DOCSLIB.ORG

Exocytosis by Networks of Rab Gtpases Decoding the Regulation

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Exocytosis by Networks of Rab Gtpases Decoding the Regulation The Journal of Immunology Decoding the Regulation of Mast Cell Exocytosis by Networks of Rab GTPases Nurit P. Azouz,* Takahide Matsui,† Mitsunori Fukuda,† and Ronit Sagi-Eisenberg* Exocytosis is a key event in mast cell functions. By this process, mast cells release inflammatory mediators, contained in secretory granules (SGs), which play important roles in immunity and wound healing but also provoke allergic and inflammatory responses. The mechanisms underlying mast cell exocytosis remained poorly understood. An essential step toward deciphering the mechanisms behind exocytosis is the identification of the cellular components that regulate this process. Because Rab GTPases regulate specific trafficking pathways, we screened 44 Rabs for their functional impacts on exocytosis triggered by the Fc«RI or combination of Ca2+ ionophore and phorbol ester. Because exocytosis involves the continuous reorganization of the actin cytoskeleton, we also repeated our screen in the presence of cytochalasin D that inhibits actin polymerization. In this paper, we report on the identification of 30 Rabs as regulators of mast cell exocytosis, the involvement of 26 of which has heretofore not been recognized. Unexpectedly, these Rabs regulated exocytosis in a stimulus-dependent fashion, unless the actin skeleton was disrupted. Functional clustering of the identified Rabs suggested their classification as Rabs involved in SGs biogenesis or Rabs that control late steps of exocytosis. The latter could be further divided into Rabs that localize to the SGs and Rabs that regulate transport from the endocytic recycling compartment. Taken together, these findings unveil the Rab networks that control mast cell exocytosis and provide novel insights into their mechanisms of action. The Journal of Immunology, 2012, 189: 2169–2180. egulated exocytosis is a central mechanism in mediating that will specifically target mast cell activation (7). For this purpose, it mast cell physiological functions in immunity and wound is of great importance to elucidate the machineries and molecular R healing, as well as underlying this cell pathological mechanisms behind mast cell activation. Indeed, a large body of functions in allergic and inflammatory reactions (1, 2). In doing so, studies aimed at resolving the stimulus–secretion coupling mecha- externally triggered cells release a variety of preformed proin- nisms in activated mast cells. In particular, previous studies have flammatory and immunomodulatory substances packaged in cyto- delineated the signaling networks elicited by the FcεRI upon binding plasmic secretory granules (SGs). The latter include vasoactive of the allergen to receptor bound allergen-specific IgE Abs (8–10). amines such as histamine and serotonin, proteases, such as chymase However, the mechanism underlying the secretory process remained and tryptase, chemoattractants, and cytokines (3). Mast cell SGs poorly understood and challenging, because mast cells contain dis- also contain lysosomal hydrolases and lysosomal membrane pro- crete types of SGs (11, 12) and release their contents by three exo- teins (3, 4) and are therefore considered secretory lysosomes, a cytic mechanisms. The latter include kiss-and-run exocytosis that property shared with SGs of other immune cells, including CTL, partially releases the SG cargo through a relative narrow and transient NK cells, and platelets (5). Once released, mast cell mediators affect fusion pore; full exocytosis, when fusion of plasma membrane multiple cells and organs, thus initiating an inflammatory response. docked SGs, with the plasma membrane, allows complete expulsion Given the pleiotropic functions of mast cells in health