The Role and Regulation of Alternative Polyadenylation in the DNA Damage Response

City University of New York (CUNY) CUNY Academic Works

All Dissertations, Theses, and Capstone Projects Dissertations, Theses, and Capstone Projects

5-2019

Michael R. Murphy The Graduate Center, City University of New York

How does access to this work benefit ou?y Let us know!

More information about this work at: https://academicworks.cuny.edu/gc_etds/3105 Discover additional works at: https://academicworks.cuny.edu

This work is made publicly available by the City University of New York (CUNY). Contact: [email protected]

Investigating the Role and Regulation of Alternative Polyadenylation

in the DNA Damage Response

Michael Robert Murphy

A dissertation submitted to the Graduate Faculty in Biology in partial fulfillment of the requirements for the degree of Doctor of Philosophy, The City University of New York

2019

Michael Robert Murphy

The Role and Regulation of Alternative Polyadenylation in the DNA Damage Response

Michael Robert Murphy

This manuscript has been read and accepted for the Graduate Faculty in Biology in satisfaction of the dissertation requirement for the degree of Doctor of Philosophy.

Date Dr Frida Kleiman

Chair of Examining Committee

Date Dr Cathy Savage-Dunn

Executive Officer

Supervisory Committee:

Dr Frida Kleiman Dr Diego Loayza Dr Olorunseun Ogunwobi Dr Kevin Ryan Dr Bin Tian

THE CITY UNIVERSITY OF NEW YORK

iii

Abstract

Investigating the Role and Regulation of Alternative Polyadenylation in the DNA Damage

Response

Michael Robert Murphy

Advisor: Dr Frida Esther Kleiman

Cellular homeostasis is achieved by the dynamic flux in gene expression. Post-transcriptional regulation of coding and non-coding RNA offers a fast method of adapting to a changing cellular environment, including deadenylation, microRNA (miRNA) pathway, and alternative polyadenylation (APA). In this dissertation, I explored some of the mechanisms involved in the post-transcriptional regulation of gene expression. The main hypothesis in these studies is that a single APA event after DNA damage is governed by specific conditions and factors outside of current known regulators of APA, and that the resultant transcript has a role in the DNA damage response (DDR). My aims were a) to investigate the RNA processing and coding potential of a

CDKN1A APA transcript, b) to elucidate the conditions and factors involved during CDKN1A

APA induction, and c) to determine whether the CDKN1A APA transcript possess any biological function.

In Chapter II, I investigated the miRNA-dependent recruitment of PARN nuclear deadenylase to p53 mRNA 3’ untranslated region (3’UTR), as part of the regulatory feedback loop involving PARN and p53. Then my studies focused on the function and regulation of APA during the progression of DDR. Understanding the scope and impact of APA in different cellular settings will help us to understand changes in the transcriptome and proteome and will offer alternative avenues for specific and effective pharmaceutical design. In Chapter III, I present

iv evidence of the magnitude of APA events occurring within introns during DDR, and the mechanisms involved in the regulation of these intronic APA events. In Chapter IV, I further investigate the coding potential and post-transcriptional processing of an intron-APA transcript from the cyclin-dependent kinase inhibitor 1A (CDKN1A) gene, which encodes the cell cycle arrest protein p21. Specifically, I observe that the CDKN1A intron-APA transcript has the potential to be spliced from an alternative splice site, generating a ‘cryptic’ exon upstream of intron-APA site, but also to exist as a non-spliced isoform. My results also indicate that neither isoform is protein-coding, implicating the resultant transcripts are stable long non-coding RNAs.

In Chapter V, I characterized the CDKN1A intron-APA transcripts and analyzed the mechanisms involved in their regulation, including the effect of both DNA binding proteins (p53) and RNA binding proteins (HuR). Finally, in Chapter VI, I present evidence that far from being a by- product of transcriptional control of canonical CDKN1A full-length mRNA, intron-APA transcripts from CDKN1A gene play roles both in a non-stress and in DDR conditions, and also can alter the timing of events during DDR. Thus, the data presented in this dissertation provides new insights into the regulation of APA as well as the cellular roles that these events can participate.

This offers a greater understanding of DDR, which aids in clearly defining pathways during therapeutic development for diseases, such as cancer.

Significance

Disruptions to normal homeostasis are constant events in a cell’s lifetime and come from a variety of endogenous and exogenous sources. Many of these disruptions manifest as damage to the nuclear DNA. While some of the lesions lead to synonymous mutations affecting specific proteins, such as spontaneous base changes, many lead to more extensive alterations such as double strand breaks and erroneous chromosomal fusions, or lesions that indirectly interrupt cellular function by preventing processive transcription or replication. The cell possesses several interconnected processes to respond to such preventive damages that depend on the nature, duration and intensity of damage. The genetic and proteomic make-up of the cell can also dictate functional output during DDR. There are mechanisms in place to promote cell cycle arrest, programmed cell death, as well as transcriptional and post- transcriptional programs to produce a swift and global response to any perturbation. Some of these post-transcriptional programs include both deadenylation of mRNA transcripts leading to mRNA destabilization as well as APA due to recognition of alternative poly(A) signals within the same transcriptional unit. Both events serve to alter the transcriptome and thus the proteome and ultimately cellular function.

This dissertation characterizes some examples of these post-transcriptional events and how they contribute to DDR. My studies indicate that alterations in RNA-protein complex formation are part of a competition between two cooperative processes affecting RNA stability, specifically the endonuclease Ago2 and the nuclear deadenylase PARN, which are components of the microRNA and deadenylation machinery, respectively. Part of my studies showed that sequence elements in the RNA are necessary for their recruitment. This study investigated more closely how the 3’UTR of tumor suppressor TP53 mRNA acts as a docking station for

RNA regulators, helping to regulate mRNA levels and, thus, protein expression. This is relevant

vi because it implicates RNA regulators affecting tumor suppressor pathways and hence carcinogenesis. My findings lead to a broader understanding of the interplay of RNA regulatory pathways following DNA damage.

The dynamic nature of mRNA 3’ end processing machinery allows the regulation of sites of RNA cleavage and polyadenylation during transcription, APA, and hence transcriptome composition having the potential to contribute to the cells rapid response to stress. It has been shown that the splicing factor U1 snRNP is central to the regulation of APA in a concentration- dependent manner (Kaida et al. 2010; Berg et al. 2012). The presence of U1 snRNA prevents the activation of cryptic promoter-proximal poly(A) sites, while the absence of U1 snRNA permits their expression. While the papers referenced involved artificial manipulation of U1 snRNA levels, this dissertation demonstrates that promoter-proximal intron APA is activated as a result of lowered U1 snRNA levels during DDR (Morra et al. 1986; Devany et al. 2016). As many of the genes undergoing intronic APA during DDR are also identified as DDR genes, my studies highlight that APA acts as both a consequence and cause of the response to cellular stress.

While many of the components of the response to damage have been revealed, some aspects remain understudied as new paradigms come to light, such as the functional roles of

RNAs both during stress and normal cellular homeostasis. My studies reveal some of the characteristics of a gene undergoing intronic APA, CDKN1A, which encodes the global inhibitor of cyclin-dependent kinases p21 (El Deiry et al. 1993). Importantly, my studies indicate that the alternative transcript produced from CDKN1A intronic APA is a long non-coding RNA (lncRNA).

Evidence presented in this dissertation shows that this lncRNA from intronic APA events affects the protein expression of the endogenous canonical product of CDKN1A, which in turn affects cell proliferation. Understanding the complexity of the interplay between intronic APA events and canonical gene products involved in DDR/tumor suppression, such as CDKN1A/p21, might help us to understand cell-specific profiles, improving the development of new therapies and the

vii identification of cancer subtypes. Although more work is necessary to identify the specific mechanism involved in intronic APA isoforms-mediated regulation of protein expression, this dissertation provides a valuable framework for understanding how APA events contribute to cell’ rapid response to DNA damage.

viii

Table of Contents

Chapter I: Background 1

Cleavage and Polyadenylation 2

Alternative Polyadenylation 5

Regulators of Alternative Polyadenylation 9

DNA Damage Response 14

Long Non-Coding RNA 19

Chapter II: Interplay between PARN-mediated deadenylation and 25

miRNA regulation in the DNA damage response

Background 26

Results 27

Discussion 29

Chapter III: Biochemical validation of bioinformatic analyses investigating 34

alternative polyadenylation during the DNA damage reponse in

mammalian cells

Background 35

Results 38

Discussion 42

Chapter IV: Investigating RNA processing and protein-coding capacity 47

of an intron-APA transcript from CDKN1A

Background 48

Results 49

Discussion 58

Chapter V: Examining the conditions and factors involved in CDKN1A 60

intron-APA induction

Background 61

Results 62

Discussion 81

Chapter VI: Investigating the cellular function of CDKN1A intronic APA 87

transcripts

Background 88

Results 89

Discussion 104

Chapter VII: Future Directions 109

Chapter VIII: Experimental Procedures 116

Chapter IX: References 124

List of Figures

Figure 1: Schematic of the CpA process. 3

Figure 2: Variations of polyadenylation selection possible within protein 6

coding genes.

