Mtdna and Osteological Analyses of an Unknown Historical Cemetery from Upstate New York

Archaeol Anthropol Sci (2012) 4:303–311 DOI 10.1007/s12520-012-0105-4

ORIGINAL PAPER mtDNA and osteological analyses of an unknown historical cemetery from upstate New York

Jennifer F. Byrnes & D. Andrew Merriwether & Joyce E. Sirianni & Esther J. Lee

Received: 20 July 2012 /Accepted: 25 September 2012 /Published online: 6 October 2012 # Springer-Verlag Berlin Heidelberg 2012

Abstract Thirteen burials located on Jackson Street in Keywords Ancient DNA . Osteology . New York Native Youngstown, NY, USA were recovered from a construction Americans . Population genetics site and excavated in 1997. Based on the artifact assemblage, it was suggested that the cemetery was used sometime between the late 1700s and 1840. No historical records Introduction existed, and initial assessment of the skeletal remains was not able to determine any cultural affiliation. We carried out During a road construction project on Main Street in osteological and genetic investigations in order to gain Youngstown, NY, USA, 13 historical burials were discov- insight into ancestral affiliation and kinship of the unknown ered at the Jackson Street junction. Referred to as the individuals from the burials. Due to poor preservation of the Jackson Street Burials, they were subsequently excavated remains, dental traits and limited osteological observations after being exposed and disturbed by the backhoe and a were available for only a few individuals. We performed utility trench (Rayner-Herter 1997). Seven of the 13 burials DNA extraction and sequenced the mitochondrial DNA included coffins containing artifacts such as numerous nails (mtDNA) control region following standard ancient DNA and nail fragments, four brass straight pins, a shell button, procedures. Our results suggest that ten individuals have and glass trade beads that are likely associated with burial evidence of biological affiliation with Native Americans, clothing. No historical records existed, but based on the and in particular, four individuals have maternal Native artifact assemblage and the history of Fort Niagara with American ancestry. One male individual was determined to which the individuals were most likely associated, the burial be of European ancestry, from both the mtDNA and osteo- site was used sometime between the late 1700s and 1840 logical results. This burial may reflect admixture as a result (Rayner-Herter 1997). Background research by the of frequent contact between Native Americans and University at Buffalo’s Archaeology Survey revealed a high Europeans during the eighteenth and nineteenth centuries historical sensitivity of this site, including local media and attempts by missionaries to convert Native Americans reports in 1912 and 1939 that described findings of 14 to Christianity. Our study demonstrates the usefulness of a historical burials at the intersection of Main Street and multifaceted approach through archaeological, osteological, Jackson Street but no records of what became of the remains and genetic analysis that provides valuable perspectives in (Rayner-Herter 1997). understanding the individuals buried at the Jackson Street The burial orientation of the individuals and associated Burials. grave goods provided some clues on their possible cultural affiliation. All 13 burials had the body laid in a supine : position and 11 (burials 1–10 and 13) had bodies in a J. F. Byrnes J. E. Sirianni west/east orientation with the head towards the west end of Department of Anthropology, University at Buffalo, 380 MFAC, Ellicott Complex, the grave. Individuals from burials 11 and 12 slightly devi- Buffalo, NY 14261, USA ated, showing a northwest/southeast orientation (Fig. 1). Furthermore, the two burials revealed a large quantity of : * D. A. Merriwether E. J. Lee ( ) glass trade beads that was distinctive from the other 11 Department of Anthropology, Binghamton University, PO Box 6000, Binghamton, NY 13902-6000, USA burials. These beads are usually associated with historical e-mail: [email protected] Seneca sites, dating from 1745 to 1820 (Wray 1982). Based 304 Archaeol Anthropol Sci (2012) 4:303–311 on the associated artifacts and burial orientation, burials 11 aided by the advancements in DNA extraction and amplifi- and 12 were deemed Native American on site, and the cation techniques (e.g., Marshall et al. 2011; Keller et al. remains were excluded from further analysis. The local 2012). Mitochondrial DNA (mtDNA) has been more suc- Seneca tribe was contacted for the repatriation of these cessful in genetic analysis of skeletal remains, presumably remains in compliance with the Native American Graves due to the ~1,000-fold higher copy number of mtDNA than Protection and Repatriation Act (NAGPRA). nuclear DNA, though it can only be informative with Native American burials during this time period adopted regards to the maternal lineage (Giles et al. 1980). Many the extended supine burial position with the head towards studies have utilized mtDNA in understanding population the west, though not always strictly abiding by the west/east history based on its unique characteristics including no axis (Axtell 1981). Seneca tribes from northeastern North recombination, maternal inheritance, and higher mutation America were shown to bury individuals in a crouched/ rate particularly in the non-coding, control region (e.g., flexed position with a northwest orientation prior to contact Lawrence et al. 2010). Ancient DNA analysis poses addi- with Europeans (Wray et al. 1987). Transition to a west/east tional challenges, as the DNA in skeletal remains is often burial orientation started with the introduction of European degraded and exists in low copy number. Several studies burial practices, in particular associated with Christian mis- have suggested guidelines for contamination control and sionary influences on Native Americans (Wray et al. 1987). authentication of the results, though there remain differences Thus, burial orientation of the remaining 11 burials was of opinion on any standardization of methods (e.g., Kemp suggestive of Christian influence. In addition, the rectangu- and Smith 2010; Winters et al. 2011). Nevertheless, it is lar coffin outlines suggested Christian burial practices important to take additional precautions to produce reliable (Simon 1990; Baker 1994). In an effort to gain understand- results from aDNA analysis. ing of their biological and possible cultural affiliation, in- The historical context of the Jackson Street Burials vestigation of the remaining 11 individuals was carried out. presents an intriguing opportunity to investigate ancestral The initial osteological analysis of the 11 burials described affiliation of the buried individuals utilizing osteological five adults (four females and one male) and six children and molecular methods. Therefore, the goal of this study (Tables 1 and 2) (Rayner-Herter 1997). Skeletal evidence was to (1) reanalyze the skeletal remains for any osteo- showed no indication that any of the individuals had died of logical measurements or observations that may be indic- chronic infectious diseases, nutritional deficiencies, or trauma. ative of ancestry and (2) carry out DNA analysis to Therefore, any circumstances leading to the death of the address the question of biological ancestral affiliation of individuals were not observable. Initial analysis of dental traits the individuals buried at Jackson Street. The integration showed some features for ancestry determination, but was of genetic and osteological analyses may allow further insufficient without stronger supporting traits. insight to the original assessment conducted in 1997 as Various anthropological studies have shown success in well as information on kinship and possible cultural utilizing ancient DNA (aDNA) analysis, which has been affiliation.

