1 Targeting TAZ-Driven Human Breast Cancer by Inhibiting a SKP2-P27

Author Manuscript Published OnlineFirst on September 20, 2018; DOI: 10.1158/1541-7786.MCR-18-0332 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

Targeting TAZ-driven Human Breast Cancer by Inhibiting a SKP2-p27 Signaling

Axis

He Shen 1, Nuo Yang 2, Alexander Truskinovsky 3, Yanmin Chen 1, Ashley L. Mussell 1,

Norma J. Nowak4, Lester Kobzik5, Costa Frangou 5* and Jianmin Zhang 1*

1. Department of Cancer Genetics & Genomics, Roswell Park Cancer Institute, Buffalo,

NY 14263

2. Department of Anesthesiology, Jacobs School of Medicine & Biomedical Sciences,

University at Buffalo, The State University of New York, NY 14214

3. Department of Pathology, Roswell Park Cancer Institute, Buffalo, NY 14263

4. Department of Biochemistry, Jacobs School of Medicine & Biomedical Sciences,

University at Buffalo, The State University of New York, NY 14214

5. Harvard TH Chan School of Public Health, Molecular and Integrative

Physiological Sciences, 665 Huntington Avenue, Boston, MA 02115

Running Title: TAZ-induced BLBC Tumor Maintenance Through SKP2-p27

Key words: TAZ, SKP2, breast cancer, cell cycle, oncogene dependence, tumor maintenance.

Downloaded from mcr.aacrjournals.org on September 25, 2021. © 2018 American Association for Cancer Research. Author Manuscript Published OnlineFirst on September 20, 2018; DOI: 10.1158/1541-7786.MCR-18-0332 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

Additional information:

Financial support: National Cancer Institute (NCI) R01 CA207504 and the

American Cancer Society Research Scholar Grant RSG-14-214-01-TBE (to J.Z.).

Correspondence:

* Dr. Costa Frangou, Harvard TH Chan School of Public Health, Molecular and

Integrative Physiological Sciences, 665 Huntington Avenue, Boston, MA 02115

[email protected]

* Dr. Jianmin Zhang, Department of Cancer Genetics & Genomics, Roswell Park

Cancer Institute, Buffalo, NY 14263

[email protected]

The authors declare no potential conflicts of interest.

Word count: 5935

Number of figures: 6

Abstract

Deregulated expression of the transcriptional co-activator with PDZ-binding motif

(WWTR1/TAZ) is a common feature of basal-like breast cancer (BLBC). Yet, how oncogenic TAZ regulates cell cycle progression and proliferation in breast cancer remains poorly understood, and whether TAZ is required for tumor maintenance has not been established. Here, using an integrative oncogenomic approach, TAZ-dependent cellular programs essential for tumor growth and progression were identified.

Significantly, TAZ-driven tumor cells required sustained TAZ expression, given that its withdrawal impaired both genesis and maintenance of solid tumors. Moreover, temporal inhibition of TAZ diminished the metastatic burden in established macroscopic pulmonary metastases. Mechanistic investigation revealed that TAZ controls distinct gene profiles that determine cancer cell fate through cell cycle networks, including a specific, causal role for S-phase kinase-associated protein 2 (SKP2) in mediating the neoplastic state. Together, this study elucidates the molecular events that underpin the role of TAZ in BLBC and link to SKP2, a convergent communication node for multiple cancer signaling pathways, as a key downstream effector molecule.

Implications: Understanding the molecular role of TAZ and its link to SKP2, a signaling convergent point and key regulator in BLBC, represents an important step toward the identification of novel therapeutic targets for TAZ-dependent breast cancer.

Introduction

Breast cancer (BC) is a multifaceted disease with distinct histopathologic features, genetic and genomic variability, and prognostic outcomes. Breast tumor heterogeneity is dynamic and evolves unpredictably during disease progression, creating considerable variability within primary tumors and metastases (1). However, BC can be classified into at least four major molecular subtypes based on gene expression programmes: luminal

A, luminal B, HER2-enriched, and basal-like (2). These subtypes exhibit important differences in risk factors, response to treatment, likelihood of disease progression, and propensity to metastasize to multiple organs, including bones, lungs, and liver (3).

Basal-like BCs (BLBCs) are especially associated with an aggressive clinical history, early recurrence, distant metastasis, and reduced survival rates in patients. BLBCs lack oestrogen (ER), progesterone (PR) and HER2 expression (4). These characteristics make BLBCs challenging to treat, as they do not respond to endocrine treatments or targeted therapies, and treatment options are restricted to conventional chemotherapy.

Despite extensive efforts to characterize the BLBC subtype, the oncogenic drivers of

BLBC remain elusive (5). Several genomic and genetic studies have identified multiple candidate oncogenic alterations in BLBC (6). These include genes associated with signal transduction, angiogenesis, the cell cycle and proliferation, cell survival, DNA replication and recombination, motility and invasion (7). For example, PTEN loss,

PI3K/AKT pathway activation, and TP53 mutations are frequently observed in BLBCs (8,

9). But widespread chromosomal instability is typical in BLBC (10), making it difficult to distinguish genes driving cancer development from those playing a bystander role.

The blockade of transcription factor interactions can be especially attractive in targeting cellular pathways that promote oncogenic transformation and typically involve many signaling proteins that ultimately converge on a much smaller set of oncogenic transcription factors. Recently, we and others reported that protein expression of the

Hippo transducer transcriptional co-activator with PDZ-binding motif (TAZ) is associated with a decreased survival rate and shorter time to relapse in BLBC patients (11, 12). The oncogenic activity of TAZ involves the regulation of diverse signal transduction pathways that direct such processes as proliferation, migration, and resistance to apoptosis, albeit through poorly characterized gene expression programmes (13).

Ectopic expression of TAZ in human cell and transgenic murine tissues results in their oncogenic transformation (11, 14). However, whether oncogenic TAZ is required for the maintenance of BLBC has not been established.

To test whether TAZ is necessary for maintaining as well as developing a cancer, we generated a transplant-based model of BLBC in which constitutively active TAZ expression is controlled in a doxycycline (dox)-dependent manner. We exploited this ability to precisely control the timing of TAZ expression during tumorigenesis and metastasis, which allowed us to examine the consequence of sustained TAZ activity on the maintenance of the transformed state in a relevant experimental setting. Using this system, we found that TAZ is not only a driver of BLBC progression and a novel prognostic factor but is also required for the maintenance of tumors and already established metastases. Importantly, this finding credentials TAZ as a legitimate BC therapeutic target. Furthermore, through iterative rounds of hypothesis generation and testing, we demonstrated that TAZ drives an SKP2-regulated cell cycle programme

involving genes linked to tumorigenic potential and poor prognosis in BC. As a result, our work provides biological insight and proof-of-concept evidence for targeting TAZ- regulated genes that support tumour maintenance to identify novel treatments for BC.

Materials and methods

Cell culture: MCF10A, HMEC, T47D, BT474, MDA-MB-453, MDA-MB-468, ZR751,

BT549, CAL120, CAL51, MDA-MB-231, MDA-MB-361, MDA-MB-435, SUM159,

HCC38, HCC1143, HCC1937 cell culture was performed as previously described (12).

MDA-MB-231, T47D, MDA-MB453, BT-474, HCC38 HCC1143 and HCC1937 cells were purchased from American Type Culture Collection (ATCC, VA); MCF10A and

HMEC were obtained from Dr. Joan Brugge, Harvard Medical School; CAL51, CAL120 and SUM159 were obtained from Dr. Toru Ouchi, PRCI; ZR751 and MDA-MB-361 were obtained from Dr. Andrei V. Bakin, RPCI. After purchase, cells were expanded and frozen after one to three passages. Cells were expanded and stored according to the manufacturer's instructions. Cells were used for no longer than 10 passages. All cell cultures were routinely tested to rule out mycoplasma infection using Mycoplasma

Detection Kit (InvivoGen, CA). MCF10A, MCF7, BT549, CAL120, HCC38, HCC1143,

HCC1937, MDA-MB-231 and MDA-MB-468 were authenticated by STR profiling.

