DOCSLIB.ORG

JOURNAL of NEMATOLOGY First Report of Paratylenchus

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
JOURNAL of NEMATOLOGY First Report of Paratylenchus JOURNAL OF NEMATOLOGY Article | DOI: 10.21307/jofnem-2020-110 e2020-110 | Vol. 52 First report of Paratylenchus lepidus Raski, 1975 associated with green tea (Camellia sinensis (L.) Kuntze) in Vietnam Thi Mai Linh Le1, 2, Huu Tien Nguyen1,2,3,*, Thi Duyen Nguyen1, 2,* and Quang Phap Trinh1, 2 Abstract 1Institute of Ecology and Biological The pin nematodes, Paratylenchus spp., are relatively small Resources, Vietnam Academy nematodes that can feed on a wide range of host plants. The of Sciences and Technology, morphological identification of this nematode is greatly hampered 18 Hoang Quoc Viet, Cau Giay, by their small size and variable characters. This study provides the 100000, Hanoi, Vietnam. first report ofParatylenchus lepidus from Vietnam with a combination of morphological and molecular characterizations. The 28S rDNA 2Graduate University of Science phylogenetic tree of the genus and the first COI mtDNA barcode of and Technology, Vietnam Academy this species are also provided. of Sciences and Technology, 18 Hoang Quoc Viet, Cau Giay, 100000, Hanoi, Vietnam. Keywords 28S rDNA, COI mtDNA, DNA barcode, Plant-parasitic nematodes, 3 Nematology Research Unit, Taxonomy. Department of Biology, Ghent University, K.L. Ledeganckstraat 35, 9000, Ghent, Belgium. *E-mails: tien.quelampb@gmail. com; [email protected] This paper was edited by Zafar Ahmad Handoo. Received for publication August 3, 2020. The genus Paratylenchus (Ciobanu et al., 2003) the identification process, which make the molecular is commonly known as pin nematodes that are approach to become more popular in recent studies of ectoparasites and can be frequently found at high pin nematodes. In Vietnam, 16 Paratylenchus species density in perennial plants, hop gardens, orchards, have been reported without molecular data, including or forest trees (Ghaderi et al., 2016; Ghaderi, 2019). Paratylenchus aculentus, P. arculatus, P colbrani, Although sometimes plants infected by Paratylenchus P corbetti, P. costatus, P. dianthus, P. discocephalus, species show no specific symptoms, large populations P. elachistus, P. epicotylus, P. laocaiensis, P. minusculus, of Paratylenchus spp. affect the absorption capacity P. nawadus, P. pandatus, P. perlatus, P. serricaudatus, of roots and the general physiology of plants and P. similis (Nguyen and Nguyen, 2000; Nguyen (Ghaderi, 2019). According to Talavera and Navas et al., 2004). In this study, we provide the first report (2002), Paratylenchus is only considered damaging of Paratylenchus lepidus (Raski, 1975) in Vietnam nematodes at a density higher than 500 nematodes using the combination of morphological and molecular per 100 cm3 of soil. However, several studies reported characterizations. that the population of Paratylenchus can increase from a low number to damaging levels within a short time Material and methods (Faulkner, 1964; Brzeski et al., 1975). The identification of Paratylenchus species was mostly based on Soil and root samples were collected from the morphological characterizations (Ghaderi et al., 2016), rhizosphere of green tea (Camellia sinensis (L.) but morphological variation can be an obstacle to Kuntze) in Vietnam. Nematodes were extracted using © 2020 Authors. This is an Open Access article licensed under the Creative 1 Commons CC BY 4.0 license, https://creativecommons.org/licenses/by/4.0/ Paratylenchus lepidus Raski, 1975 in Vietnam: Le et al. the modified Baermann tray method (Whitehead (www.geneious.com). The best fit model was chosen and Hemming, 1965). After that, they were fixed and using Mega 7 and phylogenetic analysis was done prepared to make permanent slides following Nguyen following Nguyen et al. (2019c). et