Mir-H28 and Mir-H29 Expressed Late in Productive Infection Are Exported and Restrict HSV-1 Replication and Spread in Recipient Cells

Total Page:16

File Type:pdf, Size:1020Kb

Load more

miR-H28 and miR-H29 expressed late in productive infection are exported and restrict HSV-1 replication and spread in recipient cells Zhiyuan Hana,1, Xianjie Liua,1, Xiaoqing Chena, Xusha Zhoua,TeDub, Bernard Roizmanb,2, and Guoying Zhoua,2 aState Key Laboratory of Respiratory Disease, Institute of Immunology, Guangzhou Medical University, Guangzhou 511436, China; and bThe Marjorie B. Kovler Viral Oncology Laboratories, The University of Chicago, Chicago, IL 60637 Contributed by Bernard Roizman, December 30, 2015 (sent for review October 21, 2015; reviewed by Thomas E. Shenk and Richard J. Whitley) We report on the properties and function of two herpes simplex these miRNAs are (i) they are made late in infection, i.e., after virus-1 (HSV-1) microRNAs (miRNAs) designated “miR-H28” and viral DNA and structural proteins have been made; (ii)theyare “miR-H29.” Both miRNAs accumulate late in productive infection exported in exosomes; and (iii) they accumulate in neurons in at a time when, for the most part, viral DNA and proteins have which the virus is in the process of reactivation from the latent been made. Ectopic expression of miRNA mimics in human cells state but are absent from neurons harboring latent virus. Addi- before infection reduced the accumulation of viral mRNAs and tional studies showed that ectopic expression of mimics of these proteins, reduced plaque sizes, and at vey low multiplicities of miRNAs in cells before infection reduces the rate of accumu- infection reduced viral yields. The specificity of the miRNA mimics lation of viral proteins, decreases plaque size, and at the same was tested in two ways. First, ectopic expression of mimics carry- time reduces viral yields in cells infected at a very low multi- ing mutations in the seed sequence was ineffective. Second, in plicity of infection. similar tests two viral miRNAs made early in productive infection One hypothesis that could explain the evolution of these miRNAs also had no effect. Both miR-H28 and miR-H29 are exported from is the need to block excessive replication of reactivating virus for infected cells in exosomes. A noteworthy finding is that both miR-H28 two reasons. First, repulsive lesions on the mouth or genitals and miR-H29 were absent from murine ganglia harboring latent virus would reduce physical contact between the infected tissues of the but accumulated in ganglia in which the virus was induced to transmitter and the uninfected tissue of the recipient. A second reactivate. The significance of these findings rests on the principle reason may be to reduce the amount of virus made on reac- that the transmission of HSV from person to person is by physical tivation to ensure that the reactivated virus is transmitted an- contact between the infected tissues of the donor and those of terograde to the mouth or genitals rather than retrograde to the uninfected recipient. Diminished size of primary or recurrent lesions CNS. Retrograde transport would likely kill the host and block could be predicted to enhance person-to-person transmission. Re- further viral spread. In essence these studies support the con- duction in the amount of reactivating latent virus would reduce the clusion that HSV-1 down-regulates its replication to enhance risk of retrograde transport to the CNS but would not interfere with its spread and that this process is executed by viral gene products. anterograde transport to a site at or near the site of initial infection. Results exosome | latency | reactivation | trigeminal ganglia The Isolation, Sequence, and Properties of HSV-1 miR-H28 and miR- H29. Deep-sequencing analyses of cells infected with HSV-1(F) erpes simplex viruses (HSVs) infect and multiply in cells at [the prototype HSV-1 strain used in our laboratories (15)] led to Hthe portal of entry, i.e., mouth or genitals (1). They then are the identification of two heretofore unreported viral miRNAs. exported by retrograde transport to sensory or autonomic neu- The critical parameters of miR-H28 and miR-H29 are listed rons where they establish latent (silent) infection. In response to in Table 1. In brief miR-H28 and miR-H29 were isolated neuronal stress, the virus reactivates and is transported antero- grade to a site at or near the site of initial infection. At that site Significance the virus is available for transmission by physical contact between the infected tissues of the donor and those of the uninfected Herpes simplex virus-1 (HSV-1) is transmitted by contact be- recipient (1, 2). In principle it would be expected that extensive tween the infected tissues of a transmitter and those of an lesions on initial infection and on reactivation would seed more uninfected recipient. Effective spread requires that the lesions neurons with latent virus and increase the transmission of virus be small and not repulsive in appearance. For successful from person