VECTOR-BORNE AND ZOONOTIC DISEASES Volume XX, Number XX, 2018 ª Mary Ann Liebert, Inc. DOI: 10.1089/vbz.2018.2341

A Tale of Two Valleys: Disparity in Sin Nombre Antibody Reactivity Between Neighboring Mojave Desert Communities

Risa Pesapane,1 Barryett Enge,2,* Austin Roy,3,{ Rebecca Kelley,4 Karen Mabry,4 Brian C. Trainor,5 Deana Clifford,3 and Janet Foley1

Abstract

Introduction: Hantaviruses are a group of globally distributed -associated , some of which are responsible for human morbidity and mortality. Sin Nombre , a particularly virulent species of hantavirus associated with spp. mice, is actively monitored by the Department of in California (CDPH). Recently, CDPH documented high (40%) seroprevalence in a potentially novel reservoir species, the cactus mouse (Peromyscus eremicus) in Death Valley National Park. Methods: This study was performed in the extremely isolated Mojave Desert Amargosa River valley region of southeastern Inyo County, California, 105 km from Death Valley, approximately over the same time interval as the CDPH work in Death Valley (between 2011 and 2016). Similar rodent species were captured as in Death Valley and were tested for select hantaviruses using serology and RT-PCR to assess risk to human health and the conservation of the endemic endangered Amargosa vole. Results: Among 192 tested, including 56 Peromyscus spp., only one seropositive harvest mouse (Reithro- dontomys megalotis) was detected. Discussion: These data highlight the heterogeneity in the prevalence of hantavirus even among nearby desert communities and suggest that further studies of hantavirus persistence in desert environments are needed to more accurately inform the risks to public health and wildlife conservation.

Keywords: Amargosa, California, hantavirus, , public health, wildlife conservation, zoonotic disease

Introduction (Peromyscus maniculatus) and at least some populations of cactus mice (Peromyscus eremicus) are reservoirs for Sin antaviruses are important sources of morbidity Nombre orthohantavirus (SNV) (Childs et al. 1994, Burns

Downloaded by Uc Davis Libraries University of California from www.liebertpub.com at 01/22/19. For personal use only. Hand mortality in people and nonhuman , and et al. 2018). Humans who come in contact with rodent urine, should be evaluated when studying pathogens in small mam- feces, or saliva containing SNV may develop hantavirus mal communities. Our ongoing study of disease in a remote pulmonary syndrome, which has a 36% fatality rate (CDC Mojave Desert is expanded to assess hantavirus in 2016). Other types of hantaviruses that circulate in California multiple small . Hantaviruses (: Han- rodents include El Moro Canyon orthohantavirus (EMCV) in taviridae) comprise numerous species, each associated with a western harvest mice ( megalotis) (Hjelle specific rodent host, although spillover among sympatric et al. 1994) and Isla Vista virus (ILV) in California voles rodents occurs (Mills et al. 2010). North American deer mice (Microtus californicus) (Song et al. 1995), although it was

1Department of Medicine and Epidemiology, School of Veterinary Medicine, University of California, Davis, Davis, California. 2California Department of Public Health, Viral and Rickettsial Disease Laboratory, Richmond, California. 3California Department of Fish and Wildlife, Wildlife Investigations Lab, Rancho Cordova, California. 4Department of Biology, New Mexico State University, Las Cruces, New Mexico. 5Department of Psychology, University of California, Davis, Davis, California. *Retired. {Current affiliation: Department of Biological Sciences, University of Texas at El Paso, 500W University, El Paso, Texas.

