DOCSLIB.ORG

A Second Lineage of Mammalian Major Histocompatibility Complex Class I Genes SEIAMAK BAHRAM*, MAUREEN BRESNAHAN*, DANIEL E

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A Second Lineage of Mammalian Major Histocompatibility Complex Class I Genes SEIAMAK BAHRAM*, MAUREEN BRESNAHAN*, DANIEL E Proc. Nati. Acad. Sci. USA Vol. 91, pp. 6259-6263, July 1994 Immunology A second lineage of mammalian major histocompatibility complex class I genes SEIAMAK BAHRAM*, MAUREEN BRESNAHAN*, DANIEL E. GERAGHTYt, AND THOMAS SPIES* *Diision of Tumor Virology, Dana-Farber Cancer Institute, Harvard Medical School, 44 Binney Street, Boston, MA 02115; and tHuman Immunogenetics Program, Fred Hutchinson Cancer Research Center, 1124 Columbia Street, Seattle, WA 98104 Communicated by Sherman M. Weissman, January 3, 1994 ABSTRACT Major sctibit complex (MHC) polymorphic antigen-presenting molecules (2). The physio- class I genes tpically encode polymorphic peptide-binding logical roles of HLA-E and -F are uncertain (14, 15), but chains which are ubi ly expressed and mediate the HLA-G may have a specific function at the maternal-fetal recognition of intr rtigens by cytotoxic T cells. They interface (16). In addition, the MHC contains a number of constte diverse gene fme in different species and include class I pseudogenes and gene fragments (17); however, all of the numerous cd n acal genes in the mouse H-2 the human class I sequences share close relationships indi- coplex, of which some have been adapted to variously mod- cating their common origin from a typical class I gene. ified hmctions. We have identified a d nt family of five In this report, we describe a family of sequencest in the related sequenes in the human MHC whicb are distntly human MHC which are highly divergent from al of the homologous to dass I i. These MIC genes (MHC class I known MHC class I chains and have presumably been chain-related genes) evolved in parallel with the human class I derived early in the evolution of mammalian class I genes. genes and with those of most Ifnot all ma orders. The The MICA gene (MHC class I chain-related gene A) in this MICA gene in this family Is located near HLA-R and is by far family was identified in a search of the HLA-B region for the most divergent m an MHC dass I gene known. It Is other expressed genes. This work was motivated by the still further by It unusual exon4ntron onition unexplained association of HLA-B27 with rheumatoid and and preerential essin fibroblasts and epithlial clls. inflammatory diseases. The uncommon organization of the However, the pence of disc residues in the MICA MICA gene, its restricted expression, and the characteristic amino acid sequence t ted from cDNA suggess that the amino acid sequence of its product, all indicate that the putative MICA chain fods imirly to typical class I chains putative MICA chain has evolved for afunction that is related and may have the capacity to bind peptide or other short to but is quite distinct from that of typical MHC class I Uganda. These results dine a second lineag of evolutionarily chains.§ conserved MHC cla I -gee. This Implies that MICA and bly other members In this family have been selected for MATERIALS AND METHODS specialied f tios that are either ancient or derived from those of typical MHC class I genes, in analogy to some of the Isolaton of MICA and MICB DNA Sequences. MICA and mouse H-2 gen. MICB cDNA clones were isolated from IMR90 human lung fibroblast (Clontech) and keratinocyte (18) libraries with a Typical class I genes in the major histocompatibility complex total insert probe prepared from cosmid M32A (19) by (MHC) ofall vertebrate species encode membrane-anchored described procedures (19). The closely related MICA and cell surface glycoproteins of about 44 kDa that are nonco- MICB cDNA clones of 1.4 and 2.4 kb, respectively, were valently