to person. This report challenges the hypothesis that transmission HSV must control both its replication and its viral gene products uniformly enhance viral replication and spread. spread from infected to uninfected cells. Here we report that This report centers on the function of two newly detected viral two HSV microRNAs (miRNAs) made late in productive in- microRNAs (miRNAs). Specifically HSV-1 and HSV-2 have fection are exported in exosomes. Ectopic expression in trans- – been reported to express at least 27 miRNAs (3 13). Analyses of fected cells before infection reduces the synthesis of viral gene 17 of these miRNAs have shown that they differ in their re- products and the spread from infected to uninfected cells. The quirements for synthesis in productively infected cells. Thus, miRNAs accumulate in neurons after latent virus is induced to some are made in higher amounts in the absence of viral protein reactivate. The miRNAs conform to the expectations of gene synthesis, but others require viral protein synthesis for their products that control viral replication and spread. synthesis (14). A confounding problem associated with the function of viral miRNAs is that miRNAs made in the course of Author contributions: B.R. and G.Z. designed research; Z.H., X.L., X.C., X.Z., and T.D. latent infections in neurons are also made in productively in- performed research; B.R. and G.Z. analyzed data; and B.R. and G.Z. wrote the paper. fected cells, whereas some, but not all, miRNAs accumulating in Reviewers: T.E.S., Princeton University; and R.J.W., University of Alabama at Birmingham. neurons in which latent virus is in the process of reactivation are The authors declare no conflict of interest. not made in appreciable amounts in productively infected cells (14). 1Z.H. and X.L. contributed equally to this work. Here we report the properties of two newly identified miRNAs 2To whom correspondence may be addressed. Email: [email protected] designated “miR-H28” and “miR-H29.” The key properties of or [email protected]. E894–E901 | PNAS | Published online February 1, 2016 www.pnas.org/cgi/doi/10.1073/pnas.1525674113 Downloaded by guest on September 29, 2021 Table 1. Genomic location and sequence of HSV-1(F) miR-H28, miR-H29, and derivatives PNAS PLUS miRNAs and derivatives miR-H28 miR-H29 Position in HSV-1 DNA 12,316–12,462 64,820–64,994 UL4 UL30 (antisense) (sense) miRNA precursor auaggcuauacgcgauggu ccaggguccuugaccccacu cgucuguggauuggacauc uccggguuucaugugaaccc ucgcgguggguagugagucc cguggugguguucgacuuu cccgggccggguucggugga gccagccuguaccccagcau acuguaaggggacggcgggu cauccaggcccacaaccugu uaauauacaaugaccacgu gcuucagcacgcucucccug ucggaucgcgcagagccgau agggccgacgcaguggcgca aguaugugcu ccuggaggcgggcaaggacu accuggagaucgaggu Mature miRNA CGAUGGUCGUCUG CUGGAGGCGGGCAAG UGGAU GACUACC Total reads [HSV-1(F), 0.1 pfu per cell, 16 h] HEK293T 487 415 HEp-2 432 505 NT UUCUCCGAACGUGUCACGUTT M1-H29 CAGCUGCGGGGCAAGGACUACC M2-H29 CACCUCCGGGGCAAGGACUACC Boldface indicates the mature miRNA sequence and its location. from both infected HEK293T and HEp-2 cells. The miR-H28 lines are shown in Fig. 1. In these studies, the cells were ex- sequence is antisense to and maps close to the N-terminal do- posed to 1 pfu of wild-type virus per cell and were incubated in main of unique long 4 (UL4) (Table 1). miR-H29 maps in the standard medium devoid of drugs or medium containing cy- same sense as the coding sequence of unique long 30 (UL30) cloheximide or actinomycin D. The measurements obtained (Table 1). The function of UL4 is unclear. UL30 encodes the were normalized with respect to the U6 small cellular RNA viral DNA polymerase (1). present in mock-infected untreated cells (0 h). The results The patterns of accumulation of miR-H28 and miR-H29 in show that expression of both miR-H28 and miR-H29 requires the course of productive infection in HEK293T and HEp-2 cell prior viral protein synthesis in both cell lines. The accumulation Fig. 1. Accumulation of miR-H28 and miR-29 in infected cells. Replicate cultures of HEp-2 cells (A and C) and HEK293T cells (B and D) were exposed to 1 pfu of HSV-1(F) per cell and were mock-treated or incubated in medium containing 100 μg/mL cycloheximide (CHX) or 10 μg/mL actinomycin D (Act.D). The cells were harvested at 1, 3, 6, 12, or 24 h postinfection. miR-H28 (A and B) and miR-H29 (C and D) were normalized with respect to U6 small cellular RNA detected in MICROBIOLOGY mock-infected cells (0 h). Han et al. PNAS | Published online February 1, 2016 | E895 Downloaded by guest on September 29, 2021 i) The reduction in the accumulation of viral mRNAs as a func- tion of the amounts of miR-H29 transfected into HEp-2 cells. The objectives of these experiments were twofold: to determine whether the miR-H29 mimic is effective in reduc- ing the accumulation of mRNAs of representative α (ICP27), β (ICP8), or γ (VP16) genes and whether the effects are dependent on the concentration of mimics transfected into cells.
Recommended publications
  • Structure and Expression of Class II Defective Herpes Simplex Virus

