Post-Transcriptional Gene Regulation by Hur Promotes a More Tumorigenic Phenotype

Oncogene (2008) 27, 6151–6163 & 2008 Macmillan Publishers Limited All rights reserved 0950-9232/08 $32.00 www.nature.com/onc ORIGINAL ARTICLE Post-transcriptional gene regulation by HuR promotes a more tumorigenic phenotype

K Mazan-Mamczarz1, PR Hagner1, S Corl1, S Srikantan2, WH Wood3, KG Becker3, M Gorospe2, JD Keene4, AS Levenson5 and RB Gartenhaus1

1Marlene and Stewart Greenebaum Cancer Center, University of Maryland, Baltimore, MD, USA; 2Laboratory of Cellular and Molecular Biology, National Institute on Aging, National Institutes of Health, Baltimore, MD, USA; 3Gene Expression and Genomics Unit, National Institute on Aging, National Institutes of Health, Baltimore, MD, USA; 4Department of Molecular Genetics & Microbiology, Duke University Medical Center, Durham, NC, USA and 5Northwestern University, Feinberg School of Medicine, Department of Urology and Robert H Lurie Comprehensive Cancer Center, Chicago, IL, USA

In a breast tumor xenograft model, the MCT-1 oncogene Introduction increases the in vivo tumorgenicity ofMCF7 cells by promoting angiogenesis and inhibiting apoptosis. In- In a human xenograft model, the MCT-1/MCTS-1 creases in the tumor microvascular density are accom- (multiple copies in T-cell lymphoma 1) oncogene, panied by a strong reduction in the levels ofthe hereafter named MCT-1 (Prosniak et al., 1998), angiogenesis inhibitor thrombospondin-1 (TSP1), but the promotes the transition to a more aggressive phase in mechanisms underlying this process are unknown. We breast cancer progression by enhancing invasiveness and show that TSP1 expression is controlled, at least in part, decreasing apoptosis (thereby promoting the formation by post-transcriptional events. Using RNA interference to of larger tumors), and increases angiogenesis by redu- knock down the expression ofthe RNA-binding protein cing the expression of the angiogenesis inhibitor TSP1/ HuR in MCF7 cells as well as HuR overexpression, we THBS-1 (thrombospondin 1; Levenson et al., 2005), demonstrate that HuR plays an important role in hereafter named TSP1. Given that natural angiogenesis translation ofthe TSP1 mRNA. Furthermore, employing inhibitors appear to have low toxicity, and that newly the RIP-Chip assay yielded 595 transcripts with signifi- formed vessels are more sensitive to angiogenesis cantly altered binding to HuR in the more tumorigenic inhibitors than quiescent vessels, there is growing breast cancer clones compared with the weakly tumori- interest in developing TSP1-based cancer therapies genic clones. These mRNAs clustered in several pathways (Ren et al., 2006). Previous data demonstrate that implicated in the transformed phenotype, such as the RAS overall vascular density correlates to poor cancer pathway (involved in mitogenesis), the PI3K pathway prognosis (Weidner, 1998) and that TSP1 expression is (evasion ofapoptosis) and pathways mediating angio- inversely correlated with malignant progression of genesis and the cellular response to hypoxia. These breast cancer (Zabrenetzky et al., 1994; Watnick et al., findings demonstrate for the first time that global changes 2003). Thus, understanding the mechanism of action in HuR-bound mRNAs are implicated in the evolution to a and regulation of TSP1 during angiogenesis and tumor more tumorigenic phenotype in an in vivo tumor model progression has become important. and underscore the role ofglobal mRNA-protein inter- RNA turnover and translation are critical post- actions toward tumor progression. transcriptional mechanisms of gene regulation in mam- Oncogene (2008) 27, 6151–6163; doi:10.1038/onc.2008.215; malian cells, primarily governed by the interaction of published online 21 July 2008 mRNA with specific RNA-binding proteins (RBPs). Many ribonucleoprotein (RNP) associations implicating Keywords: post-transcriptional operon; MCT-1 oncogene; sequences present in the 30-untranslated regions TSP1; HuR; RNA-binding protein; tumor angiogenesis (30UTRs) of mRNAs have been shown to regulate the transport, turnover and translation rates of the target mRNAs (Piecyk et al., 2000; Bevilacqua et al., 2003; Mazan-Mamczarz et al., 2006; Keene, 2007; Liao et al., 2007). Although the nucleotide composition of such regulatory sequences is very variable, often they are rich in adenines and uracils (AREs). The presence of AREs 0 Correspondence: Professor RB Gartenhaus, Marlene and Stewart in the TSP1 3 -UTR suggest that the regulation of TSP1 Greenebaum Cancer Center, University of Maryland, 9-011 BRB, 655 on the mRNA level may be an important mechanism West Baltimore Street, 22 South Greene street, Baltimore, MD 21201, involved in controlling TSP1 gene expression and plays USA. a critical role in tumor progression. E-mail: [email protected] Received 5 March 2008; revised 30 May 2008; accepted 11 June 2008; In this investigation, we set out to formally examine published online 21 July 2008 the molecular mechanisms regulating the expression of Global changes in HuR-bound mRNAs and tumor progression K Mazan-Mamczarz et al 6152 TSP1 in a model of increased tumorigenicity elicited cells (Figure 1a). Although the possible contributions of through the enhanced expression of the MCT-1 altered trancription or TSP1 protein stability were not oncogene (Levenson et al., 2005). Systematic study of formally ruled out, the observed reduction in TSP1 several RBPs implicated in post-transcriptional gene protein abundance was not accompanied by a compar- regulation (collectively termed translation and turnover able decrease in TSP1 mRNA levels (Figure 1b) or TSP1 regulatory (TTR) RBPs or TTR-RBPs, Pullmann et al., mRNA stability (Supplementary information, Figure 2007) to the TSP1 mRNA revealed that HuR/ELAVL1, S1), suggesting that the MCT-1-mediated decrease of hereafter named HuR specifically associated with TSP1 TSP1 might be effected by altered translation. mRNA and that this interaction was dramatically To test that TSP1 translation might be reduced in decreased in highly tumorigenic clones (with increased MCT-1 overexpressing cells, cytoplasmic extracts from MCT-1 levels). HuR regulates the stability and transla- Vector and MCT-1 cell lines were subjected to sucrose tion of many ARE-containing mRNAs and thereby density gradient analysis and the TSP1 mRNAs controls the expression of the encoded proteins, often associated with the translational machinery were mon- involved in the cell division cycle, carcinogenesis, itored. The fractions containing the nontranslating senescence and the immune and stress responses RNA (fractions 1–5) and containing polysomes (frac- (Brennan and Steitz, 2001; Kullmann et al., 2002; tions 6–11) were pooled and TSP1 mRNA abundance Galba´ n et al., 2003; Mazan-Mamczarz et al., 2003; was measured by real-time quantitative PCR (RT– Lopez de Silanes et al., 2004; Lal et al., 2005). In keeping qPCR; Figure 1c). As shown, TSP1 mRNA levels in with these functions, we found that HuR enhanced the polysomal fractions were decreased in all MCT-1 translation of the TSP1 mRNA in this model system. overexpressing populations compared to V cells: it was Interestingly, however, in cells with a more aggressive 60% lower in M cells, and 70% in both N1 and N7 phenotype (expressing high levels of MCT-1), HuR clones. The reduced presence of TSP1 mRNA in the dissociated from TSP1 mRNA, in turn causing a translating fractions suggested that the heightened reduction in TSP1 mRNA translation. Given the expression of MCT-1 in MCF7 cells decreased the proposed function of HuR in cancer, we examined the translation of TSP1 protein. Further evidence that the global interaction of HuR with other target mRNAs in translation of TSP1 was inhibited with increased this model of increased tumorigenicity. We found that expression of MCT-1 was obtained using a de novo the MCT-1 enhanced breast cancer tumorigenicity was translation assay that measured the rate of nascent TSP1 associated with significant alterations in the association protein synthesis. Vector (V) and MCT-1 transfected of HuR with functional subsets of mRNAs. In lines (M, N1 and N7) were briefly incubated in the accordance with the post-transcriptional operon model presence of L-[35S]methionine and L-[35S]cysteine, where- (Keene and Tenenbaum, 2002), our findings suggest that upon the newly translated TSP1 protein was visualized HuR functions as a downstream effector of MCT-1- by immunoprecipitation (IP) with anti- TSP1 antibody. regulated gene expression in cancer: HuR’s association While the short (20 min) incubation period for labeling with mRNAs that encode tumor-promoting proteins is inefficient and yields relatively weak signals, it allows increases (as shown for cyclins and prothymosin a the detection of newly translated protein and minimizes (Wang et al., 2000a; Lal et al., 2005)) and its association the potential contribution of protein degradation. These with mRNAs that inhibit tumorigenesis decreases, as data revealed about five fold lower de novo protein shown here for TSP1 mRNA. biosynthesis of TSP1 in all MCT-1 overexpressing cell lines that was consistent with the decreased association of TSP1 mRNA with polysomes (Figure 1d). Together, these data show that in the highly tumorigenic MCF7 Results clones expressing elevated levels of the MCT-1 oncogene, the translation of the TSP1 mRNA were Increased expression of MCT-1 reduces the translation diminished, leading to the decreased TSP1 protein of angiogenesis inhibitor TSP1 biosynthesis. Mammary epithelial adenocarcinoma MCF7 cells were stably transfected with MCT-1, and two clones that overexpressed MCT-1 protein, N1 and N7, were isolated HuR binds TSP1 mRNA and described previously in a human xenograft mouse Given previous reports linking RBPs to post-transcrip- model (Levenson et al., 2005). Here, we used the N1 and tional gene regulation (Keene, 2001; Wilusz and Wilusz, N7 clones from the in vivo tumor progression model to 2004), the existence of U-rich and AU-rich regions in the examine the mechanism(s) underlying the decreased long (B2 kb) TSP1 30UTR (Figure 2a), and the fact that TSP1 production in the MCF7 cells with a more the TSP1 30UTR contains six computationally predicted aggressive phenotype. hits of a previously identified HuR motif (Lopez de We first examined the expression levels of TSP1 from Silanes et al., 2004), we directly examined whether this MCF7 cells transfected with empty Vector (V), the RBP might be involved in the post-transcriptional pooled population overexpressing MCT-1 (M), and the regulation of TSP1 expression. The association of two MCT-1 overexpressing clones (N1 and N7). The several TTR-RBPs with endogenous TSP1 mRNA was levels of TSP1 protein decreased markedly (B5-fold) in tested by IP analysis using MCF7 cell lysates and all MCT-1 overexpressing cell lines compared to Vector antibodies recognizing the major TTR-RBPs (HuR,