Figure 3: Schematic of the basic principles behind DDR. 15

Figure 4: Diagram of initial sensors and effectors after DNA damage. 16

Figure 5: Schematic of how lncRNAs could interact with other components 20

and affect cellular processes

Figure 6: Non-coding RNAs generated around CDKN1A. 22

Figure 7: Binding of the miRNA and deadenylation machinery to TP53 31

mRNA depends on ARE sequences and miRNA targeting sites.

Figure 8: Schematic protocol for 3’READS 37

Figure 9: UV promotes alterations in both 3’UTR- and intron-APA 41

Figure 10: U1 snRNA overexpression suppresses UV-mediated apoptosis in 43

HCT116 cells.

Figure 11: CDKN1A Intron APA transcript undergoes splicing. 52

Figure 12: 3’ rapid amplification of cDNA ends (3’RACE) gives experimental 54

evidence of an endogenously utilized polyadenylation site within intron 1

of CDKN1A.

Figure 13: Ex vivo and in vitro translation reactions yield no detectable protein 56

product for both spliced and unspliced CDKN1A APA isoforms.

Figure 14: Comparative analysis of the poly(A) signal for intron-APA transcript 57

and canonical CDKN1A mRNA.

Figure 15: p53 is necessary for CDKN1A intron-APA induction. 64

Figure 16: Expression profiles for lncRNAs in normal tissue and cancer samples 66

obtained from AnnoLnc software.

Figure 17: CDKN1A APA isoforms and full-length expression in a variety of cell lines 68

and stressor conditions.

Figure 18: Rescuing CDKN1A full-lenght mRNA induction with caffeine pretreatment 71

does not abrogate DNA damage-induced APA.

Figure 19: Predicted HuR binding site overlaps with a dense conserved region in 75

CDKN1A intron 1.

Figure 20: HuR binds to unspliced but not spliced CDKN1A APA isoform. 76

Figure 21: HuR expression leves affect the abundance of CDKN1A APA transcripts. 77

Figure 22: HuR regulates abundance of CDKN1A APA isoforms in 78

transcription-independent manner.

Figure 23: Levels of CDKN1A APA isoforms are higher in p21-/- cells compared to 80

the parental cell line.

Figure 24: Localization of CDKN1A APA isoforms. 90

Figure 25: Nested PCR of 3’RACE to detect CDKN1A spliced APA intronic isoform. 92

Figure 26: Analysis of potential donor site strengths within exon 1 and alternative 93

exon in intron 1 of CDKN1A gene.

Figure 27: Overexpression of spliced CDKN1A APA transcript rescued the 95

UV-induced decrease of p21 protein levels with no effect on full-length

CDKN1A mRNA levels.

Figure 28: Overexpression of spliced CDKN1A APA transcript increases p21 protein 96

levels after UV treatment but does not prevent p21 degradation.

Figure 29: Discrepancy between detection of apoptosis markers and FACs analysis 98

is observed in samples form cells overexpressing spliced CDKN1A APA

transcript.

xii

Figure 30: Etoposide treatment masks the increase in p21 levels observed with 100

overexpression of spliced CDKN1A APA transcript.

Figure 31: CDKN1A APA isoforms overexpression does not enhance or suppress 101

101etoposide-mediated senescence.

Figure 32: siRNA-mediated knockdown of CDKN1A intronic APA isoforms can be 103

achieved without significantly affecting CDKN1A full-length mRNA levels.

Figure 33: Knockdown of CDKN1A APA isoforms decreases the level of p21 protein.105

Figure 34: Knockdown of APA increases proliferation rate in p21-dependent manner.106

Figure 35: Model for CDKN1A intronic APA induction and function. 111

Table 1: List of genes validated for APA after UV damage by qPCR analysis. 40

Table 2: Representative example of raw Ct values for control and CDKN1A isoforms. 84

xiii

CHAPTER I

BACKGROUND

Cleavage and Polyadenylation

Transcription termination in eukaryotic organisms is a highly conserved and coordinated step marking the transition between transcription and RNA processing. In all mRNAs, except for histones and long non-coding RNAs, transcription termination is demarcated from processive

RNA synthesis by the cleavage and polyadenylation (CpA) of the nascent RNA transcript. More specifically, the newly transcribed precursor, which is complementary to the template DNA strand from which it was blueprinted, is catalytically cleaved in the phosphate backbone leaving a reactive 3’OH group. Once endonucleolytic cleavage has occurred, a long string of non- templated adenosine residues are attached on the 3’ to denote the end of the transcript and affect stability on the RNA. Without polyadenylation, the nascent RNA would be vulnerable to degradation from 3’ exonucleases, leaving the message or catalytic activity the RNA had evolved to transmit prevented in its function.

Polyadenylation is carried out by a family of nucleotidyltransferases and is conserved across all 3 kingdoms of life (Anantharaman et al. 2002). Prokaryotes and archaea possess either oligonucleotide adenylate tracks or a CCA motif, while over evolutionary time, multicellular eukaryotes have adopted polyadenosine (polyA) tails into the hundreds of bases.

The enzyme responsible for the cleavage is also present across the kingdoms and is remarkably conserved between yeast and mammals (Jenny et al. 1996). The universality of this two-step coupled process highlights its importance in normal cellular homeostasis. Over billions of years, the process has amassed a sizable repertoire of over 80 catalytic, structural, activating, repressing, upstream and downstream components in mammalian cells (Shi et al.

2009); accounting for every normal and aberrant cellular condition. The core principle is detailed in Figure 1.

Figure 1: Schematic of the CpA process. 3’ end processing complexes (CPSF,

orange; CstF, green) are recruited to the DNA at the transcription bubble, and

recognize their respective sequences in the nascent transcript. The light blue

cleavage factors (CFs) aid in cleavage of the nascent RNA, allowing for poly(A)

polymerase (PAP) to catalyze the addition of adenosine nucleotides for poly(A)

binding (PAB) protein to bind to and protect the nascent RNA from degradation.

Taken from Elkon et al. 2013.

As it is understood today, CpA in humans occurs only in genes transcribed by the holoenzyme RNA polymerase II (RNAP II). As RNAP II traverses a gene, initiating from the promoter, the core complex and surrounding factors will encounter numerous DNA binding proteins (DBPs), histone contexts, and sequence elements conferring information about the immediate cellular environment, which will, in turn, affect the speed and frequency of transcription. These contextual cues will also dictate where the nascent RNA transcript will end.

Canonically, this cue exists as the hexanucleotide AAUAAA, identified over 40 years ago

(Proudfoot and Brownlee 1976; Fitzgerald and Shenk 1981), which is necessary for CpA to occur (Connelly and Manley 1988) but not for transcription to terminate (Zhang et al. 2015).

More recent analysis has shown this sequence to be the polyadenylation signal in ~50% of

cases, as numerous other variants are utilized with decreased efficacy (Tian et al. 2005). As shown in Figure 1, the complex responsible for recognition of the poly(A) signal is cleavage and polyadenylation specificity factor (CPSF). While the subunit CPSF-160 directly binds to the RNA at the poly(A) signal (Murthy and Manley 1995), subunit CPSF-73 contains the enzymatic activity for endonucleolytic cleavage (Mandel et al. 2006) at the poly(A) site, several nucleotides downstream of the poly(A) signal. Helping to coordinate the architecture of CpA machinery is recognition of a GU-rich sequence downstream of the poly(A) site by the cleavage stimulation factor (CstF) complex.