1 2 PESAPANE ET AL.

recently recommended that ILV no longer be listed as a traps (HB Sherman, Tallahassee, FL) baited with oats, peanut distinct species (Briese et al. 2016). butter, and apples in grids as previously described (Klinger The Amargosa River valley region is an ecologically im- et al. 2015, Foley et al. 2016) unless marshes were particu- portant understudied part of California, where increasing larly linear in which case the grid geometry was adjusted to ecotourism in the towns of Shoshone and Tecopa Hot Springs reflect the geometry of the marsh. A subset of rodents cap- in Inyo County potentially increases the risk for pathogen tured from 11 marshes between December 2011 and May exchange (Pesapane et al. 2013) if SNV prevalence in res- 2016, plus an additional nine carcasses (seven P. eremicus ervoir species is demonstrated. In this region, north–south and two Neotoma lepida) from residences provided by mountain ranges divide the Mojave Desert into arid alkaline community members in Shoshone were included in this valleys and desert pockets except where the Amargosa River study. These 11 marshes make up at least 56% of all vole- surfaces creating wetland oases surrounded by alkali scrub occupied habitat (Foley et al. 2016), are distributed among the and harsh desert playa. Amargosa marshes provide essential northern, middle, and southern range, including isolated island habitat for modest populations of humans, rodents, birds, patches, and represent both rural and residential-adjacent veg- amphibians, and reptiles. There are few permanent residents etation patches as well as areas that might be preferred by in Shoshone and Tecopa Hot Springs (31 and 150 people, re- Peromyscus species. The number of trap nights for trapping spectively, with <10 people/mi2) (U.S. Census 2010). Bui- conducted between December 2011 and March 2013 of this ldings are sparse, but these man-made structures can act as study was not available. Trap success for each species was, refugia for peridomestic wildlife or offer additional resources therefore, based on trapping conducted between November favoring wildlife population growth, particularly in harsh 2013 and May 2016 and calculated by multiplying the number environments, and subsequently increase the opportunity for of traps deployed per night by the number of nights in a sampling human–wildlife contact (Kuenzi et al. 2001). Some species event for a total sum of 6207 trap nights during this period alone. known to harbor hantaviruses are broadly distributed in the Data were collected on the species, age, body mass, gender, Amargosa River valley region, such as deer mice, cactus and reproductive status of captured rodents. Each rodent was mice, and harvest mice, whereas others, such as the endan- given a uniquely numbered ear tag (1005-1 Monel; National gered Amargosa vole (M. californicus scirpensis), are highly Band and Tag Co., Newport, KY) and only sampled once. For restricted geographically (Cudworth and Koprowski 2010). serology, blood samples were collected by retro-orbital bleeding In contrast to SNV, EMCV and ILV are not known to be using a heparinized capillary tube into BD Microtainer tubes pathogenic in humans, but because hantaviruses may also with EDTA (Becton Dickson, Franklin Lakes, NJ). For PCR, affect rodent fitness (Douglass et al. 2001, 2007, Kallio et al. rodents (except endangered voles) were euthanized using 2007), the presence of these viruses in ecological commu- 100 mg/kg ketamine:10 mg/kg xylazine, and >100 mg/kg pen- nities could compound challenges facing endangered rodents tobarbital followed by cervical dislocation. Sampling was such as the Amargosa vole. conducted with permission from the California Department of EMCV and ILV are rarely assessed in rodent communities, Fish and Wildlife, U.S. Fish and Wildlife Service, Bureau of but SNV is actively monitored by the Department of Public Land Management, and UC Davis IACUC (agency permits Health in California (CDPH) because of its importance to TE54614A-1 and SC-000854; IACUC protocol 19905). public health. SNV-reactive antibodies are common in rodent Blood samples were submitted to the CDPH Viral and communities of the southwestern U.S. (Mills et al. 1997), and Rickettsial Disease Laboratory (VRDL) for screening for IgG Inyo County had a >21% prevalence among P. maniculatus in response to SNV using an enzyme-linked immunosorbent and >6% across all Peromyscus species from 2007 to 2016 assay (ELISA) (Ksiazek et al. 1995). This SNV ELISA reacts (CDPH 2016), although prevalence varies across the het- with antibodies against several New World hantaviruses erogeneous landscape (Jay et al. 1997, Mills et al. 1997). (notably Sin Nombre, El Moro Canyon, and Isla Vista) Inyo is the second largest county in California and the ninth (CDPH 2013). largest in the United States, including the lowest point of Kidney tissue (25 mg) was extracted for PCR using the elevation in the United States (Badwater basin, 86 meters DNeasy Kit (Qiagen, Valencia, CA) following manufac- below sea level) and the highest (Mount Whitney, 4421 turer’s instructions. Immediately after extraction, RNA was meters above sea level). From 2010 to 2011, CDPH detected reverse transcribed and amplified using the Titan One Tube a 40% prevalence of antibody reactive with SNV among RT-PCR System (Sigma-Aldrich, St. Louis, MI) with Downloaded by Uc Davis Libraries University of California from www.liebertpub.com at 01/22/19. For personal use only. cactus mice in Death Valley National Park (DVNP) and the primers SNV-F (CAGCTGTGTCTGCATTGGAGAC) and species was confirmed to be SNV through nucleic acid se- SNV-R (TARAGYCCGATGGATTTCCAATCA) (Kramski quencing (Burns et al. 2018). However, rodents in the et al. 2007), and then visualized on a 1% agarose gel. As a Amargosa River valley have not been assessed for SNV even positive control, 9.10E+10 copies of a gBlock gene fragment though this region is near Death Valley, is a target for eco- (Integrated DNA Technologies, Skokie, IL) consisting of tourism, and has SNV reservoirs. In this study, we report the nucleotides 176–425 of the SNV nucleocapsid protein gene results of serological and PCR assays for hantavirus from a (GenBank ID: L25784.1) were used. neighboring rodent community that differ greatly from the Prevalence and 95% confidence intervals were calculated findings in DVNP. with the function prop.test in R (v. 3.3.1, R Core Team 2016). We compared Amargosa data from 2011 to 2016 with data on SNV test results from neighboring DVNP from 2010 to 2013 Materials and Methods provided by CDPH (Joseph Burns, pers. comm.) and with Rodents from marshes in Tecopa Hot Springs (3585202000N, statewide data from 2010 to 2016 CDPH annual reports. The 11681305700W) and Shoshone (3585802300N, 1168160 same serological diagnostic tests were performed by CDPH 1600W), California were trapped (Fig. 1) using Sherman live across all three data sets. DISPARITY IN SIN NOMBRE VIRUS IN THE MOJAVE DESERT 3