Oncogene Global changes in HuR-bound mRNAs and tumor progression K Mazan-Mamczarz et al 6153 1.5 V M N1 N7 - TSP1

- 1.0

- HuR 0.5 - V5-MCT-1 100 22.3 13.6 37.8 %

Fold of TSP1/GAPDH mRNA Fold of 0 V M N1 N7 Non-translating Free Polysomes mRNA Translating 120 Monosmes 254 A 100 IP: IgG TSP1 80 VV M N1 N7 Fr.# 1 234567891011 35 60 S-[TSP1]

40 % - 100 21.3 22.6 21.3

TSP1 mRNA levels (%) TSP1 mRNA levels 20

0 V M N1 N7 Figure 1 MCT-1 overexpression decreases translation and protein expression of thrombospondin-1 (TSP1) in MCF7 cells. (a) Representative western blot analysis of cells stable transfected with the empty Vector (V), and cells stable overexpressing MCT-1; mass culture (M) and to different clones (N1 and N7). A unit of 50 mg of total protein lysates were loaded and the abundance of TSP1, b-Actin, HuR and MCT-1 was assessed. (b) Changes in TSP1 total mRNA levels (relative to GAPDH mRNA) assessed by RT–qPCR for Vector (V), and MCT-1 overexpressiong cells; mass culture (M) and two clones (N1 and N7). Graphs represent the means and s.e.m. from three independent experiments. Clone N1 showed less than two fold difference compared to Vector (V); t-test value of Po0.01. (c) The relative association of the TSP1 mRNA with polysomes was tested by preparing cytoplasmic lysates from MCF7 stable cell lines (described in Figure 1a), fractionating them through sucrose gradients and collecting 11 fraction for analysis. Representative polysome distribution profile obtained after centrifugation of cytopasmic lysates over sucrose gradient (inset); free mRNA, monosomes and polysomes of increasing molecular weight are indicated. The levels of TSP1 mRNA in the pooled 1–5 fractions comprised the nontranslating RNA, and pooled 6–11 fractions comprised the translating RNA were quantified by real-time quantitative PCR (RT–qPCR) and normalized to GAPDH mRNA. Graphs represent the means and s.e.m. from six independent experiments; Po0.01 significantly different compared to Vector (V) by t-test. (d) Newly translated TSP1 protein was assessed by 20 min incubation of each stable transfected MCF7 cell lines (described in Figure 1a) with L-[35S]methionine and L-[35S]cysteine and immunoprecipitation (IP) of protein lysates with either anti-TSP1 antibody or control IgG. Samples were resolved by SDS– polyacrylamide gel electrophoresis, transferred onto membranes, and signal was visualized by PhosphoImager. Representative data are shown. In panels a and d, quantification of TSP1 signals is expressed as the percentage of the signal intensity relative to that in Vector (V) cells.

AUF-1/ hnRNPD, TIA-1 and TIAR). The association transcripts and other parts of 30UTR. AUF-1 was found of RBPs with TSP1 mRNA was monitored by RT– to bind the same ‘30D’ TSP1 sequence, although binding qPCR analyses of mRNAs isolated from the IP material appeared to be significantly weaker, while TIA-1 did not using TSP1 mRNA-specific primers (Figure 2b). As bind any TSP1 transcripts (Figure 2c). These data shown, the TSP1 PCR product was highly enriched in indicate that TSP1 mRNA is a specific target of RBP the IP material obtained with anti-HuR antibody HuR both when assessing the endogenous mRNA and compared with the low level of amplification seen in when testing a recombinant transcript in vitro, and the control immunoglobulin G (IgG) IP and in the IPs binding occurs in the terminal region of the TSP1 obtained using anti-AUF-1, anti-TIA-1 and anti-TIAR 30UTR. antibodies. To monitor the evenness of loading of the input material, we amplified GAPDH mRNA, which showed equal low-level background contamination in all Binding of the HuR to the TSP1 mRNA decreased of the IP samples tested (not shown). when using lysates from cells with increased MCT-1 levels To precisely determine the region of the TSP1 mRNA Given the reported ability of HuR and other ELAV that interacted with HuR, we synthesized several proteins to influence mRNA stability and/or translation biotinylated transcripts spanning the TSP1 mRNA (Brennan and Steitz, 2001; Gorospe, 2003), we set out to (Figure 2c, schematic) and used them in pull down directly investigate the potential contribution of HuR to assays (see Materials and methods). HuR prominently the reduction of TSP1 expression in MCT-1 expressing bound the terminal 30 untranslated region (30 UTR) MCF7 cells. First, we examined the association of TSP1 (‘30D’ fragment) but not the coding region (CR), 50UTR mRNA with HuR by carrying out RNP IP reactions

Oncogene Global changes in HuR-bound mRNAs and tumor progression K Mazan-Mamczarz et al 6154 similar to those described in Figure 2b, using lysates (included in order to monitor background binding and from V, M, N1 and N7 cells. The abundance of mRNAs as a loading control) in the IP samples was quantiﬁed by encoding TSP1 or the housekeeping GAPDH mRNA RT–qPCR. The association of TSP1 mRNA with HuR