RNAP II has a conserved domain at its C-terminal end (C-terminal domain; CTD) consisting of a heptad repeat in humans, which is subject to a number of modifications: phosphorylation, peptidyl isomerization, and glycosylation (Bentley 2014). It is known that the

CTD is necessary for efficient CpA, partly through recruitment of CSPF and CstF components

(McCracken et al. 1997), which occurs in proximity to RNAP II localization sites throughout transcribed genes, according to chromatin immunoprecipitation (ChIP) experiments (Glover-

Cutter et al. 2008). It was also found that CPSF is required to induce polymerase pausing once it encounters a functional poly(A) signal (Nag et al. 2007). These studies suggest that rather than reside close by to the site of CpA, CstF and CPSF travel along with RNAP II during nascent gene transcription in search of the poly(A) signal.

Other major components of the CpA machinery include cleavage factor (CF) required for the cleavage reaction, CF IIm involved in the binding to RNAP II CTD and other CpA factors, and poly(A) polymerase (PAP) involved in the addition of the adenosine tail. Since its discovery, polyadenylation has been shown to be a vital part in controlling gene expression by affecting the

RNA’s lifespan, regulating its stability (Drummond et al. 1985; Bernstein et al. 1989), translational efficiency (Gallie 1991), and export from the nucleus (Fuke and Ohno 2008). As the presence or absence of a poly(A) regulates these processes, the length of a poly(A) tail can itself be regulated for the same purposes (Eckmann et al. 2011). Thus, CpA is a highly

regulated and coordinated process whose regulatory signaling range between transcription initiation and protein production.

Alternative Polyadenylation

As the primary signal for CpA is a hexanucleotide sequence, it is easy to predict that the

AAUAAA sequence can occur more than once per gene. Not including the effects of selection, or repeat sequences such as microsatellites and long interspersed nuclear elements (LINES), the probability of encountering one AAUAAA is 46 every 4096 bases. Assuming the human genome has approximately 3 billion bases, there are 732,422 potential CpA sites, without even taking into account functional variants of AAUAAA. While not every defined locus of the human genome is characterized as a gene, transcription by RNAP II is pervasive (ENCODE Project

Consortium et al. 2007; Clark et al. 2011; Loya and Reines 2016), offering a wealth of opportunity for novel functional transcripts.

Some of the earliest recorded alternative polyadenylation (APA) events fall into two broad forms of APA: 3’ untranslated region (3’UTR) APA (Tosi et al. 1981) and coding region

APA (CR-APA) (Early et al. 1980) (Figure 2). Any mRNA produced is likely not only to possess a coding sequence spread out over a number of exons, but also flanking non-coding regions, of which the promoter proximal (5’UTR), at ~200 nt, is on average 5 times smaller than the ~1000 nt of the 3’UTR (Mignone et al. 2002). This difference in length provides the 3’UTR additional chances to harbor extra poly(A) sites. But what advantage would more than one poly(A) site in the 3’UTR convey? As poly(A) tails play a crucial role in RNA regulation, having more variation in the signaling present in the 3’UTR offers more opportunities and a tighter post-transcriptional regulation for any cellular context. For example, committing APA in a more upstream position within the 3’UTR decreases the number of possible regulatory elements as well as alters RNA secondary structure (Freire-Picos et al. 2001; Lamas-Maceiras et al. 2011). 3’UTR-APA in a more upstream position results in an mRNA that has lost accessibility for regulatory factors such 5

as RNA binding proteins (RBPs) and RNAs with complementary base-pairing, such as, but not restricted to, miRNAs, leading to a loss of either positive or negative regulatory effects. In sum, the binding or lack thereof of regulatory signaling as a consequence of 3’UTR APA affects the levels of the resultant mRNA, controlling not only protein expression levels but also protein localization (Berkovits and Mayr 2015).

Figure 2: Variations of polyadenylation selection possible within protein coding

genes. Constitutive PA stands for genes with only one poly(A) site. In UTR-APA,

each alternative poly(A) site exists in the terminal exon. In CR-APA, the

alternative poly(A) site can reside in either an exon or intron upstream from the

terminal exon. Adapted from Rehfeld et al. 2013.

The importance and scope of APA is exemplified by the close monitoring, widespread data gathering and numerous all-encompassing perspectives being generated since the turn of the decade (Di Giammartino et al. 2011; Lutz and Moreira 2011; Elkon et al. 2013; Tian and

Manley 2013, 2017). This flurry of insight is thanks in part to seminal papers using bioinformatic analysis to investigate APA in mammalian cells (Tian et al. 2005; Yan and Marr 2005; Zhang et al. 2005), which were able to address the frequency of APA occurrence and identify the players in this complex regulatory network.

Some of the earliest attempts to investigate APA on a genome-wide scale involved elucidating the position of termination sites in expressed sequence tags (ESTs) (Gautheret et al.

1998; Beaudoing et al. 2000), short cDNA sequences produced from clonal libraries, many of which helped in gene discovery and mapping of the human genome (Adams et al. 1991). From these studies, the extent of APA was estimated to occur in 20%-50% of transcription units. More sophisticated bioinformatic approaches culminated in an agreed estimate of 50% of genes possessing one or more poly(A) site. With enhancements in deep sequencing techniques that number has expanded to 70-85% of genes (Ozsolak et al. 2010; Derti et al. 2012).

The implication of such an expansion in the number of potential transcripts from this calculation should not be underestimated. Just as the impact RNA splicing had on proteomic diversity and was recognized for such by the work of Roberts and Sharp in the 1993 Nobel Prize in Physiology or Medicine (Sharp 1994), APA has similar functional outputs in its CR-APA form.

In contrast to 3’UTR-APA, which has multiple effects on mRNA or protein position and abundance, CR-APA occurs anywhere upstream of the terminal exon and is capable of producing an altered amino acid sequence (Figure 2). These differential termination sites have a variety of end-products. APA can occur in an upstream intron; leading to either a) an extension of the preceding exon and a novel C-terminal of the protein and/or 3’UTR (known as composite), or b) the utilization of an alternative 3’ splicing site upstream of poly(A) signal

(known as skipped exon). APA can also be in an upstream exon resulting in a truncated protein.

In rare cases, APA can occur in the 5’UTR (Shen et al. 2008) resulting in either an alternative start codon coupled with a small molecular weight protein, a small non-coding RNA, or an unstable transcript. 5’UTR-APAs are rare because the transcripts are severely truncated and, in many cases, nonfunctional with a small average size for CpA to occur. The production of shorter transcripts from promoter-proximal poly(A) sites could represent a post-transcriptional mechanism to downregulate the usage of the canonical poly(A). However, regulating gene expression using this mechanism creates a potential cellular burden: what to do with the resultant RNA?

The cell appears to be in the midst of its very own evolutionary arms race by having as many ways to degrade aberrant RNA species as it does in creating them, thus striking a balance between function and prevention of deleterious products. As I mentioned, transcription is pervasive, and this includes bidirectional transcription from promoters (Seila et al. 2008) and promoter-proximal termination (Szczepińska et al. 2015), both of which are negatively regulated by exosome complex-mediated exonucleolytic activity (Preker et al. 2008) and downregulation of transcription (Andersen et al. 2012). What complicates matters are that both types of these transcripts are 5’ capped and 3’ (poly) adenylated and thus are inherently stable prior to exosome complex detection. Notably, exosome-mediated degradation of these transcripts is not universal across conditions, as decreased degradation is seen after DNA damage (Blasius et al.

2014). A component of the microRNA processing machinery, DICER1, was also recently implicated in APA regulation through regulating RNA degradation (Burger et al. 2016), perhaps through RNA binding site availability. Thus, the levels of shorter transcripts is kept low except in cases where resources are diverted elsewhere, such as stress, or when these stable shortened transcripts possess functional significance.

Regulators of Alternative Polyadenylation

Despite the aberrant nature of many prematurely polyadenylated transcripts, there are undoubtedly a significant number of instances in which stable shortened transcripts generated by APA are functional. Originally, aberrant transcripts were only detected in studies using artificial knockdown of exosome complex components. However, APA studies have detected stable shortened transcripts in basal conditions. The selection during ongoing transcription of one polyadenylation signal over another goes beyond the DNA sequence-mediated binding affinity of CPSF to the poly(A) signal, and many factors spanning a range of primary pathways have been shown to have at least partial responsibility in positive or negative regulation of the usage of one or more poly(A) sites, as will be discussed.

