42.1 40.2 49.9 56.6 53.9 Tarm1 8.4 7.4 8.8 16.8 14.0 10.5 3.0 3.2 2.9 6.3 4.5 3.9 Tbc1d9 5.2 4.5 6.3 10.3 7.1 5.3 4.8 4.7 5.1 7.7 7.1 5.9 Tbxas1 10.7 9.2 11.2 21.0 18.8 16.5 8.4 8.5 7.0 8.9 10.3 8.4 Tcf19 10.1 10.7 12.3 8.3 8.1 8.8 18.8 18.6 19.5 17.3 17.7 15.6 Tcf4 16.0 14.6 15.2 10.8 10.0 11.0 13.0 13.0 13.5 12.2 11.6 12.4 Tcf7l2 3.2 2.4 3.1 3.0 2.2 2.2 2.8 2.4 2.8 2.3 2.6 2.6 Tcirg1 79.3 77.1 94.5 117.2 106.3 113.2 81.1 79.8 78.6 88.8 90.4 93.6 Tctex1d1 8.1 8.0 11.6 5.6 2.9 6.9 2.4 2.6 2.3 3.5 2.9 3.9 Tdrd7 4.2 3.8 4.8 7.5 6.4 5.2 3.3 2.9 3.0 3.6 4.2 3.6 Tes 37.9 34.7 39.6 27.5 25.7 27.5 54.3 53.8 57.3 51.0 44.3 47.1 Tex2 27.0 27.0 24.6 52.7 60.0 42.9 21.1 21.7 22.9 36.6 35.6 32.0 Tex9 6.7 6.6 6.9 3.2 4.5 4.8 9.8 9.3 9.2 7.5 7.2 7.9 Tfdp2 2.7 2.6 2.3 3.0 3.4 3.5 2.9 3.2 3.2 2.8 2.8 3.0 Tfpi 19.4 16.0 11.3 10.7 16.7 10.1 19.7 16.9 12.4 12.0 15.6 10.1 Tgfbr3 0.6 0.8 0.5 1.1 1.2 1.1 0.4 0.3 0.3 0.3 0.4 0.5