    Structure and Expression of Class II Defective Herpes Simplex Virus

    JOURNAL OF VIROLOGY, Aug. 1982, p. 574-593 Vol. 43, No. 2 0022-538X/82/080574-20$02.00/0 Structure and Expression of Class II Defective Herpes Simplex Virus Genomes Encoding Infected Cell Polypeptide Number 8 HILLA LOCKER,1t NIZA FRENKEL,l* AND IAN HALLIBURTON2 Department ofBiology, The University of Chicago, Chicago, Illinois 60637,1 and Department of Microbiology, University ofLeeds, Leeds, England' Received 12 February 1982/Accepted 13 May 1982 Defective genomes present in serially passaged virus stocks derived from the tsLB2 mutant of herpes simplex virus type 1 were found to consist of repeat units in which sequences from the UL region, within map coordinates 0.356 and 0.429 of standard herpes simplex virus DNA, were covalently linked to sequences from the end of the S component. The major defective genome species consisted of repeat units which were 4.9 x 106 in molecular weight and contained a specific deletion within the UL segment. These tsLB2 defective genomes were stable through more than 35 sequential virus passages. The ratios of defective virus genomes to helper virus genomes present in different passages fluctuated in synchrony with the capacity of the passages to interfere with standard virus replication. Cells infected with passages enriched for defective genomes overpro- duced the infected cell polypeptide number 8, which had previously been mapped within the UL sequences present in the tsLB2 defective genomes. In contrast, the synthesis of most other infected cell polypeptides was delayed and reduced. The abundant synthesis of infected cell polypeptide number 8 followed the , regula- tory pattern, as evident from kinetic studies and from experiments in which cycloheximide, canavanine, and phosphonoacetate were used.
  • THE ROLE of the HERPES SIMPLEX VIRUS TYPE 1 UL28 PROTEIN in TERMINASE COMPLEX ASSEMBLY and FUNCTION by Jason Don Heming Bachelor

    THE ROLE of the HERPES SIMPLEX VIRUS TYPE 1 UL28 PROTEIN in TERMINASE COMPLEX ASSEMBLY and FUNCTION by Jason Don Heming Bachelor