Splicing Factors

A potent effector of APA studied in the past few years has been the small nuclear RNA

U1 (U1 snRNA). Originally, this non-coding RNA was known for its role as the 5’ splice site recognition factor. U1 snRNA is the RNA component of the ribonucleoprotein particle U1 snRNP and is necessary for the downstream steps in RNA splicing (Mount et al. 1983; Krämer et al.

1984). However, work from the Dreyfuss lab has identified a global splicing-independent role of

U1 snRNA in preventing promoter-proximal polyadenylation site usage (Figure 2) (Kaida et al.

2010; Berg et al. 2012). Functioning in a 5’-3’ direction, U1 snRNA used its degenerate RNA binding capacity to base-pair with a number of cryptic, unused 5’ss, thus masking nearby cryptic, presumably aberrant poly(A) sites. A decrease in U1 abundance correlates with the use of the most proximal poly(A) sites. These studies are consistent with earlier work that show that various components of U1 snRNP can interact with CpA factors (Awasthi and Alwine 2003), suppressing polyadenylation at the canonical poly(A) site (Boelens et al. 1993; Gunderson et al.

1998; Ashe et al. 2000) and promoting APA (Lou et al. 1998).

Splicing and CpA are in fact intimately linked, as both events occur within the same timeframe and transcriptional unit. Interestingly, decreased usage of a particular AAUAAA can lead to decreased splicing of the most proximal (terminal) intron to the poly(A) signal, but not upstream introns (Niwa and Berget 1991; Cooke et al. 1999). Decreased usage of a 3’ splice site also reduced the usage of the adjacent polyadenylation sequence (Niwa and Berget 1991;

Cooke et al. 1999), highlighting the interrelatedness of these processes. Because of this link, factors affecting one process may be indirectly affecting the other. An example of this phenomenon is TRAP150, whereby through interaction with both spliceosomal components

(including U1 snRNP) and CpA factors promotes the usage of APA through the utilization of alternative terminal exons (Lee and Tarn 2014). Similarly, a subunit of the general transcriptional regulator Mediator; MED23, regulates splicing causing a concomitant activation of APA through alternative terminal exon usage (Huang et al. 2012)

An intriguing aspect of the competition and/or cooperation of a splice site and an intronic polyadenylation site is the relative strength of each signaling. The “strength” refers specifically to the binding affinity of recognition factors to their respective sequences, not only to the 3’ss or poly(A) signal, but also to surrounding regulatory elements that confer activation or suppression of the respective site. By and large, a weak polyadenylation signal (any of the variants other than AAUAAA or AUUAAA) corresponds with a composite terminal exon and no additional alternative splicing, whereas a strong polyadenylation signal corresponds with an alternative terminal exon and the occurrence of splicing (Tian et al. 2007). While I have mainly focused on the effect splicing factors have on CpA, the CpA machinery has also been implicated in splicing efficacy, such as CPSF (Li et al. 2001). Why might such a coupling occur? Perhaps acting redundantly as a failsafe to ensure transcription terminates at any particular site and this might change in different cellular conditions. Thus, this highly interdependent network is controlled by a variety of factors and sequence elements with a scale of binding affinity to finely tune gene expression.

Cleavage/Polyadenylation Factors

The multitudinous proteins involved in CpA are capable of regulating APA itself in contrasting fashions to different scales. Given the enormity of the complex(es) (Shi et al. 2009),

I will highlight just a select few examples.

One early example is CstF-64, which is part of the CstF complex. It was found that in naive B-cells, CstF-64 expression is deliberately repressed, reducing cleavage efficiency of the immunoglobulin IgM transcript and resulting in usage of a higher affinity, distal poly(A) site

(Takagaki et al. 1996). During differentiation, CstF-64 levels increase, allowing the usage of the more proximal, lower affinity poly(A) site. This CR-APA event produces a secreted versus membrane-bound form of IgM (Early et al. 1980).

To characterize the effect of factors known to play roles in CpA on both 3’UTR APA and

CR-APA, depletion of these factors and deep sequencing was performed ( Li et al. 2015).

Through these experiments it was possible to uncouple the regulation of 3’UTR-APA and CR-

APA. While subunits of CF I (Figure 1) were found to be the most significant repressors of proximal APA within the terminal exon, the greatest repressors of CR-APA (i.e. APA in introns) were U1 snRNA (as mentioned before) and SF3B1; a splicing factor involved in 3’ss definition.

Interestingly, U1 decrease also produces a shorter isoform of the CstF complex subunit CstF-77

(Luo et al. 2013), which in turn can lead to global lengthening of mRNAs, perhaps acting as a feedback mechanism.

An important and arguably overriding preoccupation with the study of APA is its role in health and disease. Any incidence of APA dysregulation as an epidemiological factor is unquestionably evidence of its relevance in cellular homeostasis, and reports are emerging in this regard. Agami and colleagues discovered that oculopharyngeal muscular dystrophy, a late onset autosomal degenerative disease, is caused by a triplet repeat expansion in the CpA factor poly(A) binding protein nuclear 1 (PABPN1) (Jenal et al. 2012). Mutant PABPN1 has a dominant

negative physical interaction with the wild-type protein, preventing normal inhibition of promoter- proximal APA events.

Not only can CpA factors undergo mutations detrimental to the cell but the sequences they recognize are also subject to similar aberrations. A follow up for a genome wide association study (GWAS) for systemic lupus erythematosus (SLE) identified a single nucleotide polymorphism correlating to interferon regulatory factor 5 (IRF5) (Graham et al. 2007). One of the functional alleles of IRF5 possess a canonical poly(A) signal leading to usage of a downstream signal, extension of 3’UTR and decrease in mRNA stability.

The ubiquitous nature and general function of CpA machinery offers an explanation as to why it can affect APA on a global scale. It has also been shown that APA can sufficiently affect gene expression to drive carcinogenesis or other disease phenotypes (reviewed in Elkon et al.

2013; Tian and Manley 2017).Supporting this idea, overall shortening of 3’UTRs as a result of

APA is capable of driving higher proliferation - a cancer phenotype - by reducing negative regulatory elements present in the 3’UTR of pro-proliferation mRNAs (Mayr and Bartel 2009).

Mutations in CpA proteins such as PABPN1 and PABPC1 could potentially propagate this effect as they promote distal poly(A) site usage (Li et al. 2015). In addition, a subunit of CF1 complex,

CFIm25, suppresses proximal poly(A) site usage as a method of tumor suppression in glioblastomas (Masamha et al. 2014). Thus, the CpA machinery is intimately linked with APA with ramifications in cancer and other diseases due to the myriad protein factors involved in the proper regulation of 3’ end processing.

Other Factors and Conditions

The regulation of APA is not restricted to factors involved in splicing and CpA. Gene expression is tightly controlled to allow temporal and spatial dynamic changes and this involves a number of protein components from diverse pathways, and APA is no exception. Indeed, a staggering number of conditions are capable of shifting CpA from one site to another.

A significant portion of proteins within the nucleus are transcription factors (TFs).

Loosely put, a transcription factor is any chromatin-associating protein that can positively or negatively influence mRNA expression (Latchman 1997). This umbrella definition makes TFs prime candidates for roles in APA, for they are capable of being present at ground zero of the reaction, influencing either the reaction itself or the factors enacting it. One such candidate, polymerase associated factor 1 (PAF1), was originally characterized as an RNAP II interactor necessary for positive regulation of certain genes (Shi et al. 1997). By downregulating PAF1 complex subunits expression, later research uncovered a role in suppressing not only proximal

3’UTR-APA but also CR-APA in mammalian cells (Yang et al. 2016).

Not only transcription factors, but the transcription process itself can influence the selection of poly(A) signals. For instance, high transcriptional activity measured by RNA-seq data (RNA abundance) indicated that increased output generated shorter 3’UTR isoforms, whereas longer isoforms were more likely to occur in instances of low transcription activity (Ji et al. 2011). However, it was not clear whether the link between transcription activity and APA was due to increased transcription initiation or elongation rate. While a Drosophila mutant model with lowered elongation favors proximal poly(A) signal choice (Pinto et al. 2011), RNAP II Serine 2 phosphorylation in mammals, a marker for elongation, does not correlate with APA in some conditions (Fusby et al. 2016).