and of their contents, and third, compound exocytosis, the most extensive disease (6), efforts are being undertaken to develop novel therapies mode of cargo release, which involves homotypic fusion of SGs, allowing discharge of multiple granules, including those placed distal *Department of Cell and Developmental Biology, Sackler Faculty of Medicine, Tel to the plasma membrane (13–15). In addition, the lysosomal nature of Aviv University, Tel Aviv 69978, Israel; and †Laboratory of Membrane Trafficking the mast cell SGs raises questions as to how are secretory lysosomes Mechanisms, Department of Developmental Biology and Neurosciences, Graduate School of Life Sciences, Tohoku University, Aobayama, Aoba-ku, Sendai, Miyagi formed and how do they acquire their exocytosis competence. Con- 980-8578, Japan sistent with the complexity of mast cell exocytosis, multiple SNARE Received for publication February 22, 2012. Accepted for publication June 21, 2012. proteins have been implicated in controlling this process (11, 16–18). This work was supported by a grant from the Israel Science Foundation, founded by To gain insights into the mechanisms underlying mast cell the Israel Academy for Sciences (to R.S.-E.), and was partially supported by a travel exocytosis, we have undertaken work aimed at identifying the grant from the Constantiner Institute (to N.P.A.). network of Rab GTPases that controls this process. More than N.P.A. designed and performed the experiments, analyzed the data, and wrote the 60 Rabs are expressed in mammals, regulating and coordinating paper; T.M. constructed and validated the wt and CA Rab plasmids; M.F. supervised the construction and validation of the Rab plasmids, analyzed the data, discussed the discrete steps along the vesicular trafficking through their inter- results, and reviewed the paper at all stages; and R.S.-E. conceived and supervised the actions with numerous effectors (19). Therefore, we reasoned that project, designed the experiments, analyzed the data, and wrote the paper. identification of the Rabs that regulate mast cell exocytosis should Address correspondence and reprint requests to Dr. Ronit Sagi-Eisenberg, Depart- unveil the intermediate array of steps that culminate in this pro- ment of Cell and Developmental Biology, Sackler Faculty of Medicine, Tel Aviv University, Tel Aviv 69978, Israel. E-mail address: [email protected] cess. To do so, we applied a gain-of-function screen for Rabs that ε The online version of this article contains supplemental material. affect mast cell exocytosis triggered by the Fc RI or by a calcium Abbreviations used in this article: CA, constitutively active; ERC, endocytic recycling ionophore and 12-O-tetradecanoylphorbol-13-acetate (TPA), con- compartment; ISG, immature secretory granule; KO, knockout; NPY-mRFP, neuropep- sidered to activate mast cells downstream of the receptor by ele- tide Y fused to monomeric RFP; RNAi, RNA interference; SG, secretory granule; TPA, vating cytosolic Ca2+ and activating protein kinase C. In this pa- 12-O-tetradecanoylphorbol-13-acetate; wt, wild-type. per, we identified Rab networks that regulate mast cell exocytosis Copyright Ó 2012 by The American Association of Immunologists, Inc. 0022-1767/12/$16.00 in a stimulus and actin-dependent fashion. www.jimmunol.org/cgi/doi/10.4049/jimmunol.1200542 2170 REGULATION OF MAST CELL EXOCYTOSIS BY Rab GTPases Materials and Methods conjugated donkey anti mouse IgG was from Jackson ImmunoResearch Materials Laboratories (West Grove, PA); rabbit polyclonal anti-Rab42 IgG was produced using GST-Rab42. 4-Bromo-calcium ionophore A23187, anti-DNP monoclonal IgE, DNP- HSA, cytochalasin D, and p-nitrophenyl-N-acetyl-b-D-glucosaminide were Plasmids used in this study purchased from Sigma-Aldrich (St. Louis, MO). TPAwas from Calbiochem pEGFP-wild-type (wt) Rab constructs have been described previously (20, (San Diego, CA). Hoechst was purchased from Invitrogen (Carlsbad, CA). 