    THE ROLE OF THE HERPES SIMPLEX VIRUS TYPE 1 UL28 PROTEIN IN TERMINASE COMPLEX ASSEMBLY AND FUNCTION by Jason Don Heming Bachelor of Science, Clarion University of Pennsylvania, 2004 Submitted to the Graduate Faculty of the School of Medicine in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Pittsburgh 2013 UNIVERSITY OF PITTSBURGH SCHOOL OF MEDICINE This dissertation was presented by Jason Don Heming It was defended on April 18, 2013 and approved by Michael Cascio, Associate Professor, Bayer School of Natural and Environmental Sciences James Conway, Associate Professor, Department of Structural Biology Neal DeLuca, Professor, Department of Microbiology and Molecular Genetics Saleem Khan, Professor, Department of Microbiology and Molecular Genetics Dissertation Advisor: Fred Homa, Associate Professor, Department of Microbiology and Molecular Genetics ii Copyright © by Jason Don Heming 2013 iii THE ROLE OF THE HERPES SIMPLEX VIRUS TYPE 1 UL28 PROTEIN IN TERMINASE COMPLEX ASSEMBLY AND FUNCTION Jason Don Heming, PhD University of Pittsburgh, 2013 Herpes simplex virus type I (HSV-1) is the causative agent of several pathologies ranging in severity from the common cold sore to life-threatening encephalitic infection. During productive lytic infection, over 80 viral proteins are expressed in a highly regulated manner, resulting in the replication of viral genomes and assembly of progeny virions. Cleavage and packaging of replicated, concatemeric viral DNA into newly assembled capsids is critical to virus proliferation and requires seven viral genes: UL6, UL15, UL17, UL25, UL28, UL32, and UL33. Analogy with the well-characterized cleavage and packaging systems of double-stranded DNA bacteriophage suggests that HSV-1 encodes for a viral terminase complex to perform these essential functions, and several studies have indicated that this complex consists of the viral UL15, UL28, and UL33 proteins.
  • Herpes Simplex Virus 1 ICP8 Mutant Lacking Annealing Activity Is Deficient for Viral DNA Replication

    Herpes Simplex Virus 1 ICP8 Mutant Lacking Annealing Activity Is Deficient for Viral DNA Replication

    Herpes simplex virus 1 ICP8 mutant lacking annealing activity is deficient for viral DNA replication Savithri Weerasooriyaa,1, Katherine A. DiScipioa,b,1, Anthar S. Darwisha,b, Ping Baia, and Sandra K. Wellera,2 aDepartment of Molecular Biology and Biophysics, University of Connecticut School of Medicine, Farmington, CT 06030; and bMolecular Biology and Biochemistry Graduate Program, University of Connecticut School of Medicine, Farmington, CT 06030 Edited by Jack D. Griffith, University of North Carolina, Chapel Hill, NC, and approved December 4, 2018 (received for review October 13, 2018) Most DNA viruses that use recombination-dependent mechanisms culating in patient populations (18–22). Additionally, it has long to replicate their DNA encode a single-strand annealing protein been recognized that viral replication intermediates are com- (SSAP). The herpes simplex virus (HSV) single-strand DNA binding posed of complex X- and Y-branched structures as evidenced by protein (SSB), ICP8, is the central player in all stages of DNA electron microscopy (10, 16) and pulsed-field gel electrophoresis replication. ICP8 is a classical replicative SSB and interacts physi- (15, 23, 24). ′ ′ cally and/or functionally with the other viral replication proteins. The HSV exo/SSAP, composed of a 5 -to-3 exonuclease Additionally, ICP8 can promote efficient annealing of complemen- (UL12) and an SSAP (ICP8), is capable of promoting strand ex- tary ssDNA and is thus considered to be a member of the SSAP change in vitro (25, 26). More recently, we have shown that HSV infection stimulates single-strand annealing (27), and ICP8 has family. The role of annealing during HSV infection has been been reported to promote recombineering in transfected cells difficult to assess in part, because it has not been possible to (28).
  • Type of the Paper (Article