FIG. 1. Hantavirus sampling sites in the Amargosa valley and Death Valley regions of southeast Inyo County, California. Ro- dents sampled in this study in the AMACEC andthosesampledbyJoeBurnsattheCal- iforniaDepartmentofPublicHealthinareas run by the DVNPS are shown in relation to topography in the Mojave Desert. An inset of Inyo County, California, is included for geographical reference. AMACEC, Amargo- sa Area of Critical Environmental Concern; DVNPS, Death Valley National Park Service.

Table 1. Serologic and PCR Evidence of Sin Nombre Orthohantavirus Infection in Rodents 2010–2016 Death Valley National Park, California, Amargosa River valley, 2011–2016a 2010–2013b 2010–2016c Serology RT-PCR Trap successd Serology Prev. Serology Prev. Rodent species n (pos) n (pos)Prev. (%) (per 100 nights) n (pos) (%) n (pos) (%) Downloaded by Uc Davis Libraries University of California from www.liebertpub.com at 01/22/19. For personal use only. Microtus spp. 46 (0) 1 (0) 0 6.38 — — 75 (22) 30.5 Peromyscus maniculatus 2 (0) 3 (0) 0 0.08 6 (2) 33.3 3129 (254) 8.1 Peromyscus eremicus 14 (0) 37 (0) 0 1.80 112 (41) 37.5 771 (45) 5.8 Reithrodontomys megalotis 9 (1) 30 (0) 11.1 2.21 — — 517 (48) 9.3 Mus musculus — 28 (0) 0 2.85 — — — — Neotoma spp. — 22 (0) 0 0.52 9 (1) 11.1 225 (2) <1

SNV antigen in the serologic assay can cross-react with antibodies to several New World hantaviruses (notably EMCV and ILV). Data shown as number sampled and positives in parenthesis. aData from this study. Serology completed by the California Department of Public Health, Viral and Rickettsial Disease Laboratory. RT- PCR conducted at UC Davis. bData from trapping conducted by the California Department of Public Health Viral and Rickettsial Disease Laboratory in Death Valley National Park from 2010 to 2013 (Joseph Burns, pers. comm.), partially published in Burns et al. 2018. cData summarized from California Department of Public Health Vector-Borne Disease Section Annual Reports 2010–2016. dBased on trapping conducted between November 2013 and May of 2016. EMCV, El Moro Canyon orthohantavirus; ILV, Isla Vista virus; n, number of samples; pos, positive; prev., prevalence; SNV, Sin Nombre orthohantavirus. 4 PESAPANE ET AL.

