Supplementary Information
Laboratory cultivation of acidophilic nanoorganisms. Physiological and bioinformatic dissection of a stable laboratory co-culture.
Susanne Krause [1], Andreas Bremges [3,4], Philipp C. Münch [3,5], Alice C. McHardy [3] and
Johannes Gescher* [1,2]
[1] Department of Applied Biology, Karlsruhe Institute of Technology (KIT), Karlsruhe, Germany
[2] Institute for Biological Interfaces, Karlsruhe Institute of Technology (KIT), Eggenstein-
Leopoldshafen, Germany
[3] Computational Biology of Infection Research, Helmholtz Centre for Infection Research,
Braunschweig, Germany
[4] German Center for Infection Research (DZIF), partner site Hannover-Braunschweig, Braunschweig,
Germany
[5] Max von Pettenkofer-Institute of Hygiene and Medical Microbiology, Ludwig-Maximilians-
University of Munich, Munich, Germany
SI Materials and Methods
Quantification of cells using quantitative PCR The target sequences were amplified by PCR from genomic DNA of the enrichment cultures using primers see table S8. The amplified fragments contained overlapping regions as well as a BamHI site at the 5’ end and a SacI site at the 3’ end. Using the overlaps, the fragments were combined and cloned via the added restrictions sites into plasmid pAH95 1. Integration in the genome of E. coli DH5alphaZ1 was conducted as described before 1. For standard curve design, serial dilutions of E. coli DH5alphaZ1 cells containing the merged 23S target sequences of the ARMAN und Thermoplasmatales enrichments were prepared and cells were counted in a Neubauer counting chamber (Marienfeld, Lauda-Königshofen, Germany). DNA of the dilution series as well as of enrichment-cultures was extracted using the innuSPEED soil DNA kit (Analytic Jena, Jena, Germany) with minor modifications to the manufacturer´s instructions. The starting material was 0.5 ml of each sample. The cells were spun down and washed once with PBS buffer (pH 2.5). The cell pellets were resuspended in 600 µl ELS and stored at -20°C until all samples from the timeline were collected. The following thermal lyses step was extended to 40 min. Homogenization was conducted using a Mixer Mill MM 400 (Retsch, Haan, Germany) at 30 Hz for 7 min. DNA was finally eluted in 40 µl elution buffer. qPCR reactions and analyzes were performed in a CFX96 Cycler (Bio-Rad, Munich, Germany). The optimal annealing temperature of 53°C was determined by a temperature gradient qPCR using isolated DNA from the developed E. coli strain. The qPCR reaction mix was prepared according to the manufacturer´s instructions of the SsoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad, Munich, Germany) with a final primer concentration of 0.5 µM and 1 µl template DNA. Conditions for qPCR were chosen as follows: initial denaturation at 95°C for 7 min, 32 cycles of 95°C for 10 sec, 53°C for 15 sec and 65°C for 30 sec, followed by a melting curve analysis of 60°C – 98°C with 0.1°C/sec. Standard curves were developed using biological triplicates, while samples from the enrichment cultures were quantified using technical duplicates of biological triplicates.
MCL analysis Clusters of orthologous genes were inferred using OrthoMCL 2 (v. 2.0, percent-match cutoff set to 50, e-value-exponent cutoff set to -15, minimal length set to 10, max percent stop set to 20, granularity set to 1.5) as done in Hacquard et al. (2016)3. For annotation, HMM models were generated for each KEGG Orthologue (KO) group from the database 4 using the HMMER toolkit 5 (v. 3.1b2). We employed the HMM models to search all predicted ORFs using hmmsearch (v. 3.1b2, E-value cut-off set to 0.001) and selected the hits with best expected values for the annotation. Multiple testing correction was applied based on FDR with alpha set to 0.5.
Metagenome assembly and binning All metagenomic reads from replicates S1 and S2 were jointly assembled with Ray Meta (v2.3.1; 6), using a k-mer size of 31. Assembler and k-mer size were empirically selected to maximize contiguity and inclusivity (i.e. the percentage of included reads) of the metagenome assembly. As a proxy for contiguity, we compared N50 values, as determined by QUAST (v3.1; 7). To estimate the inclusivity, we aligned all metagenomic reads to the assembled contigs with Bowtie 2 (v2.2.48) and calculated the mapping statistics with SAMtools (v1.19). Eventually, we picked the above combination (Table A2). We then used MetaBAT (v0.23.110) in its “very specific” mode to recover genome bins from our metagenome assembly. MetaBAT is an unsupervised binning tool that leverages nucleotide composition – in particular tetranucleotide frequencies – and per-sample differential coverage information to group contigs into genome bins. Upon manual inspection of the automatically generated four genome bins, we merged two partial genome bins into one, leading to three final genome bins (Figure A2). Lastly, we estimated each bin’s completeness and contamination with CheckM (v1.0.4; 11) and assigned a taxonomy to each contig with taxator-tk (v1.2.1; 12).
Functional annotation and KEGG pathway analyses The archaeal genome bins were annotated with Prokka (v1.11; 13), which uses RNAmmer (v1.214) and Prodigal (v2.6.0 15) to predict ribosomal RNA genes and protein-coding genes, respectively. We then counted the number of metagenome and metatranscriptome reads within genes with BEDTools (v2.22.016) and calculated their reads per kilobase (RPK) values. This information was used to determine the 23S rRNA gene copy numbers, too. The coding sequences were also annotated with the KEGG Automatic Annotation Server (v2.017) to determine orthologous genes in KEGG (r78.18) and their corresponding KEGG pathways. For the assignments we used bi-directional best BLAST hits against 40 well-chosen organisms for covering the most common metabolic pathways, with specific focus on archaea (neq, csy, mse, sai, iho, pto, tac, mac, msi, abi, hth, afo, pfr, mlu, mta, afe, acr, pde, gme, son, ppr, eco, aca, mer, fpl, nde, dap, dte, hya, rsp, dba, rfr, reu, pae, avn, acb, fbl, kcr, asc, and tvo). SI Figures and Tables
Figure S1: CARD-FISH picture of enrichment cultures showing B_DKE and C_DKE in red (ARCH915, Alexa 546), A_DKE in green (ARM980, Alexa 488). The in blue indicated DAPI stain also displays the presence of hyphae with stained cell nuclei originating from the fungus Acidothrix acidophila (DAPI, blue).