Fig. 1 Simple illustration of the Jackson Street Burial site. Numbers correspond to each burial listed in Table 1 Archaeol Anthropol Sci (2012) 4:303–311 305

Table 1 Summary of the initial osteological analysis of Jackson Burial # Orientation Depth of Coffin Status Completeness Sex Age (years) a Street Burials (Rayner-Herter of burial grave (cm) code 1997) 1 E/W 82 Present Adult 3 Female 25–35 2 E/W 72 Absent Adult 2 Male >40 3 E/W 90 Absent Adult 1 Female 20–35 4 E/W 80 Absent Child 3 ud ud 5 E/W 77 Present Child 3 ud 3 6 E/W 82 Absent Child 2 ud 5 7 E/W 87 Present Child 3 ud 2–3 8 E/W 90 Present Adult 2 Female 30–35 ud undetermined 9 E/W 85 Present Child 3 ud 5–6 aCompleteness codes: 10>75 % 10 E/W 102 Present Adult 2 Female 20–35 present; 2025–75 % present; 13 E/W 90 Present Child 3 ud 6–8 3025 % present

Materials and methods PI≤84.9 are considered platymeric and those with more circular diaphyses with a PI≥84.9 are eurymeric (Wescott Osteological methods and Srikanta 2008). This method was found to be valuable for distinguishing Native Americans and American Blacks The skeletal remains were notably poorly preserved since and Whites (Wescott and Srikanta 2008). The non-metric their excavation from the site and subsequent storage and cranial observations followed the list of traits outlined in handling further contributed to the deterioration of the mate- Rhine (1990). rials. Therefore, we were only able to apply metric measurements of three femur subtrochanteric shapes and non-metric Molecular methods observations of three adult skulls (burials 2, 3, and 10). Proximal femurs were measured following the methods of Previous studies have outlined several criteria to produce Wescott and Srikanta (2008) based on the original research reliable aDNA results (Cooper and Poinar 2000; Gilbert et of Gilbert and Gill’s methodology (1990). Femur subtro- al. 2005), and this study followed the standards and exper- chanteric measurements were taken to the nearest millime- imental procedures outlined in a previous study (Lee et al. ter, and the platymeric index (PI) was calculated by dividing 2009). All experimental procedures were carried out in an the anterior–posterior diameter by the medial–lateral diam- ancient-DNA-only facility with separate rooms dedicated to eter and multiplying by 100 (Bass 1995). Proximal diaphy- drilling, extracting, and preparing samples for amplification ses were determined to have high discriminating ability, in via polymerase chain reaction (PCR). Rooms were equipped which anteroposteriorly flattened proximal diaphyses with a with high efficiency particulate filtered air and UV lights over all surfaces. Airflow between the rooms was limited by magnetic interlocks on the doors and by maintaining a serial Table 2 Frequency of dental traits (Rayner-Herter 1997) positive pressure from innermost to outermost rooms. Burial # Number of teeth Presence of Presence of Standard procedures such as the use of disposable gowns, ’ shovel shaped Carabelli s gloves, shoe covers, facial masks, and goggles were fol- Deciduous Permanent incisors cusps lowed. Exposed surfaces were wiped down with bleach and 1 – 12 Present Absent UV irradiated before each procedure. Negative controls 2 – 11 Absent Absent were always included in experimental procedures. 3 – 32 Present Absent Sequence data were obtained for all researchers in the lab 4 18 2 Present Absent and those that came into contact with the specimens to 5 4 1 Absent Absent exclude the possibility of recent contamination. – 6 10 22 Present Absent Teeth from burials 1 10 and 13 were drilled for extrac- 7 8 10 Present Present tion. Drilling and extraction were carried out at least twice, 8 – 24 Absent Absent each by separate researchers. We followed the protocol 9 18 11 Present Absent described in detail from a previous study (Lee et al. 2009). Briefly, specimens were first decontaminated with bleach 10 – 22 Present Absent before drilling to produce fine bone powder of approximate- 13 18 16 Present Present ly 0.1 g. Bone powder was decalcified in 2 ml of 0.5 M 306 Archaeol Anthropol Sci (2012) 4:303–311