Part of the reason that APA has become such a highly invested topic is its usage in response to stimuli and its role in certain cellular events, notably during development and differentiation (Ji et al. 2009; Hilgers et al. 2011). For example, synaptic activity and calcium influx into neurons cause changes in gene expression, but a remarkable effect is that genes under the influence of the transcription factor MEF2 would in many cases undergo CR-APA, producing truncated transcripts of potentially different functions (Flavell et al. 2008). Although the underlying mechanism is unclear, post-synaptic calcium influx is required.

APA can result not only because of preordained, programmed events such as development. As occasion demands, unplanned and stochastic events require a robust and coordinated response to ensure cellular and/or organismal survival. A pertinent example of this type of cellular response would be genotoxic stress, such as UV or deoxyribonucleotide depletion. Recent studies have indicated widespread APA as a result of the UV-induced DNA damage response (DDR) (Devany et al. 2016; Hollerer et al. 2016). Thus, APA is a highly orchestrated and global regulator of gene expression for a variety of conditions controlled by numerous factors from multiple pathways for myriad purposes, including DDR.

DNA Damage Response

DDR is a concerted effort undertaken to ensure the survival of either the cell or the organism following stress. Cellular stress can come as either genotoxic; affecting the genome; mutagenic, or non-genotoxic; affecting factors and/or processes not directly in contact with

DNA. The appropriate response is dependent on both the intensity and duration of each specific insult the cell endures. As such, several resource-dependent mechanisms are in place for robust DNA repair and recovery of homeostasis (cell cycle arrest) in instances where damage is tolerable, or efficient cellular suicide (apoptosis) when the lesional load is too great to risk carcinogenesis or other sickness to the organism. To highlight the range of mechanisms required to deal with specific damage, several examples of stressors and responses are indicated in Figure 3.

Figure 3: Schematic of the basic principles behind DDR. Labels at the top

indicate various genotoxic insults. Labels at the bottom represent responsive

pathways, which are not mutually exclusive to any one particular stress or to

each other.

Despite the heterogeneity of DDR, a major effector for the vast majority of responses is the transcriptional activator p53 (Kastan et al. 1991; Farmer et al. 1992). The p53-centric response to DNA damage is outlined in Figure 4. As a result, stress-specific outcomes have evolved such as differential DNA binding cooperativity for the p53 tetramer (Schlereth et al.

2010), and pulsed vs sustained expression of p53 protein levels (Purvis et al. 2012), each mode inducing gene expression in characteristic ways to enact either cell cycle arrest or apoptosis.

Figure 4: Diagram of initial sensors and effectors after DNA damage.

ATR and ATM kinases induct downstream phosphorylation cascades,

including of CHK1, CHK2, and p53, allowing for DDR. Adapted from

Moorhead, 2007.

In order to induce these effects, multiple pathways are regulated at the levels of translation, transcription, and everything in between. For example, at the post-transcriptional level, the cleavage factor subunit CstF-50 and tumor suppressors BRCA1/BARD1 interact after

UV-mediated DNA damage and this interaction inhibits nascent RNA transcript cleavage

(Kleiman and Manley 1999, 2001), reducing overall mRNA levels. Later research identified that also under the CstF-50/BRCA1/BARD1 functional interaction is the polyubiquitination and degradation of RNAP II (Kleiman et al. 2005), and that CstF-50 was necessary for maintaining cell viability after UV and for efficient transcription-coupled DNA repair (Mirkin et al. 2008).

Interestingly, it was found that p53 enhanced mRNA 3’ end processing inhibition in a transactivation-independent role (Nazeer et al. 2011). Thus, mRNA processing and DDR are intimately linked.

An intriguing example of stress-specific DDR pathways is that of the tumor suppressor p21, encoded by CDKN1A gene (Xiong et al. 1991; Harper et al. 1993). An intrinsically disordered protein, p21 has two functional domains at its N- and C-terminal ends (Chen et al.

1995). The N-terminal is a global inhibitor of cyclin-dependent kinases (CDK binding domain), preventing cell cycle progression; the C-terminal is an inhibitor of DNA polymerase processivity factor PCNA (PCNA-binding domain), preventing DNA synthesis. The established consensus is that upon stress, upregulation of p53 leads to transcriptional activation of CDKN1A gene via designated p53 binding sites (Laptenko et al. 2011), increasing p21 mRNA and, consequently, protein levels for enacting cell cycle arrest. Transcriptional activation of p21 independently of p53 has also been reported (Huang et al. 2000; Takano et al. 2001). While CDKN1A/p21 regulation by p53 is well documented, the regulatory mechanism involved depending on the type of stress is less understood.

Stress-specific regulation of CDKN1A gene and p21 expression

Gottifredi and colleagues first noted a stress-specific difference in p21 regulation

(Gottifredi et al. 2001). They described that while CDKN1A mRNA and protein are induced strongly after γ-radiation treatment by activated phosphorylated p53, both p21 mRNA and protein fail to accumulate after hydroxyurea (HU) treatment despite high levels of activated p53.

HU inhibits the conversion of rNTPs to dNTPs disrupting DNA synthesis and causing G1/S blockage as part of S-phase stress (Yarbro 1992). Further studies in stress-induction of p21 discrepancy showed that p53 is acetylated at residue 382 in γ-radiation but not hypoxia

(Koumenis et al. 2001) and that this p53 posttranslational modification is necessary for strong

CDKN1A mRNA induction. Besides differences in the CDKN1A promoter activity were found, specifically in the recruitment of general transcription factor (GTF) (Espinosa et al. 2003). For example, TFIIB recruitment increases only after the topoisomerase inhibitor doxorubicin treatment, whereas TAF1 (part of the TFIID complex) increases only after UV damage.

However, in this study the treatments were for different durations, so the observed alternative

GTF recruitment could have been due to the timing after damage rather than the type of stress itself. ChIP data showed that after UV treatment p53 recruitment increases at CDKN1A promoter at a greater fold change rate than the induction of CDKN1A mRNA (Magrini et al.

2007). After UV treatment, TAF1 is recruited alongside p53 prior to other GTFs (Li et al. 2007).

Differences in H4 acetylation, specifically at the TATA box of CDKN1A gene, were also noted between γ-radiation (acetylated H4) and UV treatment (not acetylated H4) (Hill et al. 2008).

Interestingly, increased levels of p53 after treatment with Nutlin-3, which inhibits the interaction of p53 and its suppressor MDM2 (Shangary and Wang 2009), strongly induces CDKN1A mRNA levels and the recruitment of specific components of the GTF Mediator complex in the absence of DNA damage (Donner et al. 2007). Together, these studies suggest that strong induction of

CDKN1A mRNA might be a default mechanism during DDR but the recruitment and/or loss of recruitment of factor(s) under UV or HU treatment might delay CDKN1A mRNA induction.

Delving deeper into what the signal(s) might be pertaining to weaker CDKN1A mRNA upregulation despite comparable levels of p53 and RNAP II at the promoter after DNA damage, several studies have converged on inhibition of transcription elongation (Mattia et al. 2007; Valin and Gill 2013; Kumari et al. 2013). Different from the phenomenon of abortive initiation; a transcriptional elongation regulation process produces shorter truncated transcripts (8-10 nt) prior to productive elongation of full-length transcripts (Munson and Reznikoff 1981; Adelman and Lis 2012). As part of this process, DDR kinases Chk1 (Beckerman et al. 2009) and p38

(Kumari et al. 2013) were found to inhibit and activate, respectively, transcription elongation of

CDKN1A gene under damaging conditions. Ctk1 is another example of a kinase involved in mRNA elongation induction and this is achieved by serine-2 phosphorylation of RNAP II CTD, a marker for active elongation and promoter of 3’ end processing (Ahn et al. 2004). ChIP experiments also showed increased levels of the cleavage factor subunit CstF-64 at the 3’ end of CDKN1A gene upon Chk1 inhibition, supporting the idea that Chk1 depletion allows strong

CDKN1A mRNA induction (Beckerman et al. 2009). Surprisingly, the inhibition of CDKN1A- specific splicing regulator, which bound strongly to intron 1, increases the levels of “intronic sequences downstream of the promoter (Chen et al. 2011). Hence, a number of factors are at play at CDKN1A gene regulating mRNA elongation co-transcriptionally and resulting in shorter truncated transcripts.