Figure S2: CARD-FISH pictures of enrichment cultures showing: (a) a culture containing B_DKE and C_DKE (red, ARCH915, Alexa 546) and A_DKE (green, ARM980, Alexa 488) in agglomerates and (b) an enrichment culture containing only B_DKE (red, ARCH915, Alexa 546), growing as single cells. Table S1: Most closely related organisms to the 16S rRNA gene sequence of B_DKE.
NCBI Query E- Organism Identity Locality Accession coverage value number Uncultured Thermoplasma sp. 99% 0.0 99% Rio Tinto, Spain HQ730609.1 clone JL62 Uncultured Thermoplasmatales 99% 0.0 99% Huelva, Spain EF396244 archaeon clone ORCL3.3 Uncultured archaeon clone Iberian Pyritic Belt, 99% 0.0 99% HM745409 20m_arch_h3 Spain Uncultured Thermoplasmatales 99% 0.0 99% Cae Coch, Wales GU229859 archaeon clone S4BAC1 Uncultured archaeon clone 99% 0.0 99% Rio Tinto, Spain EU370310 AG_Eug_f6 Uncultured archaeon clone 99% 0.0 99% Rio Tinto, Spain EU370309 CEM_Pin_c1a Uncultured archaeon clone LMi- Copahue, Neuquen, 99% 0.0 99% KP204537 biof-arch_d6 Argentina
Table S2: Metagenome assembly and binning statistics. We assembled a total of ~4.9 Mbp, of which we grouped ~4.5 Mbp (91.5%) into three near-complete genome bins. Completeness and contamination estimated based on lineage-specific marker genes.
Est. Est. Assembly No. of Largest No. of Assembly N50 [bp] Completeness Contamination size [bp] contigs contig [bp] genes [%] [%] Metagenome 4,904,630 145 178,318 1,202,937 5,272 n/a n/a
A_DKE 976,441 7 194,415 336,535 1,013 81.78 0.93
B_DKE 1,905,249 31 82,562 235,491 2,016 98.61 0.00
C_DKE 1,606,190 3 1,202,937 1,202,937 1,556 86.29 0.00
Table S3: Functional enrichment analysis: orthoMCL groups of each genome assigned to each indicated functional category revealed significant difference between ARMAN and Thermoplasmatales members (two-sided Fisher's exact test, P=3.3E-9, 1.4E-8 and 3.5E-7, respectively).
Function P-VALUE in ARMAN in THERMO in ARMAN (SD) in THERMO FDR level Translation 6,70169E-10 88 182 3,915780041 1,669045921 1,8765E-08 * * * Amino acid metabolism 2,57011E-09 106 852 12,58305739 16,3270153 3,5981E-08 * * * Infectious diseases 5,32072E-07 38 60 3,109126351 1,8516402 4,9660E-06 * * * Metabolism of cofactors and vitamins 8,29063E-07 86 671 5,916079783 13,50595107 5,8034E-06 * * * Carbohydrate metabolism 5,91152E-05 93 656 4,272001873 12,17726218 3,3104E-04 * * * Metabolism of terpenoids and polyketides 0,000435318 22 213 4,509249753 2,875388173 1,5236E-03 * * Replication and repair 0,000354307 43 103 0,957427108 3,720119046 1,5236E-03 * * Transcription 0,000406985 19 30 1,5 1,669045921 1,5236E-03 * * Signal transduction 0,000722403 53 142 5,909032634 3,991061441 2,2475E-03 * * Folding, sorting and degradation 0,000946476 57 159 1,892969449 3,563204817 2,6501E-03 * * Nucleotide metabolism 0,004129785 73 233 1,5 4,155461123 1,0512E-02 * Energy metabolism 0,005618563 111 390 14,97497913 7,667184248 1,3110E-02 * Cell growth and death 0,017245843 23 58 2,217355783 3,370036032 3,7145E-02 * Cell motility 0,018843852 5 5 2,121320344 0 3,7688E-02 * Endocrine system 0,061058894 5 8 0,5 0 1,1398E-01 Membrane transport 0,135787818 116 631 4,242640687 16,4093832 2,3549E-01 Nervous system 0,142976928 0 12 NA 0 2,3549E-01 Overview 0,20672122 14 97 2,380476143 3,090885218 3,2157E-01 Metabolism of other amino acids 0,242326219 6 15 1,732050808 0,353553391 3,5711E-01 Cancers 0,261566786 4 9 0,577350269 0,487950036 3,6619E-01 Xenobiotics biodegradation and metabolism 0,650319455 41 178 3,593976442 10,1664715 8,6709E-01 Lipid metabolism 0,702545485 17 91 2,061552813 1,597989809 8,9415E-01 Biosynthesis of other secondary metabolites 0,79109035 16 83 1,414213562 1,302470181 9,6307E-01 Drug resistance 1 8 38 0 2,187627547 1,0000E+00 Glycan biosynthesis and metabolism 1 8 39 1,414213562 0,83452296 1,0000E+00 Environmental adaptation 1 0 3 NA 0 1,0000E+00 Immune diseases 1 0 2 NA 0 1,0000E+00 Transport and catabolism 1 0 2 NA 0 1,0000E+00
*** for FDR corrected P value < 0.001 ** for FDR corrected P value < 0.01 * for FDR corrected P value < 0.05
Table S4: Annotated gene families that are unique to A_DKE compared to the ARMAN genomes used in this study.
