Supporting Information

Yee et al. 10.1073/pnas.1100495108 SI Materials and Methods Open Biosystems; SUR1 (Abcc8, clone sequence BC141411.1) Reagents. Synthetic oligonucleotides were purchased from Gen- was purchased from imaGenes. Each stock was grown in liquid elink. Kits for plasmid and DNA fragment purification were from medium, and plasmid DNAs were purified using a miniplasmid kit Qiagen. Restriction endonucleases were from New England from Qiagen. Constructs from Open Biosystems were obtained in Biolabs. Dispase and collagenase A were from Roche. the pCMV-SPORT6 vector, and constructs from imaGenes were obtained in the pYX-Asc vector. Plasmid DNA from the above Isolation and RT of Total RNAs. Two adult (2- to 10-mo-old) C57BL/ clones was purified using a Qiagen midiprep kit and sequenced 6 mice were killed by cervical dislocation. Their tongues were by the dye terminator method at the University of Pennsylvania excised and placed in a PBS solution containing 2 mM EGTA, DNA Sequencing Facility using an ABI 96-capillary 3730XL and the epithelium containing CV papillae was peeled off, taking Sequencer (Applied Biosystems). Clone DNAs were digested care to minimize contamination from underlying muscle tissue. with SalI and transcribed by T7 or T3 RNA polymerases for NT lingual epithelium devoid of taste buds was isolated from the antisense probes, or they were digested with Not1 and transcribed ventral surface of the tongue in a similar way. Total RNA was by Sp6 RNA polymerase for sense probes. Probes were generated isolated using the Pure-Link RNA mini kit from Invitrogen with the digoxigenin (DIG) RNA Labeling kit (Roche) and were (catalog no. 12183018A) according to the manufacturer’s in- purified with ProbeQuant G-50 microcolumns (Amersham Bio- structions. Contaminating genomic DNA was digested in a col- sciences). Concentration and A260/A280 optical density of la- umn during RNA isolation using Pure-Link DNase (catalog no. beled RNA probes were checked with a NanoDrop reader (ND- 12185-010; Invitrogen). RNA concentrations were measured 1000; Thermo Fisher). using a NanoDrop device (ND-1000; Thermo Scientific). About 500 ng of total RNA was reverse-transcribed using SuperScript Tissue Preparation. Adult male C57BL/6, transgenic T1r3-GFP, III First-Strand Synthesis SuperMix for qRT-PCR (catalog no. and transgenic TrpM5-GFP mice (1) (2- to 10-mo-old) were killed 11752-050; Invitrogen). by cervical dislocation. The pancreas, skeletal muscle, and small intestine as well as the CV, foliate, and fungiform papillae- RT-PCR and qPCR. The expression of each gene studied was verified containing portions of tongue were then quickly removed and by PCR assay using PCR SuperMix (catalog no. 10572014; Invi- briefly rinsed in ice-cold PBS. For in situ hybridization, tissues trogen). Primers were designed using Primer3 (http://www.ncbi. were freshly frozen in Tissue-Tek O.C.T.mounting media (Sakura) nlm.nih.gov/tools/primer-blast/). All primer pairs were chosen using a 100% (vol/vol) ethanol dry ice bath and then sectioned such that each primer is from a different exon. The primers used within 1 h. For immunohistochemistry, tissues were fixed for 1 h for each gene are provided in Table S1. RT-PCR with GAPDH overnight at 4 °C in 4% (wt/vol) paraformaldehyde/1× PBS and primers was used to verify successful mRNA isolation and RT cryoprotected in 20% (wt/vol) sucrose/1× PBS overnight at 4 °C reactions. RT-PCR with gustducin primers was used to verify before embedding in O.C.T. Sections sized 8–12 μm thick were the