21). Constitutively active (CA) Rab mutants were prepared as previously Abs used in this study described (22) and subcloned into the pEGFP-C1 or pEF-FLAG vectors. To construct the Rab42 small interfering RNA expression vector, oligo- Anti-DNP monoclonal IgE and Hilyte Plus 647-conjugated goat anti-mouse nucleotides containing the 19-base target site GTTAGTGCGAAGAATG- IgG were from Anaspec (Fremont, CA); monoclonal anti-serotonin and ACA were cloned into the pSilencer 2.1-U6 neo (Ambion, Austin, TX) as monoclonal anti-tubulin were from Sigma-Aldrich. Mouse monoclonal described previously (23). The nomenclature of the Rabs is according to anti-TGN38 was from BD Biosciences (Franklin Lakes, NJ); Cy2- Itoh et al. (22). pEGFP-Lifeact was from ibidi (Munich, Germany), and Table I. Primers (59→39 direction) Primer [C] Primer [N] Rab GCACTGGTTTCCAAAAATGG GCCATGGCATCATAGTTGTG Rab1A TGCTGTCGATCTTCAGGTTG ATCGCTACGCCAGTGAGAAT Rab1B GAGATGCATTGGTAGCAGCA TCAGCATTCCAATTCCAACA Rab2A AGGCTGTCTTGGCTGATGTT TTTGGAGCACGTATGGTCAA Rab2B GGCCTCAAAGAACTCAAAGC GCAGAAGGAGTCCTCAGACC Rab3A AGGGGTCTGTGTCCATTGAG CTTCCTTTTCCGCTATGCTG Rab3B TGTATCTTTCCTGGCCTGCT ACAAGATGCCAGGTTTGGTC Rab3C AGTAGGCCGTGGTGATTGTC GCTATGCCGATGACTCCTTC Rab3D GTGCACTTGGAGCCTGTGTA ATGTTCCTGGAAACCAGTGC Rab4A GGCGAAGAGATATGTCACCATAC CAGCCGGGAGACATACAACT Rab4B CTCGTCCTCTGGCTGAGTTT CTTCAAAGGCAAGCAAGTCC Rab5A CACTGGCTCTTGTTCTGCTG GCCAGCAAAATATGCCAGTT Rab5B TGAAACTCCACGGCTCTCTT CAAGCAGCCATTGTGGTCTA Rab5C GCAGCAGAGTCACGGATGTA GAATCCGCTGAGGAAATTCA Rab6A TGTCAATCATCCCTTCTTTGC ACAACACCTACCAGGCAACC Rab6B TCTTTGTGGCCACTTGTCTG TACCATGCAGATCTGGGACA Rab7 GTCCTCTTCTGCTGCTCCAC GAGAAAAGCTGGCACTCGAC Rab8A AGCAGAGAACACCGGAAGAA TGGAGACAAGTGCAAAATCG Rab8B TCGGTGCAGATTGACTGTGT TGTGATTTTGGGCAACAAGA Rab9A CAGCTTCTTCAAAGGCCACT GGAGGTAGATGGACGCTTTG Rab9B TTTCGGAGGATGTCTTCAGC CTGCTTTTCAAGCTGCTCCT Rab10 TTGGCTTGTTCTCAGTGGTG TTGCAACAAGAAGCATCCAG Rab11A GATGTCCACCACATTGTTGC
Load more

Recommended publications
  • ADP-Ribosylation Factor, a Small GTP-Binding Protein, Is Required for Binding of the Coatomer Protein Fl-COP to Golgi Membranes JULIE G
    Proc. Natl. Acad. Sci. USA Vol. 89, pp. 6408-6412, July 1992 Biochemistry ADP-ribosylation factor, a small GTP-binding protein, is required for binding of the coatomer protein fl-COP to Golgi membranes JULIE G. DONALDSON*, DAN CASSEL*t, RICHARD A. KAHN*, AND RICHARD D. KLAUSNER* *Cell Biology and Metabolism Branch, National Institute of Child Health and Human Development, and tLaboratory of Biological Chemistry, Division of Cancer Treatment, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892 Communicated by Marc Kirschner, April 20, 1992 (receivedfor review February 11, 1992) ABSTRACT The coatomer is a cytosolic protein complex localized to the Golgi complex, although their functions have that reversibly associates with Golgi membranes and is Impli- not been defined. Distinct among these proteins is the ADP- cated in modulating Golgi membrane transport. The associa- ribosylation factor (ARF), originally identified as a cofactor tion of 13-COP, a component of coatomer, with Golgi mem- required for in vitro cholera toxin-catalyzed ADP- branes is enhanced by guanosine 5'-[v-thioltriphosphate ribosylation of the a subunit of the trimeric GTP-binding (GTP[yS]), a nonhydrolyzable analogue of GTP, and by a protein G, (G,.) (19). ARF is an abundant cytosolic protein mixture of aluminum and fluoride ions (Al/F). Here we show that reversibly associates with Golgi membranes (20, 21). that the ADP-ribosylation factor (ARF) is required for the ARF has been shown to be present on Golgi coated vesicles binding of (-COP. Thus, 13-COP contained in a coatomer generated in the presence of GTP[yS], but it is not a com- fraction that has been resolved from ARF does not bind to Golgi ponent of the cytosolic coatomer (22).