al. (2019a). For morphological characterization, measurements and pictures were taken using Carl Results and discussion Zeiss Axio Lab. A1 light microscope equipped with a Zeiss Axiocam ERc5s digital camera. For molecular Measurements characterization, the D2-D3 region of 28S rDNA and COI mtDNA gene were amplified using D2A/D3B n = 20 (♀♀): L = 340 ± 20 (307-371) µm, a = 25 ± 1 (5′–ACAAGTACCGTGGGGAAAGTTG–3′/5′–TCGG (22-27), b = 4.1 ± 0.3 (3.7-4.6), c = 11.5 ± 1.4 (9.8- AAGGAACCAGCTACTA–3′) (Subbotin et al., 2006) 13.8), c′ = 3.5 ± 0.4 (3.0-4.1), V% = 82 ± 1 (81-84), Lip and JB3/JB4 (5′-TTTTTTGGGCATCCTGAGGTTTAT- height = 2.7 ± 0.5 (1.9-3.6) µm, Lip width = 4.9 ± 0.5 3′/5′-TAAAGAAAGAACATAATGAAAATG-3′) (4.2-5.9) µm, Stylet = 25 ± 1 (24-27) µm, Median (Nguyen et al., 2019b) primers. Forward and reverse bulb length = 15.2 ± 2 (12.8-18.0) µm, Median bulb sequences were assembled using Geneious R11 width = 6.9 ± 0.6 (5.9-7.7) µm, SE pore = 75 ± 4 (67-81) Figure 1: Female of P. lepidus from green tea in Vietnam. A: Entire body; B: Anterior end region; C to F: Variation of the tail region. 2 JOURNAL OF NEMATOLOGY µm, Pharynx = 84 ± 3 (79-91) µm, Body width = 13.8 ± 0.4 lip region weakly sclerotized, continuous to body (13.3-14.5) µm, Vulval body diam. = 12.2 ± 0.4 (11.3- contour; median bulb elongate with a distinct valve; 12.6) µm, Anal body diam. = 8.5 ± 0.4 (7.9-9.5) µm, Tail isthmus slender, surrounded by nerve ring; basal bulb length = 30 ± 3 (26-35) µm. pyriform; secretory-excretory pore located at level of basal bulb to pharyngo-intestinal junction; hemizonid Morphological characterization located just anterior to secretory-excretory pore; gonad monodelphic, post uterine sac absent; vulval The female of Vietnamese population of Paratylenchus lips not protruding but having prominent advulval flap; lepidus is characterized by having a slender body, tail curved ventrally with a finely rounded to bluntly curved ventrally; lateral field with four incisures; pointed terminus (Fig. 1). Male was not found. Paratylenchus hamatus KF242215 Paratylenchus hamatus KF242214 100 Paratylenchus hamatus KF242216 97 98 Paratylenchus hamatus KF242217 Paratylenchus hamatus KF242218 Paratylenchus tenuicaudatus KU291239 Paratylenchus nanus KY468901 Paratylenchus nanus MH237651 100 Paratylenchus nanus KY468902 98 Paratylenchus nanus KF242198 99 Paratylenchus nanus KF242201 Paratylenchus coronatus MK506808 98 Paratylenchus neoamblycephalus MG925221 93 Paratylenchus bukowinensis AY780943 63 Paratylenchus labiosus MK506809 Paratylenchus conicephalus KP966491 Paratylenchus neoamblycephalus MK506807 95 Paratylenchus microdorus MF325255 Paratylenchus microdorus MF325256 83 56 Paratylenchus microdorus MF325257 Paratylenchus lepidus MK886692 100 100 Paratylenchus lepidus MT808205 Paratylenchus dianthus KF242226 Paratylenchus dianthus KF242227 100 Paratylenchus dianthus KF242228 Paratylenchus dianthus KF242229 Paratylenchus dianthus MN448364 92 Paratylenchus straeleni MK506804 Paratylenchus straeleni KM875547 100 Paratylenchus straeleni KF242235 Paratylenchus aculentus KR270597 100 Paratylenchus leptos KR270602 Hemicriconemoides strictathecatus MT539384 100 Hemicriconemoides gaddi MK050500 0.050 Figure 2: Bayesian inference phylogenetic tree generated from 28S rDNA sequences under HKY + G model (BIC = 2089.633, lnL = −740.031, G = 0.23, R = 3.22, f(A) = 0.226, f(T) = 0.182, f(C) = 0.249, f(G) = 0.343). Bayesian posterior probabilities (in percentage) are given next to each node. Sequences of P. lepidus from Vietnam are in bold font. 3 Paratylenchus lepidus Raski, 1975 in Vietnam: Le et al. Molecular characterization (Nematoda: Tylenchulidae). Journal of Crop Proection 8:24 3 – 57. The 28S rDNA sequence of P. lepidus from Vietnam Ghaderi, R., Geraert, E. and Karegar, A. 2016. The (742 bp long, accession number: MT808205) was Tylenchulidae of the world: identification of the family 99.7% similar (2 bp difference) to the sequence Tylenchulidae (Nematoda: Tylenchida) Academia Press, of P. lepidus from GenBank (accession number: Belgium. MK886692). The phylogenetic tree based on 28S Maria, M., Miao, W., Ye, W. and Zheng, J. 2019. rDNA sequences showed that the sequence of Updated description of Paratylenchus lepidus Raski P. lepidus from Vietnam was placed together with 1975 and P. minor Sharma, Sharma and Khan, 1986 by the sequence of P. lepidus from GenBank (100% integrating molecular and ultra-structural observations. PP) (Fig. 2). A COI mtDNA sequence of P. lepidus Journal of Nematology 51:e2019–56. from Vietnam (418 bp long) was also obtained and Nguyen, N. C. and Nguyen, V. T. 2000. Fauna of Vietnam, plant-parasitic nematodes Science and submitted to GenBank under the accession number Technics Publishing House, Hanoi, Vietnam. MT828831. Nguyen, C. N., Baldwin, J. G. and Choi, Y. E. 2004. New records of Paratylenchus Micoletzky, Remarks 1922 (Nematoda: Paratylenchinae) from Vietnam with description of Paratylenchus laocaiensis sp. n. Journal Morphology of P. lepidus from green tea in Vietnam is in of Nematode Morphology and Systematics 7:51–75. agreement with the description of the type population Nguyen, H. T., Le, T. M. L., Nguyen, T. D., Liebanas, (Raski, 1975) with small variations in measurements, G., Nguyen, T. A. D. and Trinh, Q. P. 2019a. Description however, these variations can be seen from the type of Geocenamus vietnamensis sp. n. (Nematoda: population and other populations (Maria et al., 2019). In Merliniidae) from Vietnam. Journal of Nematology this study, molecular identification is in agreement with 51:e2019–25. morphological identification to support the presence of Nguyen, H. T., Trinh, Q. P., Couvreur, M., Singh, P. lepidus in Vietnam. The first COI mtDNA sequence P. R., Decraemer, W. and Bert, W. 2019b. Molecular of P. lepidus is also provided to serve as a molecular and morphological characterisation
Load more

Recommended publications
  • Plant-Parasitic Nematodes and Their Management: a Review
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by International Institute for Science, Technology and Education (IISTE): E-Journals Journal of Biology, Agriculture and Healthcare www.iiste.org ISSN 2224-3208 (Paper) ISSN 2225-093X (Online) Vol.8, No.1, 2018 Plant-Parasitic Nematodes and Their Management: A Review Misgana Mitiku Department of Plant Pathology, Southern Agricultural Research Institute, Jinka, Agricultural Research Center, Jinka, Ethiopia Abstract Nowhere will the need to sustainably increase agricultural productivity in line with increasing demand be more pertinent than in resource poor areas of the world, especially Africa, where populations are most rapidly expanding. Although a 35% population increase is projected by 2050. Significant improvements are consequently necessary in terms of resource use efficiency. In moving crop yields towards an efficiency frontier, optimal pest and disease management will be essential, especially as the proportional production of some commodities steadily shifts. With this in mind, it is essential that the full spectrums of crop production limitations are considered appropriately, including the often overlooked nematode constraints about half of all nematode species are marine nematodes, 25% are free-living, soil inhabiting nematodes, I5% are animal and human parasites and l0% are plant parasites. Today, even with modern technology, 5-l0% of crop production is lost due to nematodes in developed countries. So, the aim of this work was to review some agricultural nematodes genera, species they contain and their management methods. In this review work the species, feeding habit, morphology, host and symptoms they show on the effected plant and management of eleven nematode genera was reviewed.