    Type of the Paper (Article

    Viruses 2018 – Breakthroughs in Viral Replication Faculty of Biology University of Barcelona Spain 7 – 9 February 2018 Conference Chair Eric O. Freed Conference Co-Chair Albert Bosch Organised by Conference Secretariat Antonio Peteira Man Luo George Andrianou Nikoleta Kiapidou Kristjana Xhuxhi Pablo Velázquez Lucia Russo Sara Martínez Lynn Huang Sarai Rodríguez Viruses 2018 – Breakthroughs in Viral Replication 1 CONTENTS Abridged Programme 5 Conference Programme 6 Welcome 13 General Information 15 Abstracts – Session 1 25 General Topics in Virology Abstracts – Session 2 45 Structural Virology Abstracts – Session 3 67 Virus Replication Compartments Abstracts – Session 4 89 Replication and Pathogenesis of RNA viruses Abstracts – Session 5 105 Genome Packaging and Replication/Assembly Abstracts – Session 6 127 Antiviral Innate Immunity and Viral Pathogenesis Abstracts – Poster Exhibition 147 List of Participants 297 Viruses 2018 – Breakthroughs in Viral Replication 3 Viruses 2018 – Breakthroughs in Viral Replication 7 – 9 February 2018, Barcelona, Spain Wednesday Thursday Friday 7 February 2018 8 February 2018 9 February 2018 S3. Virus S5. Genome Check-in Replication Packaging and Compartments Replication/Assembly Opening Ceremony S1. General Topics in Virology Morning Coffee Break S1. General Topics S3. Virus S5. Genome in Virology Replication Packaging and Compartments Replication/Assembly Lunch S2. Structural S4. Replication and S6. Antiviral Innate Virology Pathogenesis of Immunity and Viral RNA Viruses Pathogenesis Coffee Break Apéro and Poster Coffee Break Session S2. Structural S6. Antiviral Innate Virology Immunity and Viral Afternoon Conference Group Pathogenesis Photograph Closing Remarks Conference Dinner Wednesday 7 February 2018: 08:00 - 12:30 / 14:00 - 18:00 / Conference Dinner: 20:30 Thursday 8 February 2018: 08:30 - 12:30 / 14:00 - 18:30 Friday 9 February 2018: 08:30 - 12:30 / 14:00 - 18:15 Viruses 2018 – Breakthroughs in Viral Replication 5 Conference Programme Wednesday 7 February 08:00 – 08:45 Check-in 08:45 – 09:00 Opening Ceremony by Eric O.
  • An Exploration of the Interplay Between HSV-1 and the Non-Homologous End Joining Proteins PAXX and DNA-Pkcs

    An Exploration of the Interplay Between HSV-1 and the Non-Homologous End Joining Proteins PAXX and DNA-Pkcs

    An exploration of the interplay between HSV-1 and the non-homologous end joining proteins PAXX and DNA-PKcs Benjamin James Trigg Gonville and Caius College This dissertation is submitted for the degree of Doctor of Philosophy September 2017 2. Abstract An exploration of the interplay between HSV-1 and the non-homologous end joining proteins PAXX and DNA-PKcs Benjamin James Trigg Abstract DNA damage response (DDR) pathways are essential in maintaining genomic integrity in cells, but many DDR proteins have other important functions such as in the innate immune sensing of cytoplasmic DNA. Some DDR proteins are known to be beneficial or restrictive to viral infection, but most remain uncharacterised in this respect. Non-homologous end joining (NHEJ) is a mechanism of double stranded DNA (dsDNA) repair that functions to rapidly mend broken DNA ends. The NHEJ machinery is well characterised in the context of DDR but recent studies have linked the same proteins to innate immune DNA sensing and, hence, anti-viral responses. The aim of this thesis is to further investigate the interplay between herpes simplex virus 1 (HSV-1), a dsDNA virus, and two NHEJ proteins, DNA protein kinase catalytic subunit (DNA- PKcs) and paralogue of XRCC4 and XLF (PAXX). PAXX was first described in the literature as a NHEJ protein in 2015, but whether it has any role in the regulation of virus infection has not been established. Here we show that PAXX acts as a restriction factor for HSV-1 because PAXX-/- (KO) cells produce a consistently higher titre of HSV-1 than the respective wild type (WT) cells.
  • (Infected Cell Protein 8) of Herpes Simplex Virus L*