    [Show full text]
  • In Vivo Mapping of a GPCR Interactome Using Knockin Mice
    In vivo mapping of a GPCR interactome using knockin mice Jade Degrandmaisona,b,c,d,e,1, Khaled Abdallahb,c,d,1, Véronique Blaisb,c,d, Samuel Géniera,c,d, Marie-Pier Lalumièrea,c,d, Francis Bergeronb,c,d,e, Catherine M. Cahillf,g,h, Jim Boulterf,g,h, Christine L. Lavoieb,c,d,i, Jean-Luc Parenta,c,d,i,2, and Louis Gendronb,c,d,i,j,k,2 aDépartement de Médecine, Université de Sherbrooke, Sherbrooke, QC J1H 5N4, Canada; bDépartement de Pharmacologie–Physiologie, Université de Sherbrooke, Sherbrooke, QC J1H 5N4, Canada; cFaculté de Médecine et des Sciences de la Santé, Université de Sherbrooke, Sherbrooke, QC J1H 5N4, Canada; dCentre de Recherche du Centre Hospitalier Universitaire de Sherbrooke, Sherbrooke, QC J1H 5N4, Canada; eQuebec Network of Junior Pain Investigators, Sherbrooke, QC J1H 5N4, Canada; fDepartment of Psychiatry and Biobehavioral Sciences, University of California, Los Angeles, CA 90095; gSemel Institute for Neuroscience and Human Behavior, University of California, Los Angeles, CA 90095; hShirley and Stefan Hatos Center for Neuropharmacology, University of California, Los Angeles, CA 90095; iInstitut de Pharmacologie de Sherbrooke, Sherbrooke, QC J1H 5N4, Canada; jDépartement d’Anesthésiologie, Université de Sherbrooke, Sherbrooke, QC J1H 5N4, Canada; and kQuebec Pain Research Network, Sherbrooke, QC J1H 5N4, Canada Edited by Brian K. Kobilka, Stanford University School of Medicine, Stanford, CA, and approved April 9, 2020 (received for review October 16, 2019) With over 30% of current medications targeting this family of attenuates pain hypersensitivities in several chronic pain models proteins, G-protein–coupled receptors (GPCRs) remain invaluable including neuropathic, inflammatory, diabetic, and cancer pain therapeutic targets.
    [Show full text]
  • Supporting Information
    Supporting Information Yee et al. 10.1073/pnas.1100495108 SI Materials and Methods Open Biosystems; SUR1 (Abcc8, clone sequence BC141411.1) Reagents. Synthetic oligonucleotides were purchased from Gen- was purchased from imaGenes. Each stock was grown in liquid elink. Kits for plasmid and DNA fragment purification were from medium, and plasmid DNAs were purified using a miniplasmid kit Qiagen. Restriction endonucleases were from New England from Qiagen. Constructs from Open Biosystems were obtained in Biolabs. Dispase and collagenase A were from Roche. the pCMV-SPORT6 vector, and constructs from imaGenes were obtained in the pYX-Asc vector. Plasmid DNA from the above Isolation and RT of Total RNAs. Two adult (2- to 10-mo-old) C57BL/ clones was purified using a Qiagen midiprep kit and sequenced 6 mice were killed by cervical dislocation. Their tongues were by the dye terminator method at the University of Pennsylvania excised and placed in a PBS solution containing 2 mM EGTA, DNA Sequencing Facility using an ABI 96-capillary 3730XL and the epithelium containing CV papillae was peeled off, taking Sequencer (Applied Biosystems). Clone DNAs were digested care to minimize contamination from underlying muscle tissue. with SalI and transcribed by T7 or T3 RNA polymerases for NT lingual epithelium devoid of taste buds was isolated from the antisense probes, or they were digested with Not1 and transcribed ventral surface of the tongue in a similar way. Total RNA was by Sp6 RNA polymerase for sense probes. Probes were generated isolated using the Pure-Link RNA mini kit from Invitrogen with the digoxigenin (DIG) RNA Labeling kit (Roche) and were (catalog no.