    [Show full text]
  • Thesis, Dissertation
    AN ASSESSMENT OF NEMATODES AFFECTING WHEAT IN MONTANA by Riyadh Talib Al-Khafaji A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Plant Pathology MONTANA STATE UNIVERSITY Bozeman, Montana January 2018 ©COPYRIGHT by Riyadh Al-Khafaji 2018 All Rights Reserved ii DEDICATION To all scientists who are always searching to get truth of this universe. To my martyred father, Talib, in memoriam, and all freedom martyrs whose blood lit the path to liberty. To my mother Bedriah, my wife Ghusoon, my children Samaa, Ahmed, Talib, Tiba, Noor, and all my friends who have always given me unconditional advice and support. iii ACKNOWLEDGEMENTS I would like to thank and show my deep appreciation to my adviser, Dr. Alan T. Dyer, for guiding me patiently through my PhD program. I would like also express my gratitude to my committee members: Dr. Michael Giroux, Dr. William Grey, Dr. John Martin, and Dr. Kris Lambert, for their contributions to my success and knowledge growing through these years. I would also like to thank my lab members Erin Gunnink Troth, Jeff Johnston, Nathaniel Ellis, and David May for their tireless help and support. Thank you also to the members of the Department of Plant Science & Plant Pathology who have helped me throughout these studies. Thank you to Dr. Richard Smiley (Oregon State University) and Eileen Carpenter (Montana State University). Thank you to the Montana Extension agents who helped me do my survey across Montana. I am deeply grateful to the Republic of Iraq, especially the Establishment of Martyrs, for the scholarship and all the necessary support during my study.
    [Show full text]
  • Observations on the Genus Doronchus Andrássy
    Vol. 20, No. 1, pp.91-98 International Journal of Nematology June, 2010 Occurrence and distribution of nematodes in Idaho crops Saad L. Hafez*, P. Sundararaj*, Zafar A. Handoo** and M. Rafiq Siddiqi*** *University of Idaho, 29603 U of I Lane, Parma, Idaho 83660, USA **USDA-ARS-Nematology Laboratory, Beltsville, Maryland 20705, USA ***Nematode Taxonomy Laboratory, 24 Brantwood Road, Luton, LU1 1JJ, England, UK E-mail: [email protected] Abstract. Surveys were conducted in Idaho, USA during the 2000-2006 cropping seasons to study the occurrence, population density, host association and distribution of plant-parasitic nematodes associated with major crops, grasses and weeds. Eighty-four species and 43 genera of plant-parasitic nematodes were recorded in soil samples from 29 crops in 20 counties in Idaho. Among them, 36 species are new records in this region. The highest number of species belonged to the genus Pratylenchus; P. neglectus was the predominant species among all species of the identified genera. Among the endoparasitic nematodes, the highest percentage of occurrence was Pratylenchus (29.7) followed by Meloidogyne (4.4) and Heterodera (3.4). Among the ectoparasitic nematodes, Helicotylenchus was predominant (8.3) followed by Mesocriconema (5.0) and Tylenchorhynchus (4.8). Keywords. Distribution, Helicotylenchus, Heterodera, Idaho, Meloidogyne, Mesocriconema, population density, potato, Pratylenchus, survey, Tylenchorhynchus, USA. INTRODUCTION and cropping systems in Idaho are highly conducive for nematode multiplication. Information concerning the revious reports have described the association of occurrence and distribution of nematodes in Idaho is plant-parasitic nematode species associated with important to assess their potential to cause economic damage P several crops in the Pacific Northwest (Golden et al., to many crop plants.
    [Show full text]
  • The Damage Potential of Pin Nematodes, Paratylenchus Micoletzky, 1922 Sensu Lato Spp
    J. Crop Prot. 2019, 8 (3): 243-257______________________________________________________ Review Article The damage potential of pin nematodes, Paratylenchus Micoletzky, 1922 sensu lato spp. (Nematoda: Tylenchulidae) Reza Ghaderi Department of Plant Protection, School of Agriculture, Shiraz University, Shiraz, Iran. Abstract: The genus Paratylenchus sensu lato includes members belonging to the genera Paratylenchus sensustricto (species with 10 to 40µm long stylet), Gracilacus (species with 40-120µm long stylet), Gracilpaurus (species having cuticular punctuations) and Paratylenchoides (species having sclerotized cephalic framework). Long stylet species become swollen and feed as sedentary parasites of roots, some feed from cortex of perennial host roots, but most species feed as sedentary ectoparasites on roots. In other words, species with stylet shorter than 40µm commonly feed on epidermal cells, whilst the species with longer stylet nourish primarily in cortical tissue, without penetration into the plant tissue. In general, pin nematodes, Paratylenchus spp. are parasites of higher plants with a higher abundance in the rhizosphere of trees and perennials. In present review, an attempt is made to document published information on the pathogenicity and damage potential of the pin nematodes to plants. Keywords: Gracilacus, damage, pathogenicity, perennials, pin nematodes, population, trees Introduction12 Lisetskaya, 1963; 1965; Braun et al., 1966; Fisher, 1967; Ghaderi and Karegar, 2013), and The pin nematodes, Paratylenchus Micoletzky, in some nurseries of conifers, the density of Downloaded from jcp.modares.ac.ir at 5:11 IRST on Sunday October 3rd 2021 1922 sensu lato, firstly have long been population was increased to more than 1000 considered as free-living nematodes, but further individuals per 100cm3 of soil (Ruehle, 1967; studies on their life cycle led researchers to find Rossner, 1969).