associated with P2-microglobulin (1, 2). These mol- assigned to their corresponding genomic locations by blot ecules are receptors for intracellular peptides, which they hybridization with the previously cloned and mapped present to cytotoxic T cells with a# antigen receptors, thus cosmids R9A, RSA, K7A, and M32A (19), by comparison of facilitating the immune recognition ofintracellular pathogens cDNA and genomic DNA sequences, and by sequencing and altered self-proteins. Characteristic oftypical MHC class across intron-exonjunctions. Selected amino acid sequences I chains is their polymorphism, which correlates with the were aligned by using the EUGENE program package (Baylor ability of various alleles to bind peptides with different College of Medicine, Houston). sequence motifs (3). At least to some extent, the allelic DNA and RNA Blot Hybiion . Preparations of DNA repertoire ofatypical class I chain represents an evolutionary from human B-cell lines andfrom yeast artificial chromosome record of past pathogen-driven selection (4). This principle (YAC) clones and ofRNA from various human cell lines were may also be accountable for the diversity of MHC class I according to standard protocols (20). All cell lines were from genes among different species and, in several cases, for their the American Type Culture Collection or the Tenth Interna- adptation to specialized functions. But such examples have tional Histocompatibility Workshop (21). Primate DNA sam- so far only been found in the mouse. In addition to the typical ples were a gift from D. Watkins (University of Wisconsin). class I H-2K, -D, and -L genes, the mouse H-2 complex YAC clones Y2, Y3, Y17, Y18, Y19, Y22, and Y23 have been includes numerous of the nonclassical Q., T, and M genes published (22, 23); Y24, Y25, Y36, Y37, Y38, Y67, Y54, and (5-8). Ofthese, some ofthe Tgenes encode ligands forT cells Y53 are from unpublished work (D.E.G.). Blot transfer and with yS antigen receptors (9, 10) and the M3 gene product hybridization of DNA restriction fragments and RNA with specifically presents N-formylated peptides of bacterial and [a-32P~dCTP-labeled MICA cDNA were according to stan- mitochondrial origin (11, 12). dard procedures (20). For Fig. 2, RNA samples of 20 pg per The human MHC contains within about 2 megabases six class I genes (13), of which HLA-A, -B, and -C encode the Abbreviations: MHC, major histocompatibility complex; YAC, yeast artificial chromosome. tThe Human Gene Mapping Workshop symbols for these loci are The publication costs ofthis article were defrayed in part by page charge MICA, MCIB, MICC, MICD, and MICE. payment. This article must therefore be hereby marked "advertisement" *The sequence reported in this paper has been deposited in the in accordance with 18 U.S.C. §1734 solely to indicate this fact. GenBank data base (accession no. L14848). 6259 Downloaded by guest on September 26, 2021 6260 Immunology: Bahram et al. Proc. Natl. Acad. Sci. USA 91 (1994) lane were fractionated in 1% agarose/2.2 M formaldehyde DNA encoding MICB. PCR was carried out using GeneAmp gels before blot transfer. Hybridization and washes were reagents and AmpliTaq DNA polymerase (Perkin-Elmer/ under stringent conditions (19). For Fig. 6A, the final wash Cetus), 0.5 pg oftemplate DNA, and 25 pmol ofeach primer. was in 0.5x standard saline citrate (SSC; ref. 20) with 0.1% Samples were subjected to 40 cycles ofPCR with intervals at NaDodSO4 at 65°C. For Figs. SA and 6B, low-stringency 940C (1 min), 550C (1 min), and 720C (2 min) and the products conditions were employed. DNA blots were hybridized in 5 x were directly cloned into the TA vector pCRII (Invitrogen). SSC containing 50% formamide, 50 mM Tris (pH 7.5), 10 mM Sequences were obtained from double-stranded templates by Na4P2O7, 5 mM EDTA, 0.2%o bovine serum albumin, 0.2% using flanking SP6 and T7 primers (Promega) and