    [Show full text]
  • Supplementary Table 2
    Supplementary Table 2. Differentially Expressed Genes following Sham treatment relative to Untreated Controls Fold Change Accession Name Symbol 3 h 12 h NM_013121 CD28 antigen Cd28 12.82 BG665360 FMS-like tyrosine kinase 1 Flt1 9.63 NM_012701 Adrenergic receptor, beta 1 Adrb1 8.24 0.46 U20796 Nuclear receptor subfamily 1, group D, member 2 Nr1d2 7.22 NM_017116 Calpain 2 Capn2 6.41 BE097282 Guanine nucleotide binding protein, alpha 12 Gna12 6.21 NM_053328 Basic helix-loop-helix domain containing, class B2 Bhlhb2 5.79 NM_053831 Guanylate cyclase 2f Gucy2f 5.71 AW251703 Tumor necrosis factor receptor superfamily, member 12a Tnfrsf12a 5.57 NM_021691 Twist homolog 2 (Drosophila) Twist2 5.42 NM_133550 Fc receptor, IgE, low affinity II, alpha polypeptide Fcer2a 4.93 NM_031120 Signal sequence receptor, gamma Ssr3 4.84 NM_053544 Secreted frizzled-related protein 4 Sfrp4 4.73 NM_053910 Pleckstrin homology, Sec7 and coiled/coil domains 1 Pscd1 4.69 BE113233 Suppressor of cytokine signaling 2 Socs2 4.68 NM_053949 Potassium voltage-gated channel, subfamily H (eag- Kcnh2 4.60 related), member 2 NM_017305 Glutamate cysteine ligase, modifier subunit Gclm 4.59 NM_017309 Protein phospatase 3, regulatory subunit B, alpha Ppp3r1 4.54 isoform,type 1 NM_012765 5-hydroxytryptamine (serotonin) receptor 2C Htr2c 4.46 NM_017218 V-erb-b2 erythroblastic leukemia viral oncogene homolog Erbb3 4.42 3 (avian) AW918369 Zinc finger protein 191 Zfp191 4.38 NM_031034 Guanine nucleotide binding protein, alpha 12 Gna12 4.38 NM_017020 Interleukin 6 receptor Il6r 4.37 AJ002942
    [Show full text]
  • Membrane Transport Quiz
    Membrane Transport Quiz 1. Which of the following is an example of extracellular fluid? a. Cytosol b. Plasma c. Interstitial Fluid d. Both b and c 2. Which of the following correctly describes passive transport? a. the cell uses ATP in passive transport b. most pumps are examples of passive transport c. diffusion is an example of passive transport d. exocytosis is an example of passive transport 3. Simple diffusion occurs ______________. a. with transporters in the cell membrane b. directly across the cell membrane c. through exocytosis d. through endocytosis 4. Which of the following is an example of active transport? a. Filtration b. Osmosis c. Endocytosis d. Exocytosis e. Both c and d 5. Which type of active transport uses ATP directly? a. Primary Active Transport b. Secondary Active Transport c. Both a and b 6. Which of the following is an example of receptor mediated endocytosis? a. Phagocytosis b. Primary Active Transport c. Exocytosis d. ALL are For use with TCC iTunes University Membrane Transport Lecture. 1 Developed by: Martha Kutter 2009 for the Learning Commons at Tallahassee Community College. 7. A transporter that moves one type of particle in one direction is _______________. a. Uniporter b. Symporter c. Antiporter 8. A transporter the moves two different particles in two different directions is ________. a. Endocytosis b. Exocytosis c. Uniporter d. Symporter e. Antiporter 9. Which of the following is an example of a primary active transporter? a. Na+/Ca2+ transporter on cardiac contractile cells b. Na+ channels on neurons c. Na+/K+ ATPase on all cells d.
    [Show full text]
  • Exo-Endocytosis at Mossy Fiber Terminals: Toward Capacitance Measurements in Cells with Arbitrary Geometry
    Exo-endocytosis at mossy fiber terminals: Toward capacitance measurements in cells with arbitrary geometry Christopher Kushmerick and Henrique von Gersdorff* The Vollum Institute, Oregon Health and Science University, 3181 SW Sam Jackson Park Road, Portland, OR 97239 xocytosis and endocytosis are real time as a decrease in membrane ments have been made on secretory ubiquitous cellular phenomena capacitance back to baseline resting lev- cells for which the compact isopotential necessary for diverse functions els (6–9). approximation seems, prima facie,tobe such as secretion, internal sig- Most measurements obtained to date justified, including adrenal chromaffin Enaling, protein traffic, and motility. have relied on one of two general tech- cells (10), mast cells (11), and neuroen- Many different techniques have been niques to relate membrane current to docrine cells (12), which secrete via developed to assay exocytosis and endo- capacitance (6, 9). Time-domain meth- large dense-core vesicles. In addition, cytosis, but to date only electrical mea- ods use the amplitude and time course small clear-core synaptic vesicle fusion surements of plasma membrane capaci- of membrane current relaxations after and membrane retrieval have been mea- tance have had the time resolution step changes in electrical potential to sured from retinal bipolar cell terminals necessary to capture both the fusion and determine cell membrane parameters. (2, 3, 13), hair cells (4, 5), and photore- reuptake of small clear-core vesicle ceptors (14). However, these sensory membrane during fast neurotransmis- neurons contain nonconventional rib- sion. In this issue of PNAS, Hallermann bon-type active zones (3, 13, 15). et al. (1) present capacitance measure- These are the first Recently, attempts have been made to ments from hippocampal mossy fiber measure exocytosis in cells with complex nerve terminals during stimulated exocy- membrane capacitance geometry and multiple electrical com- tosis.