5’UTR Coding Region 3’UTR

1 180 3692 5820

atcatcaaattgttgattgaaagactgatcataaaccaatgctggtattgcaccttctggaactatgggcttgagaaaaccccc aggatcacttctccttggcttccttcttttctgtgcttgcatcagtgtggactcctagaacgtgcgacctgcctcaagaaaatg cagttttcaaaaacagactcagcattcagcctccaatgaataagacatcttccaagcatataaacaattgctttggtttccttt tgaaaaagcatctacttgcttcagttgggaaggtgcccattccactctgcctttgtcacagagcagggtgctattgtgaggcca tctctgagcagtggactcaaaagcattttcaggcatgtcagagaagggaggactcactagaattagcaaacaaaaccaccctga catcctccttcaggaacacggggagcagaggccaaagcactaaggggagggcgcatacccgagacgattgtatgaagaaaatat ggaggaactgttacatgttcggtactaagtcattttcaggggattgaaagactattgctggatttcatgatgctgactggcgtt agctgattaacccatgtaaataggcacttaaatagaagcaggaaagggagacaaagactggcttctggacttcctccctgatcc ccacccttactcatcacctgcagtggccagaattagggaatcagaatcaaaccagtgtaaggcagtgctggctgccattgcctg gtcacattgaaattggtggcttcattctagatgtagcttgtgcagatgtagcaggaaaataggaaaacctaccatctcagtgag caccagctgcctcccaaaggaggggcagccgtgcttatatttttatggttacaatggcacaaaattattatcaacctaactaaa acattccttttctcttttttcctgaattatcatggagttttctaattctctcttttggaatgtagattttttttaaatgcttta cgatgtaaaatatttattttttacttattctggaagatctggctgaaggattattcatggaacaggaagaagcgtaaagactat ccatgtcatctttgttgagagtcttcgtgactgtaagattgtaaatacagattatttattaactctgttctgcctggaaattta ggcttcatacggaaagtgtttgagagcaagtagttgacatttatcagcaaatctcttgcaagaacagcacaaggaaaatcagtc taataagctgctctgccccttgtgctcagagtggatgttatgggattctttttttctctgttttatcttttcaagtggaattag ttggttatccatttgcaaatgttttaaattgcaaagaaagccatgaggtcttcaatactgttttaccccatcccttgtgcatat ttccagggagaaggaaagcatatacacttttttctttcatttttccaaaagagaaaaaaatgacaaaaggtgaaacttacatac aaatattacctcatttgttgtgtgactgagtaaagaatttttggatcaagcggaaagagtttaagtgtctaacaaacttaaagc tactgtagtacctaaaaagtcagtgttgtacatagcataaaaactctgcagagaagtattcccaataaggaaatagcattgaaa tgttaaatacaatttctgaaagttatgttttttttctatcatctggtataccattgctttatttttataaattattttctcatt gccattggaatagatatctcagattgtgtagatatgctatttaaataatttatcaggaaatactgcctgtagagttagtatttc tatttttatataatgtttgcacactgaattgaagaattgttggttttttcttttttttgttttgtttttttttttttttttttt tgcttttgacctcccatttttactatttgccaatacctttttctaggaatgtgcttttttttgtacacatttttatccatttta cattctaaagcagtgtaagttgtatattactgtttcttatgtacaaggaacaacaataaatcatatggaaatttatatttataa aaaaaaaaaaaaaaaaaaaaaaaaaaaaa

5 Fold TSP1 mRNA in IP (relative to IgG) Fold 0 HuR AUF1 TIA-1 TIAR

5’CR 3’A 3’B 3’C 3’D

5’CR 3’A 3’B 3’C 3’D lysate

- HuR

- AUF1

- TIA-1

Oncogene Global changes in HuR-bound mRNAs and tumor progression K Mazan-Mamczarz et al 6155 was 65–85% reduced in the IP material obtained from maximum levels of TSP1 expression possible), while all three cell lines with elevated MCT-1 levels (M, N1 MCT-1 cells showed strikingly heightened (>8-fold) and N7) compared with the parental cells (V) TSP1 levels compared with cells transfected with the (Figure 3a). The reduced abundance of HuR-TSP1 empty tandem affinity purification (TAP) vector despite mRNA complex was not a result of different HuR IP the fact that they consistently showed a reduced efficiency (Figure 3b) or changes in HuR levels magnitude of HuR overexpression. TSP1 mRNA levels, (Figure 1a). However, we did not find any differences as measured by RT–qPCR analysis, was modestly in the association of the other RBPs studied (AUF-1, elevated after HuR overexpression in both cell lines TIA-1 and TIAR) to the TSP1 mRNA when comparing (Figure 4b). Taking into consideration the earlier cells that expressed different MCT-1 levels (Figure 3a; reports showing that HuR can promote the translation Supplementary information, Figure S3). of target mRNAs (Kullmann et al., 2002; Galba´ n et al., 2003; Mazan-Mamczarz et al., 2003; Lal et al., 2005) and our findings that TSP1 mRNA was much less Modulation of HuR expression influences TSP1 abundant in translating fractions and that TSP1 protein translation was less actively translated in the more malignant lines To study the functional consequences of decreased (Figures 1c and d), it was important to investigate HuR-TSP1 mRNA interaction on TSP1 mRNA and whether the TSP1 translation was regulated by HuR. protein levels, we carried out experiments in which HuR First, we examined whether the positive effect of HuR expression in MCF7 cells were modified (see Material on TSP1 expression levels in MCF7 cells was due to an and methods). Overexpression of HuR increased TSP1 enhanced association of TSP1 mRNA with actively protein abundance in both the Vector and MCT-1 translating polysomes. When pooling sucrose gradient overexpressing populations (Figure 4a). HuR over- fractions according to translational activity (no transla- B expression in Vector cells had lower effect ( 2-fold) tion, low translation or active translation), cells expres- on TSP1 production (the cells might have reached the sing elevated levels of HuR (HuR-TAP) shifted the distribution of TSP1 mRNA toward the heavier 100 polysomal fractions (fractions 10 and 11) in both the V Vector and MCT-1 overexpressing populations M (Figure 4c). The translational status of the TSP1 mRNA 80 N1 N7 was also monitored by directly assessing de novo protein 60 synthesis assay (Figure 4d). These data revealed more than five fold increase in TSP1 translation in cells 40 overexpressing HuR (HuR-TAP) relative to control transfection (TAP) in both cell lines (Vector, MCT-1), 20 providing additional in vivo evidence that HuR enhances

TSP1 mRNA abundance in IP (%) TSP1 mRNA abundance TSP1 mRNA translation. 0 Reduction of HuR levels by transfecting MCF7 cells HuRAUF1 TIA1 TIAR with targeting HuR siRNA effectively decreased the

IP: IgG HuR HuR levels in both Vector cells and MCT-1 over- VV M N1 N7 Lys expressing populations to o10% of the HuR levels seen in control transfection populations. Decreasing HuR HuR expression (HuR siRNA) caused more than two fold decrease in TSP1 protein abundance in both cell lines Figure 3 MCT-1 overexpression decreased the association of studied (Figure 5a). As measured by RT–qPCR, the HuR with thrombospondin-1 (TSP1) mRNA. (a) Cytoplasmic reduction was not inﬂuenced signiﬁcantly by lower total lysates from stable transfected MCF7 cell lines (described in Figure 1a) were employed for immunoprecipitation (IP) assays, TSP1 mRNA levels in HuR siRNA cells (Figure 5b). As using antibodies that recognized HuR, AUF-1/hnRNP D, TIA-1 in the HuR overexpression experiments, the transla- or TIAR. RNA was isolated and reverse transcription (RT) tional status of TSP1 mRNA was tested by monitoring following qPCR was performed. Graph represents the mean and by distribution of TSP1 mRNA in polysomal fractions s.e.m. from three independent assays. Po0.02 versus Vector (V) in IPs with HuR antibody. (b) Representative IP assays performed as along a sucrose gradient in control and HuR-silenced described in but followed by western blot analysis to assess the cell populations. HuR-silenced groups (HuR siRNA) abundance of HuR protein in the IP material. showed that TSP1 mRNA was more abundant in the

Figure 2 HuR binds the thrombospondin-1 (TSP1) mRNA. (a) Sequence of TSP1 mRNA depicting AREs sequences (underline) in TSP1 3-untranslated region (3UTR). (b) The association of TSP1 mRNA with ARE-binding proteins (HuR, AUF-1/HRNDP, TIA-1 and TIAR) was checked by immunoprecipitation (IP) of MCF7 cell lysates using either control (immunoglobulin G; IgG) or speciﬁc antibodies. The obtained RNA was reverse transcribed and measured by qPCR. Shown are means and s.e.m. from three independent experiments; GAPDH mRNA background ampliﬁcation in the IP material was used as normalization control. (c) Schematic of TSP1 mRNA, representing the biotynolated transcripts (50UTR, CR and 30UTR—A, B, C and D fragments) used for biotin pull-down analysis (top). A unit of 2 mg of each biotinylated transcript were incubated with 40 mg of MCF7 cytoplasmic lysates. The presence of HuR, AUF-1/HRNDP and TIA-1 in the pull-down material was detected by western blotting; representative picture of couple repeats is shown.