203 GENE ID FPKM values

Ctrl Ctrl Ctrl IR IR IR DL1 Ctrl1 Ctrl2 Ctrl3 IR1 IR2 IR3 DL1 1 DL1 2 DL1 3 DL1 1 DL1 2 3 Tgm2 23.2 25.8 26.6 66.0 72.7 51.4 16.8 19.5 16.0 31.3 34.7 27.7 Tgm3 0.1 0.1 0.1 0.5 0.5 0.4 0.1 0.2 0.2 0.3 0.3 0.3 Thbs1 185.4 182.5 150.4 457.9 498.7 336.0 42.0 59.2 48.0 118.4 134.2 105.5 Thsd1 3.0 2.9 3.1 1.3 1.4 2.0 5.2 4.7 5.5 3.9 3.8 4.0 Tia1 17.6 17.8 16.3 12.5 13.9 15.8 21.4 20.8 20.7 18.4 18.9 18.5 Timp2 1.6 1.1 1.7 6.9 6.5 4.1 0.4 0.5 0.6 0.8 0.9 0.6 Tlr1 7.0 5.6 7.8 17.9 12.5 11.1 2.2 2.6 2.0 4.3 4.3 3.6 Tlr13 16.8 13.0 18.1 35.5 26.9 18.4 5.6 7.3 5.9 11.1 11.0 8.1 Tlr4 10.7 8.4 9.7 17.8 14.6 9.9 2.9 3.6 3.1 5.3 5.1 4.5 Tlr6 3.4 2.7 4.0 9.4 6.5 4.5 1.8 1.9 2.0 4.6 3.2 2.8 Tlr7 5.7 4.2 6.2 12.8 10.9 8.0 1.7 2.2 1.9 3.1 3.3 2.7 Tlr8 6.5 4.7 6.7 12.4 10.4 7.0 1.8 2.3 2.2 3.1 3.0 2.6 Tmcc1 2.6 2.7 3.0 4.8 4.5 3.9 1.8 1.9 1.9 2.1 2.1 2.3 Tmed3 45.7 45.8 42.2 69.0 78.0 66.4 46.3 43.4 45.5 60.1 68.8 51.9 Tmem106a 14.4 12.2 18.7 36.2 28.1 22.0 6.9 6.5 6.5 9.6 10.8 8.0 Tmem194b 4.5 4.3 4.5 3.9 3.1 3.7 5.9 5.9 5.5 5.4 6.1 5.2 Tmem201 13.2 13.2 12.4 8.8 10.4 12.1 14.1 13.6 12.9 11.7 11.4 13.3 Tmem37 11.4 9.0 14.0 36.6 26.7 21.8 1.1 1.6 1.2 1.9 2.4 2.2 Tmem40 13.8 16.6 12.8 17.3 23.1 23.3 5.3 7.7 6.2 9.8 10.7 9.8 Tmem51 4.8 4.9 6.9 12.5 8.1 8.5 3.4 3.4 4.0 5.7 4.8 4.6 Tmem8 4.8 4.5 4.9 8.3 7.8 5.8 5.9 5.1 5.9 6.7 6.7 6.0 Tmem86a 5.8 6.3 7.6 17.9 13.9 11.9 2.6 3.1 2.9 3.6 3.8 3.5 Tmpo 117.4 113.0 109.3 82.4 89.4 93.8 119.9 116.9 123.6 116.2 110.8 116.8 Tmx4 40.4 35.7 29.2 54.7 60.1 47.6 22.1 23.3 23.2 33.2 33.0 30.0 Tnfaip1 9.6 9.7 9.9 8.4 6.9 7.7 10.5 9.4 10.4 9.1 9.3 9.4 Tnfaip2 45.9 44.5 50.2 68.3 59.0 62.4 38.8 42.1 40.4 49.8 52.0 53.0 Tnfrsf14 22.2 18.2 22.8 44.7 34.1 31.1 14.7 15.1 15.0 22.6 19.3 20.4 Tnfrsf1b 54.0 50.6 54.6 92.0 82.1 81.4 24.3 27.3 23.2 32.7 36.3 32.9 Tnfrsf26 6.8 6.3 6.2 11.6 11.8 10.1 7.2 7.0 8.2 10.7 10.5 9.6 Tom1 16.5 15.1 17.4 24.3 22.9 24.4 14.8 14.4 14.8 19.5 19.2 16.1 Top2a 176.2 169.9 157.4 114.1 124.8 131.5 177.5 179.5 192.0 172.9 164.2 177.4 Tpm4 95.6 85.7 105.1 76.4 58.0 63.3 94.2 99.7 93.6 90.2 87.4 83.7 Traf3ip2 1.4 1.9 1.7 0.9 0.7 1.0 1.6 2.0 1.6 1.5 1.3 1.4 Trafd1 22.3 21.9 27.8 30.7 26.7 27.0 25.9 27.6 25.0 33.3 31.9 32.2 Trem2 21.3 16.7 27.0 61.8 50.8 44.7 0.9 2.1 1.2 3.4 3.9 3.4 Trem3 30.8 32.5 31.4 45.5 48.2 41.3 17.7 18.6 16.6 27.7 29.3 23.0 Treml4 1.2 0.9 1.4 2.8 1.7 1.5 1.4 2.1 2.0 2.8 1.9 2.1 Trf 40.7 36.4 39.9 85.0 81.0 65.6 28.4 33.2 30.7 37.0 38.8 40.5 Trib3 10.8 9.5 13.3 6.8 6.2 7.4 12.9 13.6 13.4 9.1 11.1 9.9