Long Non-Coding RNA

Although the central dogma dictates that DNA makes RNA to act as the intermediate messenger for protein production (Crick 1970), it was soon clear that it is not quite so simple. To begin with, the discovery of rRNAs in a ribonucleoprotein complex as well as tRNAs necessary for translation (Hoagland et al. 1958) meant that RNA could be used for structural and/or catalytic roles. This is consistent with the idea of the “RNA world” (Gilbert 1986), which proposes that the most primitive cells operated with RNA as the primary method of inheritance and function.

A non-coding RNA can be broadly categorized as any product of transcription regulated by cell type or developmental stage, therefore not a result of euchromatic pervasive transcription, that is not expected to code for a protein by computational or experimental analysis but has function. For the purposes of this thesis, non-coding RNAs can again be split into small non-coding RNAs (sncRNAs; <200 nt after processing) and long non-coding RNAs

(lncRNAs; >200 nt). Some examples of small non-coding RNAs include snRNAs involved in splicing, snoRNAs that target rRNA modifications, miRNAs that target mRNAs for stability and translation regulation, and piRNAs that act similarly to miRNAs but are involved in post- transcriptional gene silencing of transposons (reviewed in Eddy 2001; Siomi et al. 2011). Many of these RNAs work in conjunction with proteins and undergo post-transcriptional processing for maturation.

The lncRNA class is a much newer and arguably more heterogeneous group of non- coding RNAs. The discovery of sncRNAs, which function almost invariably by base pairing to other RNA targets, has been simpler by searching for sequence homology and transcriptional correlations. On the other hand, while some lncRNAs also undergo base pairing in trans, for a number of discovered lncRNAs their function resides in their secondary structure or binding to proteins containing RNA recognition motifs (RRMs) (Ponting et al. 2009). LncRNAs can be generated intergenically and intragenically (from within a protein-coding gene); both sense and antisense, encased entirely within an intron, emanating from the same promoter or be bidirectional from the promoter (Katayama et al. 2005).

Figure 5: Schematic of how lncRNAs could interact with other components and

affect cellular processes. Proteins are in grey blobs, lncRNAs in purple, mRNAs

in pink. Adapted from Scheuermann and Boyer 2013.

One of the earliest lncRNA to be defined and the poster child of a functional lncRNA was the X-inactive specific transcript (XIST) (Brown et al. 1991). This 17 kb transcript possesses no open reading frame, is transcribed for the X-chromosome that will be silenced during X- chromosome inactivation, and serves to coat its host chromosome facilitating inactivation

(Brockdorff et al. 1992; Ng et al. 2007). In the subsequent years, a number of other lncRNAs were found with varying functions, several of them working to regulate transcription in cis

(Shamovsky and Nudler 2006). Since the turn of the decade, the number of annotated lncRNA transcripts approached an estimated 20,000 mRNA-producing genes (Volders et al. 2013), and

the number continues to increase with lncRNAs involved in a wide range of cellular pathways, such as DNA damage.

LncRNAs in the DNA damage response

A seminal manuscript investigating lncRNAs in DDR identified a plethora of transcripts originated around cell cycle regulated promoters in human cells (Hung et al. 2011). Other study also identified functional multi-exonic lncRNAs regulated by various transcription factors in mouse cell culture (Guttman et al. 2009). Understandably, lncRNAs transcribed in the vicinity of genes undergoing regulation under stress are also regulated themselves under damaging conditions. In addition, not all lncRNAs produced are gene-specific. LncRNAs can be synthesized as the result of and at the sites of DNA damage, mediating the recruitment of other

RNAs and damage sensor protein factors for progression of DDR (Michelini et al. 2017).

Of the numerous lncRNAs described, a surprisingly high amount exist in and around

CDKN1A (Figure 6). The first discovered was lincRNA-p21 and, as such, it has been subject to a plethora of research studies (Yoon et al. 2012; Dimitrova et al. 2014; Hall et al. 2015) as well as a recent review of its role in cancer (Chen et al. 2017). As the name indicates, it is a long intergenic non-coding RNA on the same chromosome arm as CDKN1A. Curiously, studies using siRNA against lincRNA-p21 identified a role in suppressing CDKN1A mRNA translation through base pairing (Yoon et al. 2012), whereas a genetic knockout of lincRNA-p21 showed a in cis role in activating transcription of CDKN1A (Dimitrova et al. 2014). Interestingly, absolute quantification experiments indicated that lincRNA-p21 level is ~2 copies per cell at basal conditions, and ~8 copies per cell after DNA damage, highlighting the impact low abundance transcripts can have.

Figure 6: Non-coding RNAs generated around CDKN1A. Each elliptical, other

than eRNA, represents a protein regulating or being regulated by a lncRNA.

eRNA represents an enhancer RNA generated from within intron 1 proximal to

exon 2. Green lines generate transcription start sites (TSS) for each lncRNAs

except for CDKN1A TSS, which produces full-length CDKN1A. Image adapted

from Subramanian et al. 2013.

In their manuscript, Hung and colleagues (2011) described a lncRNAs originated around

CDKN1A promoter using large scale sequencing: an antisense transcript that they named p21 associated lncRNA DNA damage activated (PANDA). As with other lncRNAs in the region,

PANDA levels are regulated in a p53-dependent manner and, thus, are damage induced. Its role was initially thought to be in suppressing apoptosis through interaction with transcription factors. PANDA function has since been expanded to interact with another factor, SAFA, affecting the recruitment of chromatin modification enzymes to repress senescence-activating genes in proliferating cells. Thus, CDKN1A-associated lncRNAs can have cell-stage and cell- fate specific functions (Flynn and Chang 2014; Lee et al. 2017).

A common theme of all these lncRNAs is their dependence on p53. Importantly, some lncRNAs can also regulate p53 expression. For example, damage induced noncoding (DINO)

lncRNA, a non-coding RNA, has been shown to be partly responsible for the p53 response

(Schmitt et al. 2016). DINO binds to p53 protein and it stabilizes it, and knockdown of DINO levels blunted the p53 response after DNA damage. DINO expression can activate damage signaling and cell cycle arrest in the absence of DNA damage. Thus, damage induced lncRNAs can not only be functional in DDR, but work in feedback loops to help orchestrate the entire response.

Most of the lncRNAs induced during DDR have the general trend to induce rather suppress expression and do not show functional overlapping during the response showing individual functions. Additionally, an enhancer region has been identified around the CDKN1A, which produces an enhancer RNA (Léveillé et al. 2015). Enhancer regions are DNA elements that serve to activate or “enhance” transcription of genes, many times located at sites particularly distal to gene to be activated (Cleutjens et al. 1997). Several mechanisms have been proposed for such occurrence but usually it is thought that DNA looping is involved bringing the enhancer region and gene promoter into proximity (Wang et al. 2005; Lupiáñez et al. 2015). More recently, RNAP II-driven transcription of these enhancer regions has been observed and the short non-polyadenylated RNAs generated have been shown to have functions in enhancing gene expression (Kim et al. 2015).

As CDKN1A possesses a long first intron, the probability to find regulatory sequences might be high. A genome-wide investigation into p53-regulated enhancers identified a binding site for p53 within CDKN1A first intron, closer to exon 2 than exon 1, shown as enhancer RNA

(eRNA) in Figure 6 (Léveillé et al. 2015). This eRNA is fundamental in p53-dependent regulation of CDKN1A gene expression and, interestingly, a lncRNA generate elsewhere in the genome is involved in the regulation of the eRNA. Thus, a number of non-coding RNAs are intricately tied with expression of a highly documented gene, CDKN1A.

In this thesis, I propose to characterize a lncRNA produced from CDKN1A after DNA damage due to APA. My studies indicate that it is similar in some aspects to the other CDKN1A-

associated lncRNAs, such as its expression being dependent on p53. However, this lncRNA differs from the others in that it is sense-strand and intragenic to CDKN1A, utilizing the same transcription start site than the full-length CDKN1A transcript. I have identified some of the cell types and conditions in which this CDKN1A APA transcript is expressed. I have performed experiments to identify that this transcript is non-coding as well as spliced. My studies show the localization of this CDKN1A APA isoform. I also present evidence that APA isoform is regulated by RNA-binding protein HuR through direct RNA-protein interaction. Further, I show that depletion of APA under non-stress conditions is capable of downregulating p21 protein without a corresponding effect on mRNA abundance, leading to increased cell proliferation.

