Mir-H28 and Mir-H29 Expressed Late in Productive Infection Are Exported and Restrict HSV-1 Replication and Spread in Recipient Cells

miR-H28 and miR-H29 expressed late in productive infection are exported and restrict HSV-1 replication and spread in recipient cells Zhiyuan Hana,1, Xianjie Liua,1, Xiaoqing Chena, Xusha Zhoua,TeDub, Bernard Roizmanb,2, and Guoying Zhoua,2 aState Key Laboratory of Respiratory Disease, Institute of Immunology, Guangzhou Medical University, Guangzhou 511436, China; and bThe Marjorie B. Kovler Viral Oncology Laboratories, The University of Chicago, Chicago, IL 60637 Contributed by Bernard Roizman, December 30, 2015 (sent for review October 21, 2015; reviewed by Thomas E. Shenk and Richard J. Whitley) We report on the properties and function of two herpes simplex these miRNAs are (i) they are made late in infection, i.e., after virus-1 (HSV-1) microRNAs (miRNAs) designated “miR-H28” and viral DNA and structural proteins have been made; (ii)theyare “miR-H29.” Both miRNAs accumulate late in productive infection exported in exosomes; and (iii) they accumulate in neurons in at a time when, for the most part, viral DNA and proteins have which the virus is in the process of reactivation from the latent been made. Ectopic expression of miRNA mimics in human cells state but are absent from neurons harboring latent virus. Addi- before infection reduced the accumulation of viral mRNAs and tional studies showed that ectopic expression of mimics of these proteins, reduced plaque sizes, and at vey low multiplicities of miRNAs in cells before infection reduces the rate of accumu- infection reduced viral yields. The specificity of the miRNA mimics lation of viral proteins, decreases plaque size, and at the same was tested in two ways. First, ectopic expression of mimics carry- time reduces viral yields in cells infected at a very low multi- ing mutations in the seed sequence was ineffective. Second, in plicity of infection. similar tests two viral miRNAs made early in productive infection One hypothesis that could explain the evolution of these miRNAs also had no effect. Both miR-H28 and miR-H29 are exported from is the need to block excessive replication of reactivating virus for infected cells in exosomes. A noteworthy finding is that both miR-H28 two reasons. First, repulsive lesions on the mouth or genitals and miR-H29 were absent from murine ganglia harboring latent virus would reduce physical contact between the infected tissues of the but accumulated in ganglia in which the virus was induced to transmitter and the uninfected tissue of the recipient. A second reactivate. The significance of these findings rests on the principle reason may be to reduce the amount of virus made on reac- that the transmission of HSV from person to person is by physical tivation to ensure that the reactivated virus is transmitted an- contact between the infected tissues of the donor and those of terograde to the mouth or genitals rather than retrograde to the uninfected recipient. Diminished size of primary or recurrent lesions CNS. Retrograde transport would likely kill the host and block could be predicted to enhance person-to-person transmission. Re- further viral spread. In essence these studies support the con- duction in the amount of reactivating latent virus would reduce the clusion that HSV-1 down-regulates its replication to enhance risk of retrograde transport to the CNS but would not interfere with its spread and that this process is executed by viral gene products. anterograde transport to a site at or near the site of initial infection. Results exosome | latency | reactivation | trigeminal ganglia The Isolation, Sequence, and Properties of HSV-1 miR-H28 and miR- H29. Deep-sequencing analyses of cells infected with HSV-1(F) erpes simplex viruses (HSVs) infect and multiply in cells at [the prototype HSV-1 strain used in our laboratories (15)] led to Hthe portal of entry, i.e., mouth or genitals (1). They then are the identification of two heretofore unreported viral miRNAs. exported by retrograde transport to sensory or autonomic neu- The critical parameters of miR-H28 and miR-H29 are listed rons where they establish latent (silent) infection. In response to in Table 1. In brief miR-H28 and miR-H29 were isolated neuronal stress, the virus reactivates and is transported anterograde to a site at or near the site of initial infection. At that site Significance the virus is available for transmission by physical contact between the infected tissues of the donor and those of the uninfected Herpes simplex virus-1 (HSV-1) is transmitted by contact be- recipient (1, 2). In principle it would be expected that extensive tween the infected tissues of a transmitter and those of an lesions on initial infection and on reactivation would seed more uninfected recipient. Effective spread requires that the lesions neurons with latent virus and increase the transmission of virus be small and not repulsive in appearance. For