DOCSLIB.ORG

In-Fusion Smarter Directional Cdna Library Construction Kit User Manual Table of Contents I

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
In-Fusion Smarter Directional Cdna Library Construction Kit User Manual Table of Contents I Takara Bio USA In-Fusion® SMARTer® Directional cDNA Library Construction Kit User Manual Cat. No. 634933 (050421) Takara Bio USA, Inc. 1290 Terra Bella Avenue, Mountain View, CA 94043, USA U.S. Technical Support: [email protected] United States/Canada Asia Pacific Europe Japan Page 1 of 40 800.662.2566 +1.650.919.7300 +33.(0)1.3904.6880 +81.(0)77.565.6999 In-Fusion SMARTer Directional cDNA Library Construction Kit User Manual Table of Contents I. List of Components .................................................................................................................................................. 4 II. Additional Materials Required .................................................................................................................................. 5 III. Introduction .......................................................................................................................................................... 6 IV. RNA Preparation & Handling ..............................................................................................................................11 A. Assessing the Quality of the RNA Template ........................................................................................................11 V. SMARTer cDNA Synthesis by LD-PCR .................................................................................................................13 A. Recommended Products ......................................................................................................................................13 C. Protocol: First-Strand cDNA Synthesis from More than 50 ng of RNA ................................................................14 D. Protocol: First-Strand cDNA Synthesis from Less than 50 ng of RNA .................................................................15 E. Protocol: ds cDNA Synthesis by LD-PCR using Advantage 2 Polymerase ...........................................................16 VI. ds cDNA Purification and Size Fractionation .......................................................................................................19 A. Protocol: CHROMA SPIN + TE-1000 Column Chromatography .........................................................................20 VII. In-Fusion Cloning of SMARTer ds cDNA into pSMART2IFD ............................................................................22 A. Protocol: In-Fusion Cloning ................................................................................................................................22 VIII. Transformation of Recombinant Plasmids into E. coli ..........................................................................................23 A. Protocol: Transformation into Electrocompetent E. coli .......................................................................................23 B. Pooling Transformation Mixes for Your Library ..................................................................................................24 IX. Titrating Plasmid Libraries ..................................................................................................................................25 A. Library Titration Precautions ...............................................................................................................................25 B. Protocol: Plasmid Library Titration......................................................................................................................25 X. Amplification of Plasmid Libraries ..........................................................................................................................26 A. Agar Plate Preparation for Amplification .............................................................................................................26 B. Protocol: Library Amplification ...........................................................................................................................27 XI. Troubleshooting Guide ........................................................................................................................................28 XII. References...........................................................................................................................................................32 Appendix A: Typical Results of PCR and ds cDNA Synthesis .........................................................................................33 Appendix B: pSMART2IFD Linearized Vector Map and In-Fusion Cloning Site ............................................................34 Appendix C: Protocol for Library Screening by PCR.......................................................................................................35 Appendix D: Preparing Your Vector for In-Fusion SMARTer cDNA Library Cloning ....................................................36 A. Primer Design .....................................................................................................................................................36 B. Protocol: Preparation of a Linearized Vector by PCR ...........................................................................................36 Appendix E: SMARTer ds cDNA Synthesis by LD-PCR using Advantage HD ...............................................................39 (050421) takarabio.com Page 2 of 40 Takara Bio USA, Inc. In-Fusion SMARTer Directional cDNA Library Construction Kit User Manual Table of Figures Figure 1. The In-Fusion SMARTer Directional cDNA Library Construction Kit includes a complete protocol for cDNA synthesis, library construction, and library amplification. ................................................................................................. 7 Figure 2. Flow chart of the In-Fusion SMARTer Directional cDNA Library Construction Kit protocol. ............................ 8 Figure 3. The In-Fusion SMARTer Directional cDNA Library Construction Kit allows you to quickly and efficiently transfer your gene into multiple expression systems via In-Fusion cloning.......................................................................10 Figure 4. Optimizing PCR parameters for SMARTer cDNA synthesis. ............................................................................18 Figure 5. Typical results: ds cDNA PCR product before (Lane 1) & after (Lane 2) size fractionation by the CHROMA SPIN +TE-1000 Column. ................................................................................................................................................19 Figure 6. CHROMA SPIN column and collection tubes. .................................................................................................19 Figure 7. Typical results: ds cDNA synthesized using the SMARTer control reagents and LD PCR protocol. ..................33 Figure 8. pSMART2IFD linearized vector map and In-Fusion Cloning site. ....................................................................34 Figure 9. How to simultaneously linearize your vector and introduce In-Fusion SMARTer sequences. ............................37 Figure 10. Preparation of a linearized vector by PCR. ......................................................................................................38 Table of Tables Table I. Guidelines for Setting Up PCR Reactions ...........................................................................................................16 Table II. Cycling Guidelines Based on Starting Material .................................................................................................17 Table III. Guidelines for Setting Up In-Fusion Cloning Reactions ...................................................................................22 Table IV. Guidelines for Setting Up Transformation Mixes .............................................................................................23 Table V. Guidelines for Setting Up PCR Reactions .........................................................................................................39 (050421) takarabio.com Page 3 of 40 Takara Bio USA, Inc. In-Fusion SMARTer Directional cDNA Library Construction Kit User Manual I. List of Components Store CHROMA SPIN Columns and Deionized H2O at room temperature. Store Control RNA and SMARTer II A Oligonucleotide at –70°C. Store all other reagents at –20°C. In-Fusion SMARTer PCR cDNA Synthesis Kit (Cat No. 634934; not sold separately) • 10 µl SMARTer V Oligonucleotide (12 µM) 5'–AAGCAGTGGTATCAACGCAGAGTAXXXXX–3' Rsa I (X = undisclosed base in the proprietary SMARTer oligo sequence) • 10 µl 3’ In-Fusion SMARTer CDS Primer (12 μM) 5’–CGGGGTACGATGAGACACCATTTTTTTTTTTTTTTTTTTTVN–3’ (N = A, C, G, or T; V = A, G, or C) • 12 µl SMARTScribe™ Reverse Transcriptase (100 units/µl) • 40 µl 5X First-Strand Buffer (RNase-Free) 250 mM Tris (pH 8.3) 30 mM MgCl2 375 mM KCl • 50 µl DTT (dithiothreitol; 100 mM) • 100 µl dNTP mix (dATP, dCTP, dGTP, dTTP; 10 mM each) • 10 µl RNase Inhibitor (40 U/µl) • 5 µl Control Mouse Liver Total RNA (1.0 µg/µl) • 200 µl 5' PCR Primer II A (12 µM) • 200 µl 3’ In-Fusion SMARTer PCR Primer (12 μM) 5’– CGGGGTACGATGAGACACCA-3’ • 200 µl Sodium Acetate (3 M; pH 4.8) • 100 µl Glycogen (20 µg/µl) • 1 ml Deionized H2O (Milli-Q-filtered, not DEPC-treated) • 30 ml 1X Fractionation Column Buffer 10 mM Tris (pH 7.4) 30 mM NaCl 0.5 mM EDTA (pH 7.4) • 20 CHROMA SPIN™ +TE-1000 Columns In-Fusion Snap Assembly Master Mix (Cat. No. 638948) • 100 µl 5X In-Fusion Snap Assembly Master Mix • 25 µl pUC19 Control Vector, linearized (50 ng/µl)
Load more

Recommended publications
  • Proquesttm Pre-Made Cdna Libraries