Oncogene Global changes in HuR-bound mRNAs and tumor progression K Mazan-Mamczarz et al 6156 Vector MCT-1 TAP HuR-TAP TAP HuR-TAP

- TSP1 TAP 1.5 HuR-TAP

- HuR-TAP 1.0

- HuR 0.5

- TSP1/GAPDH mRNA Fold of 0.0 Vector MCT-1 100 185.2 100 854.1%

200 Vector TAP MCT-1 TAP HuR-TAP * HuR-TAP

150

* 100 * * * * 50 TSP1 mRNA levels (%) TSP1 mRNA levels

0 Fr. # 1,2,3 4,5 6,7 8,9 10,11 1,2,3 4,5 6,7 8,9 10,11

IP : IgG TSP1 Vector Vector MCT-1 HuR- HuR- TAP TAP TAP TAP TAP 35S-[TSP1]

% - 100 680.7 17.8 93.8 Figure 4 Overexpression of HuR in MCF7 cells increases translation and TSP1 protein expression. (a) MCF7 cells with normal (Vector) and overexpressing MCT-1 (MCT-1) levels were transiently transfected with either a control plasmid (TAP) or a plasmid overexpressing a tagged HuR (HuR-TAP) and lysate after 72 h. Ectopically expressed HuR (HuR-TAP), endogenous HuR, TSP1 and a-Tubulin (loading control) levels were analyzed by western blotting; representative data from three independent assays are shown. (b) The abundance of total TSP1 mRNA in cells expressing normal HuR levels (TAP) or overexpressing HuR (HuR-TAP) from both Vector and MCT-1 cell lines were measured by RT–qPCR in two separate experiments (mean values and s.e.m. are shown). (c) MCF7 cells were transfected as in (a). mRNAs were extracted from each fraction, each of two or three consecutive fractions were pooled together (fractions 1, 2 and 3, fractions 4 and 5, fractions 6 and 7, fractions 8 and 9 and fractions 10 and 11), and the TSP1 mRNAs were measured by real-time quantitative PCR (RT–qPCR). Data were normalized to the GAPDH mRNA. Graphs represent the means and s.e.m. from three independent experiments. *Po0.05. (d) De novo TSP1 translation in MCF7 cell lines (Vector and overexpressing MCT-1) transfected as in panel (a) was assessed by cells incubation in L-[35S]methionine and L-[35S]cysteine, immunoprecipitation (IP) reaction using anti-TSP1 antibody or immunoglobulin G (IgG), protein electrophoresis by SDS– polyacrylamide gel electrophoresis and detection of incorporated radiolabeled amino acids into newly synthesized TSP1 protein by PhosphorImager. Representative results are shown. In panels a and d, TSP1 signals were quantiﬁed and are represented as the percentage of the signal intensity in the empty vector (TAP) group.

low translating fractions (fractions 6 and 7) and less more, in MCT-1 expressing cells, HuR association with abundant in the actively translating fractions (10 and TSP1 mRNA is reduced, and consequently TSP1 11) in both Vector and MCT-1 cells (Figure 5c). mRNA and protein levels decrease. Importantly, nascent TSP1 translation (as measured by in vivo incorporation of radiolabeled amino acids into newly synthesized TSP1) was two fold lower in both Functionally related subsets of mRNAs are regulated Vector and MCT-1 MCF-7 populations with silenced by HuR in the MCF7 cells exhibiting an aggressive HuR (HuR siRNA; Figure 5d). Taken together, our phenotype ﬁndings support the concept that HuR associates with According to the proposed post-transcriptional operon the TSP1 mRNA and enhances its translation. Further- model, functionally related genes are coordinately

Oncogene Global changes in HuR-bound mRNAs and tumor progression K Mazan-Mamczarz et al 6157 Vector MCT-1 Ctrl. HuR Ctrl. HuR siRNA siRNA siRNA siRNA Ctrl. siRNA 1.5 HuR siRNA - TSP1 1.0 - HuR 0.5

Fold of TSP1/GAPDH mRNA Fold of 0.0 100 49.9 100 38.7 % Vector MCT-1

200 Vector Ctrl. siRNA MCT-1 Ctrl. siRNA HuR siRNA HuR siRNA * 150 *

100

* 50 TSP1 mRNA levels (%) TSP1 mRNA levels

0 Fr. #1,2,3 4,5 6,7 8,9 10,11 1,2,3 4,5 6,7 8,9 10,11

IP : IgG TSP1 Vector Vector MCT-1 Ctrl. Ctrl. HuR Ctrl. HuR siRNA siRNA siRNA siRNA siRNA 35S-[TSP1] % - 100 52.1 21.7 13.8 Figure 5 HuR silencing reduces the expression of TSP1 in MCF7 cells. (a) MCF7 cells (Vector and overexpressing MCT-1) were transiently transfected either with control siRNA (Ctrl. siRNA) or siRNA targeting HuR (HuR siRNA). After 72 h, western blot analysis of HuR, TSP1 and the loading control a-Tubulin were performed. Assays were repeated three times; representative pictures are shown. (b) Real-time quantitative PCR (RT–qPCR) analysis to monitor total TSP1 mRNA levels by 72 h after siRNA transfection. Analysis was performed three times independently. (c) Seventy-two hours after transfection, cells with HuR-targeting (HuR siRNA) or control (Ctrl. siRNA) siRNAs and TSP1 mRNA levels in sucrose fractions were measured as described in Figure 4c. Graphs depict the means and s.e.m. from three independent experiments. *Po0.05. (d) Changes in newly translated thrombospondin-1 (TSP1) in cells transfected as in panerl a were measured as described in Figure 4d. Shown are representative results from three separate assays.

regulated at the post-transcriptional level through the were associated with HuR and the association of 595 action of specific RBPs that recognize sequence elements transcripts with HuR was significantly changed (269 shared among the mRNAs that encode such genes reduced, 326 elevated) in more tumorigenic MCT-1 (Keene and Tenenbaum, 2002; Keene et al., 2006). overexpressing cells (Z ratio difference values greater or Therefore, we sought to investigate whether MCT-1 less than ±1.5, P-value o0.05). Functional analysis elicited a similar modulation of binding of HuR to clustered those 595 genes into numerous different target mRNAs associated with the MCT-1-induced biological pathways. In Figure 6a, gray bars correspond tumorigenic phenotype. To this end, we studied the to pathways exhibiting genes whose binding to HuR subsets of mRNAs that were coregulated with TSP1 significantly decrease in the MCT-1 overexpression mRNA through the modulation of their association group (Z score less than À1.5). Several of the pathways with the HuR in the MCT-1 expressing cells. We represented in these populations are signal transduction performed RNP-IP analysis of MCF7 Vector and cascades implicated in neoplastic transformation, in- MCT-1 overexpressing cell lysates using anti-HuR cluding genes involved in cell-cycle arrest, angiogenesis antibody. The identification of mRNAs in each IP and apoptosis (such as p21/CDKN1A, TSP1 and Bax). group was achieved by reverse transcription followed by Black bars represent pathways containing genes whose cDNA array hybridization (see Materials and methods). association with HuR significantly increases in the Microarray analysis showed that out of 24 000 transcript MCT-1 overexpression group (Z score more than 1.5). probes available on the microarray, B9000 mRNAs Such pathways are involved in survival signaling and

Oncogene Global changes in HuR-bound mRNAs and tumor progression K Mazan-Mamczarz et al 6158 proliferation (as PIK3R1/AKT, RAS/MEK/ERK). complexes dissociated in the more tumorigenic Importantly, TSP1 mRNA was found among the MCF7 populations and further supported the genes with signiﬁcantly decreased association with view that HuR is a downstream effector of the HuR in MCT-1 overexpressing cells compared to protumorigenic gene expression program triggered by Vector control populations (Table 1, Supplementary MCT-1. See http://www.grc.nia.nih.gov/branches/rrb/ information Table S1). The microarray data dna/index/dnapubs.htm#2 for complete microarray provided additional evidence that HuR-TSP1 mRNA data.