Results sufficiently small (Calisher et al. 2005, Luis et al. 2015). The In the Amargosa River valley from December 2011 to Jan- habitat patches in the Amargosa River valley are indeed uary 2014, 71 blood samples from deer mice, cactus mice, and ecological islands surrounded by harsh desert landscapes, Amargosa voles were antibody negative, whereas one harvest which may be small enough that hantavirus cannot be mouse was antibody positive (11% prevalence, 95% CI 0–49.3 maintained. Other factors that could account for the dis- among harvest mice) (Table 1). From May 2014 to May 2016, crepancy, even with the presence of the same rodent species, 121 kidney samples from five rodent species, including those between Amargosa where there is no SNV and DVNP where from community residences, were PCR negative (Table 1). it is abundant, include population demographics and envi- ronmental attributes that influence food resources and virus persistence (Mills et al. 2010, Gorosito and Douglass 2017). Discussion

Serological assays for hantaviruses detect antibodies gen- Conclusion erated by hosts in response to exposure to a broad range of hantavirus species associated with human disease and, for- Our findings emphasize how landscape heterogeneity can tuitously, also detect species known only to occur in rodents. drive variability in pathogen prevalence. Although there is no Based on rodent community composition at our study site in evidence of hantavirus in the towns of Shoshone and Tecopa the Amargosa River valley, we could expect to detect SNV, Hot Springs at this time, it is not known whether infected EMCV, or the hantavirus species associated with Microtus rodents dispersing from the neighboring DVNP region could previously known as ILV. Although antibodies reactive to reintroduce hantavirus to the Amargosa River valley. Pa- SNV have been detected in harvest mice (Mills et al. 1997), thogen surveillance in wildlife is an important tool for the the single SNV-antibody reactive harvest mouse in this study prevention of human morbidity and mortality related to was presumably the result of cross-reactivity due to infection zoonotic diseases. Our results highlight the importance of with EMCV for which harvest mice are the reservoir (Cal- evaluating hantaviruses across heterogeneous landscapes as isher et al. 2005), because spillover of SNV was unlikely opposed to county lines. Because hantaviruses, specifically given the consistently low numbers of deer mice sampled at the pathogenic variant SNV, fluctuate with environmental these locations. Unfortunately, no additional sample was and ecological interactions, longitudinal assessments with available from this individual for molecular analysis to con- consistent sampling as discussed in Douglass and Vadell clusively determine the viral species. (2016) are also recommended to accurately reflect current None of our Amargosa voles were SNV-antibody reactive threat of spillover to humans. Furthermore, considering stud- compared with 30.5% prevalence of SNV-antibody-reactive ies that suggest there are fitness costs such as reduced re- Microtus spp. throughout the state from 2010 to 2016 (Table 1). production for those that seroconvert (Douglass et al. 2001, The absence of SNV-reactive antibodies in Amargosa voles 2007, Kallio et al. 2007), monitoring the prevalence of han- suggests that exposure to endemic hantaviruses occurs rarely, if taviruses in threatened and endangered rodent populations is at all, in these voles, and the potential for deleterious effects important for informing management decisions. Under- associated with hantavirus infection in this endangered species standing not only local disease risk but also the regional is likely minimal. context could contribute to an improved understanding of the House mouse blood from the Amargosa River valley had interdependent human–– of no detectable SNV antibodies in agreement with other Cali- Mojave Desert systems. fornia studies (Otteson et al. 1996, Bennett et al. 1999). Al- though Old World hantavirus-positive house mice have been Acknowledgments described (Diglisic et al. 1994), neither the serological nor We thank Susan Sorrells from Shoshone Village, and Chris molecular assay used in our study would have detected ex- Otahal, Russ Scofield, and Brian Croft for logistical support. posure to Old World hantaviruses. Amanda Poulsen and Caitlin Ott-Conn provided field and Although deer mice are documented reservoirs of SNV and laboratory assistance. Hantavirus data sets from Inyo County the cactus mice population just across the Amargosa Moun- were generously provided by Joseph Burns and details on tains had 40% prevalence (Burns et al. 2018), our study found serology methodology by Kristina Hsieh, from the Ontario no evidence of SNV in Peromyscus spp. from the Amargosa