Plasmids: The human TAZ4SA construct was cloned into the lentiviral pTRIPz vector

(gift from Dr. Xiaolong Yang; Queen’s University) as an AgeI–MluI fragment. The human

SKP2 c-DNA was PCR amplified from pcDNA3-myc-SKP2 (gift from Dr. Yue Xiong;

Addgene plasmid # 19947) into pENTRY vector and was further cloned into the lentiviral pWPI vector by LR reaction (Invitrogen, MA). CTGF luciferase reporter (-20bp~-1000bp of CTGF promoter region) or SKP2 luciferase reporter (-2700bp~-3700bp of SKP2 promoter region) were PCR amplified from genomic DNA of 293T cells and were cloned into pGL3 Luciferase Reporter Vector (Promega, WI). All of the constructs were confirmed by DNA sequencing.

shRNA and siRNA constructs: shRNA hairpins targeting human TAZ or SKP2 were obtained from the RNAi Consortium (The Broad Institute). The target sequences are listed (in the 5’-3’ direction): shNon-target-Control: CAACAAGATGAAGAGCACCAA; shTAZ-1: CCTGCCGGAGTCTTTCTTTAA shTAZ-2: GAAACTGCGGCTTCAGAGAAT shSKP2-928: GATAGTGTCATGCTAAAGAAT shSKP2-1000: AGTCGGTGCTATGATATAATA shTAZ or shSKP2 constructs were generated in the pLKO.1 vector at the AgeI/EcoRI sites. siRNA duplex (ON-TARGETplus-SMARTpool) targeting human TAZ (L-016083-

00-0005), SKP2 (L-003324-00-0005) and non-targeting control (D-001810-10) were purchased from GE Healthcare Dharmacon Inc (Lafayette, CO). shRNA transduction and siRNA experiments were performed as previously described (19).

Western blot and antibodies: The cell lysates were collected using RIPA buffer

(Boston Bio-Products; MA) supplemented with Protease and Phosphatase Inhibitors

(Thermo Scientific; MA). Briefly, sample proteins (30 or 40 μg) were separated by SDS-

PAGE electrophoresis and then transferred to PVDF membranes (EMDMillipore; MA).

After blocking with 5% BSA or non-fat milk for 1 h, the membranes were incubated with primary antibody overnight at 4°C; The next day, the membranes were incubated with anti-rabbit, rat or mouse secondary antibody (Bio-Rad; CA) for 1 h; Finally the detection was performed using ECL Plus Western Blotting Detection Reagents (GE Healthcare;

PA). anti-TAZ, anti-SKP2, anti-p27 and anti-p21 (Cell Signaling Technology, MA), anti-

E-cadherin (Becton Dickinson, CA), anti-Flag M2 antibodies (Sigma-Aldrich; MO); anti-

Tubulin, GAPDH and β-actin antibodies (Ubiquitin-Proteasome Biotechnologies; CO); anti-Brdu antibody (Developmental Studies Hybridoma Bank, IW).

Chromatin Immunoprecipitation (ChIP): ChIP assays were performed using

SimpleChIP® Enzymatic Chromatin IP Kit (Magnetic Beads) (Cell Signaling Technology,

MA). Briefly, inducible TAZ initiated tumour cells were cross-linked, lysed, and sonicated to generate DNA fragments with an average size of 0.5 kb. The immunoprecipitation was performed using 1 μg antibody to IgG or TAZ (Sigma, MO), respectively.

Sequences of ChIP PCR primers: RPL30 and SimpleChIP® Human CTGF Promoter

Primers were ordered from Cell Signaling Technology. SKP2 ChIP primers (in the 5′-3′ direction): SKP2-A-F: GCAGCAATGGCTTGTCAAAT; SKP2-A-R:

GGCAATATAGTTCGGCCTCA; SKP2-B-F: GAGAATAATCTGTAAAGTCC; SKP2-B-R:

AATTTGATAAAGCTTGGCAGGT; SKP2-C-F: TCAGTCTTCACAGGGAACAA; SKP2-

C-R: AAAAAGTTTGCGTTAAATTC; SKP2-D-F: GCCCCAAGCTGCCTATCTTA; SKP2-

D-R: CCCTTGAACAGAGCTCACCA; SKP2-E-F: CCTGCACAAGGGAGGTTTAAT;

SKP2-E-R: GCGTGACATATTCCAGGTACAA.

Quantitative real-time PCR (qRT-PCR): Total RNA was extracted using Trizol

Reagent (Life Technologies, MA) according to the manufacturer's protocol. cDNA synthesis and quantitative real-time PCR was performed as previously described (19).

GAPDH was used as the internal control. The primer sequences were as follows:

TAZ-F: 5'- AGTACCCTGAGCCAGCAGAA-3';

TAZ-R: 5'- GATTCTCTGAAGCCGCAGTT-3';

CTGF-F: 5'-GGAAATGCTGCGAGGAGTGG-3';

CTGF-R: 5'-GAACAGGCGCTCCACTCTGTG-3';

CDH1-F: 5'-CACGGTAACCGATCAGAATG-3'

CDH1-R: 5'-ACCTCCATCACAGAGGTTCC-3'

FN1-F: 5'-GAAGCCGAGGTTTTAACTGC-3'

FN1-R: 5'-ACCCACTCGGTAAGTGTTCC-3'

OCLN-F: 5'-CCAATGGCAAAGTGAATGAC-3'

OCLN-R: 5'-GGCGAAGTTAATGGAAGCTC-3'

SKP2-F: 5'-TTCGGATCCCATTGTCAATACTC-3'

SKP2-R: 5'-CAAAGTCTGCAGGGCAAATTC-3' p27KIP1-F: 5'-CTGCAACCGACGATTCTTCTA-3' p27KIP1-R: 5'-GCTGTTTACGTTTGACGTCTTC-3' p21CIP1-F: 5'-CGGAACAAGGAGTCAGACATT-3' p21CIP1-R: 5'-AGTGCCAGGAAAGACAACTAC -3'

GAPDH-F: 5'-GTGAAGGTCGGAGTCAACGG-3'

GAPDH-R: 5'-GAGGTCAATGAAGGGGTCATTG-3'

Flow cytometry analysis: For cell cycle analysis, cells were harvest and washed with

PBS, 1X106 cells were fixed in cold 70% ethanol for 30 min at 4°C, wash twice with PBS and treat the cells with DNase-free RNase (final concentration 200μg/ml) (Sigma, MO), add PI (final concentration 20μg/ml) (Sigma, MO) and then analyzed by flow cytometry.

β-Galactosidase staining: β-Galactosidase staining was performed using

“Senescence β-Galactosidase Staining Kit” from Cell Signaling Technology according to the kit protocol.

Statistical analysis: All statistical analysis of cell migration assay, tumour volume,

ChIP assay, reporter assay, RT-PCR, soft agar assay was performed with two-tailed

Student’s t-tests; data are expressed as mean ± SD.

Results

Assessment of dox-inducible expression of activated TAZ in 2D and 3D culture

The molecular and genetic alterations associated with the TAZ-induced transformation of mammary epithelial cells remain poorly defined (13). To study the effects of TAZ induction and de-induction on basal-like epithelial cells in tissue culture, we sought to grow the cells in a manner that resembles in vivo tumour growth (15). MCF10A is a non- tumorigenic mammary cell line that retains the ability to undergo acinar morphogenesis in 3D tissue culture. Oncogenes introduced into MCF10A cells disrupt this morphogenetic process and elicit distinct morphological phenotypes. For example, HPV

E7 MCF10A acini fail to undergo proliferation arrest but maintain a hollow polarized structure due to increased luminal apoptosis (16). In contrast, mammary structures with activated ErbB2 are filled and exhibit decreased luminal apoptosis (17, 18). Building on these findings, we adapted 3D cell culture methods to investigate the behavior of

MCF10A cells in response to an active form of TAZ (TAZ4SA) that is insensitive to negative regulation by the Hippo signaling pathway.

We used a dox expression system containing TAZ, whose expression is under the control of a tetracycline (tet) response element (TRE) promoter, and a “Tet-on” tet transactivator (rtTA), which activates TRE expression in a dox-inducible manner (Figure

1A). TAZ expression in MCF10A cells stably transduced with inducible constitutively activated TAZ (TAZ4SA) (12, 19), hereafter termed MCF10A-tetTAZ cells, was analysed by Western blotting (Figure 1A). Dox concentrations ≥0.5 μg/mL induced TAZ expression, while concentrations from 1 μg/mL resulted in complete induction of TAZ expression over a 24-hour time course (Figure S1A-B). Notably, treatment at <5ug/ml

dox had negligible effects on MCF10A cell proliferation (Figure S1C). Next, MCF10A- tetTAZ cells were evaluated in both 2D and 3D culture. As expected, the addition of dox to 2D monolayers triggered a change from an epithelial morphology to a single-spindle, mesenchymal-type morphology in a concentration-dependent manner (Figure 1B &

S1D). Furthermore, MCF10A-tetTAZ cells were more refractile and motile, and grew in soft agar, consistent with oncogenic TAZ activity (Figure 1C, D & S1E, F).