TAKEDA_NUP8_HOXA9_3D_UP RADAEVA_IFNA_UP TAKEDA_NUP8_HOXA9_8D_UP SANA_IFNG_ENDOTHELIAL_UP ST_TYPE_I_INTERFERON_PATHWAY IFNAPATHWAY IFNALPHA_HCC_UP IFNALPHA_NL_UP JECHLINGER_EMT_UP IFNALPHA_NL_HCC_UP IFNA_HCMV_6HRS_UP GRANDVAUX_IFN_NOT_IRF3_UP BECKER_TAMOXIFEN_RESISTANT_UP RIBAVIRIN_RSV_UP BRG1_SW13_UP BECKER_IFN_INDUCIBLE_SUBSET_1 XU_ATRA_PLUSNSC_UP ET743_SARCOMA_6HRS_UP IFN_BETA_UP WIELAND_HEPATITIS_B_INDUCED FLECHNER_KIDNEY_TRANSPLANT_REJECTION_UP CISPLATIN_PROBCELL_UP CELL_CYCLE_ARREST BRG1_ALAB_DN BRCA1_MES_UP ADIPOGENESIS_HMSC_CLASS8_DN ZELLER_MYC_DN UVC_LOW_ALL_UP UVC_LOW_A2_UP CIS_RESIST_GASTRIC_UP RADIATION_SENSITIVITY TRNA_SYNTHETASES AMINOACYL_TRNA_BIOSYNTHESIS PROTEASOME BRCA1_SW480_DN ACTINYPATHWAY RAC1PATHWAY TRKAPATHWAY PLCPATHWAY CDC42RACPATHWAY IDX_TSA_UP_CLUSTER4 MTA3PATHWAY ST_DICTYOSTELIUM_DISCOIDEUM_CAMP_CHEMOTAXIS RASPATHWAY CREBPATHWAY H2O2_CSBDIFF_C2 NOS1PATHWAY HYPOXIA FIBRO UP

-20 -15 -10 -5 0 5 10 Pathway Name Z-score MCT-1 versus Control

100

Colonies formed per well Colonies formed 20

0 TAP HuR- Ctrl. HuR TAP siRNA siRNA

Oncogene Global changes in HuR-bound mRNAs and tumor progression K Mazan-Mamczarz et al 6159 Table 1 Examples of pathways and input genes with altered association with HuR in more tumorigenic phenotype Pathway name Ontology Impact genes Z score Percentage of impact genes in pathway

ZELLER_MYC_DN Genes responsive to MYC oncogenic kCDKN1A, DUSP1, À5.35 60.00 transcription factor GADD45A, THBS1, TPM1 PLCPATHWAY Phospholipase C/PKC/IP3 increase in mAKT1, PIK3R1, PRKCA 3.58 50.00 intracellular calcium levels leading to the activation of PI3K/AKT and MAPK TRKAPATHWAY Promotion of survival and prolifera- mAKT1, PIK3R1, PRKCA 3.58 42.86 tion by the activation of PI3K/AKT, RAS and the MAPK pathway UVC_LOW_A2_UP DNA damage response pathways, kCDKN1A, GDF15, À5.18 42.86 cell-cycle arrest and apoptosis after GPRC5A, SOX4 UV irradiation RADAEVA_IFNA_UP Regulation of genes contributing to kADAR, BAX, BST2, À17.08 32.50 the antiviral and antitumor activities EIF2AK2, HLA-E, IFI27, of IFN IFI35, IFI44, IFI44 L, IFITM1, IFITM2, IFITM3, IRF1, IRF7, MXD4, OAS1, PLSCR1, RSAD2, STAT1, UBE2L6 mUBE2D3 CISPLATIN_PROBCELL_UP Chemotherapy-induced apoptotic kCDKN1A, DHRS3, À6.94 30.77 pathways TMEM49, TP53INP1 CREBPATHWAY Activation of transcription in response mAKT1, PIK3R1, PRKCA, 4.54 26.67 to extracellular signaling RPS6KA5 CELL_CYCLE_ARREST Halting of the cell cycle during one kCDKN1A, EIF4G2, À6.36 25.00 of the normal phases (G1, S, G2 and M) GADD45A, MYC, PPP1R15AmCDKN3 BRCA1_SW480_DN BRCA1-induced cell-cycle arrest kACTB, BAX, ZYX À3.29 25.00 (CDK inhibition) and DNA repair and DNA repair pathways TAKEDA_NUP8_HOX- Proliferation and differentiation kBIRC4BP, DHRS3, FHL2, À16.47 24.00 A9_8D_UP changes that underlie the leukemic GDF15, HERC5, HERC6, transformation HOXA5, IFI27, IFI44, IFI44L, IFIH1, IFIT2, IFIT3, IFIT5, IFITM1, IRF7, OAS1, OAS2, OAS3, PALLD, SOX4, STAT1, THBS1 mLOC134147, RP3-477H, RPS6KA5 RAC1PATHWAY Stimulation of formation of actin- mLIMK1, PIK3R1, RPS6KB1 3.25 23.08 dependent structures kMYLK RADIATION_SENSITIVITY Genes related to radiation sensitivity kACTB, BAX, CDKN1A, À4.11 21.43 GADD45A RASPATHWAY RAS-induced stimulation of signaling mAKT1, RALA, ELK1, 4.51 21.05 cascades, including PI3K/AKT PIK3R1 activation to inhibit apoptosis

Abbreviations: IFN, interferon; MAPK, mitogen-activated protein kinase; UV, ultraviolet. Ingenuity Pathway Analysis identiﬁed altered functional pathways by categorizing the genes differentially associated with HuR. Arrows indicate an increased or decreased association with HuR in more tumorigenic MCF7 cells.

Figure 6 Influence of HuR on MCT-1 overexpressing MCF7 cells. (a) Top 48 Biological Pathways with the highest percentage of genes showing significantly altered association with HuR in response to overexpression of MCT-1 in MCF7 cells. Microarray analysis was performed in triplicate and the resulting data were normalized by Z score transformation and tested for significant differences in signal intensity. Differentially expressed genes (with Z ratio >1.5 or oÀ1.5, and fdr o0.3) were organized by the Ingenuity Pathway Analysis into known biological pathways. Probability scores for each functional grouping were calculated based on the chance of mRNA abundance changes predicting these interactions. The significance of each pathway was calculated by using the right-tailed Fisher’s exact test. The P-value was calculated by comparing the number of user-specified genes of interest involved in a given pathway relative to the total number of occurrences of these genes in all pathway annotations stored in the knowledge base. Graph shows pathways in which association with HuR significantly decreased with Z score oÀ1.5 (gray bars) or increased with Z score >1.5 (black bars), Po0.05. Pathways and genes involved are described in Table 1 and Supplementary information (Table S1). (b) Modulation of HuR levels alters anchorage-independent colony growth in MCT-1 overexpressing MCF7 cells. Twenty-four hours after transfection, cells were cultured in agarose/medium, 1 week later, colonies were counted. Graphs represent the mean and s.e.m. of three independent experiments, Po0.03.