EDTA and incubated with 0.5 ml of proteinase K. Adapting Results the protocol outlined in Yang et al. (1998), extraction was carried out utilizing Centricon® Ultracel YM-30 (Millipore, Osteological results Billerica, MA, USA) and QIAamp® Spin Column (QIAGEN, Valencia, CA, USA), with a final DNA elution Eight of the 11 individuals presented shovel-shaped incisors, volume of 200 μl. and two individuals had Carabelli’s cusps in addition to inci- Amplification of the mtDNA control region was per- sive shoveling (Table 2), which was consistent with the orig- formed using four overlapping primers spanning nucleo- inal assessment. Carabelli’s cusps are typically associated with tide positions (nps) 16036–16429 in hypervariable region European ancestry and shovel-shaped incisors with Native 1 (HV1) and two overlapping primers spanning nps American/Asian ancestry (Mayhall et al. 1982; Turner 1987; 00008–00287 in HV2. Each amplified region ranged Hanihara 2008). We were unable to observe more commonly from 120 to 170 bp (Table 3, modified from Lee et al. used cranial metric and non-metric traits indicative of ancestry 2009). Each PCR reaction included 3 μl of DNA extract, due to the poor preservation of the skeletal remains. 1× PCR buffer, 0.1 mM dNTPs, 0.2 μM of each primer Table 4 shows the osteological results for burials 2, 3, and pair, 1.5 mM MgSO4, and 0.5 U of Platinum® Taq DNA 10. The left femur of the individual from burial 2 displayed a polymerase (Invitrogen, Carlsbad, CA, USA) in a total more eurymeric PI of 85.3. Wescott and Srikanta (2008) volume of 20 μl. Amplification conditions were as fol- suggested that a platymeric femur subtrochanter with a PI≤ lows: 94 °C for 2 min, 50 cycles of 94 °C for 20 s, 84.9 is suggestive of Native American ancestry. Thus, the left annealing temperature for 15 s, 72 °C for 20 s, and a femur of the individual from burial 2 is not suggestive of final step at 72 °C for 5 min (see Table 3 for primer Native American ancestry. Other traits for this individual sequences and annealing temperature used). Different included a blunt chin and straight gonion angle. These two extracts were amplified for each PCR region at least traits alone are not suggestive of one ancestry over another twice. Successful amplicons were verified by agarose (Rhine 1990), though a blunt chin was observed to be more gel electrophoresis, purified, and prepared for sequencing common in Native American groups and a pointed chin in using the BigDye® Terminator v.3.1 (Applied those of European descent (Berg 2008). The individual from Biosystems, Foster City, CA, USA). After standard alco- burial 3 had both proximal femurs available for analysis, hol precipitation, samples were sequenced directly on an which produced two very different PIs. The PI of the left ABI PRISM™ 377XL DNA Sequencer (Applied femur was 70.3, and the right was 83.4, both suggestive of Biosystems, Foster City, CA, USA). Mutations were Native American ancestry. This individual also had the same identified by comparison to the revised Cambridge non-metric observations of a blunt chin and straight gonion Reference Sequence (Andrews et al. 1999)using angle. The individual from burial 10 had a proximal right SequencherTM (Gene Codes, Ann Arbor, MI, USA). femur that produced a PI of 71.1 and showed numerous Any heterogenous sequence signals were discarded, and wormian bones in the lambdoidal suture and complex sutures. at least two different sequence reads were collected for Thus, both non-metric and metric traits suggest the individual each sample. from burial 10 to be of Native American/Asian ancestry.