CHAPTER II

INTERPLAY BETWEEN PARN-MEDIATED DEADENYLATION AND miRNA REGULATION

IN THE DNA DAMAGE RESPONSE

Background

Polyadenylation is a post-transcriptional modification of mRNA responsible in part for regulating the life-cycle of the modified RNA (reviewed in Colgan and Manley 1997). The length of a poly(A) tail is a highly regulated organism specific event. The processive addition of adenosines can be stimulated by various CpA factors, such as CPSF (Wahle 1995). Poly(A) tail length (~200-250 adenosines in humans) is controlled by PABPN1 that is required to allow the stimulatory dynamic interaction of PAP to CPSF bound-AAUAAA sequence, once the poly(A) tail reach ~200 bp is then restricted allowing for tail elongation termination to take place (Kühn et al. 2009). The poly(A) tail protects the mRNA molecule from enzymatic degradation in the cytoplasm (Fuke and Ohno 2008) and aids in export of the mRNA from the nucleus, and translation . Due to the relevance of this post-transcriptional action in controlling gene expression, poly(A) tail length can also be controlled through the reverse, that is, deliberate removal of adenosines from a set length of poly(A) at the 3’ end of the mRNA, known as deadenylation. This mechanism is relevant because its functional consequences in controlling mRNA stability and, more recently described, translation efficiency, both of which can be altered due to changes in poly(A) tail length in both cytoplasm and nucleus (Weill et al. 2012).

Deadenylation can be used as a method of fine-tuning rather than as a demolition agent leading to mRNA decay by 3’-5’ exonucleases. In fact, deadenylation can be used as a quick-fire way of adapting to changing cellular conditions in a time-frame not accomplishable by transcriptional regulation (Shyu et al. 1991). In eukaryotes, there are two distinct families of deadenylases categorized by their difference in the amino acid residues used to coordinate their respective

Mg2+ (reviewed by Goldstrohm and Wickens 2008).

For the purposes of this thesis, I will focus on poly(A) specific ribonuclease (PARN) deadenylase. PARN is a trimeric complex that exists as both a 74 kDa and a 54 kDa protein, and its enzymatic activity is stimulated by binding to the mRNA 5’ cap (Martıneź et al. 2000).

PARN was identified separately in both cytoplasm (54 kDa, Körner and Wahle 1997) and nucleus (74 kDa, Aström et al. 1991) in mammalian cells. Work from our lab also demonstrated that PARN is involved in DDR, as the CstF-50/BRCA1/BARD1 complex activated PARN activity by preventing PARN interacting with its inhibitory component cap binding protein 80 (CBP80;

Cevher et al. 2010). In addition, PARN is involved in a feedback loop with p53, whereby TP53 mRNA levels are kept low by a basal activity of PARN under non-stress conditions and p53 protein activates PARN to downregulate mRNAs as part of a general response under stress conditions (Devany et al. 2013; Newman et al. 2017). Interestingly, DDR genes, including TP53 transcript, are not affected by this PARN-mediated regulation during DDR. The factors involved in PARN-mediated recruitment to TP53 mRNA were unknown.

mRNA deadenylation is controlled by cis-acting regulatory elements, which include RBP binding sites and miRNA targeting sites, within the 3' UTRs of mRNAs. For example, in

Drosophila, RBP Nanos recruits NOT4 deadenylase to regulate mRNA translation (Kadyrova et al. 2007). Additionally, microRNA-mediated recruitment of deadenylase to transcripts has been observed in mammalian systems (Wakiyama et al. 2007), and has been seen to be a general cytoplasmic pathway (Wu et al. 2006). The nuclear component of this mechanism has not been extensively studied. While several RBPs are involved in the recruitment of PARN deadenylase to its target mRNAs, the role of miRNA in PARN recruitment to the mRNA has not been elucidated.

Results

It was previously demonstrated that PARN binds to TP53 mRNA in a region that includes AU-rich elements (AREs) present in the 3’UTR, downregulating mRNA expression under non-stress conditions (Devany et al. 2013). Directly adjacent to the ARE are overlapping miRNA sites for miR-125b (Le et al. 2009) and miR-504 (Hu et al. 2010) (Figure 7A), which are

both known to negatively regulate TP53 mRNAs. While earlier research showed that deadenylation is interlinked with the miRNA pathway (Wu et al. 2006) and that the cytoplasmic deadenylase CAF1-CCR4-NOT complex is involved in the pathway (Eulalio et al. 2009), the role of PARN deadenylase in miRNA-dependent mRNA degradation has not been elucidated.

Therefore, we were interested to test whether there was interplay between the nuclear deadenylase PARN and miRNA pathway in mammalian cells (Zhang et al. 2015).

My contribution to this published manuscript (Zhang et al. 2015) was to elucidate whether the presence of the miRNA targeting sites and/or the ARE sites were necessary for the binding of PARN or the catalytic component of the miRNA machinery, Argonaute 2 (Ago2), to the TP53 mRNA. To accomplish this I performed RNA pull-down assays using in vitro transcribed biotinylated RNA encompassing different derivatives of TP53 3′ UTR, nuclear extracts (NEs) from HCT116 cells. After NEs were incubated with biotinylated RNAs, I immunoassayed the pull-down against Ago-2 and PARN to check for binding relative to the input sample (Figure 7C). I constructed expression vectors for in vitro transcription of p53 3’UTR with derivatives including the complete sequence (WT TP53), deleted ARE (noARE), deleted

125b/504 miR sites (nomiR), or both (noBOTH) (Figure 7B). My results indicate that a biotinylated RNA encompassing WT TP53 3’UTR pulled-down PARN and Ago-2 from NEs

(Figure 7C). I observed that a negative control for pull-down, topoisomerase II, was detected only in the input. When RNA pull-down assays were performed with RNAs encompassing mutant variants of TP53 3′UTRs, my results indicated the RNA–PARN interaction depended on the presence of both the ARE sequence and the adjacent miR-504/miR-125b targeting site

(Figure 7C). As expected, Ago-2/RNA interaction was not affected by the replacement of the

ARE. As the RNAs did not include other miRNA targeting sites present in the TP53 3’UTR, such as miR-25 and miR-30d targeting sequences, the binding of Ago-2 to those miRNA targeting sites was not detected in these assays. While the loss of the miR-504/miR-125b targeting site decreased Ago-2/RNA binding, the loss of the ARE in the noBOTH derivative further reduces

Ago-2 binding. As described by others (Jing et al. 2005), this supports the idea that the association of an ARE-BP may affect Ago-2 biding to TP53 3′UTR. Some PARN was pulled- down by the noBOTH construct, probably due to the presence of the most distal ARE of TP53

3′UTR in the biotinylated RNAs.

Discussion

This manuscript was the first to show nuclear deadenylase PARN’s role in miRNA- dependent mRNA regulation in mammalian cells. The study uncovers a specialized feedback loop, whereby under non-stress conditions PARN binds to p53 mRNA in conjunction with the miRISC complex to downregulate p53 expression to allow for cellular proliferation (Zhang et al.

2015). My data included in the manuscript indicate that both the ARE and the miRNA targeting sites contribute to Ago-2 binding, as observed by the additive effect of removing both sites compared to only one. However, the largest reduction in PARN binding is by the removal of the miRNA targeting site, since the removal of both sites has a similar effect to the removal of only miRNA targeting site. These results suggest that the miRNA targeting site and, hence, the recruitment of miRNA-induced silencing complex (miRISC) might be the primary factor underlying PARN recruitment to TP53 mRNA. Unlike Ago-2, which is mostly dependent on miRNA binding for recruitment to its target RNA (Atwood et al. 2016), PARN is capable of binding to both the 5’ cap structure as well as the poly(A) through its RNA recognition motif

(RRM).