    [Show full text]
  • Nematoda: Tylenchulidae)
    Article Integrative Taxonomy Reveals Hidden Cryptic Diversity within Pin Nematodes of the Genus Paratylenchus (Nematoda: Tylenchulidae) Ilenia Clavero-Camacho 1, Juan Emilio Palomares-Rius 1, Carolina Cantalapiedra-Navarrete 1, Guillermo León-Ropero 1, Jorge Martín-Barbarroja 1, Antonio Archidona-Yuste 2,3 and Pablo Castillo 1,* 1 Instituto de Agricultura Sostenible (IAS), Consejo Superior de Investigaciones Científicas (CSIC), Avenida Menéndez Pidal s/n, Campus de Excelencia Internacional Agroalimentario, ceiA3, 14004 Córdoba, Spain; [email protected] (I.C.-C.); [email protected] (J.E.P.-R.); [email protected] (C.C.-N.); [email protected] (G.L.-R.); [email protected] (J.M.-B.) 2 Andalusian Institute of Agricultural and Fisheries Research and Training (IFAPA), Centro Alameda del Obispo, 14004 Córdoba, Spain; [email protected] 3 Department of Ecological Modelling, Helmholtz Centre for Environmental Research—UFZ, Permoserstrasse 15, 04318 Leipzig, Germany * Correspondence: [email protected] Abstract: This study delves into the diagnosis of pin nematodes (Paratylenchus spp.) in Spain based Citation: Clavero-Camacho, I.; on integrative taxonomical approaches using 24 isolates from diverse natural and cultivated envi- Palomares-Rius, J.E.; ronments. Eighteen species were identified using females, males (when available) and juveniles Cantalapiedra-Navarrete, C.; with detailed morphology-morphometry and molecular markers (D2-D3, ITS and COI). Molecular Leon-Ropero, G.; Martin-Barbarroja, markers were obtained from the same individuals used for morphological and morphometric anal- J.; Archidona-Yuste, A.; Castillo, P. yses. The cryptic diversity using an integrative taxonomical approach of the Paratylenchus straeleni- Integrative Taxonomy Reveals species complex was studied, consisting of an outstanding example of the cryptic diversity within Hidden Cryptic Diversity within Pin Paratylenchus and including the description of a new species, Paratylenchus parastraeleni sp.
    [Show full text]
  • Evaluation of Some Vulval Appendages in Nematode Taxonomy
    Comp. Parasitol. 76(2), 2009, pp. 191–209 Evaluation of Some Vulval Appendages in Nematode Taxonomy 1,5 1 2 3 4 LYNN K. CARTA, ZAFAR A. HANDOO, ERIC P. HOBERG, ERIC F. ERBE, AND WILLIAM P. WERGIN 1 Nematology Laboratory, United States Department of Agriculture–Agricultural Research Service, Beltsville, Maryland 20705, U.S.A. (e-mail: [email protected], [email protected]) and 2 United States National Parasite Collection, and Animal Parasitic Diseases Laboratory, United States Department of Agriculture–Agricultural Research Service, Beltsville, Maryland 20705, U.S.A. (e-mail: [email protected]) ABSTRACT: A survey of the nature and phylogenetic distribution of nematode vulval appendages revealed 3 major classes based on composition, position, and orientation that included membranes, flaps, and epiptygmata. Minor classes included cuticular inflations, protruding vulvar appendages of extruded gonadal tissues, vulval ridges, and peri-vulval pits. Vulval membranes were found in Mermithida, Triplonchida, Chromadorida, Rhabditidae, Panagrolaimidae, Tylenchida, and Trichostrongylidae. Vulval flaps were found in Desmodoroidea, Mermithida, Oxyuroidea, Tylenchida, Rhabditida, and Trichostrongyloidea. Epiptygmata were present within Aphelenchida, Tylenchida, Rhabditida, including the diverged Steinernematidae, and Enoplida. Within the Rhabditida, vulval ridges occurred in Cervidellus, peri-vulval pits in Strongyloides, cuticular inflations in Trichostrongylidae, and vulval cuticular sacs in Myolaimus and Deleyia. Vulval membranes have been confused with persistent copulatory sacs deposited by males, and some putative appendages may be artifactual. Vulval appendages occurred almost exclusively in commensal or parasitic nematode taxa. Appendages were discussed based on their relative taxonomic reliability, ecological associations, and distribution in the context of recent 18S ribosomal DNA molecular phylogenetic trees for the nematodes.