Table 3 Primer sequences, amplified length, and annealing Primer Primer sequence (5′–3′) Amplified length (bp) Annealing temperature (°C) temperatures used for mtDNA control region analysis (from 16036F GAAGCAGATTTGGGTACCAC 122 57 Lee et al. 2009) 16158R TACTACAGGTGGTCAAGTAT 16106F GCCAGCCACCATGAATATTGT 145 58 16251R GGAGTTGCAGTTGATGTGTGAT 16190F CCATGCTTACAAGCAAGT 165 55 16355R GGGATTTGACTGTAATGTGCT 16268F CACTAGGATACCAACAAACC 161 53 16429R GCGGGATATTGATTTCACGG 00008F GGTCTATCACCCTATTAACCAC 143 55 00151R GGATGAGGCAGGAATCAAAG 00120F CGCAGTATCTGTCTTTGATT 167 51 00287R TTGTTATGATGTCTGTGTGG Archaeol Anthropol Sci (2012) 4:303–311 307

Table 4 Results of ancestry determination of the individuals at Jackson Street Burials

Burial # Right femur Left femur Cranial traits Ancestry assessment APD MLD PI APD MLD PI

2 N/A N/A N/A 28.9 33.9 85.3 Blunt chin, no gonion eversion Non-Native American 3 24.7 29.6 83.4 20.6 29.3 70.3 Blunt chin, no gonion eversion Native American 10 21.6 30.4 71.1 N/A N/A N/A Complex lambdoidal suture with wormian bones Native American

APD anterior–posterior diameter, MLD medial–lateral diameter, PI Platymeric Index

Molecular results the genetic results, which was successful for eight out of 11, and four extracts did not amplify for parts of the control We successfully obtained sequences from eight individuals, region. Furthermore, additional typing for autosomal or Y- burials 2–9 (Table 5). These samples showed clear sequence chromosomal markers was determined unfeasible based on readings with no double peaks or signs of contamination, the poor quality of the materials and results. Of the eight yielded consistent results from different extracts for each haplotypes identified, only two individuals shared the same specimen and PCR reactions, and did not match any of the maternal lineage. researchers. Extracts from burials 1 and 10 failed to amplify Of the 11 individuals examined, the individual from consistently and produce reliable sequence results. The se- burial 2 was separately located from the other ten, referred quence results for burial 13 showed contamination, produc- to as “area B” in the illustration of the site (Fig. 1). This ing double peaks in sequence signals. Overall, haplotypes of individual was one of the three that was successful in all at least four individuals belonged to common maternal analyses applied in our study. The mtDNA haplotype of the lineages for Native Americans (Bandelt et al. 2003), includ- individual from burial 2 (haplogroup H) belongs to a com- ing three individuals assigned to haplogroup A2 and one to mon maternal lineage found among Europeans (Achilli et al. haplogroup C1. In addition, two individuals belonged to 2004; Loogväli et al. 2004). Carabelli’s cusp, suggestive of haplogroup M8, one to haplogroup H, and one to macro- European descent, was absent in this individual, but this is haplogroup N. Of the three individuals assigned to hap- shown to have varying frequencies among populations logroup A2, two individuals (burials 8, 9) shared the same (Hanihara 2008). The two observable non-metric cranial haplotype. Individuals from burials 4 and 6 showed almost traits suggest that this individual may have had both identical mutations except for the presence of a mutation at European (straight gonion angle) and Native American np 153 (burial 4). Although exhibiting the mutation at np (blunt chin) ancestry. While further traits were not available 16327 that is typical for haplogroup C, the two haplotypes for observation, we suggest this individual had maternal were missing the deletion at np 249 that is diagnostic for the European ancestry with a possibility of admixture from the Native American lineage. Further typing of the coding re- paternal lineage based on the mixed osteological traits. gion may have clarified the classification, but unfortunately, Furthermore, based on the separate location of the burial, this option was not feasible. Thus, we assigned these two the degree of relationship between this male individual and individuals to haplogroup M8. The individual assigned to the others from Jackson Street remains unclear. haplogroup H (burial 2) harbored mutations at nps 16201, Ten individuals were buried in “area A,” which consisted 16217, 16311, and 16377, and further refinement into one of of four adult females and six children (Fig. 1). We success- the subclades for H would require additional typing in the fully obtained reliable mtDNA results for seven individuals, mtDNA coding region. Based on the mutation at np 16223 of which six showed haplotypes indicating Native for the individual from burial 7, we can only identify it American/Asian ancestry. Two adult females (burials 3 and belonging to macrohaplogroup N. 8) and one child (burial 9) had haplotypes assigned to haplogroup A2, and one female (burial 8) and the child shared the same haplotype. Based on the mtDNA results, Discussion it is possible that this may be a mother and child and also a maternal aunt and niece/nephew. However, the adult female This study carried out osteological and genetic analyses for from burial 8 did not display shovel-shaped incisors, in 11 individuals from the Jackson Street Burials. Dental traits contrast to the child. The child was buried next to the adult were observed for all individuals, but osteological measure- female in burial 10, whose haplotype was not determined. ments were only possible for three due to poor preservation Some osteological measurements were possible for burial of the skeletal remains. The preservation likely influenced 10, which are suggestive of Native American ancestry 308 Archaeol Anthropol Sci (2012) 4:303–311