In 3D culture, the absence of dox led MCF10A-tetTAZ cells to proliferate and undergo normal acini formation (Figure 1E). In contrast, dox-controlled transcriptional activation of TAZ resulted in the formation of large multi-acinar structures with a filled lumen

(Figure 1E). Significantly, this severely transformed phenotype was completely reversed by dox washout and concomitant termination of TAZ expression (Figure 1E).

Collectively, these findings establish that our dox-inducible system achieved tight, temporal regulation of TAZ and closely recapitulated the known effects of constitutive

TAZ expression on tumourigenic cellular phenotypes (11).

Inhibition of TAZ inhibits mammary tumor maintenance and metastasis

Cancer patients are diagnosed and treated once tumors have already been established during what is termed tumor maintenance. Accordingly, to determine whether TAZ is required during tumor maintenance, MCF10A-tetTAZ cells were orthotopically implanted into severe combined immunodeficient (SCID) mice, and the mice were administered daily doses of dox to induce TAZ expression (dox-on) until a tumor mass was visible.

The mice were randomly separated into two groups. One group continued with dox

treatment, while dox treatments were discontinued to terminate TAZ expression in the second group (Figure 2A).

Within five days of stopping dox treatment, tumors stopped growing and rapidly regressed (Figure 2A and S2A). Tumors from the dox-on and dox-off treatment groups were excised and analysed for cell proliferation (Ki67 positive), apoptosis (activated caspase-3), and histology (Figures 2C and S2B). In dox-off cells, a reduction in Ki67- positive cells and a pronounced increase in apoptotic cells were noted at day 3. These features were followed by a collapse of tumor cellular architecture and the appearance of nuclear and cytoplasmic debris at day 5 (Figure S2C).

Our results indicated that primary mammary tumors that develop because of constitutively active TAZ expression remain dependent on TAZ for their maintenance.

To test whether constitutively active TAZ promotes metastasis, a tail-vein injection model was used to circumvent the need for cancer cells to leave the primary tumor and enter the circulation (20). We randomly divided mice injected with MCF10A-tetTAZ cells into three groups of dox treatment: 1) none; 2) continuous; and 3) treatment for three weeks, then no treatment for one (final) week. Luciferase imaging indicated equal colonization of injected cells in all three groups 72 hours after injection (Figure 2B). At three weeks, mice with continuous dox treatment developed macroscopic lung metastases. In contrast, the luciferase signal was completely absent in the mice without dox treatment, indicating that no lung metastases were established without TAZ expression (Figure 2B). Interestingly, we observed that absence of dox treatment for just the fourth week alone caused a substantial reduction in the number of lung

metastases by bioluminescence imaging (Figure 2B). Together, our results show that primary tumors and metastatic lesions in our mouse model were dependent on sustained TAZ activation for growth. Furthermore, these results suggest that inhibiting

TAZ expression in both primary mammary tumors and established lung metastases can induce anti-metastatic therapeutic benefits.

The complete regression of MCF10A TAZ-induced primary mammary tumors and metastases that we observed in SCID mice was unexpected given that human malignancies are rarely cured by treatment with a single agent (21). We next investigated whether the same holds true in patient-derived BC cell lines that overexpress TAZ by amplification, viral insertion, or in the absence of recognized changes. We introduced siRNA targeting endogenous TAZ into a panel of model BC cell lines derived from different human breast tumors that include many of the essential genomic lesions found in BC (22, 23). Immunoblotting confirmed that the addition of siRNA to the resultant cell lines led to a decrease in endogenous TAZ protein levels

(Figure S3A). The ability of this siRNA to suppress oncogenic TAZ was measured in colony-formation assays, which enable the assessment of the differences in long-term reproductive viability. As shown in Figure 2D, TAZ inhibition had a dramatic suppressive effect on CAL-120, MDA-MB-453, MDA-MB-468, MDA-MB-231 and HCC1937 cell growth (BLBC cells). Conversely, siRNA knockdown had a negligible growth effect on

MCF10A and HMEC cell (immortalized and normal basal-like mammary epithelial cells, respectively) or T47D and MCF7 cell growth (luminal BC cells).

Isogenic cancer cell lines allow the examination of the phenotypic effect of a specific genetic alteration in an otherwise identical genetic background. An alternative approach is to perform RNAi screens across many different cancer cell lines, where contextual lethality’s can be inferred by comparing groups of cancer cell lines classified according to their genetic alterations. We, therefore, performed a meta-analysis to evaluate TAZ genetic dependency in 12 breast cancer cell lines included in the Project Achilles data set (Materials & Methods). As summarized in Figure S4A, two basal-like BC cell lines were most sensitive to TAZ knockdown. However, three other basal-like & all ER- positive cell lines were insensitive to inhibition of TAZ. Conversely, oncogenes associated with breast cancer (CCND1, MYC and PI3KCA), had different essentiality profiles compared to TAZ suggesting that the dependence upon an initiating oncogenic event is not a monolithic property of tumours (Figure S4B-C).

Finally, because the genes and pathways used by cells grown in tissue culture may differ from the genes required to sustain tumour growth in vivo, we investigated whether

TAZ suppression affects tumor xenograft growth. Consistently, both tumor growth rate and tumor size were reduced in MDA-MB-231 and MDA-MB-468 BC cell lines expressing shRNA targeting TAZ compared to control cells (Figure 2E & S3B).

Collectively, these observations demonstrated that TAZ is an essential oncogene that promotes BC initiation, tumor progression and maintenance.

TAZ inactivation in mammary tumors reveals TAZ-dependent and TAZ- independent genes

The molecular mechanisms underlying the specificity of TAZ-driven oncogenic transcriptional response are poorly characterized, in part because systems to efficiently inhibit TAZ expression in established disease in vivo were not available. Several studies, including work from our lab, have aimed to profile TAZ-driven transcriptional programmes in BC cell lines (24) (12); however, these programs were primarily studied in the context of tumor cell initiation. To explore the requirements of oncogenic TAZ transcriptional programs during tumorigenesis, we sought to identify the genes transcriptionally regulated by TAZ that are required to maintain tumor growth. Of note, when comparing transcriptome profiles in control and mammary tumor tissues, changes may result either from its direct transcriptional control by TAZ or indirect regulatory effects. Thus, to discriminate between these two scenarios, we took advantage of our dox-inducible system and obtained whole-transcriptome sequencing (WTS) profiles in dox-TAZ-induced mammary tumors (dox-on) and tumors 24 hrs after TAZ shutdown by the administration of dox-free food. Using short-term TAZ inactivation in mammary tumors (24 hrs), we found that TAZ was directly required for the transcriptional regulation of distinct groups of genes. To identify differentially expressed genes (DEGs) between dox-on and dox-off tumour cells, we conducted a paired analysis that used a corrected P value ≤0.05 and a fold-change threshold of ≥2.0, which yielded 2390 DEGs

(Supplemental Table 1).

Next, to identify genes that might mediate these effects, we explored gene expression changes following the de-induction of TAZ and performed pathway analyses of DEGs using the MetaCore Suite (25). TAZ-regulated genes were enriched for molecules

involved in Hippo signaling, cell cycle progression, proliferation and cytoskeletal remodeling (Figure 3A, Supplemental Table 2), concordant with observations in multiple

BC models and with the general growth-promoting activity of TAZ. As an alternative approach, we also used the Database for Annotation, Visualization, and Integrated

Diseases (DAVID) to identify cellular processes enriched in BLBC cells caused by TAZ dysregulation. DAVID is a functional annotation tool used to interrogate Gene IDs using

>40 annotation categories, including gene ontology terms, protein-protein interactions, and biological pathways (26). Cell cycle, proteolysis and cytoskeleton organization processes were enriched with P values of 1.197E-08, 3.655E-06 and 6.767E-04, respectively (Figure 3B, Supplemental Table 3). In addition, gene set enrichment analysis (GSEA) (27) revealed a strong inverse correlation between global gene expression changes following TAZ withdrawal and several gene sets associated with poor prognosis in BC (Figure S5), implying that this gene expression programme contributes to aggressive disease in humans.