KEGG ID Function lvl1 Function lvl2 Function lvl3 Description number Phenylalanin, aroDE, DHQ-SDH, 3- gfam_ Amino acid K13832 Metabolism tyrosine and dehydroquinate dehydratase / 377 metabolism tryptophan shikimate dehydrogenase biosynthesis [EC:4.2.1.10 1.1.1.25] gfam_ Metabolism of Terpenoid MVD, mvaD, K01597 Metabolism 405 terpenoids and backbone diphosphomevalonate polyketides biosynthesis decarboxylase [EC:4.1.1.33] Amino sugar gfam_ Carbohydrate and rfbE, CDP-paratose 2-epimerase K12454 Metabolism 414 metabolism nucleotide [EC:5.1.3.10] sugar metabolism gfam_ Energy Methane mmoB, methane K16160 Metabolism 423 metabolism metabolism monooxygenase regulatory protein B gfam_ Metabolism of Terpenoid MVD, mvaD, K01597 Metabolism 426 terpenoids and backbone diphosphomevalonate polyketides biosynthesis decarboxylase [EC:4.1.1.33] gfam_ Metabolism of Folate pabAB, para-aminobenzoate K13950 Metabolism 436 cofactors and biosynthesis synthetase [EC:2.6.1.85] vitamins Metabolism of birA, BirA family transcriptional gfam_ Biotin K03524 Metabolism cofactors and regulator, biotin operon repressor 552 metabolism vitamins / biotin-[acetyl-CoA-carboxylase] ligase [EC:6.3.4.15] gfam_ Carbohydrate Starch and K16150, glycogen(starch) K16150 Metabolism 1082 metabolism sucrose synthase [EC:2.4.1.11] metabolism gfam_ Environmenta Signal FoxO PRMT1, protein arginine N- K11434 1128 l Information transduction signaling methyltransferase 1 [EC:2.1.1.-] Processing pathway gfam_ Environmenta Membrane ABC oleC4, oleandomycin transport K18232 1741 l Information transport transporters system ATP-binding protein Processing gfam_ Nucleotide Pyrimidine tdk, TK, thymidine kinase K00857 Metabolism 1753 metabolism metabolism [EC:2.7.1.21] gfam_ Degradation dmpD, xylF, 2-hydroxymuconate- K10216 Metabolism Overview 1907 of aromatic semialdehyde hydrolase compounds [EC:3.7.1.9] gfam_ Environmenta Membrane ABC ecfT, energy-coupling factor K16785 2934 l Information transport transporters transport system permease Processing protein gfam_ Nucleotide Purine amn, AMP nucleosidase K01241 Metabolism 3121 metabolism metabolism [EC:3.2.2.4]
Table S5: KEGG transcript annotations of A_DKE, B_DKE and C_DKE of enzymes involved in central metabolism.
Contig start stop gene description reads KEGG KO RPKM EC length RNA A_DKE TCA contig‐1000030 59743 60903 1160 citrate synthase 202 K01647 1,1 2.3.3.1 contig‐1000030 56805 59603 2798 aconitase 1425 K01681 3,2 4.2.1.3 contig‐21000035 20914 22143 1229 isocitrate dehydrogenase 452 K00031 2,3 1.1.1.42 contig‐37000013 3968 5842 1874 2‐oxoacid oxidoreductase (ferredoxin) 1251 K00174 4,2 1.2.7.11 contig‐37000013 5829 6737 908 2‐oxoacid oxidoreductase (ferredoxin) 605 K00175 4,2 1.2.7.11 contig‐37000013 149572 151290 1718 succinate dehydrogenase/fumarate reductase, flavoprotein subunit 336 K00239 1,2 1.3.5.4 contig‐37000013 148826 149575 749 succinate dehydrogenase/fumarate reductase, iron‐sulfur subunit 152 K00240 1,3 1.3.5.4 contig‐37000013 151437 152834 1397 fumarate hydratase class II 174 K01679 0,8 4.2.1.2 contig‐1000030 55428 56795 1367 malate dehydrogenase (quinone) 179 K00116 0,8 1.1.5.4
Gluconeogenesis contig‐44000010 51136 52014 878 pyruvate, water dikinase 60 K01007 0,4 2.7.9.2 contig‐37000013 53865 54470 605 probable phosphoglycerate mutase 68 K15634 0,7 5.4.2.12
ED contig‐2000020 45362 46435 1073 aldose 1‐dehydrogenase [NAD(P)+] 97 K18125 0,6 1.1.1.359 contig‐37000013 19277 20503 1226 gluconate/galactonate dehydratase 215 K05308 1,1 4.2.1.140 contig‐37000013 21506 22942 1436 D‐glyceraldehyde dehydrogenase 206 K18128 0,9 1.2.1.89 contig‐44000010 151267 152337 1070 pyruvate dehydrogenase E1 component alpha subunit 215 K00161 1,3 1.2.4.1 contig‐44000010 150287 151258 971 pyruvate dehydrogenase E1 component beta subunit 256 K00162 1,7 1.2.4.1
PPP contig‐37000013 322787 323671 884 ribose‐phosphate pyrophosphokinase 88 K00948 0,6 2.7.6.1 Fatty acid degradation contig‐37000013 132383 133606 1223 acetyl‐CoA C‐acetyltransferase 65 K00626 0,3 2.3.1.9