204 GENE ID FPKM values

Ctrl Ctrl Ctrl IR IR IR DL1 Ctrl1 Ctrl2 Ctrl3 IR1 IR2 IR3 DL1 1 DL1 2 DL1 3 DL1 1 DL1 2 3 Trim13 11.3 10.1 12.0 7.9 7.8 9.3 13.0 11.3 12.6 12.1 11.2 11.7 Trim45 1.9 2.2 1.9 2.8 3.1 2.7 1.9 1.8 1.8 2.3 2.5 2.2 Trim59 31.3 30.8 26.7 18.8 19.9 25.5 32.6 32.4 32.7 29.0 27.0 30.3 Trim6 2.5 2.1 2.4 0.9 1.3 1.7 2.2 2.2 1.8 1.3 1.3 1.7 Trmt61a 12.4 13.3 11.7 8.4 9.8 12.1 14.6 14.1 13.0 11.3 13.1 12.1 Troap 10.7 12.0 11.8 8.2 9.7 10.9 13.9 12.7 13.0 13.0 12.0 13.8 Trp53i11 6.4 7.5 7.3 4.5 4.3 5.4 9.0 9.3 10.2 8.0 7.5 7.8 Trp53inp1 5.2 3.9 4.6 8.3 7.2 5.9 4.5 4.7 5.4 5.7 4.8 4.5 Trp53inp2 3.5 3.2 3.9 8.4 6.0 4.9 2.0 2.3 2.3 3.3 3.1 3.0 Trub1 6.8 7.2 6.7 5.0 5.7 6.6 7.6 7.4 7.8 6.0 6.6 7.1 Tsc22d1 7.1 8.6 9.2 5.7 5.4 6.0 29.4 24.9 37.8 26.6 20.7 22.3 Tsr2 8.1 9.5 7.9 6.7 6.9 8.1 9.0 8.7 8.0 7.2 8.3 7.2 Ttc21a 1.4 1.4 1.1 2.6 3.5 2.1 0.5 0.7 0.5 1.2 1.3 1.0 Tyrobp 291.0 266.1 382.7 542.6 445.1 422.0 354.4 358.1 355.0 462.9 446.7 395.2 Uaca 3.0 3.3 3.1 2.1 2.2 1.5 2.5 2.5 3.0 2.2 2.3 2.2 Uap1l1 19.4 19.3 21.5 34.4 29.9 28.9 13.8 13.6 14.1 18.6 18.1 18.7 Ubtd2 5.8 5.6 5.7 3.4 4.0 4.2 6.4 5.6 5.4 4.6 4.9 4.6 Unc5b 0.4 0.4 0.4 1.0 1.0 0.8 0.2 0.1 0.2 0.3 0.5 0.3 Ung 15.4 17.0 16.0 12.1 13.3 14.9 17.0 19.1 17.1 16.7 17.4 15.1 Usp6nl 4.6 4.9 5.1 4.4 4.0 4.0 5.6 5.5 6.3 5.4 5.1 5.2 Vat1 60.7 62.2 59.1 88.8 96.4 87.8 57.2 57.0 60.1 64.3 67.0 60.5 Vav3 15.1 14.9 13.5 17.3 16.8 16.5 10.7 11.0 11.8 13.1 14.6 12.2 Vcam1 0.7 0.8 0.6 3.0 3.7 1.8 0.3 0.3 0.3 1.3 1.0 0.9 Vcan 23.5 18.9 24.3 42.2 31.7 19.1 3.8 4.2 3.6 9.5 9.3 6.4 Vill 2.5 2.4 2.3 4.0 4.2 4.9 1.7 1.2 1.3 1.3 1.7 1.7 Vwf 0.9 0.7 1.0 2.8 2.1 1.6 0.2 0.3 0.2 0.2 0.4 0.3 Wdr43 64.2 66.4 59.1 43.7 49.2 52.2 62.6 62.4 62.9 55.0 56.4 57.9 Wdr67 16.3 16.2 15.8 11.8 13.5 14.0 16.2 16.5 16.6 15.0 16.6 16.0 Whrn 0.9 1.0 1.2 0.4 0.7 0.4 3.2 2.8 4.1 2.9 2.8 3.0 Wiz 17.8 18.5 17.5 14.0 14.5 17.2 19.0 19.1 18.9 17.2 16.1 17.1 Ypel3 23.4 23.0 28.5 42.3 35.6 35.9 15.8 18.9 14.5 20.6 21.5 22.5 Ypel5 10.5 8.8 10.4 18.1 18.6 14.1 10.8 10.2 11.5 15.7 15.8 12.1 Zcchc14 0.2 0.4 0.2 0.6 0.5 0.4 0.2 0.2 0.4 0.3 0.2 0.1 Zcchc24 1.6 1.5 2.0 3.9 2.6 1.9 0.5 0.6 0.4 0.9 0.7 0.7 Zdhhc14 0.7 0.6 0.8 2.0 1.8 1.1 1.0 0.9 1.0 1.1 1.1 1.3 Zfp239 2.9 3.1 2.6 2.0 2.1 2.3 2.9 2.9 3.0 2.7 2.6 2.4 Zfp295 4.9 4.8 4.5 3.8 3.9 4.5 4.6 4.4 4.2 4.3 4.9 4.7 Zfp326 17.0 17.9 17.1 11.8 13.4 13.4 16.0 16.5 14.8 13.8 13.5 14.2 Zfp36l1 39.8 34.4 44.4 68.4 54.8 48.8 21.3 23.8 21.5 24.6 25.7 22.4

205 GENE ID FPKM values

Ctrl Ctrl Ctrl IR IR IR DL1 Ctrl1 Ctrl2 Ctrl3 IR1 IR2 IR3 DL1 1 DL1 2 DL1 3 DL1 1 DL1 2 3 Zfp703 7.0 6.4 7.5 12.3 10.3 8.9 4.7 5.2 5.1 5.7 5.0 5.0 Zmiz2 61.2 61.7 64.4 58.8 50.9 60.5 79.0 75.0 82.3 78.7 71.6 78.4 Zmynd15 1.6 1.3 2.8 5.1 3.3 3.2 0.7 0.9 0.8 0.7 1.0 0.9 Zswim6 3.1 3.1 3.1 5.6 4.8 4.0 1.6 1.7 1.8 2.1 2.3 1.9

206