    [Show full text]
  • GTP-Binding Proteins • Heterotrimeric G Proteins
    GTP-binding proteins • Heterotrimeric G proteins • Small GTPases • Large GTP-binding proteins (e.g. dynamin, guanylate binding proteins, SRP- receptor) GTP-binding proteins Heterotrimeric G proteins Subfamily Members Prototypical effect Gs Gs, Golf cAMP Gi/o Gi, Go, Gz cAMP , K+-current Gq Gq, G11, G14, Inositol trisphosphate, G15/16 diacylglycerol G12/13 G12, G13 Cytoskeleton Transducin Gt, Gustducin cGMP - phosphodiesterase Offermanns 2001, Oncogene GTP-binding proteins Small GTPases Family Members Prototypical effect Ras Ras, Rap, Ral Cell proliferation; Cell adhesion Rho Rho, Rac, CDC42 Cell shape change & motility Arf/Sar Arf, Sar, Arl Vesicles: fission and fusion Rab Rab (1-33) Membrane trafficking between organelles Ran Ran Nuclear membrane plasticity Nuclear import/export The RAB activation-inactivation cycle REP Rab escort protein GGT geranylgeranyl-transferase GDI GDP-dissociation inhibitor GDF GDI displacementfactor Lipid e.g. RAS e.g. ARF1 modification RAB, Gi/o of GTP-binding proteins Lipid modification Enzyme Reaction Myristoylation N-myristoyl-transferase myristoylates N-terminal glycin Farnesylation Farnesyl-transferase, Transfers prenyl from prenyl-PPi Geranylgeranylation geranylgeranyltransferase to C-terminal CAAX motif Palmitoylation DHHC protein Cysteine-S-acylation General scheme of coated vesicle formation T. J. Pucadyil et al., Science 325, 1217-1220 (2009) Published by AAAS General model for scission of coated buds T. J. Pucadyil et al., Science 325, 1217-1220 (2009) Published by AAAS Conformational change in Arf1 and Sar1 GTPases, regulators of coated vesicular transport This happens if protein is trapped in the active conformation Membrane tubules formed by GTP- bound Arf1 Membrane tubules formed by GTP-bound Sar1 Published by AAAS T.
    [Show full text]
  • ADP Ribosylation Factor 6 Is Activated and Controls Membrane Delivery
    JCBArticle ADP ribosylation factor 6 is activated and controls membrane delivery during phagocytosis in macrophages Florence Niedergang,1 Emma Colucci-Guyon,1 Thierry Dubois,1 Graça Raposo,2 and Philippe Chavrier1 1Membrane and Cytoskeleton Dynamics Group and 2Electron Microscopy Group, UMR 144 Centre National de la Recherche Scientifique, Institut Curie, F-75248 Paris Cedex 05, France ngulfment of particles by phagocytes is induced by immunoglobulins (FcRs). A dominant-negative mutant of their interaction with specific receptors on the cell ARF6 (T27N mutation) dramatically affected FcR-mediated Esurface, which leads to actin polymerization and the phagocytosis. Expression of ARF6-T27N lead to a reduction extension of membrane protrusions to form a closed phago- in the focal delivery of vesicle-associated membrane protein some. Membrane delivery from internal pools is considered 3ϩ endosomal recycling membranes at phagocytosis sites, to play an important role in pseudopod extension during whereas actin polymerization was unimpaired. This resulted phagocytosis. Here, we report that endogenous ADP ribosyla- in an early blockade in pseudopod extension and accumu- tion factor 6 (ARF6), a small GTP-binding protein, undergoes lation of intracellular vesicles, as observed by electron a sharp and transient activation in macrophages when phago- microscopy. We conclude that ARF6 is a major regulator of cytosis was initiated via receptors for the Fc portion of membrane recycling during phagocytosis. Introduction Phagocytosis is the mechanism of internalization used by cells the plasma membrane to be locally elongated to form the to take up relatively large particles (Ͼ0.5 ␮m) into an intra- engulfing pseudopods (Castellano et al., 2001; May and cellular compartment or phagosome.