Electron transport chain Complex I contig‐49000031 18622 19254 632 NADH‐quinone oxidoreductase subunit A 139 K00331 1,4 1.6.5.3 contig‐49000031 19193 19564 371 NADH‐quinone oxidoreductase subunit B 88 K00332 1,5 1.6.5.3 contig‐49000031 19561 20658 1097 NADH‐quinone oxidoreductase subunit C 142 K00333 0,8 1.6.5.3 contig‐37000013 307529 308575 1046 NADH‐quinone oxidoreductase subunit G 63 K00337 0,4 1.6.5.3 contig‐37000013 307167 307532 365 NADH‐quinone oxidoreductase subunit H 62 K00338 1,1 1.6.5.3 contig‐37000013 304609 306375 1766 NADH‐quinone oxidoreductase subunit K 87 K00341 0,3 1.6.5.3 contig‐37000013 303188 304606 1418 NADH‐quinone oxidoreductase subunit L 60 K00342 0,3 1.6.5.3 contig‐37000013 301784 303178 1394 NADH‐quinone oxidoreductase subunit M 71 K00343 0,3 1.6.5.3 Complex II contig‐37000013 149572 151290 1718 succinate dehydrogenase/fumarate reductase, flavoprotein subunit 336 K00239 1,2 1.3.5.4 contig‐37000013 148826 149575 749 succinate dehydrogenase/fumarate reductase, iron‐sulfur subunit 152 K00240 1,3 1.3.5.4 Complex III ‐ Complex IV ‐ Complex V contig‐37000013 253083 253589 506 inorganic pyrophosphatase 270 K01507 3,4 3.6.1.1 contig‐37000013 79409 81163 1754 V/A‐type H+/Na+‐transporting ATPase subunit A 323 K02117 1,2 3.6.3.14 contig‐37000013 93142 95547 2405 H+‐transporting ATPase 206 K01535 0,5 3.6.3.6 contig‐37000013 77999 79393 1394 V/A‐type H+/Na+‐transporting ATPase subunit B 469 K02118 2,1 contig‐37000013 81523 82599 1076 V/A‐type H+/Na+‐transporting ATPase subunit C 152 K02119 0,9 contig‐37000013 77380 78012 632 V/A‐type H+/Na+‐transporting ATPase subunit D 132 K02120 1,3 contig‐37000013 81204 81533 329 V/A‐type H+/Na+‐transporting ATPase subunit F 26 K02122 0,5 contig‐37000013 74919 76859 1940 V/A‐type H+/Na+‐transporting ATPase subunit I 233 K02123 0,8
Cytochrome bd complex contig‐44000010 144526 145854 1328 cytochrome d ubiquinol oxidase subunit I 80 K00425 0,4 1.10.3.14
Amino acid degradation contig‐21000035 26526 27791 1265 glutamate dehydrogenase 979 K00261 4,9 1.4.1.3
B_DKE TCA contig‐2000035 15753 16907 1154 citrate synthase 7250 K01647 39,5 2.3.3.1 contig‐7 43083 45779 2696 aconitase 9614 K01681 22,4 4.2.1.3 contig‐1000033 4676 5893 1217 isocitrate dehydrogenase 9665 K00031 49,9 1.1.1.42 contig‐7 6368 8266 1898 2‐oxoacid oxidoreductase (ferredoxin) 15548 K00174 51,5 1.2.7.11 contig‐7 110374 111222 848 2‐oxoacid oxidoreductase (ferredoxin) 7981 K00175 59,2 1.2.7.11 contig‐32000012 37876 38730 854 succinyl‐CoA synthetase alpha subunit 5062 K01902 37,3 6.2.1.5 contig‐32000012 38732 39838 1106 succinyl‐CoA synthetase subunit beta 6859 K01903 39,0 6.2.1.5 contig‐32 8060 9769 1709 succinate dehydrogenase/fumarate reductase, flavoprotein subunit 2608 K00239 9,6 1.3.5.4 contig‐32 7323 8051 728 succinate dehydrogenase/fumarate reductase, iron‐sulfur subunit 1208 K00240 10,4 1.3.5.4 contig‐7 113814 115187 1373 fumarate hydratase class II 8527 K01679 39,1 4.2.1.2 contig‐31 24521 25495 974 malate dehydrogenase 4677 K00024 30,2 1.1.1.37
Gluconeogenesis contig‐32000012 127207 129864 2657 pyruvate, orthophosphate dikinase 3507 K01006 8,3 2.7.9.1 contig‐39 29945 31819 1874 phosphoenolpyruvate carboxykinase (GTP) 1945 K01596 6,5 4.1.1.32 contig‐42000024 3291 4511 1220 enolase 1836 K01689 9,5 4.2.1.11 contig‐32000012 219808 221022 1214 2,3‐bisphosphoglycerate‐independent phosphoglycerate mutase 3545 K15635 18,4 5.4.2.12 contig‐20 7053 8300 1247 phosphoglycerate kinase 3959 K00927 20,0 2.7.2.3 contig‐0 152976 154079 1103 glyceraldehyde‐3‐phosphate dehydrogenase (NAD(P)) 4488 K00150 25,6 1.2.1.59 contig‐1000036 100427 101089 662 triosephosphate isomerase 703 K01803 6,7 5.3.1.1 contig‐1 10674 11831 1157 fructose 1,6‐bisphosphate aldolase/phosphatase 4300 K01622 23,4 4.1.2.13 contig‐30 41933 42853 920 glucose/mannose‐6‐phosphate isomerase 807 K15916 5,5 5.3.1.9 contig‐8 77540 78904 1364 phosphomannomutase/phosphoglucomutase 1718 K15778 7,9 5.4.2.2
ED contig‐22 59230 60321 1091 glucose/galactose 1‐dehydrogenase (NADP+) 1214 K18124 7,0 1.1.1.360 contig‐7 45923 47110 1187 gluconate/galactonate dehydratase 1159 K05308 6,1 4.2.1.140 45782 2‐dehydro‐3‐deoxy‐D‐gluconate/2‐dehydro‐3‐deoxy‐phosphogluconate 1201 K11395 8,8 4.1.2.55 contig‐1000025 45782 46642 aldolase contig‐0 20437 21915 1478 D‐glyceraldehyde dehydrogenase 1823 K18128 7,8 1.2.1.89 contig‐1000036 132560 134056 1496 glyceraldehyde‐3‐phosphate dehydrogenase [NAD(P)+] 2231 K18978 9,4 1.2.1.90 contig‐2000035 65718 67016 1298 glycerate 2‐kinase 267 K11529 1,3 2.7.1.165 contig‐0 21910 23592 1682 pyruvate kinase 2875 K00873 10,7 2.7.1.40 contig‐32 46321 47334 1013 pyruvate dehydrogenase E1 component alpha subunit 5417 K00161 33,6 1.2.4.1 contig‐32 47331 48299 968 pyruvate dehydrogenase E1 component beta subunit 8374 K00162 54,4 1.2.4.1
PPP contig‐30 41933 42853 920 bifunctional phosphoglucose/phosphomannose isomerase 807 K15916 5,5 5.3.1.9 contig‐1 10674 11831 1157 fructose 1,6‐bisphosphate aldolase/phosphatase 4300 K01622 23,4 4.1.2.13 contig‐2000035 28105 29058 953 transketolase 1712 K00615 11,3 2.2.1.1 contig‐2000035 27450 28121 671 transaldolase 1851 K00616 17,3 2.2.1.2 contig‐33 14119 14769 650 ribulose‐phosphate 3‐epimerase 1125 K01783 10,9 5.1.3.1 contig‐2000035 62788 63459 671 ribose‐5‐phosphate isomerase A 472 K01807 4,4 5.3.1.6 contig‐42000024 5109 6005 896 ribokinase 452 K00852 3,2 2.7.1.15 contig‐0 108922 109824 902 ribose‐phosphate pyrophosphokinase 3994 K00948 27,8 2.7.6.1 contig‐8 77540 78904 1364 phosphomannomutase/phosphoglucomutase 1718 K15778 7,9 5.4.2.2