N (Tables 4 and 6). While it is difficult to infer familial relations between burials 8–10 due to the lack of data, based on the burial proximity and similar estimated age for both females, if we suggest a possible mother–child relationship for burial 9 and 10, it may be more likely that the female from burial 8 was a maternal aunt to the child. The other haplogroup A2 was identified in the adult female from burial 3, for which osteological measurements for ancestry assessment were possible. The individual from burial 3 displayed shovel-shaped incisors and did not dis- denotes region that was not sequenced play Carabelli’s cusp on the maxillary first molars, which is “–” consistent with a Native American maternal lineage from the mtDNA. The PI values from both femurs were also consistent with a Native American ancestry. The higher PI ..CGG..GA2 ..CGG..GA2 .....Del.GC1 value of 83.4 for the right femur may be due to environ- mental (biomechanical) influences, in which this individual may have been involved in an activity favoring the right side that altered the proximal femoral shape. Although the two ––– ––– ––––––––––– ––– non-metric cranial traits were conflicting, based on the dental traits and mtDNA results, we suggest that this individual had maternal Native American ancestry with possible admixture from the paternal side. The three remaining haplotypes from “area A” were identified in three children (burials 4–6) that were assigned to haplogroup M8 (burials 4 and 6) and C1

00287) sequences obtained from each individual (burial 5). While haplogroup M has been identified – among prehistoric North Americans (Malhi et al. 2007), M8 has not been found among Native Americans but is frequent among Siberian populations (Starikovskaya et

16429, 00008 al. 2005). Dental traits of the children in burials 4 and ...... T...... GH – 6 suggest Native American/Asian ancestry, and based on the historical information, it seems more likely these children were of maternal Native American ancestry than Asian. However, we stress that further confirmation is necessary to explore the possible presence of M8 line- indicates the same nucleotide as the rCRS (revised Cambridge Reference Sequence), and ” · ages among Native Americans. On the other hand, the “ C1-haplotype of the child from burial 5 indicates maternal Native American ancestry, but the absence of shovel- shaped incisors may suggest possible admixture from the paternal side. This discrepancy between the genetic and osteological results may also highlight the complex relationship in the expression of morphological traits. Furthermore, it is possible that the other females (burials 1 and 10) shared maternal lineages with the three children, but we were unable to successfully obtain mtDNA results for the two female individuals. Another child from “area A” (burial 7) only had a mutation np 16223, which alone is not specific to Native Americans and appears in many haplotypes across different populations. This individual had both shovel-shaped inci- Polymorphic sites table for successful mtDNA control region (nps 16036 sors and Carabelli’s cusp. Thus, while this child may not

Deletion have had maternal Native American ancestry, it is possible Del Burial 9 TNucleotide changes are indicated by the specific abbreviation, . . T . T . . A C . C . Burial 8 T . . T . T . . A C . C . Burial 6Burial 7 ...... T T . . . . C . . . . C T . . . G ...... G M8 IDrCRS 16111Burial 16201 2 C 16217Burial 3 16223 .Burial 4 16256 T C 16290Burial 5 16298 . T 16311 . T . 16319 T 16325 . 16327 C . . 16362 . 16377 . C 64 T . 73 94 . T C 141 . T 143 146 . T . 153 T T 235 249 T . . 253 . . 263 G C C C . T . . A C . C . T C . C C T C C T A G . . . C G . T . G T . A A G T A . . A . C C . G A G . HG . G . . G . A2 . G M8 Table 5 the child either had paternal Native American ancestry or at Archaeol Anthropol Sci (2012) 4:303–311 309

least shared a close social or cultural affinity with the other individuals based on the fact they were buried together. Native Americans currently located in the region of the Jackson Street Burials are mainly descendants of the Seneca tribe (Abler and Tooker 1978), and the presence of hap- Asian