    [Show full text]
  • Identification of a New Nematode Species in Ohio and Soil Factor Effects on Plant Nutrition
    Identification of a new nematode species in Ohio and soil factor effects on plant nutrition of soybean Thesis Presented in Partial Fulfillment of the Requirements for the Degree Master of Science in the Graduate School of The Ohio State University By Katharine Elizabeth Ankrom Graduate Program in Horticulture and Crop Science The Ohio State University 2016 Master’s Examination Committee: Dr. Laura E. Lindsey, Advisor Dr. Terry L. Niblack Dr. S. Kent Harrison Copyrighted by Katharine Elizabeth Ankrom 2016 Abstract Plant nutrition is of great importance to soybean [Glycine max (L.) Merr.] growth and grain yield. Nutrient analysis is often difficult to interpret due to the compounding interactions in the soybean rhizosphere. A state-wide survey of Ohio soybean production was done with two objectives: 1) to assess the status of soil fertility and plant nutrition; and 2) to determine the impact of soil factors on the relationship of nutrient uptake to the plant from the soil. Sampling was conducted from 2013 through 2015 in Ohio resulting in 588 total samples. Soil-test and tissue concentrations of phosphorus (P) and potassium (K) were taken as well as soil-test levels of pH, cation exchange capacity (CEC), soil texture, and nematode population densities. Low correlations were observed between the soil and tissue tests with R2 values of 0.1539 and 0.36781, for P and K respectively. We found that 32.9% of the P soil samples tested below the critical soil test range, but only 2.7% of the samples were below tissue-test critical levels for P, while 23.4% of the K soil test samples were found to be below the critical levels and only 5.9% of the K tissue tests fell below the critical level.
    [Show full text]
  • JOURNAL of NEMATOLOGY on the Synonymy of Trophotylenchulus
    JOURNAL OF NEMATOLOGY Article | DOI: 10.21307/jofnem-2019-078 e2019-78 | Vol. 51 On the synonymy of Trophotylenchulus asoensis and T. okamotoi with T. arenarius, and intra-generic structure of Paratylenchus (Nematoda: Tylenchulidae) Hossein Mirbabaei,1 Ali Eskandari,1* Reza Ghaderi2 and Akbar Karegar2 Abstract 1Department of Plant Protection, Two populations of the genus Trophotylenchulus and 10 species Faculty of Agriculture, University of the genus Paratylenchus from Iran were characterized based of Zanjan, Zanjan, Iran. on morphometric, morphological and molecular characters. Our observations on the two populations of Trophotylenchulus from Iran 2 Department of Plant Protection, revealed that T. asoensis and T. okamotoi have been distinguished School of Agriculture, Shiraz from T. arenarius, on the basis of the features which cannot be longer University, Shiraz, Iran. considered as stable diagnostic characters. One of the populations *E-mail: [email protected] shows a mixed combination of the characters of T. arenarius and T. asoensis; it has morphometrics more similar to T. arenarius but shows This paper was edited by Zafar affinities with T. asoensis in the tail terminus shape of females and Ahmad Handoo. second-stage juveniles (J2) and in having a reduced stylet in males. The Received for publication July 20, other population fit well withT. okamotoi; it has females with generally 2019. bluntly rounded tails typical for T. okamotoi, but sometimes with finely rounded tail termini, like those of T. arenarius or T. asoensis. The sequences of D2–D3 expansion segments of 28 S rRNA gene for the two populations are identical with each other, but only 4 bp (0.67%) difference with T.