several Ficoll, 0.2% polyvinylpyrrolidone, 1% NaDodSO4, 5% dex- oligonucleotides derived from MICA intron sequences. tran sulfate, and sonicated salmon sperm DNA (150 Pg/ml) These were 42 bp 3' of the al exon (3'-GTCTTTTCAATC- for 16 hr at 37°C. Filters were washed in 2x SSC with 0.1% CCCGTC-5'), 39 and 40 bp 5' and 3' of the a2 exon, NaDodSQ4 at 37°C. respectively (5'-TCACTTGGGTGGAAAGGTGAT-3' and Cloning and Sequencing of MICA Agcic Variants. MICA 3'-ACGATCTCAACGGAGTGGAGG-5'), and 40 bp 5' of fragments of 2250 bp including the al, a2, and a3 domains the a3 exon (5'-GTTCCTCTCCCCTCCTTAGA-3'). All of were amplified by the polymerase chain reaction (PCR) from the MICA alleles were verified by sequencing ofat least three genomic DNA of the HLA homozygous typing cell lines clones derived from two independent PCR products. EJ32B, MOU, PITOUT, and YAR (21). The oligonucleotides selected for PCR were derived from the 5' end ofthe al exon (5'-GAGCCCCACAGTCTTCGT-3') and the transmembrane RESULTS AND DISCUSSION sequence (3'-TGTAAGGTACAAAGACGAC-5') of MICA We have used previously cloned cosmids from the 170-kb and were tested with cosmid M32A DNA as a template. With interval between HLA-B and BAT] at the centromeric end of this primer pair, no fragment was amplified from cosmid R9A the MHC class I region (19) to screen various human cDNA A BATI MICB 15 MICA 17 HLA-B _n_m - _ p> - R9A K7A - R5A - M32A 20 kb '-' | FIG. 1. (A) Localization of MICA B and MICB in previously cloned L al a2 a3 TM CY'/3'UT cosmids. From a contiguous series, only the cosmids relevant here- I- I MICA R9A, R5A, K7A, and M32A-are shown; for a restriction map, see ref. 19. Black and shaded boxes on top L CY3'UT 2 kb line correspond to genes; open boxes I i MHC-I labeled 15 and 17 indicate short class I-like gene fragments contained in C Xba I and Pst I restriction fragments EXON 1 of 1.5 and 1.7 kb, respectively. Ar- CACTGCTTGAGCCGCTGAGAGGGTGGCGACGTCGGGGCCATGGGGCTGGGCCCGGTCTTCCTGCTTCTGGCTGGCATCTTCCCT 'TTTGCACCT rows show transcriptional orienta- -23 M G L G P V F L LL A G I F P F A P tions of Exon-intron EXON 2 L genes.
Load more

Recommended publications
  • High-Allelic Variability in HLA-C Mrna Expression: Association with HLA-Extended Haplotypes
    Genes and Immunity (2014) 15, 176–181 & 2014 Macmillan Publishers Limited All rights reserved 1466-4879/14 www.nature.com/gene ORIGINAL ARTICLE High-allelic variability in HLA-C mRNA expression: association with HLA-extended haplotypes F Bettens1,2, L Brunet1,2 and J-M Tiercy1 Human leukocyte antigen (HLA)-C is a clinically relevant transplantation antigen in unrelated hematopoietic stem cell and cord blood transplantation. Furthermore, HLA-C antigens, as ligands for killer immunoglobulin-like receptors expressed on natural killer cells, have a central role in HIV control. Several studies have reported significant correlations between HLA-C mRNA and cell surface expression with polymorphisms in the 50- and 30-regions of the HLA-C locus. We determined HLA-C mRNA in blood donors by using locus as well as allele-specific real-time–PCR and focused the analysis on HLA-extended haplotypes. High inter-individual variability of mRNA expression was disclosed. A lower inter-individual variability for C*07:01 but a higher variability for C*06:02, C*04:01 and C*03:04 alleles were detected. The previously reported associations between HLA-C cell surface expression and À 32 kb/ À 35 kb single nucleotide polymorphisms were not confirmed. Related and unrelated individuals sharing the same two A-B-C-DRB1 or B-C haplotypes show strikingly similar levels of HLA-C mRNA expression in each of the different haplotypic combinations tested. Altogether, our results suggest that HLA-C expression levels best correlate with the extended HLA haplotype rather than with the allotype or with polymorphisms in the 50-region of the HLA-C locus.