Probable Native American/ N/A logroups A2 and C1 is consistent with our current understanding of the Native American maternal genetic landscape. Haplogroup A shows a high frequency in eastern North America, while haplogroup C is said to be fairly American American/ Asian N/A N/A Native uniform in frequency across North America (Malhi et al. 2002). Genetic data are relatively lacking among northeastern Native American groups, but previously published data American American/ Asian that include the Mohawk and Ojibwa show that the frequen- Native Native cy of haplogroup A reaches 45–50 %, while haplogroup C is 13–19 % (O’Rourke et al. 2000). Overall, our results show that except for the male indi- American European vidual in burial 2, the remaining ten individuals at Jackson Probable Street have evidence of Native American ancestry. These identified Native American remains from our study were made available for repatriation in addition to the two burials identified during excavation. Still, we cannot completely rule out the possibility that the male individual from burial 2 may have been paternally related to the children and/or Asian Non-Native American Native Probable Native American/ had significant social or biological relations to one of the adult females. During the eighteenth–nineteenth centuries in this region, people of European descent and the local Native Americans interacted frequently, and marriages between Siberian American/ Asian East Asian/ Native these two groups often occurred (Peterson 1981;Pascoe 1991). In addition, documentation of “Praying Towns” from other excavations, in which Native American women out- numbered the men, may account for the diverse maternal American European Native Probable lineages (7/8) present at Jackson Street (Baker 1994). Documentation suggests that missionaries were working with local Native Americans during the eighteenth– nineteenth centuries, and some were converting to Christianity and would have been buried accordingly in Siberian Asian Native American/ the west–east orientation (Abler and Tooker 1978). If these individuals were not Native American Christians but buried in such a manner, it is possible that the people who buried them were Christian, such as local missionaries.

Asian Furthermore, it is important to note that while these individ- Native American/ uals may or may not be biologically related, a shared cultural and/or historical affiliation is likely to have been an important factor at the Jackson Street Burials. European Probable

Conclusions

Our study shows how evidence from genetics and bioarch- Asian is used in circumstances of mixed dental ancestry traits aeology can be useful to understand individuals from un- ” Overall summary of results from dental, osteological, and mtDNA analysis known burials. We successfully obtained osteological