Fatty acid degradation contig‐21 28264 29943 1679 long‐chain acyl‐CoA synthetase 2857 K01897 10,7 6.2.1.3 contig‐1000035 35287 36411 1124 acyl‐CoA dehydrogenase 13029 K00249 72,9 1.3.8.7 contig‐15 1722 2900 1178 acetyl‐CoA acetyltransferase 1715 K00632 9,2 2.3.1.16 contig‐30 36416 37609 1193 acetyl‐CoA acetyltransferase 9771 K00626 51,5 2.3.1.9
Electron transport chain Complex I contig‐32000012 54709 55146 437 NADH‐quinone oxidoreductase subunit A 2138 K00330 30,8 1.6.5.3 contig‐32000012 54248 54712 464 NADH‐quinone oxidoreductase subunit B 2032 K00331 27,5 1.6.5.3 contig‐32000012 53784 54251 467 NADH‐quinone oxidoreductase subunit C 2233 K00332 30,1 1.6.5.3 contig‐32000012 52675 53784 1109 NADH‐quinone oxidoreductase subunit D 5102 K00333 28,9 1.6.5.3 contig‐32000012 198303 199748 1445 NADH‐quinone oxidoreductase subunit F 740 K00335 3,2 1.6.5.3 contig‐32000012 51638 52678 1040 NADH‐quinone oxidoreductase subunit H 3039 K00337 18,4 1.6.5.3 contig‐32000012 51207 51641 434 NADH‐quinone oxidoreductase subunit I 2333 K00338 33,8 1.6.5.3 contig‐32000012 50962 51210 248 NADH‐quinone oxidoreductase subunit J 1146 K00339 29,1 1.6.5.3 contig‐32000012 50443 50742 299 NADH‐quinone oxidoreductase subunit K 575 K00340 12,1 1.6.5.3 contig‐32000012 48503 50440 1937 NADH‐quinone oxidoreductase subunit L 3696 K00341 12,0 1.6.5.3 contig‐32000012 47016 48503 1487 NADH‐quinone oxidoreductase subunit M 3471 K00342 14,7 1.6.5.3 contig‐32000012 45553 47019 1466 NADH‐quinone oxidoreductase subunit N 4032 K00343 17,3 1.6.5.3 Complex II contig‐32 8060 9769 1709 succinate dehydrogenase/fumarate reductase, flavoprotein subunit 2608 K00239 9,6 1.3.5.4 contig‐32 7323 8051 728 succinate dehydrogenase/fumarate reductase, iron‐sulfur subunit 1208 K00240 10,4 1.3.5.4 Complex III contig‐32000012 203033 204733 1700 ubiquinol‐cytochrome c reductase cytochrome b subunit 770 K00412 2,8 1.10.2.2 Complex IV contig‐1 6060 7739 1679 cytochrome c oxidase subunit I 1743 K02274 6,5 1.9.3.1 Complex V contig‐21 55476 56021 545 inorganic pyrophosphatase 3833 K01507 44,2 3.6.1.1 contig‐0 100480 102246 1766 V/A‐type H+/Na+‐transporting ATPase subunit A 7037 K02117 25,1 3.6.3.14 contig‐12 46989 49358 2369 H+‐transporting ATPase 2676 K01535 7,1 3.6.3.6 contig‐0 99081 100478 1397 V/A‐type H+/Na+‐transporting ATPase subunit B 6771 K02118 30,5 contig‐0 102580 103653 1073 V/A‐type H+/Na+‐transporting ATPase subunit C 3133 K02119 18,4 contig‐0 98453 99094 641 V/A‐type H+/Na+‐transporting ATPase subunit D 3061 K02120 30,0 contig‐0 103650 104213 563 V/A‐type H+/Na+‐transporting ATPase subunit E 3552 K02121 39,7 contig‐0 102236 102574 338 V/A‐type H+/Na+‐transporting ATPase subunit F 1067 K02122 19,9 contig‐0 96010 97947 1937 V/A‐type H+/Na+‐transporting ATPase subunit I 6653 K02123 21,6
Amino acid degradation contig‐37 14092 15372 1280 glutamate dehydrogenase 34744 K00261 170,7 1.4.1.3
C_DKE TCA contig‐35 1E+06 1E+06 1157 citrate synthase 1852 K01647 10,1 2.3.3.1 contig‐38000030 1E+06 1E+06 2687 aconitase 2418 K01681 5,7 4.2.1.3 contig‐38000030 1E+06 1E+06 1211 isocitrate dehydrogenase 824 K00031 4,3 1.1.1.42 contig‐38000030 62409 64313 1904 2‐oxoacid oxidoreductase (ferredoxin) 5706 K00174 18,8 1.2.7.11 contig‐38000030 64303 65229 926 2‐oxoacid oxidoreductase (ferredoxin) 2362 K00175 16,0 1.2.7.11 contig‐38000030 85487 86344 857 succinyl‐CoA synthetase alpha subunit 1046 K01902 7,7 6.2.1.5 contig‐38000030 84379 85485 1106 succinyl‐CoA synthetase subunit beta 1581 K01903 9,0 6.2.1.5 contig‐38000030 842075 843796 1721 succinate dehydrogenase/fumarate reductase, flavoprotein subunit 2534 K00239 9,3 1.3.5.4 contig‐38000030 841326 842078 752 succinate dehydrogenase/fumarate reductase, iron‐sulfur subunit 1171 K00240 9,8 1.3.5.4 contig‐35 189411 190775 1364 fumarate hydratase class II 853 K01679 3,9 4.2.1.2 contig‐38000030 897362 898330 968 malate dehydrogenase 2187 K00024 14,2 1.1.1.37
Gluconeogenesis contig‐32000012 782120 784795 2675 pyruvate, orthophosphate dikinase 682 K01006 1,6 2.7.9.1 contig‐38000030 98280 100127 1847 phosphoenolpyruvate carboxykinase (GTP) 248 K01596 0,8 4.1.1.32 contig‐38000030 149582 150799 1217 enolase 313 K01689 1,6 4.2.1.11 contig‐38000030 930052 931272 1220 2,3‐bisphosphoglycerate‐independent phosphoglycerate mutase 452 K15635 2,3 5.4.2.12 contig‐38000030 873168 874418 1250 phosphoglycerate kinase 363 K00927 1,8 2.7.2.3 contig‐38000030 992930 993943 1013 glyceraldehyde‐3‐phosphate dehydrogenase (NAD(P)) 887 K00150 5,5 1.2.1.59 contig‐38000030 57767 58924 1157 fructose 1,6‐bisphosphate aldolase/phosphatase 833 K01622 4,5 4.1.2.13 contig‐38000030 693941 694894 953 glucose/mannose‐6‐phosphate isomerase 485 K15916 3,2 5.3.1.9 contig‐38000030 928613 929959 1346 phosphomannomutase/phosphoglucomutase 370 K15778 1,7 5.4.2.2