Downloaded by Uc Davis Libraries University of California from www.liebertpub.com at 01/22/19. For personal use only. and Richmond, CA offices of CDPH, respectively. Funding River valley. Although CDPH annual reports indicate a 5.8% was provided by the Bureau of Land Management, the Cal- seroprevalence in cactus mice statewide from 2010 to 2016 ifornia Department of Fish and Wildlife, and the National (Table 1), that would include the 40 seropositive cactus mice Science Foundation Graduate Fellowship Program for R.R.P. reported in DVNP. Thus, we can conclude that the sero- prevalence of cactus mice at all other locations in California was just 5/671 (0.7%) and that our results in the Amargosa Author Disclosure Statement reflect the overall limited number of SNV-antibody reactive No competing financial interests exist. The findings and cactus mice in the state. These findings lend support to the conclusions in this report are those of the authors and do not novelty of the DVNP location or the cactus mouse population necessarily represent the views of the California Department at that site. of Public Health. Although our limited sampling of the primary SNV res- ervoir, and potential secondary reservoir, yielded no evidence of SNV in the Amargosa River valley, endemic hantaviruses References can disappear from rodent populations in isolated or frag- Bennett SG, Webb Jr JP, Madon MB, Childs JE, et al. Hanta- mented habitats or even large patches when populations are virus (Bunyaviridae) in rodents from Orange and DISPARITY IN SIN NOMBRE VIRUS IN THE MOJAVE DESERT 5