Not available measurements from three individuals and mtDNA haplo- Probable Osteology N/AmtDNA N/A European Native American N/A European Native American East Asian/ N/A N/A N/A N/A N/A Native N/A Table 6 Evidence Burial 1Dental Native American/ Burial 2 Burial 3 Burial 4“ Burial 5 Burial 6 Burial 7types from Burial 8 eight Burial individuals. 9 Burial 10 Burial 13 Among the eight mtDNA 310 Archaeol Anthropol Sci (2012) 4:303–311 haplotypes characterized, only two are identical that indi- Berg GE (2008) Biological affinity and sex determination using mor- cates the same maternal lineage. Overall, our results suggest phometric and morphoscopic variables from the human mandible. PhD Dissertation, University of Tennessee that ten of the 11 individuals show evidence of biological Cooper A, Poinar HN (2000) Ancient DNA: do it right or not at all. affinity with Native Americans. We note that these burials Science 289(5482):1139. doi:10.1126/science.289.5482.1139b date to a time when Native Americans and Europeans were Gilbert R, Gill GW (1990) A metric technique for identifying Amer- in constant contact and marriage between the two groups ican Indian femora. In: Gill GW, Rhine S (eds) Skeletal attribution of race: methods for forensic anthropology, vol 4. University of was likely. Utilizing a multifaceted approach through ar- New Mexico, Maxwell Museum of Anthropological Papers, chaeology, osteology, and genetics has not only directly Albuquerque, pp 97–99 enabled the repatriation of the additional Native American Gilbert MT, Bandelt HJ, Hofreiter M, Barnes I (2005) Assessing – remains, but also produced valuable results in understanding ancient DNA studies. Trends Ecol Evol 20(10):541 544. doi:10.1016/j.tree.2005.07.005 the broader historical context of the Jackson Street Burials. Giles RE, Blanc H, Cann HM, Wallace DC (1980) Maternal inheritance of human mitochondrial DNA. Proc Natl Acad Sci U S A 77 (11):6715–6719 Acknowledgments The authors would like to thank Stacy McGrath Hanihara T (2008) Morphological variation of major human popula- and Lisa Mandarino for their assistance with the molecular procedures tions based on nonmetric dental traits. Am J Phys Anthropol 136 and Jennifer Odien for assisting with the osteological measurements. (2):169–182. doi:10.1002/ajpa.20792 We are grateful to Elena Kouneski, who also assisted with the molec- Keller A, Graefen A, Ball M, Matzas M, Boisguerin V, Maixner F, ular procedures and provided constructive comments on the project Leidinger P, Backes C, Khairat R, Forster M, Stade B, Franke A, and Nicholas Passalacqua for generously reviewing earlier versions of Mayer J, Spangler J, McLaughlin S, Shah M, Lee C, Harkins TT, this article. We also thank James Hartner from the University at Sartori A, Moreno-Estrada A, Henn B, Sikora M, Semino O, Buffalo’s Archaeology Survey for providing firsthand knowledge on Chiaroni J, Rootsi S, Myres NM, Cabrera VM, Underhill PA, the excavation of Jackson Street Burials, as well as those who contrib- Bustamante CD, Vigl EE, Samadelli M, Cipollini G, Haas J, uted to the original archaeology report. This research was funded by Katus H, O’Connor BD, Carlson MRJ, Meder B, Blin N, Meese the University at Buffalo Graduate Student Association Mark Diamond E, Pusch CM, Zink A (2012) New insights into the Tyrolean Grant Fund, Grant no. Sp-08-04. Iceman’s origin and phenotype as inferred by whole-genome sequencing. Nat Commun 3:698. doi:10.1038/ncomms1701 Kemp BM, Smith DG (2010) Ancient DNA methodology: thoughts from Brian M. Kemp and David Glenn Smith on “Mitochondrial DNA of protohistoric remains of an Arikara population from South References Dakota”. Hum Biol 82(2):227–238. doi:10.3378/027.082.0207 Lawrence DM, Kemp BM, Eshleman J, Jantz RL, Snow M, George D, Smith DG (2010) Mitochondrial DNA of protohistoric remains of Abler T, Tooker E (1978) Seneca. In: Trigger BG (ed) Handbook of an Arikara population from South Dakota: implications for the North American Indians: Northeast, vol. 15. Smithsonian Institu- macro-Siouan language hypothesis. Hum Biol 82(2):157–178. tion, Washington, pp 509–511 doi:10.3378/027.082.0203 Achilli A, Rengo C, Magri C, Battaglia V, Olivieri A, Scozzari R, Lee EJ, Anderson LM, Dale V, Merriwether DA (2009) MtDNA Cruciani F, Zeviani M, Briem E, Carelli V, Moral P, Dugoujon origins of an enslaved labor force from the 18th century Schuyler JM, Roostalu U, Loogvali EL, Kivisild T, Bandelt HJ, Richards Flatts Burial Ground in colonial Albany, NY: Africans, Native M, Villems R, Santachiara-Benerecetti AS, Semino O, Torroni A Americans, and Malagasy? J Archaeol Sci 36(12):2805–2810. (2004) The molecular dissection of mtDNA haplogroup H con- doi:10.1016/j.jas.2009.09.008 firms that the Franco-Cantabrian glacial refuge was a major Loogväli EL, Roostalu U, Malyarchuk BA, Derenko MV, Kivisild T, source for the European gene pool. Am J Hum Genet 75 Metspalu E, Tambets K, Reidla M, Tolk HV, Parik J, Pennarun E, (5):910–918. doi:10.1086/425590 Laos S, Lunkina A, Golubenko M, Barac L, Pericic M, Balanovsky Andrews RM, Kubacka I, Chinnery PF, Lightowlers RN, Turnbull OP, Gusar V, Khusnutdinova EK, Stepanov V, Puzyrev V, Rudan P, DM, Howell N (1999) Reanalysis and revision of the Cambridge Balanovska EV, Grechanina E, Richard C, Moisan JP, Chaventre A, reference sequence for human mitochondrial DNA. Nat Genet 23 Anagnou NP, Pappa KI, Michalodimitrakis EN, Claustres M, Golge (2):147. doi:10.1038/13779 M, Mikerezi I, Usanga E, Villems R (2004) Disuniting uniformity: a Axtell J (1981) Last Rights: the acculturation of native funerals in pied cladistic canvas of mtDNA haplogroup H in Eurasia. Mol Biol colonial North America. In: Axtell J (ed) The European and the Evol 21(11):2012–2021. doi:10.1093/molbev/msh209 Indian: essays in the ethnohistory of colonial North America. Malhi RS, Eshleman JA, Greenberg JA, Weiss DA, Schultz Shook BA, Oxford University Press, New York, pp 110–128 Kaestle FA, Lorenz JG, Kemp BM, Johnson JR, Smith DG (2002) Baker BJ (1994) Pilgrim’s progress and praying Indians: the biocul- The structure of diversity within New World mitochondrial DNA tural consequences of contact in southern New England. In: haplogroups: implications for the prehistory of North America. Larsen CS, Milner GR (eds) In the wake of contact: biological Am J Hum Genet 70(4):905–919. doi:10.1086/339690 responses to conquest. Wiley-Liss, New York, pp 35–45 Malhi RS, Kemp BM, Eshleman JA, Cybulski J, Smith DG, Cousins S, Bandelt HJ, Herrnstadt C, Yao YG, Kong QP, Kivisild T, Rengo C, Harry H (2007) Mitochondrial haplogroup M discovered in pre- Scozzari R, Richards M, Villems R, Macaulay V, Howell N, historic North Americans. J Archaeol Sci 34(4):642–648. Torroni A, Zhang YP (2003) Identification of Native American doi:10.1016/j.jas.2006.07.004 founder mtDNAs through the analysis of complete mtDNA Marshall C, Tench PA, Cook DC, Kaestle FA (2011) Brief communica- sequences: some caveats. Ann Hum Genet 67(Pt 6):512–524. tion: conjoined twins at angel mounds? An ancient DNA perspective. doi:10.1046/j.1469-1809.2003.00049.x Am J Phys Anthropol 146(1):138–142. doi:10.1002/ajpa.21557 Bass WM (1995) Human osteology: a laboratory and field manual, 4th Mayhall J, Saunders S, Belier P (1982) The dental morphology of edn. Missouri Archaeological Society, Columbia North American whites: a reappraisal. In: Kurton B (ed) Teeth: Archaeol Anthropol Sci (2012) 4:303–311 311