ED contig‐38000030 651336 652421 1085 glucose/galactose 1‐dehydrogenase (NADP+) 74 K18124 0,4 1.1.1.360 contig‐35 71306 72514 1208 gluconate/galactonate dehydratase 1551 K05308 8,1 4.2.1.140 contig‐38000030 140106 141572 1466 D‐glyceraldehyde dehydrogenase 767 K18128 3,3 1.2.1.89 contig‐38000030 295637 296857 1220 glycerate 2‐kinase 55 K11529 0,3 2.7.1.165 contig‐38000030 1E+06 1E+06 992 pyruvate dehydrogenase E1 component alpha subunit 1201 K00161 7,6 1.2.4.1 contig‐38000030 1E+06 1E+06 974 pyruvate dehydrogenase E1 component beta subunit 1077 K00162 7,0 1.2.4.1
PPP contig‐38000030 693941 694894 953 bifunctional phosphoglucose/phosphomannose isomerase 485 K15916 3,2 5.3.1.9 contig‐38000030 57767 58924 1157 fructose 1,6‐bisphosphate aldolase/phosphatase 833 K01622 4,5 4.1.2.13 contig‐38000030 523220 524176 956 transketolase 346 K00615 2,3 2.2.1.1 contig‐38000030 524160 524831 671 putative transaldolase 587 K00616 5,5 2.2.1.2 contig‐38000030 1E+06 1E+06 656 ribulose‐phosphate 3‐epimerase 88 K01783 0,8 5.1.3.1 contig‐38000030 210246 210914 668 ribose‐5‐phosphate isomerase A 139 K01807 1,3 5.3.1.6 contig‐38000030 151349 152251 902 ribokinase 245 K00852 1,7 2.7.1.15 contig‐35 219435 220289 854 ribose‐phosphate pyrophosphokinase 226 K00948 1,7 2.7.6.1 contig‐38000030 928613 929959 1346 phosphomannomutase/phosphoglucomutase 370 K15778 1,7 5.4.2.2
Fatty acid degradation contig‐38000030 308250 309950 1700 long‐chain acyl‐CoA synthetase 206 K01897 0,8 6.2.1.3 contig‐35 142685 143809 1124 acyl‐CoA dehydrogenase 804 K00249 4,5 1.3.8.7 contig‐38000030 1E+06 1E+06 1967 enoyl‐CoA hydratase / 3‐hydroxyacyl‐CoA dehydrogenase 1835 K15016 5,9 4.2.1.17 contig‐35 209038 210243 1205 acetyl‐CoA acetyltransferase 401 K00632 2,1 2.3.1.16 contig‐35 79051 80313 1262 acetyl‐CoA acetyltransferase 1642 K00626 8,2 2.3.1.9
Electron transport chain Complex I contig‐43000032 54713 55153 440 NADH‐quinone oxidoreductase subunit A 322 K00330 4,6 1.6.5.3 contig‐43000032 55150 55614 464 NADH‐quinone oxidoreductase subunit B 490 K00331 6,6 1.6.5.3 contig‐43000032 55620 56078 458 NADH‐quinone oxidoreductase subunit C 576 K00332 7,9 1.6.5.3 contig‐43000032 56084 57205 1121 NADH‐quinone oxidoreductase subunit D 1085 K00333 6,1 1.6.5.3 contig‐43000032 57202 58242 1040 NADH‐quinone oxidoreductase subunit H 926 K00337 5,6 1.6.5.3 contig‐43000032 58239 58679 440 NADH‐quinone oxidoreductase subunit I 371 K00338 5,3 1.6.5.3 contig‐43000032 58917 59135 218 NADH‐quinone oxidoreductase subunit J 272 K00339 7,8 1.6.5.3 contig‐43000032 59136 59435 299 NADH‐quinone oxidoreductase subunit K 320 K00340 6,7 1.6.5.3 contig‐43000032 59437 61329 1892 NADH‐quinone oxidoreductase subunit L 1789 K00341 5,9 1.6.5.3 contig‐43000032 61330 62817 1487 NADH‐quinone oxidoreductase subunit M 1079 K00342 4,6 1.6.5.3 contig‐43000032 62819 64258 1439 NADH‐quinone oxidoreductase subunit N 1015 K00343 4,4 1.6.5.3 Complex II contig‐38000030 842075 843796 1721 succinate dehydrogenase/fumarate reductase, flavoprotein subunit 2534 K00239 9,3 1.3.5.4 contig‐38000030 841326 842078 752 succinate dehydrogenase/fumarate reductase, iron‐sulfur subunit 1171 K00240 9,8 1.3.5.4 Complex III ‐ Complex IV contig‐38000030 132228 133949 1721 cytochrome c oxidase subunit I 1768 K02274 6,5 1.9.3.1 contig‐38000030 131749 132228 479 cytochrome c oxidase subunit II 502 K02275 6,6 1.9.3.1 Complex V contig‐38000030 858972 859520 548 inorganic pyrophosphatase 487 K01507 5,6 3.6.1.1 contig‐38000030 1E+06 1E+06 2363 H+‐transporting ATPase 297 K01535 0,8 3.6.3.6 contig‐35 25608 27362 1754 V/A‐type H+/Na+‐transporting ATPase subunit A 1995 K02117 7,2 contig‐35 27693 28751 1058 V/A‐type H+/Na+‐transporting ATPase subunit C 865 K02119 5,1 contig‐35 23562 24227 665 V/A‐type H+/Na+‐transporting ATPase subunit D 758 K02120 7,2 contig‐35 27367 27696 329 V/A‐type H+/Na+‐transporting ATPase subunit F 359 K02122 6,9 contig‐35 21196 23124 1928 V/A‐type H+/Na+‐transporting ATPase subunit I 1379 K02123 4,5
Cytochrome bd complex contig‐38000030 728449 729816 1367 cytochrome d ubiquinol oxidase subunit I 274 K00425 1,3 1.10.3.14
Amino acid degradation contig‐38000030 202896 204146 1250 glutamate dehydrogenase 13117 K00261 66,0 1.4.1.3 Table S6: Most abundant top 20 mRNA reads of all three community members of the enrichment culture, using KEGG and PROKKA databases for annotation.