    Instruction Manual TM ProQuest Pre-made cDNA Libraries For detecting protein-protein interactions Version B December 12, 2002 25-0617 Table of Contents General Information ..............................................................2 Overview...............................................................................5 Using ProQuest™ Libraries....................................................8 pPC86.................................................................................13 pEXP-AD502.......................................................................15 Recipe.................................................................................17 Accessory Products ............................................................18 Purchaser Notification.........................................................19 Technical Service................................................................22 References..........................................................................24 1 General Information Contents 2 x 0.5 ml aliquots and Storage Each cDNA library is supplied in 80% SOB medium, 20% (v/v) glycerol. Store the library at -80°C. The cDNA library is stable for six months when stored properly. Titer of the Each library has greater than 5 x 109 cfu (colony Libraries forming units) derived from > 107 primary clones to ensure complete representation of rare sequences. ProQuest™ The following ProQuest™ Pre-made cDNA Libraries are Pre-made available from Invitrogen. For more information on cDNA preparing the library, see page
    [Show full text]
  • Library Construction and Screening
    Library construction and screening • A gene library is a collection of different DNA sequences from an organism, • which has beenAlso called genomic libraries or gene banks. • cloned into a vector for ease of purification, storage and analysis. Uses of gene libraries • To obtain the sequences of genes for analysis, amplification, cloning, and expression. • Once the sequence is known probes, primers, etc. can be synthesized for further diagnostic work using, for example, hybridization reactions, blots and PCR. • Knowledge of a gene sequence also offers the possibility of gene therapy. • Also, gene expression can be used to synthesize a product in particular host cells, e.g. synthesis of human gene products in prokaryotic cells. two types of gene library depending upon the source of the DNA used. 1.genomic library. 2.cDNA library Types of GENE library: • genomic library contains DNA fragments representing the entire genome of an organism. • cDNA library contains only complementary DNA molecules synthesized from mRNA molecules in a cell. Genomic Library : • Made from nuclear DNA of an organism or species. • DNA is cut into clonable size pieces as randomly possible using restriction endonuclease • Genomic libraries contain whole genomic fragments including gene exons and introns, gene promoters, intragenic DNA,origins of replication, etc Construction of Genomic Libraries 1. Isolation of genomic DNA and vector. 2.Cleavage of Genomic DNA and vector by Restriction Endonucleases. 3.Ligation of fragmented DNA with the vector. 4.Transformation of
    [Show full text]
  • Global Tissue-Specific Transcriptome Analysis of Citrus Sinensis
    www.nature.com/scientificdata opeN Global tissue-specifc transcriptome Data DeScrIpTor analysis of Citrus sinensis fruit across six developmental stages Received: 9 May 2019 Guizhi Feng, Juxun Wu & Hualin Yi Accepted: 23 July 2019 Published: xx xx xxxx Citrus sinensis fruit is a type of nonclimacteric fruit that mainly consists of four tissues: the epicarp, albedo, segment membrane and juice sac. The fruit quality is determined by the characteristics of these four tissues. However, our knowledge of the molecular processes that occur in these four tissues during citrus fruit development and ripening is limited. Tissue-specifc transcriptomes provide a comprehensive and detailed molecular regulatory network of citrus fruit development and ripening. In our study, we collected four types of tissue from C. sinensis fruits at six developmental stages. A total of 72 libraries were constructed from 24 samples (each sample had three replicates), and the transcriptomes were sequenced by an Illumina HiSeq 4000. The comprehensive analyses of the transcriptomes from the four tissues and six developmental stages presented here provide a valuable resource for the discovery of the molecular networks underlying citrus fruit development and ripening. Background & Summary Citrus, a nonclimacteric fruit, is widely cultivated worldwide. Citrus is mainly composed of the inedible epicarp (EP) and albedo (AL) and the edible segment membrane (SM) and juice sac (JS). Te development and ripening of citrus fruit is a complex and sophisticated regulatory process that can be divided into three stages: cell division stage; expansion stage involving cell enlargement and water, sugar accumulation; and ripening stage1. At present, most studies investigating citrus fruit development and ripening are based on the organ-wide or mixed-tissue level, which inevitably obscures many tissue-specifc phenomena.