    [Show full text]
  • Exocytosis and Endocytosis
    Exocytosis and Endocytosis Exocytosis and Endocytosis A Closer Look at Cell Membranes . Aim: How do large particles enter and exit cells? . Do Now: Name some molecules/materials that enter and exit the cell. How would you describe the cell membrane that allows passage of these materials? Exocytosis and Endocytosis Exocytosis and Endocytosis . Exocytosis (out of the cell) • The fusion of a vesicle with the cell membrane, releasing its contents to the surroundings . Endocytosis (into the cell) • The formation of a vesicle from cell membrane, enclosing materials near the cell surface and bringing them into the cell Exocytosis and Endocytosis Endocytosis . Phagocytosis – solid . Pinocytosis – liquid (general) Endocytosis: . Uptake of substances . Transport of protein or lipid components of compartments . Metabolic or division signaling . Defense to microorganisms Endocytosis . Clathrin-coated vesicles . Non-clathrin coated vesicles . Macropinocytosis . Potocytosis Exocytosis and Endocytosis Endocytosis Required: . signal . membrane receptor (Fc receptor for Ab) . formation of pseudopodium . cortical actin network The formed vesicle: phagosome (hetero-; auto-) Endocytosis . Clathrin-coated vesicles . Non-clathrin coated vesicles . Macropinocytosis . Potocytosis Endocytosis and Exocytosis Examples Three Pathways of Endocytosis . Bulk-phase endocytosis • Extracellular fluid is captured in a vesicle and brought into the cell; the reverse of exocytosis . Receptor-mediated endocytosis • Specific molecules bind to surface receptors, which are then enclosed in an endocytic vesicle . Phagocytosis • Pseudopods engulf target particle and merge as a vesicle, which fuses with a lysosome in the cell Phagocytosis (“engulfment”) Exocytosis and Endocytosis Membrane Cycling . Exocytosis and endocytosis continually replace and withdraw patches of the plasma membrane . New membrane proteins and lipids are made in the ER, modified in Golgi bodies, and form vesicles that fuse with plasma membrane Exocytic Vesicle 5.5 Key Concepts: Membrane Trafficking .
    [Show full text]
  • Lysosomal Biology and Function: Modern View of Cellular Debris Bin
    cells Review Lysosomal Biology and Function: Modern View of Cellular Debris Bin Purvi C. Trivedi 1,2, Jordan J. Bartlett 1,2 and Thomas Pulinilkunnil 1,2,* 1 Department of Biochemistry and Molecular Biology, Dalhousie University, Halifax, NS B3H 4H7, Canada; [email protected] (P.C.T.); jjeff[email protected] (J.J.B.) 2 Dalhousie Medicine New Brunswick, Saint John, NB E2L 4L5, Canada * Correspondence: [email protected]; Tel.: +1-(506)-636-6973 Received: 21 January 2020; Accepted: 29 April 2020; Published: 4 May 2020 Abstract: Lysosomes are the main proteolytic compartments of mammalian cells comprising of a battery of hydrolases. Lysosomes dispose and recycle extracellular or intracellular macromolecules by fusing with endosomes or autophagosomes through specific waste clearance processes such as chaperone-mediated autophagy or microautophagy. The proteolytic end product is transported out of lysosomes via transporters or vesicular membrane trafficking. Recent studies have demonstrated lysosomes as a signaling node which sense, adapt and respond to changes in substrate metabolism to maintain cellular function. Lysosomal dysfunction not only influence pathways mediating membrane trafficking that culminate in the lysosome but also govern metabolic and signaling processes regulating protein sorting and targeting. In this review, we describe the current knowledge of lysosome in influencing sorting and nutrient signaling. We further present a mechanistic overview of intra-lysosomal processes, along with extra-lysosomal processes, governing lysosomal fusion and fission, exocytosis, positioning and membrane contact site formation. This review compiles existing knowledge in the field of lysosomal biology by describing various lysosomal events necessary to maintain cellular homeostasis facilitating development of therapies maintaining lysosomal function.