Inferred network model captures TAZ-driven oncogenic pathways in BLBC

To understand complex biological processes such as tumor maintenance, DEGs should be considered in the context of complex molecular networks (28). Network models may help to prioritize disease genes and provide information complementary to pathway enrichment analyses such that the two data sources can be combined for maximal impact. Based on this basic tenet, we generated a functional interaction network (FIN) using expert-curated pathways (29) to identify key downstream genes transcriptionally regulated by TAZ (Materials & Methods). Briefly, we took each DEG in the FIN as a

candidate key gene (CKG) and tested whether its network neighbourhood was enriched for gene members of the inferred pathway gene set using Fisher's exact test. Using an

FDR P≤0.05, we identified 187 CKGs from the FIN. Focusing our analysis on a smaller sub-network, we extracted a core FIN regulating progression through the cell cycle and including Hippo signaling pathway genes such as AMOTL2, CTGF, LATS2, NDRG1,

SCHIP1, TEAD1 and VGLL3 (Figure 3C). Candidate genes were subsequently ranked by leveraging their associations with clinical correlations, including co-expression with

TAZ using gene expression data from The Cancer Genome Atlas Breast Invasive

Carcinoma project (7), as well as their statistical significance (Figure 3D, Supplemental

Table 4). This approach identified S-phase kinase-associated protein 2 (SKP2) required for the proteolytic turnover of several proteins involved in cell cycle control and transcriptional regulation as a highly ranked key gene meriting further investigation

(Figure 3D).

Identification of SKP2 as a target gene transcriptionally regulated by TAZ

SKP2 in normal cells promotes progression into S phase of the cell cycle through targeted degradation of the cyclin-dependent kinase inhibitor p27 (30, 31). Conversely,

SKP2 overexpression in mammary epithelial cells promotes transition from G1 to S phase, resulting in accelerated proliferation, making this process critically involved in the pathogenesis of BC (32, 33). But SKP2 transcriptional regulation has never before been associated with TAZ. To determine whether inhibiting TAZ expression leads to a reciprocal decrease in SKP2 protein expression, we performed immunohistochemical staining for SKP2 in MCF10A-tetTAZ primary tumors responding to dox withdrawal

(Figure 4A & S6B). SKP2 protein levels were considerably reduced under dox withdrawal conditions. In agreement with this observation, SKP2 mRNA expression was also decreased in response to dox withdrawal to a similar extent as the reduction in TAZ expression (Figure S6A).

We next excised mammary tumors from MCF10A-tetTAZ primary tumors and re-derived cell lines via puromycin selection. Drug-resistant cell lines were readily established from five of the six tumors and pooled together to mitigate biased clonal selection (used herein). Western blotting demonstrated that the tumor-derived pooled cells expressed high levels of flag-tagged TAZ in response to dox and rapid reduction of TAZ expression in response to dox withdrawal (Figure 4B &C). Uniquely, since serial biopsies and analyses of in vivo tumors are not feasible, tumor-derived cells represent an attractive alternative for the detailed molecular characterization of the BLBC maintenance program of activated TAZ.

To test whether the inhibiting TAZ expression affects cell cycle progression, we analysed the effect of TAZ inactivation on the cell cycle in response to dox withdrawal in vivo and in vitro. This effort led to several related and important observations. First, we found noticeably reduced BrdU labelling in TAZ-induced tumors after dox removal

(Figure 4D & S6C), indicating decreased DNA synthesis and proliferation. Second, we analysed the cell cycle in TAZ tumor-derived cells by FACS. As shown in Figure 4E and

S6D, we found that withdrawing dox significantly reduced S/G2 cell populations and increased the number of cells in G1. Furthermore, the loss of TAZ activity induced significant morphological changes consistent with the induction of senescence, as

confirmed by β-galactosidase staining (Figure 4F & S6E). In agreement with these findings, we detected decreased SKP2 protein levels in response to dox withdrawal

(Figure 4B) and a reciprocal increase in SKP2 in response to dox administration (Figure

4C). Furthermore, these results corresponded to alterations in p27 protein levels in response to dox administration or withdrawal (Figure 4B, C & S6F) and were independently confirmed in TAZ-overexpressing MCF10A cells (Figure S6G).

While aberrant SKP2 protein stabilization has been reported to account for the elevated

SKP2 expression in BLBC, the fact that SKP2 mRNA levels are also frequently up- regulated has been overlooked until recently (34). To this end, we next asked whether

TAZ directly regulates SKP2 transcription or is secondary to an enrichment of cells due to an indirect consequence of TAZ-dependent cell proliferation. To answer this question, we first performed a chromatin immunoprecipitation (ChIP) assay using an anti-TAZ antibody in TAZ tumor-derived cells. We found that TAZ directly binds to SKP2 promoter regions (Figure 4G). In addition, we sub-cloned the SKP2 promoter region that contains the conserved TEAD1/4 (24, 35) binding motif into a luciferase vector. As predicted, TAZ activated the SKP2 promoter-containing luciferase activity (Figure 4H).

These results suggested that TAZ is an upstream regulator of SKP2 expression via the

TEAD family of transcription factors and that reduced TAZ expression results in cell arrest and a senescent phenotype via induction of p27 cell cycle-controlling proteins.

Inhibition of SKP2 reverses TAZ-induced cell proliferation and tumor growth

If SKP2 mediates cellular dependence to TAZ, then the perturbation of SKP2 in high

TAZ-expressing BLBC cells would result in the inhibition of cell proliferation and tumor

formation. To investigate the effects of RNAi-mediated SKP2 expression, we inhibited

SKP2 expression using two independent shRNAs in TAZ tumor-derived cells (Figure

S7A). Perturbing SKP2 dramatically reduced the proliferation rate of TAZ tumor-derived cells (Figure 5A). To test whether exogenously overexpressing SKP2 rescues the TAZ inactivation phenotype, we generated a wild-type (WT) SKP2 expression construct, which we transduced into TAZ tumor-derived cells (Figure 5B). SKP2-WT overexpression rescued cell proliferation by greater than 60% when dox was withdrawn in TAZ tumor-derived cells (Figure 5B). Taken together, our results showed that TAZ- mediated SKP2 activation is critical for TAZ-initiated oncogene dependence.

While we demonstrated using multiple assays that genetically engineered human tumour cells depend upon TAZ-mediated SKP2 transcriptional activation, we wished to address whether the same holds true in actual cancer cell lines isolated from BC patients. First, we evaluated the correlation between TAZ and SKP2 expression in a panel of luminal and BLBC cell lines. Accordant with earlier observations, TAZ expression correlated with SKP2 expression in a broad range of BC cells (Figure S7B).

We proceeded to investigate the effects of SKP2 inhibition on BC cell proliferation and knocked down SKP2 using siRNA in MCF10A, luminal-type cell lines (T47D, MCF7) and in basal-type cell lines (CAL120, MDA-MB-453, MDA-MB-468, MDA-MB-231 and

HCC1937). SKP2 inhibition reduced the proliferation of basal-type CAL120, MDA-MB-

453, MDA-MB-468, MDA-MB-231 and HCC1937 cells (Figures 5C and S7C), whereas

SKP2 siRNA had no effect on MCF10A or luminal-type T47D and MCF7 cells.

Having established the relevance of SKP2 for TAZ-induced in vitro cell proliferation, we next investigated the role of SKP2 in regulating breast cancer tumorigenesis and progression by knocking down SKP2 in TAZ tumor-derived cells, MDA-MB-468 and

MDA-MB-231 cells using two independent shRNAs against SKP2. As shown in Figure

5D-E and S7D-E, SKP2 knockdown significantly inhibited tumor formation in TAZ tumor- derived cells, MDA-MB-468 and MDA-MB-231 cells. These results complement the above findings regarding the role of SKP2 in TAZ-dependent tumor growth and show that SKP2 plays a crucial role in TAZ-mediated tumorigenesis, thus phenocopying the requirement of TAZ in BLBC.

TAZ/SKP2 gene expression levels correlate with clinicopathological features of

BC patients

We previously reported that elevated TAZ expression is correlated with BLBCs (12). In addition, a recent analysis of BC patient gene expression data sets showed correlations between TAZ activity and histological grading and a higher probability of developing metastases (36). Nonetheless, whether high TAZ/SKP2 expression can be exploited for clinical use in BLBC is unknown. Thus, to investigate whether our findings have clinical relevance, the correlations between the relative mRNA expression levels of these two genes and key clinicopathological features were examined by univariate Kaplan-Meier analyses. A positive association between increased TAZ/SKP2 gene expression and both reduced median overall survival (OS) and reduced relapse-free survival (RFS) within five years of diagnosis was observed using several independent patient data sets

(Figure 6A-C). Compatible with these findings, a separate multivariate analysis of prognostic factors with a Cox proportional-hazards model confirmed that high TAZ/SK2

expression was a robust predictor of poor survival in BC and remained significant when adjusting for other prognostic factors, such as age, gender, tumour size and histological type. Moreover, the prognostic accuracy was higher than that based on TAZ or SKP2 data alone. As DFS and, to a lesser extent, OS reflect new micro-metastatic spread before surgery; these independent and cross-platform clinical epidemiology data support our findings implicating hyperactive TAZ and SKP2 in tumor progression and metastasis.