    (Infected Cell Protein 8) of Herpes Simplex Virus L*

    THEJOURNAL OF BIOLOGICAL CHEMISTRY Vol. 262, No. 9, Issue of March 25, pp. 4260-4266, 1987 0 1987 by The American Society of Biological Chemists, Inc Printed in U.S. A. Interaction between theDNA Polymerase and Single-stranded DNA- binding Protein (Infected Cell Protein 8) of Herpes Simplex Virus l* (Received for publication, September 22, 1986) Michael E. O’DonnellS, Per EliasQ,Barbara E. Funnellll, and I. R. Lehman From the Department of Biochemistry, Stanford University School of Medicine, Stanford, California 94305 The herpes virus-encoded DNA replication protein, ICP8 completely inhibits replication of singly primed ssDNA infected cell protein 8 (ICPS), binds specifically to templates by the herpespolymerase. On the other hand, ICP8 single-stranded DNA with a stoichiometry of one ICPS strongly stimulates replication of duplex DNA. It does so, molecule/l2 nucleotides. In the absence of single- however, onlyin the presence of anuclear extract from stranded DNA, it assembles into long filamentous herpes-infected cells. structures. Binding of ICPS inhibits DNA synthesis by the herpes-induced DNA polymerase on singly primed EXPERIMENTALPROCEDURES single-stranded DNA circles. In contrast, ICPS greatly Materials-DNase I and venom phosphodiesterase were obtained stimulates replication of circular duplex DNA by the from Worthington. The syntheticoligodeoxynucleotide (44-mer) was polymerase. Stimulation occurs only in the presence of synthesized by the solid-phase coupling of protected phosphoramidate a nuclear extract from herpes-infected cells. Appear- nucleoside derivatives (11).3H-Labeled #X ssDNA was a gift from ance of the stimulatory activity in nuclear extracts Dr. R. Bryant (this department). pMOB45 (10.5 kilobases) linear coincides closely with the time of appearance of her- duplex plasmid DNA was a gift from Dr.
  • The Neural F-Box Protein NFB42 Mediates the Nuclear Export of the Herpes Simplex Virus Type 1 Replication Initiator Protein (UL9 Protein) After Viral Infection

    The Neural F-Box Protein NFB42 Mediates the Nuclear Export of the Herpes Simplex Virus Type 1 Replication Initiator Protein (UL9 Protein) After Viral Infection

    The neural F-box protein NFB42 mediates the nuclear export of the herpes simplex virus type 1 replication initiator protein (UL9 protein) after viral infection Chi-Yong Eom*, Won Do Heo†, Madeleine L. Craske†, Tobias Meyer†, and I. Robert Lehman*‡ Departments of *Biochemistry and †Molecular Pharmacology, Stanford University School of Medicine, Stanford, CA 94305-5307 Contributed by I. Robert Lehman, February 3, 2004 The neural F-box 42-kDa protein (NFB42) is a component of the in nonneural tissues (11). The factors required for ubiquitination SCFNFB42 E3 ubiquitin ligase that is expressed in all major areas of and subsequent degradation of target proteins are found the brain; it is not detected in nonneuronal tissues. We previously throughout the cell, including the cytosol, nucleus, endoplasmic identified NFB42 as a binding partner for the herpes simplex virus reticulum, and cell-surface membranes (9, 12). 1 (HSV-1) UL9 protein, the viral replication-initiator, and showed Because NFB42 is found primarily in the cytosol (11), whereas that coexpression of NFB42 and UL9 in human embryonic kidney the UL9 protein is located predominantly in the nucleus (13), it (293T) cells led to a significant decrease in the level of UL9 protein. was important to determine the mechanism that permits their We have now found that HSV-1 infection promotes the shuttling interaction. We report here that HSV-1 infection promotes the of NFB42 between the cytosol and the nucleus in both 293T cells shuttling of NFB42 between the cytosol and the nucleus in both and primary hippocampal neurons, permitting NFB42 to bind to the 293T cells and in primary hippocampal neurons, and that NFB42 phosphorylated UL9 protein, which is localized in the nucleus.
  • Multifunctional Viral Protein γ34.5 Manipulates Nucleolar Protein

    Multifunctional Viral Protein γ34.5 Manipulates Nucleolar Protein

    Meng et al. Cell Death and Disease (2018) 9:103 DOI 10.1038/s41419-017-0116-2 Cell Death & Disease ARTICLE Open Access Multifunctional viral protein γ34.5 manipulates nucleolar protein NOP53 for optimal viral replication of HSV-1 Wen Meng1, Shi-Chong Han1,Cui-CuiLi1, Hui-Jun Dong1 and Xiao-Jia Wang1 Abstract To ensure efficient virus replication, herpes simplex virus type 1 (HSV-1) encodes several viral proteins to counter host defense response upon infection. Among these proteins, the multifunctional viral protein γ34.5 crucially interferes with or disrupts several antiviral pathways at multiple levels. The current study shows that γ34.5 utilizes nucleolar protein NOP53 to facilitate the dephosphorylation of eukaryotic initiation factor eIF2α for efficient viral translation. Our study shows that: (1) ectopic expression of NOP53 greatly increases the intracellular and extracellular viral yields of HSV-1 (wild strain F) in type I interferon-deficient Vero cells, and more subtly promotes viral replication of γ34.5 deletion mutant virus HSV-1/Δγ34.5. (2) NOP53 is migrated from nuclei in HSV-1/F infected cells, but is redistributed incompletely after infection by either HSV-1/Δγ34.5 or ICP4 deletion mutant virus HSV-1/d120 (replication inadequate). Ectopic expression of γ34.5, consequently, induces cytoplasmic translocation of NOP53 in response to HSV-1/Δγ34.5 infection. (3) Increase of NOP53, in two forms of transient transfection and in vitro expression, attenuates the phosphorylation level of eIF2α in HSV-1/F infected cells, but fails to affect eIF2α phosphorylation induced by HSV-1/ Δγ34.5 infection. (4) Knockdown of NOP53, which impairs the specific interaction between γ34.5 and protein phosphatase PP1α, disrupts the ability of γ34.5 to maintain HSV-1 virulence.
  • Infection and Transport of Herpes Simplex Virus Type 1 in Neurons: Role of the Cytoskeleton

