JOURNAL OF NEMATOLOGY Article | DOI: 10.21307/jofnem-2020-110 e2020-110 | Vol. 52 First report of Paratylenchus lepidus Raski, 1975 associated with green tea (Camellia sinensis (L.) Kuntze) in Vietnam Thi Mai Linh Le1, 2, Huu Tien Nguyen1,2,3,*, Thi Duyen Nguyen1, 2,* and Quang Phap Trinh1, 2 Abstract 1Institute of Ecology and Biological The pin nematodes, Paratylenchus spp., are relatively small Resources, Vietnam Academy nematodes that can feed on a wide range of host plants. The of Sciences and Technology, morphological identification of this nematode is greatly hampered 18 Hoang Quoc Viet, Cau Giay, by their small size and variable characters. This study provides the 100000, Hanoi, Vietnam. first report ofParatylenchus lepidus from Vietnam with a combination of morphological and molecular characterizations. The 28S rDNA 2Graduate University of Science phylogenetic tree of the genus and the first COI mtDNA barcode of and Technology, Vietnam Academy this species are also provided. of Sciences and Technology, 18 Hoang Quoc Viet, Cau Giay, 100000, Hanoi, Vietnam. Keywords 28S rDNA, COI mtDNA, DNA barcode, Plant-parasitic nematodes, 3 Nematology Research Unit, Taxonomy. Department of Biology, Ghent University, K.L. Ledeganckstraat 35, 9000, Ghent, Belgium. *E-mails: tien.quelampb@gmail. com; [email protected] This paper was edited by Zafar Ahmad Handoo. Received for publication August 3, 2020. The genus Paratylenchus (Ciobanu et al., 2003) the identification process, which make the molecular is commonly known as pin nematodes that are approach to become more popular in recent studies of ectoparasites and can be frequently found at high pin nematodes. In Vietnam, 16 Paratylenchus species density in perennial plants, hop gardens, orchards, have been reported without molecular data, including or forest trees (Ghaderi et al., 2016; Ghaderi, 2019). Paratylenchus aculentus, P. arculatus, P colbrani, Although sometimes plants infected by Paratylenchus P corbetti, P. costatus, P. dianthus, P. discocephalus, species show no specific symptoms, large populations P. elachistus, P. epicotylus, P. laocaiensis, P. minusculus, of Paratylenchus spp. affect the absorption capacity P. nawadus, P. pandatus, P. perlatus, P. serricaudatus, of roots and the general physiology of plants and P. similis (Nguyen and Nguyen, 2000; Nguyen (Ghaderi, 2019). According to Talavera and Navas et al., 2004). In this study, we provide the first report (2002), Paratylenchus is only considered damaging of Paratylenchus lepidus (Raski, 1975) in Vietnam nematodes at a density higher than 500 nematodes using the combination of morphological and molecular per 100 cm3 of soil. However, several studies reported characterizations. that the population of Paratylenchus can increase from a low number to damaging levels within a short time Material and methods (Faulkner, 1964; Brzeski et al., 1975). The identification of Paratylenchus species was mostly based on Soil and root samples were collected from the morphological characterizations (Ghaderi et al., 2016), rhizosphere of green tea (Camellia sinensis (L.) but morphological variation can be an obstacle to Kuntze) in Vietnam. Nematodes were extracted using © 2020 Authors. This is an Open Access article licensed under the Creative 1 Commons CC BY 4.0 license, https://creativecommons.org/licenses/by/4.0/ Paratylenchus lepidus Raski, 1975 in Vietnam: Le et al. the modified Baermann tray method (Whitehead (www.geneious.com). The best fit model was chosen and Hemming, 1965). After that, they were fixed and using Mega 7 and phylogenetic analysis was done prepared to make permanent slides following Nguyen following Nguyen et al. (2019c). et al. (2019a). For morphological characterization, measurements and pictures were taken using Carl Results and discussion Zeiss Axio Lab. A1 light microscope equipped with a Zeiss Axiocam ERc5s digital camera. For molecular Measurements characterization, the D2-D3 region of 28S rDNA and COI mtDNA gene were amplified using D2A/D3B n = 20 (♀♀): L = 340 ± 20 (307-371) µm, a = 25 ± 1 (5′–ACAAGTACCGTGGGGAAAGTTG–3′/5′–TCGG (22-27), b = 4.1 ± 0.3 (3.7-4.6), c = 11.5 ± 1.4 (9.8- AAGGAACCAGCTACTA–3′) (Subbotin et al., 2006) 13.8), c′ = 3.5 ± 0.4 (3.0-4.1), V% = 82 ± 1 (81-84), Lip and JB3/JB4 (5′-TTTTTTGGGCATCCTGAGGTTTAT- height = 2.7 ± 0.5 (1.9-3.6) µm, Lip width = 4.9 ± 0.5 3′/5′-TAAAGAAAGAACATAATGAAAATG-3′) (4.2-5.9) µm, Stylet = 25 ± 1 (24-27) µm, Median (Nguyen et al., 2019b) primers. Forward and reverse bulb length = 15.2 ± 2 (12.8-18.0) µm, Median bulb sequences were assembled using Geneious R11 width = 6.9 ± 0.6 (5.9-7.7) µm, SE pore = 75 ± 4 (67-81) Figure 1: Female of P. lepidus from green tea in Vietnam. A: Entire body; B: Anterior end region; C to F: Variation of the tail region. 