    [Show full text]
  • HLA-DPB1 Gene Major Histocompatibility Complex, Class II, DP Beta 1
    HLA-DPB1 gene major histocompatibility complex, class II, DP beta 1 Normal Function The HLA-DPB1 gene provides instructions for making a protein that plays a critical role in the immune system. The HLA-DPB1 gene is part of a family of genes called the human leukocyte antigen (HLA) complex. The HLA complex helps the immune system distinguish the body's own proteins from proteins made by foreign invaders such as viruses and bacteria. The HLA complex is the human version of the major histocompatibility complex (MHC), a gene family that occurs in many species. The HLA-DPB1 gene belongs to a group of MHC genes called MHC class II. MHC class II genes provide instructions for making proteins that are present on the surface of certain immune system cells. These proteins attach to protein fragments (peptides) outside the cell. MHC class II proteins display these peptides to the immune system. If the immune system recognizes the peptides as foreign (such as viral or bacterial peptides), it triggers a response to attack the invading viruses or bacteria. The protein produced from the HLA-DPB1 gene attaches (binds) to the protein produced from another MHC class II gene, HLA-DPA1. Together, they form a functional protein complex called an antigen-binding DPab heterodimer. This complex displays foreign peptides to the immune system to trigger the body's immune response. Each MHC class II gene has many possible variations, allowing the immune system to react to a wide range of foreign invaders. Researchers have identified hundreds of different versions (alleles) of the HLA-DPB1 gene, each of which is given a particular number (such as HLA-DPB1*03:01).
    [Show full text]
  • HLA on Chromosome 6: the Story Gets Longer and Longer Leslie J
    COMMENTARY HLA on Chromosome 6: The Story Gets Longer and Longer Leslie J. Raffel,1 Janelle A. Noble,2 and Jerome I. Rotter1 within the MHC has played a substantial role in allowing disease linkages and associations to be detected. The early ver the past three decades, substantial progress studies that reported associations with HLA-B8 and -B15 has been made in understanding the genetic used remarkably small numbers of cases and controls basis for diabetes. One of the important first relative to the hundreds to thousands considered neces- Osteps that allowed this progress to occur was sary in current studies (4–6). Had it not been for the realizing that diabetes is heterogeneous, and, therefore, strong LD, those initial studies would have been unlikely separation of clinically distinct forms of the disorder (i.e., to yield positive results. Yet, at the same time, this LD has type 1 vs. type 2 diabetes) improves the ability to detect also created challenges in accomplishing the next step, genetic associations. The key points that allowed type 1 that of identification of the specific genes that are respon- diabetes to be separated from type 2 diabetes included sible for disease susceptibility. The fact that researchers realization of the clinical differences (typically childhood have spent Ͼ30 years trying to elucidate all of the loci onset, thin, ketosis-prone versus adult onset, obese, non- responsible for type 1 diabetes susceptibility in the HLA ketosis prone); family and twin studies that demonstrated region underscores the complexity
    [Show full text]
  • Histocompatibility Antigens
    HISTOCOMPATIBILITY ANTIGENS 2 CRAIG 1. TAYLOR 1 and PHILIP A. DYER Cambridge and Manchester Keratoplasty is a well-established method for the are similar for corneal grafts and other forms of treatment of irreversible corneal opacity, ocular allotransplantation.12,13 disease and injury. For primary transplants in patients with avascular corneal beds (usually asso­ HLA SYSTEM ciated with keratoconus) success rates are relatively The dominant antigenic stimulus for allograft rejec­ high when compared with other forms of organ tion and antibody production is the MHC (major transplantation, with 90-95% 1 year graft survival. I histocompatibility complex). In humans this is known This is achieved even in the absence of intensive as the HLA (human leucocyte antigen) system, The systemic immunosuppression, reflecting the view that products of the MHC genes control T cell antigen the avascular cornea enjoys some degree of recognition. Evidence that HLA is the human MHC 'immunological privilege'. However, even in this came from early kidney transplants performed using situation some 10% of patients undergo a rejection related donors. Graft survival was shown to correlate episode of which up to half may progress to with the number of HLA haplotypes shared between irreversible clouding and graft failure?,3 the donor and recipient, with 90% 1 year graft In contrast, for patients with a vascularised corneal survival between HLA-identical siblings. The 10% of bed a different picture emerges, with 35% graft loss transplant failures despite immunosuppression, is in the first year following transplantation.4 This thought to represent multiple minor histocompat­ ibility antigen differences. situation is more closely analogous to solid organ The HLA system is a complex mUltigene family transplants where vascularisation enables access of consisting of more than 10 loci coded for on the short the host immune system, with a concomitant arm of chromosome 6.