specificity of taste and NT RNAs. cDNAs from tissues in which prepared using a CM3050S cryostat (Leica Microsystems) and the queried genes were already known to be expressed were used applied on precoated microscope slides (Superfrost plus; Fisher as positive controls. PCR products were separated on 1.5% (wt/ Scientific). The sections were dried at 40 °C for 20 min and im- vol) agarose gels and visualized with ethidium bromide under UV mediately used for in situ hybridization or stored at −80 °C for illumination. immunohistochemistry. Expression of each gene was quantified by qPCR using Taqman Gene Expression (Applied Biosystems) utilizing FAM dye as In Situ Hybridization. Fresh sections were fixed for 10 min in 4% the reporter, minor groove binder moiety on the 5′ end, non- (wt/vol) paraformaldehyde/1× PBS, permeabilized by a 10- fluorescent quencher dye on the 3′ end, and ROX as the passive min incubation at 37 °C in 1 M Tris-HCl (pH 8.0)/0.5 M reference standard. Taqman FAST custom plates (Applied Bio- EDTA containing 10 μg/mL proteinase K (Boehringer Man- systems) were used with GAPDH as an internal control and 18s nheim), postfixed for 10 min in 4% (wt/vol) paraformaldehyde/ rRNA as a manufacturing control. The Taqman probe and primer 1× PBS, and then acetylated for 10 min. All steps were followed combinations for each gene were chosen according to the rec- by three 5-min washes with diethyl pyrocarbonate-treated 1× ommendations of the manufacturer (Applied Biosystems) and are PBS. Slides were then prehybridized for 1 h at room temperature provided in Table S2. A master mix was prepared for CV or NT in a mixture containing 50% (vol/vol) deionized formamide, 5× samples using 2× TaqMan Fast Universal Master Mix (part no. saline/sodium citrate (SSC), 5× Denhardt’s solution, 500 μg/mL 4444557; Applied Biosystems), nuclease free water, and cDNA salmon sperm DNA, 250 μL/mL of yeast tRNA, and 2.5 M (0.8 μL per reaction). Ten-microliter reactions were run in a Step- EDTA in DEPC-treated water. For hybridization, aliquots of OnePlus (Applied Biosystems) machine running StepOne 2.1 the mixture were heated at 85 °C for 10 min to denature yeast software. Each gene was quantified by triplicate reactions in each tRNA, and DIG-labeled RNA probe was added to yield the run, and the runs were repeated three times for CV and NT sam- desired concentration. The following concentrations were used ples from both mice. Data analysis was done using MS Excel for each RNA probe: 0.5 μg/mL GLUT2, 0.25 μg/mL GLUT4, μ μ μ (Microsoft Corporation). The log10 of the average δ-cycle thresh- 0.25 g/mL GLUT9, 0.5 g/mL SGLT1, and 0.3 g/mL SUR1. old (Ct) value (difference between Ct values of GAPDH and each The RNA probe mixtures were heated at 85 °C for 3 min to gene) of each gene was plotted for both CV and NT tissues. denature the probe and then immediately chilled on ice. Hy- brislip plastic coverslips (Invitrogen) were used to keep sections RNA Probes. Commercially available mouse Mammalian Gene from drying out during hybridization, and slides were placed in Collection verified full-length cDNAs for GLUT2 (Slc2a2, clone a humidified chamber, sealed in a large moist zip-lock bag, and sequence BC034675.1), GLUT4 (Slc2a4, clone sequence incubated at 65 °C overnight. Plastic coverslips were removed by BC014282.1), GLUT9 (Slc2a9, clone sequence BC006076), and soaking in 5× SSC prewarmed to 65 °C. Slides were washed three SGLT1 (Slc5a1, clone sequence BC003845) were purchased from times for 30 min each time in 0.2× SSC and once for 10 min in