Discussion

Compared with other subtypes, basal-like cancers are associated with an aggressive clinical history and poor patient outcomes, as patients with these types of tumors will not be responsive to anti-oestrogen or anti-HER2 therapies (37). Genome sequencing efforts have identified several signalling pathways that are deregulated in many BLBC tumours. For example, >70% of BLBCs have genetic alterations in the PI3-AKT-MTOR pathway, ~80% have alterations in TP53 signaling and 20% show RB1 mutation/loss

(6). These deregulated signaling pathways often converge on a few common modulators (38). Unfortunately, attempts at targeted therapy have failed to improve outcomes in BLBC patients, underscoring the need to identify new therapeutic strategies with limited side effects.

BC displays frequent intra- and inter-tumor heterogeneity as the result of genetic and non-genetic alterations that often enhance the vigour of cancer cells. Tumor heterogeneity and widespread chromosomal instability are also typical in BLBC (10), making it difficult to distinguish genes driving tumor development and progression from those playing a bystander role. However, compelling evidence from preclinical studies, as well as from cancer patients treated with oncogene-targeted therapeutics indicates cancer cell survival relies on relatively few key genetic driver events (39, 40). This is illustrated by the introduction of Herceptin (trastuzumab), an antibody that inhibits the

HER2 oncogene in BC (41). Furthermore, the effectiveness of this target-specific approach is reinforced by inducible mouse cancer models directed by oncogenes, such as BRAF in melanomas, K-RAS in lung cancers and MYC in haematopoietic

malignancies (42–44). Subsequent studies have demonstrated that cancer can also become dependent to downstream mediators of driving oncogenes, providing additional entry points for therapeutic intervention (45). Notwithstanding their potential importance, the precise molecular programmes that mediate oncogene addiction remain poorly understood.

Transcriptional regulators are commonly mutated in BLBC, highlighting the importance of understanding abnormal transcriptional regulation in tumourigenesis (46). TAZ is a transcriptional co-activator and a downstream effector of the Hippo pathway, which controls organ size by regulating cell proliferation, apoptosis, and stem cell self-renewal

(47). Conversely, amplification and overexpression of TAZ in BLBC are associated with poor prognosis and correlate with aggressive or metastatic behaviour (36). In addition, elevated TAZ activity has been shown to be necessary and sufficient to endow cancer stem cell (CSC)-related traits on BC cells (11). Unfortunately, the clinical significance of

TAZ deregulation and the underlying molecular programmes which TAZ utilizes to drive

BC cell survival and growth in vivo remain poorly defined. Furthermore, a fundamental unresolved question is whether sustained TAZ expression is required for the maintenance of the transformed BC phenotype. To address this question, we generated a genetic BLBC model permitting the temporal regulation of constitutively active TAZ during tumourigenesis, which enabled us to examine the consequences of sustained

TAZ activity in the transformed state, from the onset of benign tumors to malignant tumour maintenance. We showed for the first time that TAZ-driven tumors, including those of patient-derived cell lines, required sustained TAZ expression, as withdrawal of

this oncogenic signal led to a dramatic decrease in tumor progression and prolonged survival. Remarkably, TAZ inhibition impaired the spread of BC cells by switching off the oncogene in advanced carcinomas and within established macroscopic metastases, formally validating TAZ as a rational target for BLBC therapy.

Pharmacological inhibition of TAZ function has proven challenging because of the diverse mechanisms driving its aberrant expression. For example, direct pharmacological inhibition of TAZ is challenging, as this protein has no catalytic activity and functions by engaging diverse protein domains that facilitate context-dependent protein-protein or protein-DNA interactions. In addition, upstream kinases are negative regulators of TAZ and would need to be activated to counteract TAZ-mediated tumorigenesis (48). Given the difficulty of targeting TAZ therapeutically, we sought to comprehensively characterize the transcriptional programs mediated by TAZ to identify other potential therapeutic targets. This effort is a necessary first step towards developing therapeutically tractable approaches to counter the effects of TAZ deregulation in BLBC. Further, this approach may have an added advantage of reduced toxicity compared with that of targeting upstream signaling molecules endowed with pleiotropic functions. By acutely inactivating the TAZ protein in tumours, we showed that

TAZ is directly required for either the activation or repression of distinct groups of genes. WTS profiling in developing and regressing tumors allowed us to discriminate between secondary and primary TAZ-dependent regulatory events in mammary tumors.

Mechanistic investigations revealed that TAZ controls distinct sets of genes that

determine cancer cell fate through cell cycle networks, including a specific, causal role for SKP2.

Deregulation of the cell cycle results in uncontrolled cell proliferation, and aberrant regulation of the proteins involved in this process is pivotally involved in BLBC progression. Emerging evidence has demonstrated that SKP2 overexpression promotes the cell cycle transition from G1 to S phase and has been associated with poor prognosis alone and in combination with high cyclin E expression, as well as other unfavourable prognostic factors, including an increased tumour grade, a lack of ER and

PR expression, and HER2 overexpression (30, 32). Elevated SKP2 expression has been shown to be a common characteristic of BLBC but has never been associated with TAZ.

Notably, Hippo-Yap signalling suppresses cell polyploidy and oncogenesis through the

AKT-SKP2 axis (49). Moreover, a recent report found that SKP2 mRNA levels are regulated by mechanical cues such as ECM rigidity and depend on the translocation and activation of the Hippo signaling mediator YAP (34), suggesting that Hippo-SKP2 transcriptional regulation may represent a common endpoint of various pathways involved in cell transformation. Consistent with this scenario, our data indicate that TAZ directly regulates SKP2 transcription and that TAZ or SKP2 inactivation induces cell cycle arrest and/or apoptosis. While drug development typically targets upstream receptors/kinases, our study provides compelling evidence for targeting proteins at the nexus of multiple oncogenic signalling pathways as new BC therapeutics. Furthermore, our findings showing that SKP2 transcriptional upregulation by TAZ is critical during

tumor initiation and progression underscore the importance of this protein as a BLBC anticancer target (50).

Acknowledgement

We thank laboratory animal, flow and image cytometry, experimental tumour models and translational imaging shared resource of RPCI. We thank Dr. Xiaolong Yang kindly shared with us the pTRIPz plasmid. This work was supported by the Roswell Park

Cancer Institute and National Cancer Institute (NCI) Grant #P30 CA016056, Roswell

Park Alliance Foundation, National Cancer Institute (NCI) R01 CA207504 and the

American Cancer Society Research Scholar Grant RSG-14-214-01-TBE (to J.Z.).