    [Show full text]
  • Biological Consequences of Major Histocompatibility Class-II Expression by Tumor Cells in Cancer
    Author Manuscript Published OnlineFirst on November 21, 2018; DOI: 10.1158/1078-0432.CCR-18-3200 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Biological Consequences of Major Histocompatibility Class-II Expression by Tumor Cells in Cancer Running Title: Biological Consequences of MHC-II Expression by Tumor Cells Margaret L. Axelrod1,2, Rebecca S. Cook2,3,4,5, Douglas B. Johnson1,5, and Justin M. Balko*1,2,5 Affiliations: Department of Medicine, Vanderbilt University Medical Center1; Cancer Biology Graduate Program2, Department of Cell and Developmental Biology3, and Department of Biomedical Engineering4, Vanderbilt University, and the Vanderbilt-Ingram Cancer Center5, Nashville, TN 37232 Acknowledgments: This article is supported by the U.S. Department of Defense (BC170037; J. M. Balko) and the National Institute of General Medical Sciences (T32GM007347; M. L. Axelrod). Conflicts and Disclosures: D. B. Johnson reports receiving commercial research grants from Bristol-Myers Squibb and Incyte, is a consultant/advisory board member for Array, Bristol-Myers Squibb, Genoptix, Merck, Incyte, and Novartis, and is inventor on a provisional patent on the use of MHC-II as a biomarker of immunotherapy response. J. M. Balko is a consultant/advisory board member for Novartis, reports receiving commercial research grants from Incyte, Bristol- Myers Squibb, and Genentech, and is inventor on a provisional patent on the use of MHC-II as a biomarker of immunotherapy response and a patent on HLADR as a biomarker for ICI response. No potential conflicts of interest were disclosed by the other authors. Downloaded from clincancerres.aacrjournals.org on October 2, 2021.
    [Show full text]
  • Orientation of Loci Within the Human Major Histocompatibility Complex by Chromosomal in Situ Hybridization (Human Leukocyte Antigen/Gene Mapping) CYNTHIA C
    Proc. Nati. Acad. Sci. USA Vol. 81, pp. 2816-2820, May 1984 Genetics Orientation of loci within the human major histocompatibility complex by chromosomal in situ hybridization (human leukocyte antigen/gene mapping) CYNTHIA C. MORTON*t, ILAN R. KIRSCHt, WALTER E. NANCE*, GLEN A. EVANS§, ALAN J. KORMAN¶, AND JACK L. STROMINGER¶ *Department of Human Genetics, Medical College of Virginia, Virginia Commonwealth University, Richmond, VA 23298; tNational Cancer Institute, Navy Medical Oncology Branch, The National Naval Medical Center, Building 1, Room 415, Bethesda, MD 20814; §The Cancer Biology Laboratory, The Salk Institute, San Diego, CA 92138; and ¶Fairchild Biochemistry Building, Harvard University, 7 Divinity Avenue, Cambridge, MA 02138 Contributed by Jack L. Strominger, December 29, 1983 ABSTRACT We have determined the localization and ori- with closely linked markers such as glyoxylase 1 (GLO 1) entation of two genetic probes within the human major histo- have permitted inferences to be drawn about the order and compatibility complex by chromosomal in situ hybridization. map distances between marker loci on the proximal portion Our data indicate that a cloned genomic probe cross-hybridiz- of the short arm of chromosome 6, as follows: GLO 1-4 ing to HLA-A, -B, and -C heavy chain loci is homologous to centimorgans (cM)-HLA-DR-0.3 cM-BF, C4B, C4A, sequences located on chromosome 6 at band p21.3 while a sub- C2-0.7 cM-HLA-B-0.1 cM-HLA-C-0.7 cM-HLA-A clone of the genomic HLA-DR a-chain gene corresponding to (16-18). the nonpolymorphic p34 protein is homologous to sequences in Improvements in chromosomal in situ hybridization have band 6p21.1.