Yee et al. www.pnas.org/cgi/content/short/1100495108 1of7 PBS with 0.1× Triton X-100 (PBST). A tyramide signal ampli- microscope and captured using Nikon NIS-Element F 3.00 fication Plus DNP-AP kit (Perkin-Elmer) was used according to software or a SPOT digital camera (Diagnostic Instruments, Inc.) the manufacturer’s protocol to amplify signals from the RNA attached to a Nikon SA Microphot microscope and were mini- probes for GLUT2, GLUT4, GLUT9, and SUR1. Slides hybrid- mally processed using Image-Pro Plus image analysis software ized with SGLT1 probes displayed significant mRNA labeling in (Media Cybernetics, Inc.). Acquisition parameters were held both tongue and intestinal tissues without the amplification steps. constant for in situ hybridization with both antisense and sense These slides were blocked for 1 h at room temperature with 10% probes. Fluorescent images were captured with the TCS SP2 (vol/vol) heat-inactivated normal goat serum, followed by a 3-h Spectral Confocal Microscope (Leica Microsystems, Inc.) using incubation at room temperature with anti–DIG-alkaline phos- UV, Ar, GeNe, and HeNe lasers as well as appropriate excitation phatase (1:1,000; Boehringer) in blocking solution. Alkaline spectra. Scanware software (Leica Microsystems, Inc.) was used phosphate labeling was detected by incubation overnight at room to acquire z-series stacks captured at a step size of 0.25–0.35 μm. temperature in the dark with a nitroblue tetrazolium plus 5- Images were scanned using a 512 × 512 pixel format; scan lines bromo-4-chloro-3 indolyl-phosphate mixture (Roche) with le- were averaged twice, and frames were scanned three times. vamisole (Sigma). Slides were washed in PBST, rinsed in water, Acquisition parameters [i.e., gain, offset, photomultiplier tube dehydrated with an increasing series of ethyl alcohol, cleared (PMT) settings] were held constant for experiments with anti- with Histoclear (National Diagnostics), and coverslipped with bodies and for controls without antibodies. Digital images were Permount (Fisher Scientific). Antisense and sense RNA probes cropped and arranged using Photoshop CS (Adobe Systems, were used at equivalent concentrations and run in parallel in the Inc.). Related antisense and sense images were adjusted at the same experiment to ensure equivalent conditions. For each ex- same brightness and contrast. Fluorescence images within a fig- periment, in situ hybridization with positive controls with T1r3 or ure were adjusted for brightness and contrast for background gustducin antisense probes was done on taste tissue to ensure the standardization. hybridization worked properly. In addition, in situ hybridization experiments were done on positive control tissues to confirm the Cell Counting. Quantitative measurements were conducted to quality and specificity of the RNA probes (Fig. S1). determine the percentage of singly and doubly labeled type II (T1r3-GFP) and type III (SNAP-25) taste cells that coexpressed Immunohistochemistry. Standard immunohistochemical techni- GLUT4 or SUR1. Taste bud-containing sections were scanned ques were used. Briefly, frozen sections were rehydrated with under a 40× objective on the TCS SP2 Spectral Confocal Mi- PBS. Nonspecific binding was blocked with a blocking buffer croscope and magnified to yield a 100- to 150-μm2 area in which [3% (vol/vol) BSA, 0.3% Triton X-100, 2% (vol/vol) goat or donkey individual taste cells could be easily distinguished; only those serum in 1× PBS] at room temperature for 1–2 h. Sections were taste cells for which the entire cell bodies could be visualized incubated with primary antibody against rabbit anti-GLUT2 (1:150, were counted. For each taste-cell type, one to two sections of an sc-9117; Santa Cruz Biotechnology), rabbit anti-GLUT4 (1:150, entire CV papilla and two to three sections from foliate papillae ab33780; Abcam), rabbit anti-Kir6.1 (1:100, ab80972; Abcam), rab- were counted. bit anti-SGLT1 (1:150, ab14686; Abcam), rabbit anti-SUR1 (1:150, sc-25683; Santa Cruz Biotechnology), goat anti-lamin B (1:100, Electrophysiology. Taste buds from the fungiform papillae of WT sc6217; Santa Cruz Biotechnology), goat anti-GLAST1 (1:250, sc- C57BL/6 mice were isolated by well-established procedures (2). 7757; Santa Cruz Biotechnology), or mouse anti–SNAP-25 (1:250, Individual cells within the taste bud were recorded using con- MAB331; Chemicon) overnight at 4 °C in a humidified chamber. ventional whole-cell patch clamp conditions with borosilicate Afterthree15-minwasheswithPBST,slideswereincubatedfor patch pipettes pulled to a resistance of 4–10 MΩ when filled with 1 h at room temperature with one of the following fluorescent a standard intracellular solution of 140 mM K-gluconate, 1 mM secondary antibodies (1:500) in blocking buffer: Alexa448 donkey CaCl2, 2 mM MgCl2, 10 mM Hepes, and 11 mM EGTA (pH 7.2). anti-rabbit (Molecular Probes) for immunofluorescence of rabbit A nominally Ca2+-free extracellular solution containing 140 mM primaries and Alexa594 donkey anti-rabbit (Molecular Probes) for Na-gluconate, 5 mM KCl, 1 mM MgCl2, 10 mM Hepes, 10 mM immunofluorescence of rabbit primaries with sections from T1R3- glucose, 10 mM Na pyruvate, and 0.5 mM tetrodotoxin was used GFP mice. All double-immunofluorescent labeling was done with to isolate outward K+ currents during 0.4-s voltage steps from combinations of the secondary antibodies Alexa488 donkey anti- −80 to +40 mV in 10-mV increments. Glibenclamide (0.1–100 goat, Alexa 488 donkey anti-mouse, Alexa594 donkey anti-goat, or μM; Sigma) was added to this solution and bath-applied at a flow Alexa594 donkey anti-rabbit (1:500; all from Molecular Probes), rate of ∼4 mL/min, permitting solution change in less than 5 s. along with DAPI (1:1,000; Molecular Probes) to label cell nuclei. Series resistance and capacitance were optimally compensated Negative controls included the omission of primary antibody. GLUT for before recording, and no records were leak-subtracted. Cur- antibodies were also tested on positive control tissues (Fig. S3). rent data were recorded, and command potentials were delivered using pClamp software (v. 8-10) (Molecular Devices). This soft- Imaging. Bright-field images were visualized using either a Nikon ware was interfaced with an AxoPatch 200B amplifier and Dig- DXM 1200C digital camera attached to a Nikon Eclipse 80i idata 1322A data acquisition system (Molecular Devices).