    [Show full text]
  • JOURNAL of NEMATOLOGY Article | DOI: 10.21307/Jofnem-2019-056 E2019-56 | Vol
    JOURNAL OF NEMATOLOGY Article | DOI: 10.21307/jofnem-2019-056 e2019-56 | Vol. 51 Updated description of Paratylenchus lepidus Raski, 1975 and P. minor Sharma, Sharma and Khan, 1986 by integrating molecular and ultra-structural observations Munawar Maria1, Wentao Miao1, 2 1,3 Weimin Ye and Jingwu Zheng * Abstract 1Laboratory of Plant Nematology, Institute of Biotechnology, College Two populations of Paratylenchus lepidus and P. minor were of Agriculture & Biotechnology, detected in the rhizosphere of Elaeocarpus sp. and Chinese red pine Zhejiang University, Hangzhou from Taizhou and Hangzhou, Zhejiang Province, China. Previously, 310058, Zhejiang, P.R. China. P. lepidus has been reported from China whereas P. minor was originally described from India decades ago in the rhizosphere of 2 Nematode Assay Section, North peach but was never reported thereafter. In this study, both species Carolina Department of Agriculture, were characterized morphologically and molecularly coupled with SEM Raleigh, NC. observations. Morphologically, both species have four incisures in the 3Ministry of Agriculture Key Lab of lateral field, vulval present (SEM observations), stylet less than 30 μ m Molecular Biology of Crop Path- long and cephalic region without submedian lobes. Phylogenetically, ogens and Insects, Hangzhou both species grouped with paratylenchid species having short stylets. 310058, P. R. China. Both species can be differentiated from each other by the shape of lip region (rounded in P. lepidus and narrow truncated in P. minor) and *E-mail: [email protected] tail terminus (pointed in P. lepidus and a broadly rounded in P. minor) This paper was edited by Zafar and several morphomemtrical values.The study provided an updated Ahmad Handoo.
    [Show full text]
  • Plant-Parasitic Nematodes in Germany – an Annotated Checklist
    86 (3) · December 2014 pp. 177–198 Plant-parasitic nematodes in Germany – an annotated checklist Dieter Sturhan Arnethstr. 13D, 48159 Münster, Germany, and c/o Julius Kühn-Institut, Toppheideweg 88, 48161 Münster, Germany E-mail: [email protected] Received 15 September 2014 | Accepted 28 October 2014 Published online at www.soil-organisms.de 1 December 2014 | Printed version 15 December 2014 Abstract A total of 268 phytonematode species indigenous in Germany or more recently introduced and established outdoors are listed. Their current taxonomic status and classification is given, which is not always in agreement with that applied in Fauna Europaea or recent publications. Recently used synonyms are included and comments on the species status are sometimes added. Species originally described from Germany are particularly marked, presence of types and other voucher specimens in the German Nematode Collection - Terrestrial Nematodes (DNST) is indicated; likewise potential occurrence or absence of species in field soil and similar cultivated land is noted. Species known from indoor plants and only occasionally observed outdoors are listed separately. Synonymies and species considered as species inquirendae are listed in case records refer to Germany; records and identifications considered as doubtful are also listed. In a separate section notes on a number of genera and species are added, taxonomic problems are indicated, and data on morphology, distribution and habitat of some recently discovered species and of still unidentified or undescribed species or populations are given. Longidorus macroteromucronatus is synonymised with L. poessneckensis. Paratrophurus striatus is transferred as T. casigo nom. nov., comb. nov. to the genus Tylenchorhynchus. Neotypes of Merlinius bavaricus and Bursaphelenchus fraudulentus are designated.