References

1. Beca F, Polyak K. Intratumor Heterogeneity in Breast Cancer. Adv Exp Med Biol. 2016;882:169-89. 2. Paquet ER, Hallett MT. Absolute assignment of breast cancer intrinsic molecular subtype. J Natl Cancer Inst. 2015;107:357. 3. Holm J, Eriksson L, Ploner A et al. Assessment of Breast Cancer Risk Factors Reveals Subtype Heterogeneity. Cancer Res. 2017;77:3708-17. 4. Rakha EA, Reis-Filho JS, Ellis IO. Basal-like breast cancer: a critical review. J Clin Oncol. 2008;26:2568-81. 5. Dey N, Smith BR, Leyland-Jones B. Targeting basal-like breast cancers. Curr Drug Targets. 2012;13:1510-24. 6. Curtis C, Shah SP, Chin SF et al. The genomic and transcriptomic architecture of 2,000 breast tumours reveals novel subgroups. Nature. 2012;486:346-52. 7. Ciriello G, Gatza ML, Beck AH et al. Comprehensive Molecular Portraits of Invasive Lobular Breast Cancer. Cell. 2015;163:506-19. 8. Citi V, Del Re M, Martelli A, Calderone V, Breschi MC, Danesi R. Phosphorylation of AKT and ERK1/2 and mutations of PIK3CA and PTEN are predictive of breast cancer cell sensitivity to everolimus in vitro. Cancer Chemother Pharmacol. 2018 9. Rangel R, Lee SC, Hon-Kim Ban K et al. Transposon mutagenesis identifies genes that cooperate with mutant Pten in breast cancer progression. Proc Natl Acad Sci U S A. 2016;113:E7749-58. 10. Popova T, Manié E, Rieunier G et al. Ploidy and large-scale genomic instability consistently identify basal-like breast carcinomas with BRCA1/2 inactivation. Cancer Res. 2012;72:5454-62. 11. Cordenonsi M, Zanconato F, Azzolin L et al. The Hippo transducer TAZ confers cancer stem cell-related traits on breast cancer cells. Cell. 2011;147:759-72. 12. Frangou C, Li YW, Shen H et al. Molecular profiling and computational network analysis of TAZ-mediated mammary tumorigenesis identifies actionable therapeutic targets. Oncotarget. 2014;5:12166-76. 13. Zanconato F, Cordenonsi M, Piccolo S. YAP/TAZ at the Roots of Cancer. Cancer Cell. 2016;29:783-803. 14. Azzolin L, Zanconato F, Bresolin S et al. Role of TAZ as mediator of Wnt signaling. Cell. 2012;151:1443-56. 15. Debnath J, Brugge JS. Modelling glandular epithelial cancers in three-dimensional cultures. Nat Rev Cancer. 2005;5:675-88. 16. Shaw KR, Wrobel CN, Brugge JS. Use of three-dimensional basement membrane cultures to model oncogene-induced changes in mammary epithelial morphogenesis. J Mammary Gland Biol Neoplasia. 2004;9:297-310. 17. Cheng Q, Bilgin CC, Fontenay G et al. Erratum: Stiffness of the microenvironment upregulates ERBB2 expression in 3D cultures of MCF10A within the range of mammographic density. Sci Rep. 2016;6:31680. 18. Muthuswamy SK, Li D, Lelievre S, Bissell MJ, Brugge JS. ErbB2, but not ErbB1, reinitiates proliferation and induces luminal repopulation in epithelial acini. Nat Cell Biol. 2001;3:785- 92. 19. Li YW, Shen H, Frangou C et al. Characterization of TAZ domains important for the induction of breast cancer stem cell properties and tumorigenesis. Cell Cycle. 2015;14:146-56. 20. Khanna C, Hunter K. Modeling metastasis in vivo. Carcinogenesis. 2005;26:513-23. 21. Pagliarini R, Shao W, Sellers WR. Oncogene addiction: pathways of therapeutic response, resistance, and road maps toward a cure. EMBO Rep. 2015;16:280-96. 31

22. Neve RM, Chin K, Fridlyand J et al. A collection of breast cancer cell lines for the study of functionally distinct cancer subtypes. Cancer Cell. 2006;10:515-27. 23. Chin K, DeVries S, Fridlyand J et al. Genomic and transcriptional aberrations linked to breast cancer pathophysiologies. Cancer Cell. 2006;10:529-41. 24. Zanconato F, Forcato M, Battilana G et al. Genome-wide association between YAP/TAZ/TEAD and AP-1 at enhancers drives oncogenic growth. Nat Cell Biol. 2015;17:1218-27. 25. Dubovenko A, Nikolsky Y, Rakhmatulin E, Nikolskaya T. Functional Analysis of OMICs Data and Small Molecule Compounds in an Integrated “Knowledge-Based” Platform. Methods Mol Biol. 2017;1613:101-24. 26. Huang DW, Sherman BT, Lempicki RA. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc. 2009;4:44-57. 27. Subramanian A, Kuehn H, Gould J, Tamayo P, Mesirov JP. GSEA-P: a desktop application for Gene Set Enrichment Analysis. Bioinformatics. 2007;23:3251-3. 28. Schneider HC, Klabunde T. Understanding drugs and diseases by systems biology. Bioorg Med Chem Lett. 2013;23:1168-76. 29. Wu G, Feng X, Stein L. A human functional protein interaction network and its application to cancer data analysis. Genome Biol. 2010;11:R53. 30. Chan CH, Lee SW, Wang J, Lin HK. Regulation of Skp2 expression and activity and its role in cancer progression. ScientificWorldJournal. 2010;10:1001-15. 31. Bloom J, Pagano M. Deregulated degradation of the cdk inhibitor p27 and malignant transformation. Semin Cancer Biol. 2003;13:41-7. 32. Zhang W, Cao L, Sun Z et al. Skp2 is over-expressed in breast cancer and promotes breast cancer cell proliferation. Cell Cycle. 2016;15:1344-51. 33. Signoretti S, Di Marcotullio L, Richardson A et al. Oncogenic role of the ubiquitin ligase subunit Skp2 in human breast cancer. J Clin Invest. 2016;126:4387. 34. Jang W, Kim T, Koo JS, Kim SK, Lim DS. Mechanical cue-induced YAP instructs Skp2- dependent cell cycle exit and oncogenic signaling. EMBO J. 2017;36:2510-28. 35. Pobbati AV, Hong W. Emerging roles of TEAD transcription factors and its coactivators in cancers. Cancer Biol Ther. 2013;14:390-8. 36. Bartucci M, Dattilo R, Moriconi C et al. TAZ is required for metastatic activity and chemoresistance of breast cancer stem cells. Oncogene. 2015;34:681-90. 37. Badve S, Dabbs DJ, Schnitt SJ et al. Basal-like and triple-negative breast cancers: a critical review with an emphasis on the implications for pathologists and oncologists. Mod Pathol. 2011;24:157-67. 38. Hoadley KA, Yau C, Wolf DM et al. Multiplatform analysis of 12 cancer types reveals molecular classification within and across tissues of origin. Cell. 2014;158:929-44. 39. Felsher DW. Oncogene addiction versus oncogene amnesia: perhaps more than just a bad habit. Cancer Res. 2008;68:3081-6; discussion 3086. 40. Weinstein IB, Joe A. Oncogene addiction. Cancer Res. 2008;68:3077-80; discussion 3080. 41. Jacobi N, Seeboeck R, Hofmann E, Eger A. ErbB Family Signalling: A Paradigm for Oncogene Addiction and Personalized Oncology. Cancers (Basel). 2017;9 42. Sharma SV, Gajowniczek P, Way IP et al. A common signaling cascade may underlie “addiction” to the Src, BCR-ABL, and EGF receptor oncogenes. Cancer Cell. 2006;10:425- 35. 43. Lee HJ, Zhuang G, Cao Y, Du P, Kim HJ, Settleman J. Drug resistance via feedback activation of Stat3 in oncogene-addicted cancer cells. Cancer Cell. 2014;26:207-21. 44. Nagel R, Semenova EA, Berns A. Drugging the addict: non-oncogene addiction as a target for cancer therapy. EMBO Rep. 2016;17:1516-31. 45. Luo J, Solimini NL, Elledge SJ. Principles of cancer therapy: oncogene and non-oncogene

addiction. Cell. 2009;136:823-37. 46. Bhagwat AS, Vakoc CR. Targeting Transcription Factors in Cancer. Trends Cancer. 2015;1:53-65. 47. Yu FX, Zhao B, Guan KL. Hippo Pathway in Organ Size Control, Tissue Homeostasis, and Cancer. Cell. 2015;163:811-28. 48. Johnson R, Halder G. The two faces of Hippo: targeting the Hippo pathway for regenerative medicine and cancer treatment. Nat Rev Drug Discov. 2014;13:63-79. 49. Zhang S, Chen Q, Liu Q et al. Hippo Signaling Suppresses Cell Ploidy and Tumorigenesis through Skp2. Cancer Cell. 2017;31:669-684.e7. 50. Lee Y, Lim HS. Skp2 Inhibitors: Novel Anticancer Strategies. Curr Med Chem. 2016;23:2363-79.

Figure legends

Figure 1 Establishment of Tet-inducible TAZ expressing MCF10A cells.

(A) Schematic illustration of Doxycycline (Dox) administration to Tet-inducible TAZ-4SA transduced MCF10A cells. Immunoblot analyses were performed with anti-Flag and anti-β-Actin antibodies. The samples are lysates from the Tet-inducible TAZ-4SA transduced MCF10A cells without Dox treatment, Dox treatment for 3, 6 days or Dox treatment for 6 days followed Dox withdrawal for 6 days. β-Actin was used as the loading control.

(B) Representative images of Tet-inducible TAZ-4SA cells 2D culture without Dox, Dox treatment for 6 days or Dox treatment for 6 days followed Dox removal for 6 days.

(Scale bar=20μm)

Dox treatment for 6 days or Dox treatment for 6 days followed Dox removal for 6 days.