Oncogene Global changes in HuR-bound mRNAs and tumor progression K Mazan-Mamczarz et al 6160 Finally, to demonstrate that altered HuR binding to repress target mRNA translation (p27Kip1, IGF-IR, target mRNAs affects the phenotype of MCT-1 over- Wnt5a and various cytokines; Kullmann et al., 2002; expressing MCF7 cells, we carried out soft agar colony Katsanou et al., 2005; Meng et al., 2005; Leandersson formation assays after modulation of HuR levels. As et al., 2006). Most of those reports show enhanced shown, overexpression of HuR increased, while HuR binding of HuR to target transcripts (for example, p21, knockdown reduced the ability of MCF7 MCT-1 p53, Pro-Ta and mRNAs) following exposure to overexpressing cells to form anchorage-independent different stress stimuli (Wang et al., 2000b; Mazan- colonies (Figure 6b). Mamczarz et al., 2003; Lal et al., 2005). Here, we found instead a reduction in the association of HuR and the TSP1 mRNA in MCT-1 overexpressing MCF7 cell lines. Importantly, the dissociation of [HuR-TSP1 mRNA] Discussion complexes caused TSP1 mRNA to be less efficiently recruited to translationally active polysomes (Figure 1c), We recently demonstrated that MCT-1 promotes the and less actively translated into protein (Figure 1d). One transition to a more aggressive phase in breast cancer recent report demonstrated that the oxidative stress- progression by increasing tumor angiogenesis. This triggered dissociation of the [HuR-SIRT1 mRNA] effect was achieved, at least in part, through the MCT- complex promoted SIRT1 mRNA decay (Abdelmohsen 1-triggered downregulation of an endogenous angiogen- et al., 2007). Some reports have begun to emerge esis inhibitor, TSP1 (Levenson et al., 2005). However, documenting the dynamic association of RBPs from the mechanism(s) underlying the regulation of TSP1 in target mRNAs under a variety of conditions (Lal et al., this model remains unknown. In the light of accumulat- 2006; Kim et al., 2007). Tenenbaum et al. (2000) ing evidence that post-transcriptional events critically demonstrated the association and dissociation of specific determine gene expression patterns (Orphanides and mRNAs from the HuB RNP in embryonic carcinoma Reinberg, 2002), we set out to study whether the levels cells following treatment with retinoic acid. A recent of TSP1 were governed by post-transcriptional mechan- study showed that UVC irradiation triggered a decrease isms. Using MCF7 cells, we showed that the reduced in the binding of HuR to cyclin D1 mRNA, and instead TSP1 expression in the more aggressive (MCT-1 over- promoted the binding of AUF-1/hnRNP D to this expressing) clones is due to the suppression of TSP1 mRNA (Lal et al., 2004). Similarly, HuR transiently translation levels, and identify HuR as a major dissociated from the cytochrome c mRNA, while the regulatory factor in this process. HuR associated with binding of TIA-1 to this transcript increased following the 30UTR of the TSP1 mRNA, which bears U- and endoplasmic reticulum stress (Kawai et al., 2006). AU-rich sequences (ARE; Figure 2a), as revealed by IP Bhattacharyya et al. (2006) demonstrated that the followed by either RT–qPCR or microarray analysis. microRNA miR-122 can bind to the CAT-1 30UTR The abundance of the (HuR-TSP1 mRNA) complex and repress its translation; HuR was proposed to decreased dramatically in MCT-1 overexpressing more function by displacing miR-122 from the CAT 30UTR aggressive cells, in turn decreasing TSP1 translation, and and thereby relieved the miRNA-imposed translational leading to a reduction in TSP1 protein abundance in repression. These studies underscore the existence of a these cells. Experiments in which the entire TSP1 30UTR complex and dynamic association of RBPs (as well as was linked to the coding region of the heterologous miRNAs) with a given target mRNA, which can be reporter GFP revealed decreased expression of GFP modulated by different genotoxic stresses and growth protein in overexpressing MCT-1 MCF7 cells compared conditions, and can vary from transcript to transcript. to cells transfected with plasmid containing the GFP We hypothesized that another TTR-RBP(s), likely one coding region alone (Supplementary information, Fig- that represses translation, might displace HuR from the ure S2), suggesting the TSP1 30UTR functions to TSP1 in MCT-1 overexpressing cells and suppress TSP1 suppress TSP1 expression levels specifically in MCT-1 expression. Other TTR-RBPs studied showed compara- overexpressing cells. Similar results were obtained for tively less enrichment in TSP1 mRNA (Figure 2b), the c-fos and c-myc 30UTR ARE, which destabilized the although the different relative affinities of the antibodies c-fos and c-myc mRNAs: deletion of this sequence led to used preclude a direct comparison of the relative ability increases in mRNA stability, protein abundance and of each TTR-RBP to associate with the TSP1 mRNA. cellular transformation (Meijlink et al., 1985; Hollis HuR was proposed to play a central role in cancer by et al., 1988; Aghib et al., 1990). binding to mRNAs encoding proteins involved in HuR has been described as a protein that stabilizes malignant transformation and altering their expression many important target mRNAs (that is, VEGF, c-myc, through post-transcriptional mechanisms (Nabors et al., c-fos, TNF-a, cyclin A, cyclin B1, p21 and EGF; as 2001; Lopez de Silanes et al., 2005). Through its reviewed by Brennan and Steitz, 2001). HuR has also association with target mRNAs, HuR was found to been shown to promote the translation of numerous enhance the expression of many of growth-promoting, target transcripts independent of its effect on mRNA proliferative, and proto-oncogenic factors like EGF, stability, p53, Pro-Ta, cytochrome c, p27Kip1 and TIA- cyclin A, cyclin B1 and c-myc (Wang et al., 2000a; 1 (Millard et al., 2000; Mazan-Mamczarz et al., 2003; Sheflin et al., 2004). It has been postulated that HuR can Lal et al., 2005; Kawai et al., 2006; Pullmann et al., expand the cell’s invasiveness and metastatic ability by 2007), although in some cases, it has also been shown to elevating the expression of mRNAs encoding MMP-9

Oncogene Global changes in HuR-bound mRNAs and tumor progression K Mazan-Mamczarz et al 6161 (Akool et al., 2003) and MTA1 (Lopez de Silanes et al., Materials and methods 2004). Finally, HuR was shown to regulate angiogenesis through its binding to mRNAs and elevating of Cell culture, plasmids and transient transfections expression of proangiogenic genes such as VEGF and Mammary epithelial adenocarcinoma MCF7 cells stably HIF-1 (Levy et al., 1998; Sheflin et al., 2004; Galba´ n transfected with the pLXSN empty vector (Vector) or pLXSN-MCT-1-V5-histidine (MCT-1; Levenson et al., 2005), et al., 2008). Our findings that the dissociation of HuR were cultured in Dulbecco’s modified essential medium (Gibco negatively impacts upon the expression of the anti- BRL, Gaithersburg, MD, USA) supplemented with 10% fetal angiogenic gene TSP1 are in keeping with the groups of bovine serum and antibiotics. cancer-related mRNAs whose association changes with Plasmids used for HuR overexpression (pcDNA3-TAP) a more tumorigenic phenotype. Together, an exciting were described previously (Lal et al., 2005). For HuR RNAi model emerges whereby HuR functions as a down- transfections siRNA targeting the HuR coding region stream effector of cancer-related gene expression. (AAGAGGCAATTACCAGTTTCA) and a control siRNA According to this model, in cells with a less tumorigenic (Qiagen, Valencia, CA, USA) were used at 20 nM. Cells were phenotype, HuR associates with mRNAs encoding transfected with Lipofectamine 2000 (Invitrogen, Carlsbad, proapoptotic proteins (such as TSP1, CDKN1A and CA, USA) when plasmids were used and with oligofectamine (Invitrogen) when siRNA were used. Seventy-two hours after Bax). In cells with a more malignant phenotype, transfection, cells were collected for analysis; experiments were however, HuR switches its mRNA interaction partners, performed three times independently. and associates instead with other mRNAs encoding proteins that favor a more tumorigenic phenotype Cell fractionation (such as PIK3R1/AKT and RAS/MEK/ERK). A For the whole cell protein lysates B3 Â 106 cells were corollary of this model is that MCT-1 functions trypsinized and prepared in RIPA buffer (10 mM Tris-HCL as a ‘master’ upstream regulator of the subsets of (pH 7.4), 1% NP-40, 1 mM EDTA, 0.1% SDS, 150 mM NaCl) mRNAs with which HuR associates in cells of each as described (Lal et al., 2004). phenotype. Linear sucrose gradient fractionation was prepared as Our findings lend strong support to the ‘post- previously described (Galba´ n et al., 2003) with minor transcriptional operon’ model first proposed by Keene modifications. Briefly, B6 Â 106 cells were incubated for and Tenenbaum (2002). According to this model, RBPs 15 min with 100 mg/ml cycloheximide. Cells were lysed in can jointly regulate subsets of mRNAs encoding cytoplasmic lysis buffer containing 20 mM Tris-HCl (pH 7.5), 100 mM KCl, 5 mM MgCl2, 0.3% IGEPAL CA-630, RNase- functionally related proteins. Our microarray analysis OUT (Invitrogen) and, protease inhibitor cocktail for 5 min on yielded 595 transcripts with significantly altered binding ice and centrifuged (10 000 Â g, 10 min, 4 1C). Cytoplasmic to HuR in the more aggressive breast cancer cell lines. extracts were loaded onto the 10–50% sucrose gradients and These mRNAs clustered in several pathways implicated after centrifugation (Beckman SW41, 35 000 r.p.m., 3 h, 4 1C) in malignant transformation/progression, such as the the material was fractionated into 1 ml aliquots using a RAS pathway (implicated in mitogenesis), the PI3K gradient fractionator (Brandel) and monitored by optical pathway (evasion of apoptosis), the hypoxic response density measurement (A254). RNA from fractions was and angiogenesis (Hanahan and Weinberg, 2000). These extracted using Trizol reagent. findings are in keeping with the hypothesis that MCT-1 mediates a more aggressive phenotype in breast carci- Western blotting noma cells, partially through its ability to redirect the For Western blot analysis, 50 mg of protein lysates were subsets of mRNAs to be expressed in the cell. Our resolved by SDS–polyacrylamide gel electrophoresis (Invitro- results reported here demonstrate for the first time that gen, Carlsbad, CA, USA) and transferred onto PVDF the global changes in HuR-bound mRNAs are impli- membranes. Blots were probed with monoclonal antibodies recognizing TSP1 (NeoMarkers, Fremont, CA), HuR (Santa cated in the progression to a more malignant phenotype Cruz Biotechnology Inc.), b-Actin (Abcam, Cambridge, UK), in an in vivo model. a-tubulin (Sigma, St Louis, MO, USA), V5 (MCT-1-V5; In summary, our work reveals a novel mechanism of Invitrogen), or polyclonal AUF-1/HRNDP antibody (Upstate regulation of cancer-related genes in MCF7 cells. Biotech., Lake Placid, NY USA). Following incubation with HuR associates with TSP1 mRNA and enhances its appropriate secondary antibodies, signals were detected by translation, however, in cells overexpressing MCT-1, enhanced chemiluminescence (Pierce, Rockford, IL, USA) and HuR dissociates from the TSP1 mRNA linked to quantified by using VisionWorksLS Software (UVP, Upland, decreases in TSP1 protein synthesis. Importantly, we CA, USA). show herein that knocking down HuR has a significant effect on the ability of MCF7 cells to grow in an Binding assays; immunoprecipitation of ribonucleoprotein anchorage-independent manner. These studies under- complexes and biotin pull-down score the role of global mRNA–protein interactions Immunoprecipitation of endogenous RNA–protein complexes toward the development of a more malignant phenotype were carried out as described previously (Mazan-Mamczarz and suggest that interventions targeting mRNA–protein et al., 2006) and are explained in detail in Supplementary information. associations may represent novel treatment strategies In vitro transcription of TSP1 transcripts was carried out as for cancer therapy. Additional work will provide described (Mazan-Mamczarz et al., 2006). Oligomers used for a better understanding of the role that post-transcrip- amplification of TSP1 fragments for pull-down assay are listed tional gene regulation plays in tumor development and in Supplementary information. After incubating biotinylated progression. transcripts (2 mg) with 40 mg of cytoplasmic lysate, the