    [Show full text]
  • Succession of Nematodes During Composting Processess and Their Potential As Indicators of Compost Maturity
    Succession of nematodes during composting processess and their potential as indicators of compost maturity Hanne Steel Promoters: Prof. dr. Wim Bert (UGent) Prof. dr. Tom Moens (UGent) Thesis submitted to obtain the degree of doctor in Sciences, Biology Proefschrift voorgelegd tot het bekomen van de graad van doctor in de Wetenschappen, Biologie Dit werk werd mogelijk gemaakt door een beurs van het Fonds Wetenschappelijk Onderzoek- Vlaanderen (FWO) This work was supported by a grant of the Foundation for Scientific Research, Flanders (FWO) 3 Reading Committee: Prof. dr. Deborah Neher (University of Vermont, USA) Dr. Thomaé Kakouli-Duarte (Institute of Technology Carlow, Ireland) Prof. dr. Magda Vincx (Ghent University, Belgium) Dr. Eduardo de la Peña (Ghent University, Belgium) Examination Committee: Prof. dr. Koen Sabbe (chairman, Ghent University, Belgium) Prof. dr. Wim Bert (secretary, promotor, Ghent University, Belgium) Prof. dr. Tom Moens (promotor, Ghent University, Belgium) Prof. dr. Deborah Neher (University of Vermont, USA) Dr. Thomaé Kakouli-Duarte (Institute of Technology Carlow, Ireland) Prof. dr. Magda Vincx (Ghent University, Belgium) Prof. dr. Wilfrida Decraemer (Royal Belgian Institute of Natural Sciences, Belgium) Dr. Eduardo de la Peña (Ghent University, Belgium) Dr. Ir. Bart Vandecasteele (Institute for Agricultural and Fisheries Research, Belgium) 5 Acknowledgments Eindelijk is het zover! Ik mag mijn dankwoord schrijven, iets waar ik stiekem al heel lang naar uitkijk en dat alleen maar kan betekenen dat mijn doctoraat bijna klaar is. JOEPIE! De voorbije 5 jaar waren zonder twijfel leuk, leerrijk en ontzettend boeiend. Maar… jawel doctoreren is ook een project van lange adem, met vallen en opstaan, met zin en tegenzin, met geluk en tegenslag, met fantastische hoogtes maar soms ook laagtes….Nu ik er zo over nadenk en om in een vertrouwd thema te blijven: doctoreren verschilt eigenlijk niet zo gek veel van een composteringsproces, dat bij voorkeur trouwens ook veel adem (zuurstof) ter beschikking heeft.
    [Show full text]
  • Molecular Characterisation of Some Plant-Parasitic Nematodes
    Russian Journal of Nematology, 2020, 28 (1), 1 – 28 Molecular characterisation of some plant-parasitic nematodes (Nematoda: Tylenchida) from Belgium Catherine Malike Etongwe1, Phougeishangbam Rolish Singh1, Wim Bert1 and 2, 3 Sergei A. Subbotin 1Nematology Research Unit, Department of Biology, Ghent University, K.L. Ledeganckstraat 35, 9000, Ghent, Belgium 2Plant Pest Diagnostic Centre, California Department of Food and Agriculture, 3294 Meadowview Road, 95832-1448, Sacramento, CA, USA 3A.N. Severtsov Institute of Ecology and Evolution, Russian Academy of Sciences, Leninskii Prospect 33, 117071, Moscow, Russia e-mail: [email protected] Accepted for publication 20 February 2020 Summary. Using morphological, morphometric and molecular analysis, eleven valid nematode species from nine genera: Amplimerlinius icarus, Criconema annuliferum, Criconemoides informis, Helicotylenchus varicaudatus, Hemicriconemoides pseudobrachyurus, Hemicycliophora thienemanni, Mesocriconema xenoplax, Paratylenchus bukowinensis, P. nanus, Rotylenchus montanus and R. robustus together with twelve unidentified species, were identified in samples collected from eighteen locations in Belgium. The unidentified species include six Paratylenchus species, one Helicotylenchus species, three criconematid species and two Rotylenchus species. A total of new partial 21 18S rRNA, 69 28S rRNA, 10 ITS rRNA and 51 COI mtDNA gene sequences were obtained and used for phylogenetic and sequence analysis. Short descriptions, morphometrics and light and scanning microscopic photos are presented for selected species. Based on the results of molecular analysis, Hemicriconemoides promissus syn. n. was proposed as a junior synonym of H. pseudobrachyurus. Key words: Amplimerlinius icarus, Criconema annuliferum, Criconemoides informis, Helicotylenchus varicaudatus, Hemicriconemoides pseudobrachyurus, Hemicycliophora thienemanni, Mesocriconema xenoplax, Paratylenchus bukowinensis, Paratylenchus nanus, Rotylenchus montanus, Rotylenchus robustus, phylogeny, 18S rRNA, ITS rRNA, 28S rRNA, COI mtDNA.
    [Show full text]