All the experiments were performed in triplicates. Error bars represent SD; *** p<0.001 by two-tailed student’s t-test.

(D) Quantification of colony formation in soft-agar assay for Tet-inducible TAZ-4SA cells without Dox, Dox treatment for 6 days or Dox treatment for 6 days followed Dox removal for 6 days. Error bars represent SD; *** p<0.001 by two-tailed student’s t-test.

(E) Representative images and quantification of large acini formation in 3D culture for

Tet-inducible TAZ-4SA cells without Dox, Dox treatment for 6 days or Dox treatment for

6 days followed Dox removal for 6 days. Error bars represent SD; *** p<0.001 by two- tailed student’s t-test.

Figure 2 TAZ confers reversible mammary tumorigenicity and metastasis.

(A) Schematic illustration for TAZ induced mammary gland tumors in vivo (top panel).

Tumors completely regressed in response to Dox withdrawal (lower panel).

(B) Representative bioluminescence images of SCID mice intravenously injected with

Tet-inducible TAZ expressing cells and then receiving either normal chow, Dox containing chow or Dox containing chow for 3 weeks followed normal chow for 1 week.

The colour scale represents the photon flux (photons per second) emitted from the lung region of xenografted mice. All the experiments were performed in duplicate and n=10 mice for each group.

(C) Quantification of TAZ, Ki67 and cleaved caspase 3 IHC staining on the tumor samples after continued Dox treatment or Dox removal for 5 days. Error bars represent

SD; *** p<0.001 by two-tailed student’s t-test.

(D) Quantification of colony-formation assay for MCF10A, HMEC, T47D, MCF7,

CAL120, MDA-MB-453, MDA-MB-468, MDA-MB-231 and HCC1937 breast cancer cells transduced with sicontrol or siTAZ. All experiments were performed in triplicate. Error bars represent SD; *** p<0.001 by two-tailed student’s t-test.

(E) Quantification of primary tumor volume was measured after 6 weeks mammary fat pad injection of shcontrol or shTAZ transduced MDA-MB-468 and MDA-MB-231 cells into SCID mice. n=6 mice per group; error bars represent SD; *** p<0.001 by two-tailed student’s t-test and p <0.01 for the difference between shTAZ1 vs shTAZ2.

Figure 3 RNA-Seq analysis after short-term TAZ inactivation identifies TAZ- dependent and TAZ-independent DEG categories.

(A) Metacore pathway enrichment analysis of DEGs (multivariate-corrected P-value cut- off <0.05 by Bonferroni).

(B) Pathway enrichment analysis of DEGs by DAVID bioinformatics tool (multivariate- corrected P-value cut-off <0.05 by Benjamini).

(C) Fifty-six of 187 candidate key gene (CKGs) code for proteins involved in a FI subnetwork with TAZ as the hub. Edge paths are coloured according to their functions, i.e., genetic interactions, pathway, and physical interaction parameters.

(D) Pairwise gene correlation analysis for FI network gene sets and TCGA expression data (GSE31979) using the Pearson correlation statistic. The top-scoring correlated genes correspond closely to the Hippo signalling pathway. The P-value threshold is

0.05. Genes were ranked by the percentile of the target genes in the top of all genes as measured in each experiment and the top gene rank percentile are summarized in the table.

Figure 4 TAZ inactivation reduces SKP2 expression and leads to cell cycle arrest.

(A) Quantification of SKP2 IHC staining on the tumor samples from animals treated with

Dox-containing chow, or switched to normal chow for either 24 or 120 hours. Error bars represent SD; *** p<0.001 by two-tailed student’s t-test.

(B) Immunoblot analyses were performed with anti-Flag, anti-SKP2, anti-p27, anti-p21 and anti-GAPDH antibodies. The samples are lysates from the tumor-derived cells after

Dox treatment, or after Dox removal for 1, 3, 6 or 9 days. GAPDH was used as the loading control.

(C) Immunoblot analyses were performed with anti-Flag, anti-SKP2, anti-p27, anti-p21 and anti-GAPDH antibodies. The samples are lysates from the tumor-derived cells after

Dox removal for 6 days, or followed Dox treatment for 1, 3 or 6 days. GAPDH was used as the loading control.

(D) Quantification of Brdu immunofluorescence staining on the tumour samples from animals treated with Dox-containing chow, or switched to normal chow for 48 or 96 hours.

(E) Cell cycle distribution quantification of FACS analyses on the tumor-derived cells with Dox or after Dox removal for 3 days.

(F) Quantification of β- galactosidase staining on the tumor-derived cells with Dox or after Dox removal for 6 days.

(G) Chromatin immunoprecipitation (ChIP) analyses were performed with anti-TAZ or rabbit IgG. Samples were prepared from tumor-derived cells under the condition of Dox treatment. The precipitated chromatin was quantified by qPCR using primers in the promoter region of the SKP2 gene. RPL30 was used as negative control; CTGF was used as positive control. Data represent means + SD; ** p<0.01; *** p<0.001 by two- tailed student’s t-test.

(H) Luciferase activity analyses were performed using CTGF or SKP2 promoter-driven luciferase reporters. Indicated luciferase reporters were co-transfected with pCDNA-

TAZ-4SA and Renilla (as internal control for transfection efficiency) into 293T cells. A

CTGF luciferase reporter was used as positive control. Data represent means + SD; *** p<0.001 by two-tailed student’s t-test.

Figure 5 Knockdown of SKP2 inhibits breast cancer cell proliferation and tumor formation.

(A) Quantification of colony-formation assay for tumor-derived cells transduced with shcontrol or two independent shSKP2 with Dox. All experiments were performed in triplicate. Data represent means + SD; *** p<0.001 by two-tailed student’s t-test.

(B) Immunoblot analyses were performed with anti-Flag or anti-β-actin antibodies (left panel). The samples are lysates from vector or SKP2-WT transduced tumor-derived cells with Dox treatment. Quantifications of colony-formation assay for vector or SKP2-

WT transduced tumor-derived cells with Dox or without Dox (right panel). All experiments were performed in triplicate. Data represent means + SD; *** p<0.001 by two-tailed student’s t-test.

MB-453, MDA-MB-468, MDA-MB-231 and HCC1937 breast cancer cells transduced with sicontrol or siSKP2. All experiments were performed in triplicate. Data represent means + SD; *** p<0.001 by two-tailed student’s t-test.

(D) Quantification of primary tumor volume was measured after 7 weeks mammary fat pad injection of shcontrol or shSKP2-transduced tumor-derived cells in SCID mice with

Dox-containing chow. n=5 mice per group; error bars represent SD; ** p<0.01; *** p<0.001 by two-tailed student’s t-test.

(E) Quantification of primary tumor volume was measured after 6 weeks mammary fat pad injection of shcontrol or shSKP2-transduced MDA-MB-468 or MDA-MB-231 cells in

SCID mice. n=5 mice per group; error bars represent SD; *** p<0.001 by two-tailed student’s t-test.

Figure 6 High TAZ/SKP2 expression predicts poor breast cancer patient outcome.

(A) Kaplan-Meier overall survival (OS), (B) relapse-free survival (RFS) and (C) metastasis-free survival analysis of breast cancer patients using a median split of TAZ-

SKP2 gene expression (KM-plotter). The Log-Rank test was used to measure the statistical difference between the high and low TAZ-SKP2 groups for Kaplan-Meier curves. One-way ANOVA was used to measure the differences in TAZ-SKP2 expression in breast cancer patients of various subtypes. X-axis: follow-up time in years; y-axis: cumulative survival. Four independent patient data sets were used from the Gene Expression Omnibus (GSE42568, GSE25065, GSE5327, and NKI from

PROGgenv2).