    Infection and Transport of Herpes Simplex Virus Type 1 in Neurons: Role of the Cytoskeleton

    viruses Review Infection and Transport of Herpes Simplex Virus Type 1 in Neurons: Role of the Cytoskeleton Monica Miranda-Saksena 1,* ID , Christopher E. Denes 1 ID , Russell J. Diefenbach 2 ID and Anthony L. Cunningham 1,* ID 1 Centre for Virus Research, The Westmead Institute for Medical Research, The University of Sydney, Westmead NSW 2145, Australia; [email protected] 2 Department of Biomedical Sciences, Faculty of Medicine and Health Sciences, Macquarie University, Sydney NSW 2109, Australia; [email protected] * Correspondence: [email protected] (M.M.S.); [email protected] (A.L.C.); Tel.: +612-8627-3624 (M.M.S.) Received: 24 January 2018; Accepted: 20 February 2018; Published: 23 February 2018 Abstract: Herpes simplex virus type 1 (HSV-1) is a neuroinvasive human pathogen that has the ability to infect and replicate within epithelial cells and neurons and establish a life-long latent infection in sensory neurons. HSV-1 depends on the host cellular cytoskeleton for entry, replication, and exit. Therefore, HSV-1 has adapted mechanisms to promote its survival by exploiting the microtubule and actin cytoskeletons to direct its active transport, infection, and spread between neurons and epithelial cells during primary and recurrent infections. This review will focus on the currently known mechanisms utilized by HSV-1 to harness the neuronal cytoskeleton, molecular motors, and the secretory and exocytic pathways for efficient virus entry, axonal transport, replication, assembly, and exit from the distinct functional compartments (cell body and axon) of the highly polarized sensory neurons. Keywords: herpes simplex virus; neurons; axonal transport; cytoskeleton; microtubules; actin 1.
  • Interactions Between Polyomavirus Large T Antigen and the Viral Replication Origin Dna: How and Why

    Interactions Between Polyomavirus Large T Antigen and the Viral Replication Origin Dna: How and Why

    INTERACTIONS BETWEEN POLYOMAVIRUS LARGE T ANTIGEN AND THE VIRAL REPLICATION ORIGIN DNA: HOW AND WHY by Yu-Cai Peng Department of Microbiology and Immunology McGill University, Montreal April, 1999 A thesis submitted to the Faculty of Craduate Studies and Re3earch in partial fulfullmeat of the requirements of the degree of doctor of philosophy @Yu-Cai Peng, 1999 National Library Biblioth ue nationale 1+1 of Canada du Cana7 a Acquisitions and Acquisitions et Bibliographie Srvices services bibliographiques 395 Wellmgton Street 395, nie Weliingîm Ottawa ON KIA ON4 OrtawaON K1AON4 Canada Canada The author has granted a non- L'auteur a accordé une licence non exclusive Licence ailowing the exclusive permettant à la National Library of Canada to Bibliothèque nationale du Canada de reproduce, loan, distribute or sell reproduire, prêter, distribuer ou copies of this thesis in microform, vendre des copies de cette thèse sous paper or electronic formats. la forme de microfichelfilm, de reproduction sur papier ou sur format électronique. The author retains ownership of the L'auteur conserve la propriété du copyright in this thesis. Neither the droit d'auteur qui protège cette thèse. thesis nor substantial extracts fkom it Ni la thèse ni des extraits substantiels may be printed or othenvise de celle-ci ne doivent être imprimés reproduced without the author's ou autrement reproduits sans son permission. autorisation. TABLE OF CONTENTS Page Tableofcontents................................................... I Abstract .......................................................... VI Resumé........................................................... VI11 Acknowledgements ................................................. X Claim of contribution to kaowledge ................................... XI Listoffigures ...................................................... XllI Guidelines regarding doctoral thesis ................................... XV CHAPTER 1. INTRODUCTION .................................... 1 1. Overview: Life cycle of polyomavirus and simian virus 40 ..........
  • Noroviruses Subvert the Core Stress Granule Component G3BP1 to Promote Viral Vpg-Dependent Translation