form, function, and evolution. Columbia University Press, New K, Wallace DC (2005) Mitochondrial DNA diversity in indigenous York, pp 245–258 populations of the southern extent of Siberia, and the origins of O’Rourke DH, Hayes MG, Carlyle SW (2000) Spatial and temporal Native American haplogroups. Ann Hum Genet 69(Pt 1):67–89. stability of mtDNA haplogroup frequencies in native North Amer- doi:10.1046/j.1529-8817.2003.00127.x ica. Hum Biol 72(1):15–34 Turner CG (1987) Late Pleistocene and Holocene population history of Pascoe P (1991) Race, gender, and intercultural relations: the case of East Asia based on dental variation. Am J Phys Anthropol 73 interracial marraige. Frontiers 12(1):5–18 (3):305–321. doi:10.1002/ajpa.1330730304 Peterson J (1981) The people in between: Indian-White marriage and Wescott D, Srikanta D (2008) Testing assumptions of the Gilbert and Gill the genesis of a Metis society and culture in the Great Lakes method for assessing ancestry using the femur subtrochanteric region. PhD Dissertation, University of Illinois at Chicago shape. Homo 59(5):347–363. doi:10.1016/j.jchb.2008.05.002 Rayner-Herter NL (1997) Archaeological investigation of the Lower Winters M, Barta JL, Monroe C, Kemp BM (2011) To clone or not to River Road/Main Street project area including the Jackson Street clone: method analysis for retrieving consensus sequences in burial site (UB 2803) Village of Youngstown, Niagara County, ancient DNA samples. PLoS One 6(6):e21247. doi:10.1371/ New York. Report No. 16. Reports of the Archaeological Survey. journal.pone.0021247 State University of New York at Buffalo, Buffalo Wray CF (1982) Seneca glass trade beads, ca AD 1550-1820. In: Rhine S (1990) Non-metric skull racing. In: Gill GW, Rhine S (eds) Hayes CFI (ed) Proceedings of the 1982 glass trade bead confer- Skeletal attributions of race: methods for forensic anthropology, ence. Rochester Museum and Science Center, Rochester vol 4. University of New Mexico, Maxwell Museum of Anthro- Wray CF, Sempowski ML, Saunders LP, Cervone GC (1987) Charles pological Papers, Albuquerque F. Wray series in Seneca archaeology: the Adams and Culbertson Simon BG (1990) Native American culture change and persistence in sites. Report No. 19. Rochester Museum and Science Center, contact-period New England: analysis of mortuary data from a Rochester, NY praying Indian burial ground in Massachusetts. Paper presented at Yang DY, Eng B, Waye JS, Dudar JC, Saunders SR (1998) Technical note: the 55th Annual Meeting of the Society for American Archaeol- improved DNA extraction from ancient bones using silica- ogy, Las Vegas, 19 April 1990 based spin columns. Am J Phys Anthropol 105(4):539–543. Starikovskaya EB, Sukernik RI, Derbeneva OA, Volodko NV, Ruiz- doi:10.1002/(SICI)1096-8644(199804)105:4<539::AID- Pesini E, Torroni A, Brown MD, Lott MT, Hosseini SH, Huoponen AJPA10>3.0.CO;2-1