Downloaded from mcr.aacrjournals.org on September 25, 2021. © 2018 American Association for Cancer Research. Author Manuscript Published OnlineFirst on September 20, 2018; DOI: 10.1158/1541-7786.MCR-18-0332 A Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Figure 1 Day 0 3 6 6 B +Dox 6 Days -Dox +Dox 6 Days -Dox 6 Days 3 Dox 6 Dox P6 Dox withdraw Dox

Days 036 6P6 1Pg/ml Dox -+++- Flag-TAZ

Eactin D 350 C *** *** 180 300 160 250 140 120 200 100 150 80 100 60 50 40 Colony numbers per field 20 0 -Dox +Dox +Dox 6 Days Cell migration numbers per field 0 -Dox +Dox +Dox 6 Days 6 Days -Dox 6 Days 6 Days -Dox 6 Days E 90 *** 80 70 +Dox 6 Days -Dox +Dox 6 Days -Dox 6 Days 60 50 40 30 20 10 Enlarged 3D structures/100 acin 0 -Dox +Dox +Dox 6 Days 6 Days -Dox 6 Days

Downloaded from +Dox +Dox 4.0 Author ManuscriptPublishedOnlineFirstonSeptember20,2018;DOI:10.1158/1541-7786.MCR-18-0332 -Dox Author manuscriptshavebeenpeerreviewedandacceptedforpublicationbutnotyetedited. - Dox

3.0 mcr.aacrjournals.org 5 0 x10 +Dox -Dox 2.0

100

Percentage of tumor free mice Percentage of tumor free 20 40 55 60 65 70 Time (Days) +Dox 3 weeks remove Dox 1 W

C D 80 TAZ independent TAZ dependent E BC cells BC cells 3 MDA-MB-468 *** 60 250 *** 30 40 *** 200 *** 25 *** ***

Tumor volume (mm ) (mm volume Tumor 20 20 150 *** ** *** 15 100 *** shcontrol shTAZ1 shTAZ2

10 Colony numbers Colony 50 120 3 MDA-MB-231 Positive cells per field cells per Positive 5 0 90 0

60 TAZ Ki67 *** *** Caspase 3 30 Tumor volume (mm ) (mm volume Tumor

shcontrol shTAZ1 shTAZ2 Author Manuscript Published OnlineFirst on September 20, 2018; DOI: 10.1158/1541-7786.MCR-18-0332 A Author manuscripts have been peer reviewed and acceptedB for publication but have not yet been edited. Figure 3 123456 -log (p Value)

1. Cell cycle_Chromosome 1 condensation in prometaphase 2 4 6 8 10 -log (p Value)

2. Development_Positive regulation 1 1. Cell cycle_Mitosis 2 of STK3/4 (Hippo) pathway and negative regulation of YAP/TAZ 2 2. Cell cycle_G2-M function 3. Transcription_Role of heterochromatin 3 3. Proteolysis_Ubiquitin-proteasomal 3 protein 1 (HP1) family in proteolysis transcriptional silencing 4 4. Cell cycle_S phase 4 4. NETosis in SLE 5 5. Cell cycle_Core 5 5. dCTP/dUTP metabolism 6 6. Cell cycle_Role of Nek in cell 6. Cell cycle_G1-S 6 cycle regulation 7 7. Inflammation_MIF-signaling 7. Cell cycle_Role of APC in cell 8 7 8. Cytoskeleton_Spindle microtubules cycle regulation 9 9. Transcription_Chromatin modification 8. Cytoskeleton remodeling_Substance 8 P mediated membrane blebbing 10 10. DNA damage_DBS repair 9. Immune response_ETV3 affect on 9 CSF1-promoted macrophage differention 10. Cell cycle_Spindle assembly and 10 chromosome separation

C Physical Interactions D Co-expression TAZ co- Log Odds Rank expressed p-Value Predicted RaƟo genes Co-localization 1 SCHIP1 1.11E-18 2.79 Pathway 2 SKP2 7.39E-18 2.30 3 IFRD1 1.14E-12 2.12 Genetic Interactions 4 EXT1 1.54E-12 1.99 Protein Domains 5 SOCS5 5.51E-12 2.35 6 PLOD2 4.20E-11 2.09 7 UGP2 1.09E-10 2.27 8 SIRPA 1.84E-10 2.23 9 NDRG1 1.92E-08 1.58 10 IVNS1ABP 1.16E-07 1.67 11 ABL2 1.80E-07 1.68 12 DAPK1 5.07E-07 1.98 13 AFAP1 1.18E-06 2.09 14 SERTAD4 1.83E-06 1.40 15 LATS2 2.18E-06 2.13 16 VGLL3 7.54E-06 1.76 17 RND3 1.04E-05 1.81 18 PXDC1 1.72E-05 1.53 19 GRAMD3 8.59E-05 1.72 20 AKAP2 2.42E-04 1.67 21 TEAD1 2.42E-04 1.67 22 THBS1 3.16E-04 1.52 23 FSTL1 5.55E-04 1.44 24 AMOTL2 6.26E-04 1.51 25 MBNL1 1.50E-03 1.28 26 COL8A1 2.77E-03 1.34 27 HPS5 3.23E-03 1.42 28 CTGF 1.31E-02 1.21 Downloaded from mcr.aacrjournals.org on September 25, 2021. © 2018 American Association for Cancer Research. A Author Manuscript*** Published OnlineFirst on SeptemberB 20, 2018; DOI: 10.1158/1541-7786.MCR-18-0332 Figure 4 25 Author*** manuscripts have been peer reviewed and acceptedDays for publication 0 but 1 have not yet3 been edited.6 9 Dox + - - - - 20 Flag-TAZ 15 SKP2 10 p27

5 p21

SKP2 positive cells/field 0 GAPDH +Dox -Dox 24hrs -Dox 120hrs C D Days 0 1 3 6 12 *** Dox- + + + 10 *** Flag-TAZ 8

SKP2 6

p27 4

p21 2 BrdU positive cells/field GAPDH 0 +Dox -Dox 48hrs -Dox 96hrs EF 90 *** 80 100 *** 70 +Dox -Dox day3 60 *** 80 50 60 40 30 40 20 ** 10 20 Percentage in Cell cycle 0 G1 S G2 0 % E -galactosidase positive cells +Dox -Dox day6 SKP2 promoter region G H ABCDE -5000 9 *** 6 8 *** *** *** 7 5 6 4 5 *** IgG 3 vector 4 *** TAZ TAZ-4SA 3 ** 2 2

Relative activity Relative 1

Relative Flag enrichment 1 0 0 RPL30 CTGF ABCDE CTGF reporter SKP2 reporter Downloaded from mcr.aacrjournals.orgSkp2 on September 25, 2021. © 2018 American Association for Cancer Research. A Author Manuscript*** Published OnlineFirst on September 20, 2018; DOI: 10.1158/1541-7786.MCR-18-0332 Author manuscripts have been peerB reviewed and accepted for publication but60 have not yet been edited. Figure 5 60 *** 50 50 vector vector SKP2 40 40 *** SKP2 Flag-SKP2 30 30 E-actin 20 20 10 10 0 Colony numbers per plate Colony numbers per plate shcontrol shSKP2-928 shSKP2-1000 0 C D +Dox -Dox TAZ independent TAZ dependent BC cells BC cells 250 TAZ tumor *** 120 siCon 3 200 derived cells siSKP2 150 100 *** *** 100 *** 80 ***

Colony numbers Colony 50 60 *** 0 ***

Tumor volume (mm ) (mm volume Tumor 40

E shcontrol shSKP2-928 shSKP2-1000

80 MDA-MB-468 120 MDA-MB-231

100 3 60 3

40 60 ***

40 Tumor volume (mm ) (mm volume Tumor *** ) (mm volume Tumor 20 *** 20 ***

shcontrol shSKP2-928 shSKP2-1000 shcontrol shSKP2-928 shSKP2-1000

A Relapse Free Survival Overall Survival B C Lung Met Free Survival

Downloaded from p=0.0167 p=0.0403 p=0.044 Author ManuscriptPublishedOnlineFirstonSeptember20,2018;DOI:10.1158/1541-7786.MCR-18-0332 Author manuscriptshavebeenpeerreviewedandacceptedforpublicationbutnotyetedited. mcr.aacrjournals.org GSE42568 GSE5327 GSE42568 3 years 5 years 3 years 5 years

Metastasis Free Survival NKI GSE25065 GSE5327 3 years 5 years 3 years 5 years Author Manuscript Published OnlineFirst on September 20, 2018; DOI: 10.1158/1541-7786.MCR-18-0332 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

Targeting TAZ-driven Human Breast Cancer by Inhibiting a SKP2-p27 Signaling Axis

He Shen, Nuo Yang, Alexander M Truskinovsky, et al.

Mol Cancer Res Published OnlineFirst September 20, 2018.

Updated version Access the most recent version of this article at: doi:10.1158/1541-7786.MCR-18-0332

Supplementary Access the most recent supplemental material at: Material http://mcr.aacrjournals.org/content/suppl/2018/09/20/1541-7786.MCR-18-0332.DC1

Author Author manuscripts have been peer reviewed and accepted for publication but have not yet been Manuscript edited.

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://mcr.aacrjournals.org/content/early/2018/09/20/1541-7786.MCR-18-0332. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.