    [Show full text]
  • Combinatorial Cdna Library by Complementation of an Auxotrophic Escherichia Coli: Antibodies for Orotate Decarboxylation JEFFREY A
    Proc. Natd. Acad. Sci. USA Vol. 91, pp. 8319-8323, August 1994 Biochemistry Selection of catalytic antibodies for a biosynthetic reaction from a combinatorial cDNA library by complementation of an auxotrophic Escherichia coli: Antibodies for orotate decarboxylation JEFFREY A. SMILEY AND STEPHEN J. BENKOVIC* Department of Chemistry, The Pennsylvania State University, University Park, PA 16802 Contributed by Stephen J. Benkovic, May 23, 1994 ABSTRACT Antibodies capable of decarboxylating oro- tate were sought by immunization with a hapten designed to elicit antibodies with combining sites that resemble the orotate- binding and catalytic portion of the active site of the enzyme OPRTase ODCase orotidine 5'-monophosphate (OMP) decarboxylase (orotidine- 0 '00 \\ 5'-monophosphate carboxy-lyase, EC 4.1.1.23). Active recom- binant antibody fragments (Fabs) were selected from a com- HN 'PO4 binatorial cDNA library by complementation of a pyrF strain UMP ofEscherichia cofl and growth ofthe library-expressing cells on pyrimidine-free medium. In this biological screen, a suffi- H " 0 ciently active antibody from the library would decarboxylate Antibody \ Urasi orotate to produce uracil, a pyrimidine source for the aux- Catalysis PRTase otroph, and would provide the cells with a growth advantage compared to cells without an active antibody. Six recombinant AN Fabs yielded identifiable colonies in a screen of 16,000 trans- H formants. To enhance its stability and expression level, one of the six positive fragments was converted into single-chain form. FIG. 1. Pathways for UMP biosynthesis. Upper route involves In this form, the antibody a naturally occurring enzymes orotate phosphoribosyltransferase fragment conferred definite growth (OPRTase) and OMP decarboxylase (ODCase).
    [Show full text]
  • Efficient PCR Approach for the Selection of Cdnas Encoded In
    Proc. Nati. Acad. Sci. USA Vol. 88, pp. 9623-9627, November 1991 Genetics cDNA selection: Efficient PCR approach for the selection of cDNAs encoded in large chromosomal DNA fragments (yeast artificial chromosomes/cosmids/major histocompatibility complex) SATISH PARIMOO*t, SANKHAVARAM R. PATANJALI*, HRIDAYABHIRANJAN SHUKLA*, DAVID D. CHAPLIN*, AND SHERMAN M. WEISSMAN* *Department of Genetics, Yale University School of Medicine, 333 Cedar Street, New Haven, CT 06510; and tDepartment of Internal Medicine and Howard Hughes Medical Institute, Washington University School of Medicine, St. Louis, MO 63110 Contributed by Sherman M. Weissman, July 24, 1991 ABSTRACT Identification of coding segments in large B30H3, isolated by one of us (D.D.C.; ref. 20), encompasses fragments of genomic DNA is a recurrent problem in genome a 320-kilobase (kb) region from the human major histocom- mapping and positional cloning studies. We have developed a patibility complex (MHC) class I HLA-A locus. Yeast chro- rapid and efficient protocol to achieve this goal, based on mosomes from agarose plugs were fractionated by 1% aga- hybridization of cDNA fragments to immobilized DNA and rose contour-clamped homogeneous electric field gel elec- recovery of the selected cDNAs by the PCR. The procedure trophoresis (21) in 0.5x TBE (45 mM Tris HCl, pH 8.3/45 permits rapid cloning of cDNA fragments encoded by large mM boric acid/0.2 mM EDTA) at 14'C for 45 hr at 150 V/cm genomic DNA fragments, groups of yeast artificial chromo- with a switching interval of 30 sec in an LKB Pulsaphor somes, or cosmids and has the potential to directly enrich apparatus.