San Diego counties, California. Am J Trop Med Hyg 1999; mouse Reithrodontomys megalotis. J Virol 1994; 68:6751– 60:75–84. 6754. Briese T, Alkhovsky S, Beer M, Calisher CH, et al. 2016. ICTV Jay M, Ascher M, Chomel B. Seroepidemiologic studies of taxonomic proposal 2016.023a-cM.A.v2.Hantavirus_sprev. hantavirus infection among wild rodents in California. Emerg In the genus Hantavirus, create 24 species and abolish 7 spe- Infect Dis 1997; 3:183–190. cies; change the genus name to Orthohantavirus and rename its Kallio E, Voutilainen L, Vapalahti O, Vaheri A, et al. Endemic constituent species similarly. www.ictv.global/proposals-16/ hantavirus infection impairs the winter survival of its rodent 2016.023a-cM.A.v2.Hantavirus_sprev.pdf. (accessed 12 Au- host. Ecology 2007; 88:1911–1916. gust 2018). Klinger R, Cleaver M, Anderson S, Maier, et al. Implications of Burns J, Metzger C, Fritz C, Vilcins I, et al. A novel focus of scale-independent habitat specialization on persistence of a Sin Nombre Virus in Peromyscus eremicus in Death Valley rare small . Global Ecol Conserv 2015; 3:100–114. National Park, California. Emerg Infect Dis 2018; 24:1112– Kramski M, Meisel H, Klempa B, Kru¨ger D, et al. Detection 1115. and typing of human pathogenic hantaviruses by real-time Calisher C, Mills J, Reeder S, Root J, et al. Epizootiology of Sin reverse transcription-PCR and pyrosequencing. Clin Chem Nombre and El Moro Canyon hantaviruses, southeastern 2007; 53:1899–1905. Colorado, 1995–2000. J Wildl Dis 2005; 41:1–11. Ksiazek T, Peters C, Rollin P, Zaki S, et al. Identification of a [CDC] Centers for Disease Control and Prevention. Hantavirus. new North American hantavirus that causes acute pulmonary Available at www.cdc.gov/hantavirus insufficiency. Am J Trop Med Hyg 1995; 52:117–123. [CDPH] California Department of Public Health Vector-Borne Kuenzi A, Douglass R, Bond C, Mills J. Antibody to Sin Nombre Disease Section. 2013 Annual Report. Available at www Virus in rodents associated with peridomestic habitats in west .cdph.ca.gov/Programs/CID/DCDC/CDPH%20Document%20 central Montana. Am J Trop Med Hyg 2001; 64:137–146. Library/VBDSAnnualReport13.pdf Luis AD, Douglass RJ, Mills JN, Bjørnstad ON. Environmental [CDPH] California Department of Public Health Vector-Borne fluctuations lead to predictability in Sin Nombre hantavirus Disease Section. 2016 Annual Report. Available at www outbreaks. Ecology 2015; 96:1691–1701. .cdph.ca.gov/Programs/CID/DCDC/CDPH%20Document%20 Mills J, Amman B. Glass G. Ecology of hantaviruses and their Library/VBDSAnnualReport16.pdf hosts in . Vector Borne Zoonotic Dis 2010; 10: Childs J, Ksiazek T, Spiropoulou C, Krebs J, et al. Serologic 563–574. and genetic identification of Peromyscus maniculatus as the Mills J, Ksiazek T, Ellis B, Rollin P, et al. Patterns of associ- primary rodent reservoir for a new hantavirus in the south- ation with host and habitat: Antibody reactive with Sin western United States. J Infect Dis 1994; 169:1271–1280. Nombre virus in small mammals in the major biotic com- Cudworth N, Koprowski J. Microtus californicus (Rodentia: munities of the southwestern United States. Am J Trop Med ). Mamm Species 2010; 42:230–243. Hyg 1997; 56:273–284. Diglisic G, Xiao SY, Gligic A, Obradovic M, et al. Isolation of Otteson EW, Riolo J, Rowe JE, Nichol ST, et al. Occurrence of Puumala-like virus from Mus musculus captured in Yu- hantavirus within the rodent population of northeastern Ca- goslavia and its association with severe hemorrhagic fever lifornia and Nevada. Am J Trop Med Hyg 1996; 54:127–133. with renal syndrome. J Infect Dis 1994; 169:204–207. Pesapane R, Ponder M, Alexander, KA. Tracking pathogen Douglass R, Calisher C, Wagoner K, Mills J. Sin Nombre virus transmission at the human wildlife interface: Banded mon- infection of deer mice in Montana: Characteristics of newly goose and Escherichia coli. Ecohealth 2013; 10:115–128. infected mice, incidence, and temporal pattern of infection. R Core Team. R: A language and environment for statistical J Wildl Dis 2007; 43:12–22. computing. R Foundation for Statistical Computing, Vienna, Douglass R, Vadell MV. How much effort is required to ac- Austria. 2016. Available at www.R-project.org curately describe the complex ecology of a rodent-borne viral Song W, Torrez-Martinez N, Irwin W, Harrison F, et al. Isla disease? Ecosphere 2016; 7:e01368. Vista virus: A genetically novel hantavirus of the California Douglass R, Wilson T, Semmens W, Zanto S, et al. Long- vole Microtus californicus. J Gen Virol 1995; 76:3195–3199. itudinal studies of Sin Nombre virus in deer mouse- United States Census Bureau. U.S. Census. 2010. Available at dominated of Montana. Am J Trop Med Hyg www.census.gov/programssurveys/decennial-census/decade 2001; 65:33–41. .2010.html Foley J, Roy A, Clifford D, Crews A, et al. Range-wide as- sessment of the endangered Amargosa vole and analysis of Address correspondence to:

Downloaded by Uc Davis Libraries University of California from www.liebertpub.com at 01/22/19. For personal use only. critical habitat stressors. University of California Davis. Risa Pesapane A Report to the California Department of Fish and Wildlife Department of Medicine and Epidemiology 2016:1–105. School of Veterinary Medicine Gorosito IL, Douglass RJ. A damped precipitation-driven, University of California, Davis bottom-up model for deer mouse population abundance in the 1320 Tupper Hall northwestern United States. Ecol Evol 2017; 7:11113–11123. Davis, CA 95616 Hjelle B, Chavez-Giles F, Torrez-Martinez N, Yates T, et al. Genetic identification of a novel Hantavirus of the harvest E-mail: [email protected]