    [Show full text]
  • Major Histocompatibility Antigens and Antigen-Processing Molecules in Uveal Melanoma1
    Vol. 9, 4159–4164, September 15, 2003 Clinical Cancer Research 4159 Major Histocompatibility Antigens and Antigen-processing Molecules in Uveal Melanoma1 Subramanian Krishnakumar, Dhiraj Abhyankar, tigens and the APM was seen in nonepithelioid cell melano- Amirtha Lakshmi Sundaram, mas. There was no correlation with largest tumor diameter. Conclusions: Our data suggest decreased expression of Vaijayanthi Pushparaj, HLA, and APM are seen in uveal melanomas with no ex- Mahesh Palanivelu Shanmugam, and trascleral extension and in nonepithelioid cell melanomas. 2 Jyotirmay Biswas Decreased expression of APM may contribute to decreased Department of Ocular Pathology [S. K., A. L. S., V. P., J. B.] and HLA class I antigen expression. Ocular Oncology [M. P. S.], Medical and Vision Research Foundations, Sankara Nethralaya, Chennai, 600 600, India, and Department of Immunology, Roswell Park Cancer Institute, Buffalo, INTRODUCTION New York 142631 [D. A.] Uveal melanoma is the commonest primary intraocular tumor in Caucasian adults, with an incidence rate of 0.7/100,000. The average survival rate after the diagnosis of ABSTRACT metastatic disease, usually in the liver, is between 2 and 7 Purpose: Malignant transformation of cells is fre- months. No effective treatment for metastatic disease is yet quently associated with abnormalities in the human leuko- available (1). The therapy of uveal melanoma remains problem- cyte antigen (HLA) expression. These abnormalities may atic because of the high rate of metastatic dissemination, irre- play a role in the clinical course of the disease, because HLA spective of the success of treatment of the primary tumor. When antigens mediate interactions of tumor cells with T cells and metastatic disease is diagnosed, patient survival is usually Ͻ1 natural killer cells.