    [Show full text]
  • Manual: Lambda ZAP-CMV XR Library Construction
    Lambda ZAP-CMV XR Library Construction Kit INSTRUCTION MANUAL Catalog #200448 BN #200448-12 Revision A.01 For In Vitro Use Only 200448-12 LIMITED PRODUCT WARRANTY This warranty limits our liability to replacement of this product. No other warranties of any kind, express or implied, including without limitation, implied warranties of merchantability or fitness for a particular purpose, are provided by Agilent. Agilent shall have no liability for any direct, indirect, consequential, or incidental damages arising out of the use, the results of use, or the inability to use this product. ORDERING INFORMATION AND TECHNICAL SERVICES United States and Canada Agilent Technologies Stratagene Products Division 11011 North Torrey Pines Road La Jolla, CA 92037 Telephone (858) 373-6300 Order Toll Free (800) 424-5444 Technical Services (800) 894-1304 Internet [email protected] World Wide Web www.stratagene.com Europe Location Telephone Fax Technical Services Austria 0800 292 499 0800 292 496 0800 292 498 Belgium 00800 7000 7000 00800 7001 7001 00800 7400 7400 0800 15775 0800 15740 0800 15720 France 00800 7000 7000 00800 7001 7001 00800 7400 7400 0800 919 288 0800 919 287 0800 919 289 Germany 00800 7000 7000 00800 7001 7001 00800 7400 7400 0800 182 8232 0800 182 8231 0800 182 8234 Netherlands 00800 7000 7000 00800 7001 7001 00800 7400 7400 0800 023 0446 +31 (0)20 312 5700 0800 023 0448 Switzerland 00800 7000 7000 00800 7001 7001 00800 7400 7400 0800 563 080 0800 563 082 0800 563 081 United Kingdom 00800 7000 7000 00800 7001 7001 00800 7400 7400 0800 917 3282 0800 917 3283 0800 917 3281 All Other Countries Please contact your local distributor.
    [Show full text]
  • Full-Length Mrna Sequencing Reveals Principles of Poly(A) Tail Length Control
    bioRxiv preprint doi: https://doi.org/10.1101/547034; this version posted February 11, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Full-length mRNA sequencing reveals principles of poly(A) tail length control Ivano Legnini*,1, Jonathan Alles*,1, Nikos Karaiskos1, Salah Ayoub1 and Nikolaus Rajewsky1,$ Laboratory for Systems Biology of Gene Regulatory Elements, Berlin Institute for Medical Systems Biology (BIMSB), Max Delbrück Center for Molecular Medicine, Robert-Rössle Str 10, Berlin-Buch, Germany * eQual contribution $ correspondence to [email protected] Summary Although mRNAs are key molecules for understanding life, there exists no method to determine the full-length seQuence of endogenous mRNAs including their poly(A) tails. Moreover, although poly(A) tails can be modified in functionally important ways, there also exists no method to accurately seQuence them. Here, we present FLAM-seQ, a rapid and simple method for high-Quality seQuencing of entire mRNAs. We report a cDNA library preparation method coupled to single-molecule seQuencing to perform FLAM-seQ. Using human cell lines, brain organoids, and C. elegans we show that FLAM-seQ delivers high-Quality full-length mRNA seQuences for thousands of different genes per sample. We find that (a) 3’ UTR length is correlated with poly(A) tail length, (b) alternative polyadenylation sites and alternative promoters for the same gene are linked to different tail lengths, (c) tails contain a significant number of cytosines. Thus, we provide a widely useful method and fundamental insights into poly(A) tail regulation.
    [Show full text]
  • DNA Libraries (PART-I)
    NPTEL – Biotechnology – Fundamentals of Biotechnology Lecture 10: DNA Libraries (PART-I) Introduction-Gene sequence are arranged in genome in a randon fashion and selecting or isolating a gene is a big task especially when the genomic sequences are not known. A small portion of genome is transcribed to give mRNA where as a major portion remained untranscribed. Hence, there are two ways to represent a genomic sequence information into the multiple small fragments in the form of a library: (1) Genomic library (2) cDNA library. Preparation of Genomic Library-A genomic library represents complete genome in multiple clones containing small DNA fragments. Depending upon organism and size of genome, this library is either prepared in a bacterial vector (discussed later in future lectures) or in yeast artificial chromosome (YAC). An outline of the construction of genomic library is given in Figure 10.1. it has following steps: 1. Isolation of genomic DNA 2. Generation of suitable size DNA fragments 3. Cloning in suitable vector system (depending on size) 4. Transformation in suitable host . Joint initiative of IITs and IISc – Funded by MHRD Page 1 of 65 NPTEL – Biotechnology – Fundamentals of Biotechnology Figure 10.1: Contruction of Genomic library. Joint initiative of IITs and IISc – Funded by MHRD Page 2 of 65 NPTEL – Biotechnology – Fundamentals of Biotechnology 1. Isolation of genomic DNA- Isolation of genomic DNA has following steps: 1. Lysis of cells with detergent containing lysis buffer. 2. Incubation of cells with digestion buffer containing protease-K, SDS to release genomic DNA from DNA-protein complex. 3. Isolation of genomic DNA by absolute alchol precipitation.