1. Clapp TR, Medler KF, Damak S, Margolskee RF, Kinnamon SC (2006) Mouse taste cells 2. Baquero AF, Gilbertson TA (2010) Insulin activates epithelial sodium channel (ENaC) with G protein-coupled taste receptors lack voltage-gated calcium channels and SNAP- via phosphoinositide 3-kinase in mammalian taste receptor cells. Am J Physiol 25. BMC Biol 4:7. 10.1152/ajpcell.00318.2010.

Yee et al. www.pnas.org/cgi/content/short/1100495108 2of7 Fig. S1. In situ hybridization controls. Before use with taste bud-containing sections, all DIG-labeled antisense RNA probes were tested for positive expression in tissues known to express the genes of interest. Antisense probes (A, C, E, G, and I) demonstrated appropriate expression in pancreas (GLUT2, GLUT9, and SUR1), skeletal muscle (GLUT4), and small intestine (SGLT1). Sense probes (B, D, F, H, and J) were shown to have low nonspecific hybridization to these tissues. (Scale bars: 40 μm.)

Yee et al. www.pnas.org/cgi/content/short/1100495108 3of7 Fig. S2. Nuclear localization of SUR1. Indirect immunofluorescence confocal microscopy of taste bud-containing sections from mouse CV and foliate taste papillae was carried out with the nuclear stain DAPI (A, D, G, and J), antibodies against the KATP subunit SUR1 (B, E, H, and L), or the nuclear envelope marker lamin B (K). Overlaid images (C, F, I, and M) demonstrate that SUR1 expression in taste cells is in the nucleus; higher magnification images (G–M) indicate that SUR1 is internal to the taste-cell nuclear envelope. (Scale bars: A–F,20μm; G–M,2μm.)