    [Show full text]
  • HLA – Basics (Or How to Recognize “Self”)
    HLA – Basics (or how to recognize “self”) Directors’ Affairs Committee plus others (with our gratitude) Overview • Some Definitions – MHC and HLA – Class I and Class II – Nomenclature • Class II extended haplotypes • HLA Typing Technology • HLA Immunogenicity • Solid Phase Antibody detection methods • HLA and Disease Associations • HLA and Pharmacogenetics • Review 2 Human Leukocyte Antigens Polymorphism slide-new alleles each year 3 Major Histocompatibility Complex (MHC) • MHC in humans is named “Human Leukocyte Antigens” (HLA) as they were first defined on the surface of peripheral blood leukocytes • HLA Class I in humans is found on virtually all nucleated cells and platelets • HLA Class II (constitutive expression) is restricted to specialized cells of the immune system (macrophages, B cells, etc.) • HLA genes are highly polymorphic 4 HLA Protein Structure CD8 Tcell cytosol • Class I is heterodimeric with a polymorphic alpha chain and a plasma membrane common beta-2 microglobulin – Alpha chain is composed of 3 TCR extra-cellular domains ( α1, α2, and α3) – α1 and α2 form a groove like structure with a floor of β α2 α1 pleated sheets and ridges of α helices CD8 – presents peptides derived from α3 β2 m internal cellular proteins to the T cell receptor of CD8 T cells. plasma membrane – involved in the immune response cytosol against intra-cellular parasites, Antigen Presenting Cell viruses and cancer 5 HLA Class I Molecule Influenza M1 A view down the peptide groove of an HLA-A2 ααα1 domain molecule ααα2 domain βββ2 microglobulin ααα3
    [Show full text]
  • Histocompatibility Y Antigen Compatibility and Allograft Rejection
    Histocompatibility Y KENJI INOUE, SHIRO AMANO, TETSURO OSHIKA, TADAHIKO TSURU antigen compatibility and allograft rejection in corneal transplantation Abstract Rejection is triggered when the host lymphocytes recognise the major and minor Purpose To assess the effects of histocompatibility antigens expressed by cells of histocompatibility Y (H-Y) antigen matching the corneal grafts. In humans, the effects of on the rate of corneal allograft rejection after matching of the major histocompatibility penetrating keratoplasty (PKP). complex (MHC) in corneal transplantation are Methods We retrospectively investigated the subject to controversy?-9 Some previous studies graft survival rate and rejection-free graft have reported that the matching of HLA- and survival rate after PKP in 396 eyes. The A-B antigens decreases the rate of graft compatible combinations of H-Y antigen . reJectIOn,. 37- wh ere as ot h ers reported that the included male donors and male recipients (n = matching of HLA-A, -B and -DR antigens does 135), female donors and male recipients (n = not decrease the rate of allograft rejection.8,9 107), and female donors and female recipients Histocompatibility Y (H-Y) antigen is a male­ (n = 60). Incompatible combination was from specific minor histocompatibility antigen and male donors and female recipients (n = 94). was originally found as a transplantation The eyes were classified into two groups - antigen by Eichwald and Slimser in 1955.10 They high-risk (168 eyes) and low-risk (228 eyes) - found that skin grafts from male donors could depending on the degree of vascularisation in K. Inoue be rejected by female recipients from certain the recipient corneas or a history of previous Department of strains of inbred mice.lO The term H-Y antigen Ophthalmology allograft rejection.
    [Show full text]
  • Ncomms8146.Pdf
    ARTICLE Received 8 Feb 2015 | Accepted 7 Apr 2015 | Published 21 May 2015 DOI: 10.1038/ncomms8146 OPEN Major histocompatibility complex associations of ankylosing spondylitis are complex and involve further epistasis with ERAP1 Adrian Cortes1,SaraL.Pulit2,PaulJ.Leo1, Jenny J. Pointon3, Philip C. Robinson1, Michael H. Weisman4,MichaelWard5, Lianne S. Gensler6, Xiaodong Zhou7, Henri-Jean Garchon8,9, Gilles Chiocchia8, Johannes Nossent10,11,BenedicteA.Lie12,13, Øystein Førre14, Jaakko Tuomilehto15,16,17, Kari Laiho18, Linda A. Bradbury1, Dirk Elewaut19,20, Ruben Burgos-Vargas21, Simon Stebbings22, Louise Appleton3,ClaireFarrah3, Jonathan Lau3,NigilHaroon23, Juan Mulero24, Francisco J. Blanco25, Miguel A. Gonzalez-Gay26,C.Lopez-Larrea27,28,PaulBowness3, Karl Gaffney29, Hill Gaston30,DafnaD.Gladman31,32,33, Proton Rahman34, Walter P. Maksymowych35,J.BartA.Crusius36, Irene E. van der Horst-Bruinsma37, Raphael Valle-On˜ate38, Consuelo Romero-Sa´nchez38, Inger Myrnes Hansen39, Fernando M. Pimentel-Santos40, Robert D. Inman23,JavierMartin41, Maxime Breban8,42,BryanPaulWordsworth3, John D. Reveille7, David M. Evans1,43,44,PaulI.W.deBakker2,45 & Matthew A. Brown1 Ankylosing spondylitis (AS) is a common, highly heritable, inflammatory arthritis for which HLA-B*27 is the major genetic risk factor, although its role in the aetiology of AS remains elusive. To better understand the genetic basis of the MHC susceptibility loci, we genotyped 7,264 MHC SNPs in 22,647 AS cases and controls of European descent. We impute SNPs, classical HLA alleles and amino-acid residues within HLA proteins, and tested these for association to AS status. Here we show that in addition to effects due to HLA-B*27 alleles, several other HLA-B alleles also affect susceptibility.