    [Show full text]
  • Human Thrombomodulin Gene Is Intron Depleted
    Proc. Natl. Acad. Sci. USA Vol. 84, pp. 6425-6429, September 1987 Biochemistry Human thrombomodulin gene is intron depleted: Nucleic acid sequences of the cDNA and gene predict protein structure and suggest sites of regulatory control (protein C/coated-pit receptors/endothelial cell) ROBERT W. JACKMAN*, DAVID L. BEELER*, LINDA FRITZE*t, GERALD SOFF*t, AND ROBERT D. ROSENBERG*t *Department of Biology and Whitaker College, Massachusetts Institute of Technology, Cambridge, MA 02139; and tthe Department of Medicine, Harvard Medical School and the Beth Israel Hospital, Boston, MA 02215 Communicated by Phillips W. Robbins, June 19, 1987 ABSTRACT We have isolated a human thrombomodulin METHODS cDNA, and a human genomic clone containing the putative promoter domain, as well as the translated and untranslated Screening of Human cDNA and Genomic Libraries. The regions of the endothelial cell receptor. The nucleotide se- human cDNA and genomic libraries were screened (3) on quence of the thrombomodulin cDNA allows us to provide a Escherichia coli Y 1088 or LE 392 (cDNA library), and LE complete picture of the structure of this endothelial cell 392 (genomic library) with Colony Plaque Screen (New receptor, and to confirm its homology to the human low density England Nuclear) according to the following modifications of lipoprotein receptor. The nucleotide sequence of the thrombo- the manufacturer's instructions. The filters were lifted in modulin gene suggests areas within the putative promoter duplicate, air-dried, autoclaved for 1 min, air-dried again, and domain that may be critical for regulating expression of the then baked at 80°C for 1 hr (4).
    [Show full text]
  • Sequencing of First-Strand Cdna Library Reveals Full-Length
    ARTICLE Received 20 Mar 2014 | Accepted 2 Dec 2014 | Published 21 Jan 2015 DOI: 10.1038/ncomms7002 Sequencing of first-strand cDNA library reveals full-length transcriptomes Saurabh Agarwal1, Todd S. Macfarlan2, Maureen A. Sartor3 & Shigeki Iwase1 Massively parallel strand-specific sequencing of RNA (ssRNA-seq) has emerged as a powerful tool for profiling complex transcriptomes. However, many current methods for ssRNA-seq suffer from the underrepresentation of both the 50 and 30 ends of RNAs, which can be attributed to second-strand cDNA synthesis. The 50 and 30 ends of RNA harbour crucial information for gene regulation; namely, transcription start sites (TSSs) and polyadenylation sites. Here we report a novel ssRNA-seq method that does not involve second-strand cDNA synthesis, as we Directly Ligate sequencing Adaptors to the First-strand cDNA (DLAF). This novel method with fewer enzymatic reactions results in a higher quality of the libraries than the conventional method. Sequencing of DLAF libraries followed by a novel analysis pipeline enables the profiling of both 50 ends and polyadenylation sites at near-base resolution. Therefore, DLAF offers the first genomics tool to obtain the ‘full-length’ transcriptome with a single library. 1 Department of Human Genetics, University of Michigan, Ann Arbor, Michigan 48109, USA. 2 Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, Maryland 20892, USA. 3 Department of Computational Medicine and Bioinformatics, University of Michigan, Ann Arbor, Michigan 48109, USA. Correspondence and requests for materials should be addressed to S.I. (email: [email protected]). NATURE COMMUNICATIONS | 6:6002 | DOI: 10.1038/ncomms7002 | www.nature.com/naturecommunications 1 & 2015 Macmillan Publishers Limited.