2 JOURNAL OF NEMATOLOGY µm, Pharynx = 84 ± 3 (79-91) µm, Body width = 13.8 ± 0.4 lip region weakly sclerotized, continuous to body (13.3-14.5) µm, Vulval body diam. = 12.2 ± 0.4 (11.3- contour; median bulb elongate with a distinct valve; 12.6) µm, Anal body diam. = 8.5 ± 0.4 (7.9-9.5) µm, Tail isthmus slender, surrounded by nerve ring; basal bulb length = 30 ± 3 (26-35) µm. pyriform; secretory-excretory pore located at level of basal bulb to pharyngo-intestinal junction; hemizonid Morphological characterization located just anterior to secretory-excretory pore; gonad monodelphic, post uterine sac absent; vulval The female of Vietnamese population of Paratylenchus lips not protruding but having prominent advulval flap; lepidus is characterized by having a slender body, tail curved ventrally with a finely rounded to bluntly curved ventrally; lateral field with four incisures; pointed terminus (Fig. 1). Male was not found. Paratylenchus hamatus KF242215 Paratylenchus hamatus KF242214 100 Paratylenchus hamatus KF242216 97 98 Paratylenchus hamatus KF242217 Paratylenchus hamatus KF242218 Paratylenchus tenuicaudatus KU291239 Paratylenchus nanus KY468901 Paratylenchus nanus MH237651 100 Paratylenchus nanus KY468902 98 Paratylenchus nanus KF242198 99 Paratylenchus nanus KF242201 Paratylenchus coronatus MK506808 98 Paratylenchus neoamblycephalus MG925221 93 Paratylenchus bukowinensis AY780943 63 Paratylenchus labiosus MK506809 Paratylenchus conicephalus KP966491 Paratylenchus neoamblycephalus MK506807 95 Paratylenchus microdorus MF325255 Paratylenchus microdorus MF325256 83 56 Paratylenchus microdorus MF325257 Paratylenchus lepidus MK886692 100 100 Paratylenchus lepidus MT808205 Paratylenchus dianthus KF242226 Paratylenchus dianthus KF242227 100 Paratylenchus dianthus KF242228 Paratylenchus dianthus KF242229 Paratylenchus dianthus MN448364 92 Paratylenchus straeleni MK506804 Paratylenchus straeleni KM875547 100 Paratylenchus straeleni KF242235 Paratylenchus aculentus KR270597 100 Paratylenchus leptos KR270602 Hemicriconemoides strictathecatus MT539384 100 Hemicriconemoides gaddi MK050500 0.050 Figure 2: Bayesian inference phylogenetic tree generated from 28S rDNA sequences under HKY + G model (BIC = 2089.633, lnL = −740.031, G = 0.23, R = 3.22, f(A) = 0.226, f(T) = 0.182, f(C) = 0.249, f(G) = 0.343). Bayesian posterior probabilities (in percentage) are given next to each node. Sequences of P. lepidus from Vietnam are in bold font. 3 Paratylenchus lepidus Raski, 1975 in Vietnam: Le et al. Molecular characterization (Nematoda: Tylenchulidae). Journal of Crop Proection 8:24 3 – 57. The 28S rDNA sequence of P. lepidus from Vietnam Ghaderi, R., Geraert, E. and Karegar, A. 2016. The (742 bp long, accession number: MT808205) was Tylenchulidae of the world: identification of the family 99.7% similar (2 bp difference) to the sequence Tylenchulidae (Nematoda: Tylenchida) Academia Press, of P. lepidus from GenBank (accession number: Belgium. MK886692). The phylogenetic tree based on 28S Maria, M., Miao, W., Ye, W. and Zheng, J. 2019. rDNA sequences showed that the sequence of Updated description of Paratylenchus lepidus Raski P. lepidus from Vietnam was placed together with 1975 and P. minor Sharma, Sharma and Khan, 1986 by the sequence of P. lepidus from GenBank (100% integrating molecular and ultra-structural observations. PP) (Fig. 2). A COI mtDNA sequence of P. lepidus Journal of Nematology 51:e2019–56. from Vietnam (418 bp long) was also obtained and Nguyen, N. C. and Nguyen, V. T. 2000. Fauna of Vietnam, plant-parasitic nematodes Science and submitted to GenBank under the accession number Technics Publishing House, Hanoi, Vietnam. MT828831. Nguyen, C. N., Baldwin, J. G. and Choi, Y. E. 2004. New records of Paratylenchus Micoletzky, Remarks 1922 (Nematoda: Paratylenchinae) from Vietnam with description of Paratylenchus laocaiensis sp. n. Journal Morphology of P. lepidus from green tea in Vietnam is in of Nematode Morphology and Systematics 7:51–75. agreement with the description of the type population Nguyen, H. T., Le, T. M. L., Nguyen, T. D., Liebanas, (Raski, 1975) with small variations in measurements, G., Nguyen, T. A. D. and Trinh, Q. P. 2019a. Description however, these variations can be seen from the type of Geocenamus vietnamensis sp. n. (Nematoda: population and other populations (Maria et al., 2019). In Merliniidae) from Vietnam. Journal of Nematology this study, molecular identification is in agreement with 51:e2019–25. morphological identification to support the presence of Nguyen, H. T., Trinh, Q. P., Couvreur, M., Singh, P. lepidus in Vietnam. The first COI mtDNA sequence P. R., Decraemer, W. and Bert, W. 2019b. Molecular of P. lepidus is also provided to serve as a molecular and morphological characterisation
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages4 Page
-
File Size-