    [Show full text]
  • Significance of The
    CHAPTERCHAPTER 7 7 SignificanceSignificance ofof thethe MHCMHC MajorMajor HistocompatibilityHistocompatibility Complex Complex (MHC)(MHC) WhatWhat isis MHC?MHC? rolerole inin immuneimmune responseresponse ––HLAHLA rolerole inin organorgan transplantationtransplantation – H-2 – H-2 rolerole inin predispositionpredisposition toto diseasedisease ––MinorMinor histocompatibilityhistocompatibility antigensantigens ––PeterPeter GorerGorer & & GeorgeGeorge SneellSneell (1940) (1940) - MHC molecules were initially discovered during studies Chromosome 17 aimed at understanding the molecules responsible for rejection of transplanted tissues . - Hence the name “Major Histocompatibility Complex ” L (MHC). - The term “Major Histocompatibility Complex” actually refers to a region of the genome that encodes a number of genes (hence Complex) that play an important (hence Chromosome 6 Major) role in tissue transplantation (hence Histocompatibility). - The term “MHC molecule” or “MHC antigen” refers to a molecule encoded by a gene within this region. In humans: In the Mouse: Class I = A, B and C (also called HLA-A, HLA-B and HLA-C) Class I = K, D and L molecules (also called - Ag (peptide) presentation to CD8+ cells H-2D, H-2K and H-2L) Class II = DP, DQ and DR (also called Class II = A and E (also called I-A and I-E) HLA-DP, HLA-DQ and HLA-DR) - Ag (peptide) presentation to CD4+ cells Class III = Complement proteins, Tumor necrosis factor (TNFs)-α, β Class III = Complement proteins, Tumor necrosis factor (TNFs)-α, β 1 MHC- Polimorphism PolymorphismPolymorphism
    [Show full text]
  • 2492.Full-Text.Pdf
    Five HLA-DP Molecules Frequently Expressed in the Worldwide Human Population Share a Common HLA Supertypic Binding Specificity This information is current as of October 1, 2021. John Sidney, Amiyah Steen, Carrie Moore, Sandy Ngo, Jolan Chung, Bjoern Peters and Alessandro Sette J Immunol 2010; 184:2492-2503; Prepublished online 5 February 2010; doi: 10.4049/jimmunol.0903655 Downloaded from http://www.jimmunol.org/content/184/5/2492 Supplementary http://www.jimmunol.org/content/suppl/2010/02/01/jimmunol.090365 Material 5.DC1 http://www.jimmunol.org/ References This article cites 88 articles, 32 of which you can access for free at: http://www.jimmunol.org/content/184/5/2492.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision by guest on October 1, 2021 • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2010 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Five HLA-DP Molecules Frequently Expressed in the Worldwide Human Population Share a Common HLA Supertypic Binding Specificity John Sidney, Amiyah Steen, Carrie Moore, Sandy Ngo, Jolan Chung, Bjoern Peters, and Alessandro Sette Compared with DR and DQ, knowledge of the binding repertoires and specificities of HLA-DP alleles is somewhat limited.
    [Show full text]