successful from person to person. This report challenges the hypothesis that transmission HSV must control both its replication and its viral gene products uniformly enhance viral replication and spread. spread from infected to uninfected cells. Here we report that This report centers on the function of two newly detected viral two HSV microRNAs (miRNAs) made late in productive in- microRNAs (miRNAs). Specifically HSV-1 and HSV-2 have fection are exported in exosomes. Ectopic expression in trans- – been reported to express at least 27 miRNAs (3 13). Analyses of fected cells before infection reduces the synthesis of viral gene 17 of these miRNAs have shown that they differ in their re- products and the spread from infected to uninfected cells. The quirements for synthesis in productively infected cells. Thus, miRNAs accumulate in neurons after latent virus is induced to some are made in higher amounts in the absence of viral protein reactivate. The miRNAs conform to the expectations of gene synthesis, but others require viral protein synthesis for their products that control viral replication and spread. synthesis (14). A confounding problem associated with the function of viral miRNAs is that miRNAs made in the course of Author contributions: B.R. and G.Z. designed research; Z.H., X.L., X.C., X.Z., and T.D. latent infections in neurons are also made in productively in- performed research; B.R. and G.Z. analyzed data; and B.R. and G.Z. wrote the paper. fected cells, whereas some, but not all, miRNAs accumulating in Reviewers: T.E.S., Princeton University; and R.J.W., University of Alabama at Birmingham. neurons in which latent virus is in the process of reactivation are The authors declare no conflict of interest. not made in appreciable amounts in productively infected cells (14). 1Z.H. and X.L. contributed equally to this work. Here we report the properties of two newly identified miRNAs 2To whom correspondence may be addressed. Email: [email protected] designated “miR-H28” and “miR-H29.” The key properties of or [email protected]. E894–E901 | PNAS | Published online February 1, 2016 www.pnas.org/cgi/doi/10.1073/pnas.1525674113 Downloaded by guest on September 29, 2021 Table 1. Genomic location and sequence of HSV-1(F) miR-H28, miR-H29, and derivatives PNAS PLUS miRNAs and derivatives miR-H28 miR-H29 Position in HSV-1 DNA 12,316–12,462 64,820–64,994 UL4 UL30 (antisense) (sense) miRNA precursor auaggcuauacgcgauggu ccaggguccuugaccccacu cgucuguggauuggacauc uccggguuucaugugaaccc ucgcgguggguagugagucc cguggugguguucgacuuu cccgggccggguucggugga gccagccuguaccccagcau acuguaaggggacggcgggu cauccaggcccacaaccugu uaauauacaaugaccacgu gcuucagcacgcucucccug ucggaucgcgcagagccgau agggccgacgcaguggcgca aguaugugcu ccuggaggcgggcaaggacu accuggagaucgaggu Mature miRNA CGAUGGUCGUCUG CUGGAGGCGGGCAAG UGGAU GACUACC Total reads [HSV-1(F), 0.1 pfu per cell, 16 h] HEK293T 487 415 HEp-2 432 505 NT UUCUCCGAACGUGUCACGUTT M1-H29 CAGCUGCGGGGCAAGGACUACC M2-H29 CACCUCCGGGGCAAGGACUACC Boldface indicates the mature miRNA sequence and its location. from both infected HEK293T and HEp-2 cells. The miR-H28 lines are shown in Fig. 1. In these studies, the cells were ex- sequence is antisense to and maps close to the N-terminal do- posed to 1 pfu of wild-type virus per cell and were incubated in main of unique long 4 (UL4) (Table 1). miR-H29 maps in the standard medium devoid of drugs or medium containing cy- same sense as the coding sequence of unique long 30 (UL30) cloheximide or actinomycin D. The measurements obtained (Table 1). The function of UL4 is unclear. UL30 encodes the were normalized with respect to the U6 small cellular RNA viral DNA polymerase (1). present in mock-infected untreated cells (0 h). The results The patterns of accumulation of miR-H28 and miR-H29 in show that expression of both miR-H28 and miR-H29 requires the course of productive infection in HEK293T and HEp-2 cell prior viral protein synthesis in both cell lines. The accumulation Fig. 1. Accumulation of miR-H28 and miR-29 in infected cells. Replicate cultures of HEp-2 cells (A and C) and HEK293T cells (B and D) were exposed to 1 pfu of HSV-1(F) per cell and were mock-treated or incubated in medium containing 100 μg/mL cycloheximide (CHX) or 10 μg/mL actinomycin D (Act.D). The cells were harvested at 1, 3, 6, 12, or 24 h postinfection. miR-H28 (A and B) and miR-H29 (C and D) were normalized with respect to U6 small cellular RNA detected in MICROBIOLOGY mock-infected cells (0 h). Han et al. PNAS | Published online February 1, 2016 | E895 Downloaded by guest on September 29, 2021 i) The reduction in the accumulation of viral mRNAs as a function of the amounts of miR-H29 transfected into HEp-2 cells. The objectives of these experiments were twofold: to determine whether the miR-H29 mimic is effective in reduc- ing the accumulation of mRNAs of representative α (ICP27), β (ICP8), or γ (VP16) genes and whether the effects are dependent on the concentration of mimics transfected into cells.

Load more