Oncogene Global changes in HuR-bound mRNAs and tumor progression K Mazan-Mamczarz et al 6162 RBP complexes were isolated with paramagnetic streptavidin- Microarray analysis after IP conjugated Dynabeads (Dynal), and the pull-down material RNA from IP material was labeled using the Illumina was analyzed by western blotting. Total Prep RNA Amplification Kit (Ambion, Austin, TX, USA). Biotin-labeled cRNA was hybridized to HumanRef-8 RT–PCR analysis of RNA v2 Expression BeadChips (Illumina, San Diego, CA, USA) RNA from total, polysome or IP material, was reverse containing 22 000 transcripts probes per sample. The transcribed by using iScript cDNA synthesis kit (BioRad, data were normalized by Z score transformation (Cheadle Hercules, CA) following the manufacture’s protocol and et al., 2003) and tested for significant differences in signal subjected to real-time qPCR analysis using gene-specific intensity. Transcripts were considered changed when Z ratios primer pairs: CAGAGGCCAAAGCACTAAGG and TGAG were more then 1.5 or less then À1.5. Ingenuity Systems TAAGGGTGGGGATCAG for TSP1 mRNA and, CGG Pathways Analysis (Ingenuity Systems; Redwood City, AGTCAACGGATTTGGTCGTAT and AGCCTTCTCCAT CA, USA) was used to identify top network functions GGTGGTGAAGAC GAPDH mRNA. qPCR analysis was involving differentially expressed genes. See Supplementary performed using iQSYBR Green Supermix (BioRad) and information and Calvano et al. (2005) for details in array BioRad iCycler instrument. Each reaction was carried out in analysis. triplicate and three independent experiments were run. GAPDH cDNA served as the internal control. Anchorage-independent growth assay Twenty hours after transfection, cells were plated at 7500 cells/ In vivo translation ml in a 1:3 agarose/medium mixture on top of a solidified Analysis of de novo translation was carried out using the layer (1:1 agarose/medium) and covered with medium. methodology described previously (Mazan-Mamczarz et al., One week later, colonies were counted under the microscope. 2006). Briefly, 106 cells were incubated with 1 mCi Experiments were performed three times independently. L-[35S]methionine and L-[35S]cysteine (Easy Tag EXPRESS, NEN/Perkin Elmer, Waitham, MA, USA) per 60-mm plate for 20 min, whereupon cells were lysed using RIPA Acknowledgements buffer. Immunoprecipitation was carried out overnight at 4 1C using TSP1 antibody and IgG as a control. Following We thank Dr Y Zhang for assistance with the extensive washes in TNN buffer (50 mM Tris (pH 7.5), 250 mM statistical analysis of the RIP-Chip array data and Dr J NaCl, 5 mM EDTA and 0.5% NP-40) the IP material was Hasday for technical support. A Merit Review Award resolved by SDS–polyacrylamide gel electrophoresis, from the Department of Veterans Affairs to RBG supported transferred onto PVDF membranes, and visualized by this work. MG and SS were supported by the National PhosphorImager (Molecular Dynamics, Piscataway, NJ, USA). Institute on Aging Intramural Research Program, NIH.

References

Abdelmohsen K, Pullmann Jr R, Lal A, Kim HH, Galba´ n S, Yang X Galba´ n S, Martindale JL, Mazan-Mamczarz K, Lopez de Silanes I, et al. (2007). Phosphorylation of HuR by Chk2 regulates SIRT1 Fan J, Wang W et al. (2003). Influence of the RNA-binding ;protein expression. Mol Cell 23: 543–557. HuR in pVHL-regulated p53 expression in renal carcinoma cells. Aghib DF, Bishop JM, Ottolenghi S, Guerrasio A, Serra A, Saglio G. Mol Cell Biol 23: 7083–7095. (1990). A 30 truncation of MYC caused by chromosomal transloca- Gorospe M. (2003). HuR in the mammalian genotoxic response: post- tion in a human T-cell leukemia increases mRNA stability. transcriptional multitasking. Cell Cycle 2: 412–414. Oncogene 5: 707–711. Hanahan D, Weinberg RA. (2000). The hallmarks of cancer. Cell 100: Akool el-S, Kleinert H, Hamada FM, Abdelwahab MH, 57–70. Forstermann U, Pfeilschifter J et al. (2003). Nitric oxide increases Hollis GF, Gazdar AF, Bertness V, Kirsch IR. (1988). Complex the decay of matrix metalloproteinase 9 mRNA by inhibiting the translocation disrupts c-myc regulation in a human plasma cell expression of mRNA-stabilizing factor HuR. Mol Cell Biol 23: myeloma. Mol Cell Biol 8: 124–129. 4901–4916. Katsanou V, Papadaki O, Milatos S, Blackshear PJ, Anderson P, Bevilacqua A, Ceriani MC, Capaccioli S, Nicolin A. (2003). Post- Kollias G et al. (2005). HuR as a negative posttranscriptional transcriptional regulation of gene expression by degradation of modulator in inflammation. Mol Cell 19: 777–789. messenger RNAs. J Cell Physiol 195: 356–372. Kawai T, Lal A, Yang X, Galba´ n S, Mazan-Mamczarz K, Gorospe M. Bhattacharyya SN, Habermacher R, Martine U, Closs EI, Filipowicz W. (2006). Translational control of cytochrome c by RNA-binding (2006). Relief of microRNA-mediated translational repression in proteins TIA-1 and HuR. Mol Cell Biol 26: 3295–3307. human cells subjected to stress. Cell 125: 1111–1124. Keene JD. (2001). Ribonucleoprotein infrastructure regulating the Brennan CM, Steitz JA. (2001). HuR and mRNA stability. Cell Mol flow of genetic information between the genome and the proteome. Life Sci 58: 266–277. Proc Natl Acad Sci USA 98: 7018–7024. Calvano SE, Xiao W, Richards DR, Felciano RM, Baker HV, Cho RJ Keene JD. (2007). RNA regulons: coordination of post-transcriptional et al. (2005). Inflamm and Host Response to Injury Large Scale events. Nat Rev Genet 8: 533–543. Collab. Res. Program. A network-based analysis of systemic Keene JD, Komisarow JM, Friedersdorf MB. (2006). RIP-Chip: the inflammation in humans. Nature 437: 1032–1037. isolation and identification of mRNAs, microRNAs and protein Cheadle C, Vawter MP, Freed WJ, Becker KG. (2003). Analysis components of ribonucleoprotein complexes from cell extracts. of microarray data using Z score transformation. J Mol Diagn 5: Nat Protoc 1: 302–307. 73–81. Keene JD, Tenenbaum SA. (2002). Eukaryotic mRNPs may represent Galba´ n S, Kuwano Y, Pullmann Jr R, Martindale JL, Kim HH, posttranscriptional operons. Mol Cell 9: 1161–1167. Lal A et al (2008). RNA-binding proteins HuR and PTB promote Kim HS, Kuwano Y, Zhan M, Pullmann Jr R, Mazan-Mamczarz K, Li H the translation of hypoxia-inducible factor 1a. Mol Cell Biol 28: et al. (2007). Elucidation of a C-rich signature motif in target mRNAs of 93–107. RNA-binding protein TIAR. MolCellBiol27: 6806–6817.