    [Show full text]
  • An Analysis of DNA Methylation in Human Adipose Tissue Reveals Differential Modification of Obesity Genes Before and After Gastric Bypass and Weight Loss Miles C
    Himmelfarb Health Sciences Library, The George Washington University Health Sciences Research Commons Genomics and Precision Medicine Faculty Genomics and Precision Medicine Publications 1-22-2015 An analysis of DNA methylation in human adipose tissue reveals differential modification of obesity genes before and after gastric bypass and weight loss Miles C. Benton Alice Johnstone David Eccles Brennan Harmon Mark T. Hayes See next page for additional authors Follow this and additional works at: http://hsrc.himmelfarb.gwu.edu/smhs_intsysbio_facpubs Part of the Systems Biology Commons Recommended Citation Benton, M.C., Johnstone, A., Eccles, D., Harmon, B., Hayes, M.T. et al. (2015). An analysis of DNA methylation in human adipose tissue reveals differential modification of obesity genes before and after gastric bypass and weight loss. Genome Biology, 16:8. This Journal Article is brought to you for free and open access by the Genomics and Precision Medicine at Health Sciences Research Commons. It has been accepted for inclusion in Genomics and Precision Medicine Faculty Publications by an authorized administrator of Health Sciences Research Commons. For more information, please contact [email protected]. Authors Miles C. Benton, Alice Johnstone, David Eccles, Brennan Harmon, Mark T. Hayes, Rod A. Lea, Lyn Griffiths, Eric P. Hoffman, Richard S. Stubbs, and Donia Macartney-Coxson This journal article is available at Health Sciences Research Commons: http://hsrc.himmelfarb.gwu.edu/smhs_intsysbio_facpubs/ 112 Benton et al. Genome Biology (2015) 16:8 DOI 10.1186/s13059-014-0569-x RESEARCH Open Access An analysis of DNA methylation in human adipose tissue reveals differential modification of obesity genes before and after gastric bypass and weight loss Miles C Benton1,2, Alice Johnstone1,5, David Eccles1, Brennan Harmon4, Mark T Hayes3,5, Rod A Lea2, Lyn Griffiths2, Eric P Hoffman4, Richard S Stubbs3,5 and Donia Macartney-Coxson1* Abstract Background: Environmental factors can influence obesity by epigenetic mechanisms.
    [Show full text]
  • Synaptic Vesicle Dynamics in Living Cultured Hippocampal Neurons Visualized with CY3-Conjugated Antibodies Directed Against the Lumenal Domain of Synaptotagmin
    The Journal of Neuroscience, June 1995, 1~76): 4328-4342 Synaptic Vesicle Dynamics in Living Cultured Hippocampal Neurons Visualized with CY3-Conjugated Antibodies Directed against the Lumenal Domain of Synaptotagmin Kajetan Kraszewski,’ Olaf Mundigl,’ Laurie DanielI,’ Claudia Verclerio,* Michela Matteoli,2 and Pietro De Camilli’ ‘Department of Cell Biology and Howard Hughes Medical Institute, Yale University School Medicine, New Haven, Connecticut 06510 and XNR Center of Cytopharmacology and Department of Medical Pharmacology, University of Milano, Milano, Italy Antibodies directed against the lumenal domain of synap- which representthe presynaptic elementsof synapses.They un- totagmin I conjugated to CY3 (CYB-Syt,-Abs) and video mi- dergo exocytosis selectively at specialized regions of the pre- croscopy were used to study the dynamics of synaptic ves- synaptic plasmalemmacalled active zones and their rate of exo- icles in cultured hippocampal neurons. When applied to cytosis is dramatically stimulated by depolarization-induced cultures after synapse formation, CY3-Syt,-Abs produced a Ca2+ influx (De Camilli and Jahn, 1990; Jesse1and Kandel, strong labeling of presynaptic vesicle clusters which was 1992; Stidhof et al., 1993; Bennett and Scheller, 1994). markedly increased by membrane depolarization. The in- Until recently, the properties of SVs in situ could only be crease of the rate of CYSSyt,-Ab uptake in a high K+ me- studied by conventional morphological approacheswhich in- dium was maximal during the first few minutes but per- volve cell fixation, or by using electrophysiological techniques sisted for as long as 60 min. In axons developing in iso- which detect effects produced by neurotransmitterrelease. New lation, CYSSyt,-Abs, in combination with electron micros- probes have now been developed which make possibleto mon- copy immunocytochemistry, revealed the presence of itor morphologically, at the light microscopic level, SV dynam- synaptic vesicle clusters which move in bulk in antero- ics in the living cell.
    [Show full text]