Contig start stop gene length description reads RNA KEGG KO RPKM EC A_DKE contig‐37000013 69775 70080 305 translation initiation factor IF‐2 subunit beta 10563 217,8 contig‐44000010 18682 18975 293 hypothetical protein 6358 136,5 contig‐37000013 317631 317810 179 hypothetical protein 2636 92,6 contig‐44000010 45231 45533 302 hypothetical protein 3924 81,7 contig‐37000013 181665 184601 2936 hypothetical protein 34635 74,2 contig‐2000020 182168 182545 377 hypothetical protein 3625 60,5 contig‐37000013 267356 267466 110 hypothetical protein 1044 59,7 contig‐37000013 7984 8193 209 hypothetical protein 1721 51,8 contig‐21000035 25725 26252 527 hypothetical protein 4081 48,7 contig‐1000030 38585 38923 338 hypothetical protein 2513 46,8 contig‐44000010 18968 19342 374 lineage‐specific thermal regulator protein 2746 46,2 contig‐49000031 56730 57038 308 hypothetical protein 2068 42,2 contig‐2000020 164191 164433 242 translation initiation factor IF‐2 subunit beta 1554 40,4 contig‐37000013 267507 267860 353 hypothetical protein 1931 34,4 contig‐37000013 285871 286191 320 thioredoxin 1681 K03671 33,0 contig‐2000020 12871 13170 299 hypothetical protein 1436 30,2 contig‐25 2681 2932 251 PRC‐barrel domain protein 1192 29,9 contig‐44000010 54824 54943 119 hypothetical protein 496 26,2 contig‐44000010 90705 90800 95 hypothetical protein 367 24,3
B_DKE contig‐31 57635 59110 1475 HD domain protein 483384 K06885 2060,8 contig‐7 105910 108729 2819 bacterial extracellular solute‐binding protein 401991 896,7 contig‐42000024 38066 38572 506 replication factor A1 21750 K07466 270,3 contig‐1000036 117348 117620 272 DNA‐binding protein HTa 10705 247,5 contig‐21 33575 34189 614 superoxide dismutase, Fe‐Mn family 18966 K04564 194,2 1.15.1.1 contig‐21 32809 33498 689 ornithine cyclodeaminase 19157 K01750 174,8 4.3.1.12 contig‐11 600 2225 1625 thermosome subunit beta 44712 173,0 contig‐32 70969 71400 431 zinc‐containing ferredoxin 11708 170,8 contig‐37 14092 15372 1280 glutamate dehydrogenase 34744 K00261 170,7 1.4.1.3 contig‐39 28395 29009 614 putative membrane protein 14746 K08980 151,0 contig‐0 169450 169914 464 hypothetical protein 10524 142,6 contig‐1000033 29597 30283 686 proteasome alpha subunit 15525 K03432 142,3 3.4.25.1 contig‐7 17508 20420 2912 hypothetical protein 65546 141,5 contig‐0 122793 123041 248 putative HTH‐type transcriptional regulator 5335 135,3 contig‐8 44214 44702 488 archaeal flagellar protein FlaC 10106 K07822 130,2 contig‐6 16406 18757 2351 ribonucleoside‐diphosphate reductase alpha chain 48591 K00525 130,0 1.17.4.1 contig‐7 60627 60974 347 carboxymuconolactone decarboxylase family protein 7170 129,9 contig‐31 25873 27147 1274 elongation factor 1‐alpha 26035 K03231 128,5 contig‐37 12560 12745 185 hypothetical protein 3702 125,8 contig‐2000035 48894 49319 425 hypothetical protein 8287 122,6
C_DKE contig‐38000030 1E+06 1E+06 431 zinc‐containing ferredoxin 4985 72,7 contig‐38000030 202896 204146 1250 glutamate dehydrogenase 13117 K00261 66,0 1.4.1.3 contig‐38000030 848006 848488 482 replication factor A1 4696 K07466 61,3 contig‐35 45838 47196 1358 4‐aminobutyrate aminotransferase 9988 K00823 46,3 2.6.1.19 contig‐35 161263 161880 617 hypothetical protein 4305 K08980 43,9 contig‐35 117743 118084 341 programmed cell death protein 5 1636 K06875 30,2 contig‐43000032 73535 73807 272 DNA‐binding protein HTa 1154 26,7 contig‐43000032 66418 66717 299 sec‐independent protein translocase protein TatA 1214 K03116 25,5 contig‐38000030 45100 46374 1274 elongation factor 1‐alpha 5125 K03231 25,3 contig‐38000030 987718 990306 2588 bacterial extracellular solute‐binding protein 10303 25,0 contig‐38000030 180575 181012 437 hypothetical protein 1493 21,5 contig‐38000030 289576 290568 992 iron complex transport system substrate‐binding protein 3266 K02016 20,7 contig‐38000030 1E+06 1E+06 359 hypothetical protein 1171 20,5 contig‐35 112257 113144 887 hypothetical protein 2889 20,5 contig‐38000030 480699 481172 473 putative peroxiredoxin 1532 20,4 contig‐38000030 62409 64313 1904 2‐oxoacid ferredoxin oxidoreductase subunit alpha 5706 K00174 18,8 1.2.7.11 contig‐35 191260 191712 452 universal stress protein 1340 18,6 contig‐35 18646 19275 629 cytochrome C oxidase subunit II 1826 18,3 contig‐38000030 927214 927480 266 elongation factor 1‐beta 766 K03232 18,1 contig‐35 32080 32697 617 superoxide dismutase, Fe‐Mn family 1754 K04564 17,9 1.15.1.1 Table S7: Primers used in this study.