Oncogene Global changes in HuR-bound mRNAs and tumor progression K Mazan-Mamczarz et al 6163 Kullmann M, Gopfert U, Siewe B, Hengst L. (2002). ELAV/Hu Millard SS, Vidal A, Markus M, Koff A. (2000). AU-richelement in proteins inhibit p27 translation via an IRES element in the p27 the 50 untranslated region is necessary for the translation of p27 5UTR. Genes Dev 16: 3087–3099. mRNA. Mol Cell Biol 20: 5947–5959. Lal A, Abdelmohsen K, Pullmann R, Kawai T, Galba´ n S, Yang X Nabors LB, Gillespie GY, Harkins L, King PH. (2001). HuR, a RNA et al. (2006). Posttranscriptional derepression of GADD45alpha by stability factor, is expressed in malignant brain tumors and binds to genotoxic stress. Mol Cell 22: 117–128. adenine- and uridine-rich elements within the 30 untranslated regions Lal A, Kawai T, Yang X, Mazan-Mamczarz K, Gorospe M. (2005). of cytokine and angiogenic factor mRNAs. Cancer Res 61: Anti-apoptotic function of RNA-binding HuR effected through 2154–2161. prothymosin a. EMBO J 24: 1852–1862. Orphanides G, Reinberg D. (2002). A uniﬁed theory of gene Lal A, Mazan-Mamczarz K, Kawai T, Yang X, Martindale JL, expression. Cell 108: 439–451. Gorospe M. (2004). Concurrent versus individual binding of HuR Piecyk M, Wax S, Beck AR, Kedersha N, Gupta M, Maritim B et al. and AUF1/HRNDP to common labile target mRNAs. EMBO J 23: (2000). TIA-1 is a translational silencer that selectively regulates the 3092–3102. expression of TNF-alpha. EMBO J 19: 4154–4163. Leandersson K, Riesbeck K, Andersson T. (2006). Wnt-5a mRNA Prosniak M, Dierov J, Okami K, Tilton B, Jameson B, Sawaya BE translation is suppressed by the Elav-like protein HuR in human et al. (1998). A novel candidate oncogene, MCT-1, is involved in cell breast epithelial cells. Nucleic Acids Res 34: 3988–3999. cycle progression. Cancer Res 58: 4233–4237. Levenson AS, Thurn KE, Simons LA, Veliceasa D, Jarrett J, Osipo C Pullmann Jr R, Kim HH, Abdelmohsen K, Lal A, Martindale JL, et al. (2005). MCT-1 oncogene contributes to increased in vivo Yang X et al. (2007). Analysis of turnover and translation regulatory tumorigenicity of MCF7 cells by promotion of angiogenesis and RNA-binding protein expression through binding to cognate inhibition of apoptosis. Cancer Res 65: 10651–10656. mRNAs. Mol Cell Biol 27: 6265–6278. Levy NS, Chung S, Furneaux H, Levy AP. (1998). Hypoxic Ren B, Yee KO, Lawler J, Khosravi-Far R. (2006). Regulation of stabilization of vascular endothelial growth factor mRNA by the tumor angiogenesis by thrombospondin-1. Biochim Biophys Acta RNA-binding protein HuR. Biol Chem 273: 6417–6423. 1765: 178–188. Liao B, Hu Y, Brewer G. (2007). Competitive binding of AUF1/ Sheﬂin LG, Zou AP, Spaulding SW. (2004). Androgens regulate the HRNDP and TIAR to MYC mRNA controls its translation. Nat binding of endogenous HuR to the AU-rich 30UTRs of HIF-1alpha Struct Mol Biol 14: 511–518. and EGF mRNA. Biochem Biophys Res Commun 322: 644–651. Lopez de Silanes I, Fan J, Galban CJ, Spencer RG, Becker KG, Tenenbaum SA, Carson CC, Lager PJ, Keene JD. (2000). Identifying Gorospe M. (2004). Global analysis of HuR-regulated gene mRNA subsets in messenger ribonucleoprotein complexes by using expression in colon cancer systems of reducing complexity. Gene cDNA arrays. Proc Natl Acad Sci USA 97: 14085–14090. Expr 12: 49–59. Wang W, Caldwell MC, Lin S, Furneaux H, Gorospe M. (2000a). Lopez de Silanes I, Lal A, Gorospe M. (2005). HuR: post- HuR regulates cyclin A and cyclin B1 mRNA stability during cell transcriptional paths to malignancy. RNA Biol 2: 11–13. proliferation. EMBO J 19: 1–12. Mazan-Mamczarz K, Galba´ n S, Lopez de Silanes I, Martindale JL, Wang W, Furneaux H, Cheng H, Caldwell MC, Hutter D, Liu Y et al. Atasoy U, Keene JD et al. (2003). RNA-binding protein HuR (2000b). HuR regulates p21 mRNA stabilization by UV light. Mol enhances p53 translation in response to ultraviolet light irradiation. Cell Biol 20: 760–769. Proc Natl Acad Sci USA 100: 8354–8359. Watnick RS, Cheng YN, Rangarajan A, Ince TA, Weinberg RA. Mazan-Mamczarz K, Lal A, Martindale JL, Kawai T, Gorospe M. (2003). Ras modulates Myc activity to repress thrombospondin-1 (2006). Translational repression by RNA-binding protein TIAR. expression and increase tumor angiogenesis. Cancer Cell 3: Mol Cell Biol 26: 2716–2727. 219–231. Meijlink F, Curran T, Miller AD, Verma IM. (1985). Removal of a 67- Weidner N. (1998). Tumoural vascularity as a prognostic factor in cancer base-pair sequence in the noncoding region of protooncogene fos patients: the evidence continues to grow. JPathol184: 119–122. converts it to a transforming gene. Proc Natl Acad Sci USA 82: Wilusz CJ, Wilusz J. (2004). Bringing the role of mRNA decay in the 4987–4991. control of gene expression into focus. Trends Genet 20: Meng Z, King PH, Nabors LB, Jackson NL, Chen CY, Emanuel PD 491–497. et al. (2005). The ELAV RNA-stability factor HuR binds the 50- Zabrenetzky V, Harris CC, Steeg PS, Roberts DD. (1994). Expression untranslated region of the human IGF-IR transcript and differen- of the extracellular matrix molecule thrombospondin inversely tially represses cap-dependent and IRES-mediated translation. correlates with malignant progression in melanoma, lung and breast Nucleic Acids Res 33: 2962–2979. carcinoma cell lines. Int J Cancer 59: 191–195.

Supplementary Information accompanies the paper on the Oncogene website (http://www.nature.com/onc)

Oncogene