Proc. Nati. Acad. Sci. USA Vol. 91, pp. 6259-6263, July 1994 Immunology A second lineage of mammalian major histocompatibility complex class I genes SEIAMAK BAHRAM*, MAUREEN BRESNAHAN*, DANIEL E. GERAGHTYt, AND THOMAS SPIES* *Diision of Tumor Virology, Dana-Farber Cancer Institute, Harvard Medical School, 44 Binney Street, Boston, MA 02115; and tHuman Immunogenetics Program, Fred Hutchinson Cancer Research Center, 1124 Columbia Street, Seattle, WA 98104 Communicated by Sherman M. Weissman, January 3, 1994 ABSTRACT Major sctibit complex (MHC) polymorphic antigen-presenting molecules (2). The physio- class I genes tpically encode polymorphic peptide-binding logical roles of HLA-E and -F are uncertain (14, 15), but chains which are ubi ly expressed and mediate the HLA-G may have a specific function at the maternal-fetal recognition of intr rtigens by cytotoxic T cells. They interface (16). In addition, the MHC contains a number of constte diverse gene fme in different species and include class I pseudogenes and gene fragments (17); however, all of the numerous cd n acal genes in the mouse H-2 the human class I sequences share close relationships indi- coplex, of which some have been adapted to variously mod- cating their common origin from a typical class I gene. ified hmctions. We have identified a d nt family of five In this report, we describe a family of sequencest in the related sequenes in the human MHC whicb are distntly human MHC which are highly divergent from al of the homologous to dass I i. These MIC genes (MHC class I known MHC class I chains and have presumably been chain-related genes) evolved in parallel with the human class I derived early in the evolution of mammalian class I genes. genes and with those of most Ifnot all ma orders. The The MICA gene (MHC class I chain-related gene A) in this MICA gene in this family Is located near HLA-R and is by far family was identified in a search of the HLA-B region for the most divergent m an MHC dass I gene known. It Is other expressed genes. This work was motivated by the still further by It unusual exon4ntron onition unexplained association of HLA-B27 with rheumatoid and and preerential essin fibroblasts and epithlial clls. inflammatory diseases. The uncommon organization of the However, the pence of disc residues in the MICA MICA gene, its restricted expression, and the characteristic amino acid sequence t ted from cDNA suggess that the amino acid sequence of its product, all indicate that the putative MICA chain fods imirly to typical class I chains putative MICA chain has evolved for afunction that is related and may have the capacity to bind peptide or other short to but is quite distinct from that of typical MHC class I Uganda. These results dine a second lineag of evolutionarily chains.§ conserved MHC cla I -gee. This Implies that MICA and bly other members In this family have been selected for MATERIALS AND METHODS specialied f tios that are either ancient or derived from those of typical MHC class I genes, in analogy to some of the Isolaton of MICA and MICB DNA Sequences. MICA and mouse H-2 gen. MICB cDNA clones were isolated from IMR90 human lung fibroblast (Clontech) and keratinocyte (18) libraries with a Typical class I genes in the major histocompatibility complex total insert probe prepared from cosmid M32A (19) by (MHC) ofall vertebrate species encode membrane-anchored described procedures (19). The closely related MICA and cell surface glycoproteins of about 44 kDa that are nonco- MICB cDNA clones of 1.4 and 2.4 kb, respectively, were valently associated with P2-microglobulin (1, 2). These mol- assigned to their corresponding genomic locations by blot ecules are receptors for intracellular peptides, which they hybridization with the previously cloned and mapped present to cytotoxic T cells with a# antigen receptors, thus cosmids R9A, RSA, K7A, and M32A (19), by comparison of facilitating the immune recognition ofintracellular pathogens cDNA and genomic DNA sequences, and by sequencing and altered self-proteins. Characteristic oftypical MHC class across intron-exonjunctions. Selected amino acid sequences I chains is their polymorphism, which correlates with the were aligned by using the EUGENE program package (Baylor ability of various alleles to bind peptides with different College of Medicine, Houston). sequence motifs (3). At least to some extent, the allelic DNA and RNA Blot Hybiion . Preparations of DNA repertoire ofatypical class I chain represents an evolutionary from human B-cell lines andfrom yeast artificial chromosome record of past pathogen-driven selection (4). This principle (YAC) clones and ofRNA from various human cell lines were may also be accountable for the diversity of MHC class I according to standard protocols (20). All cell lines were from genes among different species and, in several cases, for their the American Type Culture Collection or the Tenth Interna- adptation to specialized functions. But such examples have tional Histocompatibility Workshop (21). Primate DNA sam- so far only been found in the mouse. In addition to the typical ples were a gift from D. Watkins (University of Wisconsin). class I H-2K, -D, and -L genes, the mouse H-2 complex YAC clones Y2, Y3, Y17, Y18, Y19, Y22, and Y23 have been includes numerous of the nonclassical Q., T, and M genes published (22, 23); Y24, Y25, Y36, Y37, Y38, Y67, Y54, and (5-8). Ofthese, some ofthe Tgenes encode ligands forT cells Y53 are from unpublished work (D.E.G.). Blot transfer and with yS antigen receptors (9, 10) and the M3 gene product hybridization of DNA restriction fragments and RNA with specifically presents N-formylated peptides of bacterial and [a-32P~dCTP-labeled MICA cDNA were according to stan- mitochondrial origin (11, 12). dard procedures (20). For Fig. 2, RNA samples of 20 pg per The human MHC contains within about 2 megabases six class I genes (13), of which HLA-A, -B, and -C encode the Abbreviations: MHC, major histocompatibility complex; YAC, yeast artificial chromosome. tThe Human Gene Mapping Workshop symbols for these loci are The publication costs ofthis article were defrayed in part by page charge MICA, MCIB, MICC, MICD, and MICE. payment. This article must therefore be hereby marked "advertisement" *The sequence reported in this paper has been deposited in the in accordance with 18 U.S.C. §1734 solely to indicate this fact. GenBank data base (accession no. L14848). 6259 Downloaded by guest on September 26, 2021 6260 Immunology: Bahram et al. Proc. Natl. Acad. Sci. USA 91 (1994) lane were fractionated in 1% agarose/2.2 M formaldehyde DNA encoding MICB. PCR was carried out using GeneAmp gels before blot transfer. Hybridization and washes were reagents and AmpliTaq DNA polymerase (Perkin-Elmer/ under stringent conditions (19). For Fig. 6A, the final wash Cetus), 0.5 pg oftemplate DNA, and 25 pmol ofeach primer. was in 0.5x standard saline citrate (SSC; ref. 20) with 0.1% Samples were subjected to 40 cycles ofPCR with intervals at NaDodSO4 at 65°C. For Figs. SA and 6B, low-stringency 940C (1 min), 550C (1 min), and 720C (2 min) and the products conditions were employed. DNA blots were hybridized in 5 x were directly cloned into the TA vector pCRII (Invitrogen). SSC containing 50% formamide, 50 mM Tris (pH 7.5), 10 mM Sequences were obtained from double-stranded templates by Na4P2O7, 5 mM EDTA, 0.2%o bovine serum albumin, 0.2% using flanking SP6 and T7 primers (Promega) and several Ficoll, 0.2% polyvinylpyrrolidone, 1% NaDodSO4, 5% dex- oligonucleotides derived from MICA intron sequences. tran sulfate, and sonicated salmon sperm DNA (150 Pg/ml) These were 42 bp 3' of the al exon (3'-GTCTTTTCAATC- for 16 hr at 37°C. Filters were washed in 2x SSC with 0.1% CCCGTC-5'), 39 and 40 bp 5' and 3' of the a2 exon, NaDodSQ4 at 37°C. respectively (5'-TCACTTGGGTGGAAAGGTGAT-3' and Cloning and Sequencing of MICA Agcic Variants. MICA 3'-ACGATCTCAACGGAGTGGAGG-5'), and 40 bp 5' of fragments of 2250 bp including the al, a2, and a3 domains the a3 exon (5'-GTTCCTCTCCCCTCCTTAGA-3'). All of were amplified by the polymerase chain reaction (PCR) from the MICA alleles were verified by sequencing ofat least three genomic DNA of the HLA homozygous typing cell lines clones derived from two independent PCR products. EJ32B, MOU, PITOUT, and YAR (21). The oligonucleotides selected for PCR were derived from the 5' end ofthe al exon (5'-GAGCCCCACAGTCTTCGT-3') and the transmembrane RESULTS AND DISCUSSION sequence (3'-TGTAAGGTACAAAGACGAC-5') of MICA We have used previously cloned cosmids from the 170-kb and were tested with cosmid M32A DNA as a template. With interval between HLA-B and BAT] at the centromeric end of this primer pair, no fragment was amplified from cosmid R9A the MHC class I region (19) to screen various human cDNA A BATI MICB 15 MICA 17 HLA-B _n_m - _ p> - R9A K7A - R5A - M32A 20 kb '-' | FIG. 1. (A) Localization of MICA B and MICB in previously cloned L al a2 a3 TM CY'/3'UT cosmids. From a contiguous series, only the cosmids relevant here- I- I MICA R9A, R5A, K7A, and M32A-are shown; for a restriction map, see ref. 19. Black and shaded boxes on top L CY3'UT 2 kb line correspond to genes; open boxes I i MHC-I labeled 15 and 17 indicate short class I-like gene fragments contained in C Xba I and Pst I restriction fragments EXON 1 of 1.5 and 1.7 kb, respectively. Ar- CACTGCTTGAGCCGCTGAGAGGGTGGCGACGTCGGGGCCATGGGGCTGGGCCCGGTCTTCCTGCTTCTGGCTGGCATCTTCCCT 'TTTGCACCT rows show transcriptional orienta- -23 M G L G P V F L LL A G I F P F A P tions of Exon-intron EXON 2 L genes.