Name Sequence 5´ to 3´ Application
General forward primer for 5,8S rRNA gene ITS1 TCCGTAGGTGAACCTGCGG and relating ITS DNA-sequences of fungi 19 General reverse primer for 5,8S rRNA gene ITS4 TCCTCCGCTTATTGATATGC and relating ITS DNA-sequences of fungi 19 Fusionprimer GTGTTTTACGCCGCATCC Forward fusion primer for A_DKE and for Thermoplasmatales sequences (this study)
Fusionprimer CAGTGATAAGCTGTCAAACATGAG Reverse fusion primer for A_DKE and rev Thermoplasmatales sequences (this study)
GTGTTTTACGCCGCATCCGGCATTACAAAATGA A_DKE cloning Forward cloning primer for A_DKE (this CTTTGTAAACGCGTGGATCCCTTAGTACAGTGG Primer for study) GTGACGC CAGACGACATCGAAGTAGCAAACCCTATGGTT A_DKE cloning GGGACAGTGGAACAATC Reverse cloning primer for A_DKE (this study) Primer rev
Thermoplasma TGGCGTAACGATTGTTCCACTGTCCCAACCATA Forward cloning primer for tales cloning GGGTTTGCTACTTCGA Thermoplasmatales (this study) Primer for Thermoplasma CAGTGATAAGCTGTCAAACATGAGAATTCGAG Reverse cloning primer for tales cloning CTCCGTTCCTCTCGTACTAAAGGC Thermoplasmatales (this study) Primer rev A_DKE qPCR CTTAGTACAGTGGGTGACGC for Forward qPCR primer for A_DKE (this study)
A_DKE qPCR GGTTGGGACAGTGGAACAATC rev Reverse qPCR primer for A_DKE (this study)
Thermo qPCR GGGTTTGCTACTTCGATGTCG Forward qPCR primer for Thermoplasmatales for (this study)
Thermo qPCR CGTTCCTCTCGTACTAAAGGC Forward qPCR primer for Thermoplasmatales rev (this study)
General forward primer for 16S rRNA gene of Arch20F TTCCGGTTGATCCYGCCRG archaea20 General forward primer for 16S rRNA gene of Uni1406R GACGGGCRGTGTGTRCAA prokaryotes21
Table S8: Calculating 23S rRNA gene copy numbers. Normalized per-sample coverages for the 23S rRNA genes are below the average/median metagenomic coverages of all genes, indicating a 23S rRNA gene copy number of one, respectively. RPK = Reads per kilobase.
RPK in S1 RPK in S2 23S rRNA Median of Mean ± SD of 23S rRNA Median of Mean ± SD of Genome gene all genes all genes gene all genes all genes 96,042.1 ± 201,755.0 ± A_DKE 75,582.5 96,092.1 148,337.0 203,944.0 12,216.3 22,531.3 141,842.0 ± 58,767.9 ± B_DKE 113,425.0 141,111.0 44,626.6 58,081.1 20,907.6 8,550.3 19,633.0 ± 2,750.8 ± C_DKE 18,981.8 19,835.6 2,474.4 2,767.1 2,595.7 350.1
Table S9: Metagenomic and -transcriptomic sequencing. We sequenced 26.6 Gbp and 17.3 Gbp of the metagenome and –transcriptome, respectively, with biological replicates available for metagenomic samples (aiding the successive binning step).
Included in assembly Sample Library Protocol No. of reads No. of base pairs [bp] [%] S1 MG 2 x 51 bp 293,819,146 14,984,776,446 95.38 S2 MG 2 x 51 bp 227,249,154 11,589,706,854 96.17 MT MT 2 x 100 bp 173,164,004 17,316,400,400 91.83
SI References
1. Haldimann, A. & Wanner, B. L. Conditional-replication , integration , excision , and retrieval plasmid-host systems for gene structure-function studies of bacteria. J. Bacteriol. 183, 6384– 6393 (2001).
2. Li, L., Stoeckert, C. J. J. & Roos, D. S. OrthoMCL: Identification of Ortholog Groups for Eukaryotic Genomes. Genome Res. 13, 2178–2189 (2003).
3. Hacquard, S. et al. Survival trade-offs in plant roots during colonization by closely related beneficial and pathogenic fungi. Nat. Commun. 7, 11362 (2016).
4. Ogata, H. et al. KEGG: Kyoto Encyclopedia of Genes and Genomes. Nucleic Acids Res. 27, 29– 34 (1999).
5. Eddy, S. Profile hidden Markov models. Bioinformatics 14, 755–763 (1998).
6. Boisvert, S., Raymond, F., Godzaridis, E., Laviolette, F. & Corbeil, J. Ray Meta: scalable de novo metagenome assembly and profiling. Genome Biol. 13, R122 (2012).
7. Gurevich, A., Saveliev, V., Vyahhi, N. & Tesler, G. QUAST: Quality assessment tool for genome assemblies. Bioinformatics 29, 1072–1075 (2013).
8. Langmead, B. & Salzberg, S. L. Fast gapped-read alignment with Bowtie 2. Natl. Institutes Heal. 9, 357–359 (2013).
9. Li, H. et al. The Sequence Alignment/Map format and SAMtools. Bioinformatics 25, 2078– 2079 (2009).
10. Kang, D. D., Froula, J., Egan, R. & Wang, Z. MetaBAT, an efficient tool for accurately reconstructing single genomes from complex microbial communities. PeerJ 3, (2015).
11. Parks, D. H., Imelfort, M., Skennerton, C. T., Hugenholtz, P. & Tyson, G. W. CheckM: assessing the quality of microbial genomes recovered from isolates, single cells, and metagenomes. Genome Res. 25, 1043–55 (2015).
12. Droege, J., Gregor, I. & McHardy, A. C. Taxator-tk: Precise taxonomic assignment of metagenomes by fast approximation of evolutionary neighborhoods. Bioinformatics 31, 817– 824 (2015).
13. Seemann, T. Prokka: Rapid prokaryotic genome annotation. Bioinformatics 30, 2068–2069 (2014).
14. Lagesen, K. et al. RNAmmer: Consistent and rapid annotation of ribosomal RNA genes. Nucleic Acids Res. 35, 3100–3108 (2007).
15. Hyatt, D. et al. Prodigal: prokaryotic gene recognition and translation initiation site identification. BMC Bioinformatics 11, 119 (2010).
16. Quinlan, A. R. & Hall, I. M. BEDTools: A flexible suite of utilities for comparing genomic features. Bioinformatics 26, 841–842 (2010).
17. Moriya, Y., Itoh, M., Okuda, S., Yoshizawa, A. C. & Kanehisa, M. KAAS: An automatic genome annotation and pathway reconstruction server. Nucleic Acids Res. 35, 182–185 (2007).
18. Kanehisa, M. & Goto, S. KEGG: Kyoto encyclopedia of genes and genomes. Nucleic Acids Res. 28, 27–30 (2000). 19. White, T. J., Bruns, T., Lee, S. & Taylor, J. in PCR protocols: a guide to methods and applications. (eds. Innis, M. A., Gelfand, D. H., Sninsky, J. & White, T. J.) 315–322 (Academic, 1990).
20. Massana, R. & Murray, A. Vertical distribution and phylogenetic characterization of marine planktonic Archaea in the Santa Barbara Channel. Appl. Environ. Microbiol. 63, 50–56 (1997).
21. Kato, S. et al. Abundance of Zetaproteobacteria within crustal fluids in back-arc hydrothermal fields of the Southern Mariana Trough. Environ. Microbiol. 11, 3210–3222 (2009).