    [Show full text]
  • SMART™ Cdna Library Construction Kit User Manual
    User Manual SMART™ cDNA Library Construction Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Cat. No. 634901 Clontech Laboratories, Inc. PT3000-1 (PR043527) A Takara Bio Company 1290 Terra Bella Ave. Published May 2010 Mountain View, CA 94043 Technical Support (US) E-mail: [email protected] www.clontech.com SMART™ cDNA Library Construction Kit User Manual Table of Contents I. Introduction 4 II. List of Components 9 III. Additional Materials Required 12 IV. General Considerations 15 V. SMART cDNA Synthesis by LD PCR 18 A. First-Strand cDNA Synthesis 18 B. cDNA Amplification by LD PCR 19 C. Proteinase K Digestion 21 D. SfiI Digestion 21 E. cDNA Size Fractionation by CHROMA SPIN-400 22 VI. SMART cDNA Synthesis by Primer Extension 24 A. First-Strand cDNA Synthesis 24 B. ds cDNA Synthesis by Primer Extension 25 C. Proteinase K Digestion 26 D. SfiI Digestion 27 E. cDNA Size Fractionation by CHROMA SPIN-400 27 VII. SMART cDNA Library Protocols 30 A. Ligation of cDNA to λTriplEx2 Vector 30 B. Bacterial Culture Plating 31 C. Titering the Unamplified Library 32 D. Determining the Percentage of Recombinant Clones 33 E. Library Amplification 34 F. Titering the Amplified Library 35 VIII. Troubleshooting Guide 37 IX. References 42 Appendix A: Typical Results of ds cDNA Synthesis 43 Appendix B: Converting λTriplEx2 to pTriplEx2 45 Appendix C: Restriction Map of λTriplEx2 48 Clontech Laboratories, Inc. www.clontech.com Protocol No. PT3000-1 2 Version No.
    [Show full text]
  • "RNA-Seq: a Method for Comprehensive Transcriptome
    RNA-Seq: A Method for Comprehensive UNIT 4.11 Transcriptome Analysis Ugrappa Nagalakshmi,1 Karl Waern,1 and Michael Snyder1 1Molecular, Cellular, and Developmental Biology Department, Yale University, New Haven, Connecticut ABSTRACT A recently developed technique called RNA Sequencing (RNA-Seq) uses massively parallel sequencing to allow transcriptome analyses of genomes at a far higher resolution than is available with Sanger sequencing- and microarray-based methods. In the RNA- Seq method, complementary DNAs (cDNAs) generated from the RNA of interest are directly sequenced using next-generation sequencing technologies. The reads obtained from this can then be aligned to a reference genome in order to construct a whole- genome transcriptome map. RNA-Seq has been used successfully to precisely quantify transcript levels, conÞrm or revise previously annotated 5 and 3 ends of genes, and map exon/intron boundaries. This unit describes protocols for performing RNA-Seq using the Illumina sequencing platform. Curr. Protoc. Mol. Biol. 89:4.11.1-4.11.13. C 2010 by John Wiley & Sons, Inc. Keywords: RNA-Seq r transcriptome r high-throughput sequencing r gene expression r annotation r cDNA library preparation INTRODUCTION The transcriptome is the complete set of transcripts in a cell, both in terms of type and quantity. Various technologies have been developed to characterize the transcriptome of a population of cells, including hybridization-based microarrays and Sanger sequencing– based methods (Yamada et al., 2003; Bertone et al., 2004; David et al., 2006). The advent of high-throughput sequencing–based methods has changed the way in which transcriptomes are studied. RNA sequencing (RNA-Seq) involves direct sequencing of complementary DNAs (cDNAs) using high-throughput DNA sequencing technologies followed by the mapping of the sequencing reads to the genome.
    [Show full text]