    Noroviruses Subvert the Core Stress Granule Component G3BP1 to Promote Viral Vpg-Dependent Translation

    Washington University School of Medicine Digital Commons@Becker Open Access Publications 8-12-2019 Noroviruses subvert the core stress granule component G3BP1 to promote viral VPg-dependent translation Myra Hosmillo Jia Lu Michael R. McAllaster James B. Eaglesham Xinjie Wang See next page for additional authors Follow this and additional works at: https://digitalcommons.wustl.edu/open_access_pubs Authors Myra Hosmillo, Jia Lu, Michael R. McAllaster, James B. Eaglesham, Xinjie Wang, Edward Emmott, Patricia Domingues, Yasmin Chaudhry, Tim J. Fitzmaurice, Matthew K.H. Tung, Marc Dominik Panas, Gerald McInerney, Nicolas Locker, Craig B. Wilen, and Ian G. Goodfellow RESEARCH ARTICLE Noroviruses subvert the core stress granule component G3BP1 to promote viral VPg-dependent translation Myra Hosmillo1†, Jia Lu1†, Michael R McAllaster2†, James B Eaglesham1,3, Xinjie Wang1,4, Edward Emmott1,5,6, Patricia Domingues1, Yasmin Chaudhry1, Tim J Fitzmaurice1, Matthew KH Tung1, Marc Dominik Panas7, Gerald McInerney7, Nicolas Locker8, Craig B Wilen9*, Ian G Goodfellow1* 1Division of Virology, Department of Pathology, University of Cambridge, Cambridge, United Kingdom; 2Department of Pathology and Immunology, Washington University School of Medicine, St. Louis, United States; 3Department of Microbiology, Harvard Medical School, Boston, United States; 4Institute for Brain Research and Rehabilitation, South China Normal University, Guangzhou, China; 5Department of Bioengineering, Northeastern University, Boston, United States; 6Barnett Institute for Chemical
  • HSV-1 Single-Cell Analysis Reveals the Activation of Anti-Viral And

    HSV-1 Single-Cell Analysis Reveals the Activation of Anti-Viral And

    RESEARCH ARTICLE HSV-1 single-cell analysis reveals the activation of anti-viral and developmental programs in distinct sub-populations Nir Drayman1,2*, Parthiv Patel1,2, Luke Vistain1,2, Savas¸Tay1,2* 1Institute for Molecular Engineering, The University of Chicago, Chicago, United States; 2Institute for Genomics and Systems Biology, The University of Chicago, Chicago, United States Abstract Viral infection is usually studied at the population level by averaging over millions of cells. However, infection at the single-cell level is highly heterogeneous, with most infected cells giving rise to no or few viral progeny while some cells produce thousands. Analysis of Herpes Simplex virus 1 (HSV-1) infection by population-averaged measurements has taught us a lot about the course of viral infection, but has also produced contradictory results, such as the concurrent activation and inhibition of type I interferon signaling during infection. Here, we combine live-cell imaging and single-cell RNA sequencing to characterize viral and host transcriptional heterogeneity during HSV-1 infection of primary human cells. We find extreme variability in the level of viral gene expression among individually infected cells and show that these cells cluster into transcriptionally distinct sub-populations. We find that anti-viral signaling is initiated in a rare group of abortively infected cells, while highly infected cells undergo cellular reprogramming to an embryonic-like transcriptional state. This reprogramming involves the recruitment of b-catenin to the host nucleus and viral replication compartments, and is required for late viral gene expression and progeny production. These findings uncover the transcriptional differences in cells with variable infection outcomes and shed new light on the manipulation of host pathways by HSV-1.