Yee et al. www.pnas.org/cgi/content/short/1100495108 4of7 Fig. S3. Indirect immunofluorescence controls. Before use with taste bud-containing sections, all antibodies were tested for positive expression in tissues known to express the genes of interest. Antibodies demonstrated appropriate expression in pancreas (A, GLUT2; B, SUR1), skeletal muscle (D, GLUT4), and small intestine (F, SGLT1). Omission of the primary antibody (No 1°) demonstrated low nonspecific background from secondary antibodies with these tissues (C, E, and G) or with CV (H and I). Transmitted light images (J–M) are of the above tissues used for controls without primary antibodies. (Scale bars: 60 μm.)

Yee et al. www.pnas.org/cgi/content/short/1100495108 5of7 Fig. S4. GLUT4 and SUR1 are not widely expressed in type I or type III taste cells. Indirect immunofluorescence confocal microscopy of taste bud-containing sections from mouse CV taste papillae was carried out with antibodies against GLUT4 (A and G) and SUR1 (D, J, and M). Double-staining was carried out with antibodies or GFP to mark type I taste cells (anti-GLAST: B, C, E, and F), type III taste cells (anti–SNAP-25: H, I, K, and L), or type II (TrpM5-GFP: N and O) taste cells. Overlaid images indicate no coexpression in CV taste cells of GLUT4 with GLAST (C) or SNAP-25 (I) or of SUR1 with GLAST (F) and infrequent coexpression of SUR1 with SNAP-25 (J–L, arrows). In contrast, SUR1 in CV taste cells is mostly in the TrpM5-expressing type II taste cells (O). (Scale bars: 20 μm.)

Table S1. RT-PCR primer pairs Gene name Forward primer Reverse primer

GUSTDUCIN TGCACCTTAGCCACTTTCTCCTGGAA CCCCTGGGTACGTGCCAAATGA GAPDH CCTTCATTGACCTCAACTAC GGAAGGCCATGCCAGTGACC GLUT2 CGGTGGGACTTGTGCTGCTGG GTCTTTTGAGGAAATCGCTGCAG GLUT4 CCTGCCCGAAAGAGTCTAAAGC ACTAAGAGCACCGAGACCAACG GLUT8 ACTGGTTCATGGCCTTTCTAGTGAC CTTAAGAAGGAGACACCTGGGTCAG GLUT9B GACTCCTACTGCTTCCTCGTCTTC GCCAAAGATTAACAACAGGCATTT SGLT1 CTGTACCAACATCGCCTACC CCGTTGATGTTCACCACTGT SUR1 AGTGGGAAGTCCTCCTTCTCTCTC ACAGTACGAAACACTAGGCAAGCA SUR2A AGTGGAGTGTGATACTGGTCCAAAC TGGTCTACAGAGTGAGTTCCAGGAC SUR2B GATCGCACGGTCGTAACCATAGC CAACAGCAAGGTCATGCTAGTCTT KIR6.1 ACCAGAATTCTCTGCGGAAG GCCCTGAACTGGTGATGAGT KIR6.2 TTGGAAGGCGTGGTAGAAAC GGACAAGGAATCTGGAGAGAT INSR ATCTGGATCCCCCTGATAACTGTC ACAACAAAATCTTGGTTTGATACGG

Yee et al. www.pnas.org/cgi/content/short/1100495108 6of7 Table S2. Taqman probes Gene name Taqman probe ID

GUSTDUCIN Gnat3-Mm01165313_m1 GAPDH Gapdh-Mm99999915_g1 GLUT4 Slc2a4-Mm01245502_m1 GLUT8 Slc2a8-Mm00444634_m1 GLUT9 Slc2a9-Mm01211147_m1 SGLT1 Slc5a1-Mm01218040_m1 SUR1 Abcc8-Mm00803450_m1 SUR2 Abcc9-Mm00441638_m1 KIR6.1 Kcnj8-Mm00434620_m1 KIR6.2 Kcnj11-Mm00440050_s1 INSR Insr-Mm01211875_m1 T1R3 Tas1r3-Mm00473459_g1 PKD2L1 Pkd2l1-Mm00619572_m1

Yee et al. www.pnas.org/cgi/content/short/1100495108 7of7