Under UV conditions, p53 protein is upregulated via phosphorylation, preventing its interaction with its cognate ubiquitin ligase MDM2 (Inoue et al. 2001). The upregulated p53 protein then binds to and activates PARN, facilitating deadenylation of a larger number of targets, including housekeeping genes (Devany et al. 2013). Other studies have shown that under UV conditions 3’UTR of TP53 mRNA is protected by an intramolecular secondary

structure known as a quadruplex (Decorsière et al. 2011; Newman et al. 2017), potentially preventing accessibility by the deadenylation and miRNA machinery. Consistent with the G- quadruplex studies, the research

Figure 7: Binding of the miRNA and deadenylation machinery to TP53 mRNA depends on ARE sequences and miRNA targeting sites. (A) Sequence of TP53 mRNA

3′UTR. miRNA targeting sites and AREs are shown. miR-125b/miR-504 binding sites

(red) are adjacent to an ARE (blue). (B) Diagram of constructs with different 3′UTR sequences from the TP53 gene. The sites of replacement are indicated: miR-

125b/miR-504 binding site (red), ARE (blue). (C) Both ARE and adjacent miR-125b targeting signal at TP53 3′UTR are necessary for PARN binding. RNA pull-down assays were performed using biotinylated RNA carrying WT or signal replaced TP53

3′UTR (noARE, nomiR and noBOTH) and NEs from HCT116 cells. A representative pull-down reaction from three independent assays is shown. Ten percent of the NE used in the pull-down reactions is shown as input. The means ± standard deviation of

PARN and Ago-2 signals are indicated. Modified from Zhang et al. 2015.

from our lab showed that TP53 mRNA is also protected from degradation by downregulation of miR125b under damaging conditions (Zeng et al. 2012; Zhang et al. 2015).

This is consistent with my data (Figure 7) as the loss of miRNA binding capability results in reduced PARN binding and, thus, deadenylation and instability of the mRNA. Additionally, certain miRNAs involved in TP53 mRNA regulation were detected to bind PARN by immunoprecipitation experiments, and this binding was reduced after UV treatment (Zhang et al.

2015). Interestingly, the reduced miRISC/PARN binding may not only be due to the lowered interaction at mRNA 3’UTR but also due to PARN role in miRNA maturation (Yoda et al. 2013).

PARN has been shown to mediate trimming of the 3’ ends of miRNA precursors promoting their maturation. While trimming of pre-miRNAs is not essential for silencing of target mRNAs, it is possible that this maturation mechanism might affect the levels of mature miRNA.

Recent computational work has highlighted ARE sequences “hotspots” exhibiting enhanced binding of numerous RBPs and other cellular components that interact with mRNA, such as miRNAs (Plass et al. 2017). Likewise, RBPs were found to be enriched at miRNA binding sites. Such overlapping between AREs and miRNA binding sites appears to be a general phenomenon and supports our observations with the TP53 mRNA. In many cases,

RBPS and miRISC functions are opposite. Data presented in this manuscript indicate that HuR, a RBP that stabilizes TP53 mRNA and binds TP53 ARE (Mazan-Mamczarz et al. 2003), can revert the recruitment of PARN to TP53 mRNA by miR-125b-loaded miRISC (Zhang et al.

2015). Genome wide studies also showed that HuR binding sites also overlap considerably with miRNA targeting sites (Mukherjee et al. 2011).

What might the relevance of this PARN-p53 axiom be as a feedback loop? One can imagine that while miRNA levels are reduced and mRNA secondary structures are acting as steric hindrances to PARN recruitment, the p53-dependent activation of PARN could eventually reach a threshold whereby even the most minimal binding to RNA (Figure 7C, noBoth) could permit deadenylation and instability of TP53 mRNA, thus lowering p53 levels and reducing

activation of PARN under non-stress conditions. Interestingly, PARN mutations have been detected in patients with developmental delay and mental retardation (Dhanraj et al. 2015), and dysregulated apoptosis, possibly through elevated p53 levels, is a hallmark of developmental delay phenotype (Chester et al. 1998). In the future, it will be interesting to determine whether the phenotypes seen in patients with PARN mutations have relevance to its regulation of p53 under non-stress conditions.

CHAPTER III

BIOCHEMICAL VALIDATION OF BIOINFORMATIC ANALYSES INVESTIGATING

ALTERNATIVE POLYADENYLATION DURING THE DNA DAMAGE RESPONSE IN

MAMMALIAN CELLS

Background

Alternative polyadenylation (APA) has been shown to be a widespread phenomenon across multiple model organisms, such as fish (Ulitsky et al. 2012), plants (Wu et al. 2016), yeast (Ozsolak et al. 2010), fly (Smibert et al. 2012), and mammals (Xiao et al. 2016). Given the enormity of nucleotide abundance in any given genome, with approximately 3 billion bases in a human cell, up until the turn of the century the extent and impact of APA was unknown and intangible. However, following the advent of the human genome project (HGP; Venter et al.

2001), contextual knowledge of non-repetitive sequences in our genome in conjunction with an expanding annotation of what defines a gene by the Encyclopedia of DNA Elements (ENCODE) project (ENCODE Project Consortium et al. 2007) has allowed for systematic elucidation of canonical and non-canonical APA sites.

Since the human genome project was published, the cost of sequencing has mercifully decreased. The HGP was completed using Sanger sequencing (Sanger, Nicklen, and Coulson

1977), a now antiquated but faithful method. Following great efforts to find strategies to decrease the cost of sequencing DNA (Schloss 2008), a number of companies developed high- throughput sequencing (HTS) techniques such as the Roche 454 pyrosequencer and

Solexa/Illumina sequence analyzer (Reuter et al. 2015). Both of these types, while offering different throughput capabilities and individual read lengths, operated on the same basic principle. The DNA or RNA to be sequenced is fragmented to ~1kb segments, ligated to an adaptor annealed to beads on a slide. The sample is then incubated with a single type of deoxynucleotide (dNTP). If the first nucleotide in the sequence corresponds to the type of dNTP added, a light reaction will occur due to polymerase-mediated incorporation. The dNTP type is then washed away and replaced with the “next” dNTP. If no light reaction occurs then the next letter in the sequence does not correspond to the dNTP added, and nucleotides are washed and added until the light reaction does occur. This process is repeated simultaneously across

thousands of wells up until each fragment is fully sequenced. This, combined with exponentially increasing computing power, allows for many samples and conditions to be analyzed in parallel and the high readthrough confirms the results obtained.

The detection of APA in myriad model organisms (Ulitsky et al. 2012, Wu et al. 2016,

Ozsolak et al. 2010, Smibert et al. 2012, Xiao et al. 2016) has inspired experimental methods designed specifically to detect the site of CpA during transcription (Chen et al. 2017). A number of methods have been developed to enrich for information of the 3’ end of the transcriptome, which can be broken down into two main categories, each with their own advantages and disadvantages. For example, samples can be primed from oligo(dT), such as in PAS-seq

(Mangone et al. 2010), which is easy to implement but suffers from priming from internal oligoadenine stretches, leading to false positive results for CpA. Alternatively, samples can undergo RNA manipulation, such as with 3’ Region Extraction and Deep Sequencing

(3’READS; Hoque et al. 2012) (Figure 8). In 3’READS, RNA is fragmented followed by base- pairing to a 45 nucleotide thymine stretch, which enriches for long canonical poly(A) tails, as opposed to oligo(A) tails added by polymerases other than PAP (reviewed in (Schmidt and

Norbury 2010). The enriched RNA is then freed by RNase H digestion and undergoes deep sequencing, alleviating the requirement for oligo(dT) priming and thus circumventing the issue of internal priming. The disadvantages are that this process is laborious and time consuming due to the extensive RNA manipulation required (Chen et al. 2017). As of 2016, a refined version, known as 3’READS+, was developed that requires lower starting quantity of RNA and allows the analysis of RNA fragments with an optimal number of terminal adenines, increasing data quality and detection of genuine polyadenylation sites (Zheng et al. 2016).

Our studies were aimed to explore the mechanisms and consequences of APA on UV- induced DNA damage (Devany et al. 2016). Overall, we found that APA was induced after UV treatment, and that this is dependent on decrease in U1 snRNAs levels, as artificially manipulating U1 levels altered APA occurrence. We found that 3’UTR APA did not correlate

with lengthening or shortening globally, as examples of both were found with no bias one way or the other. As 3’READS+ was developed after the publication of the manuscript, we utilized

3’READS in collaboration with Dr. Tian (Rutgers University). As discussed later in this Chapter, it is possible the data we uncovered may be lacking the detection of genuine CpA events that occur immediately downstream of A-rich sequences. Interestingly, we also found that intron-

APA underwent 2-fold increase, with promoter-proximal APA in genes with a long first intron highly represented. Our study described a significant gene regulatory scheme in DDR where U1 snRNA controls gene expression via the U1-APA axis.

Figure 8: Schematic protocol for 3’READS. Following extraction, RNA is

fragmented prior to binding to custom T-rich oligo ligated to beads. Bound

fragments are RNase H treated to digest portion of poly(A) tail. After ligation of

known adaptor sequences, remaining RNA undergoes amplification and

sequencing, before aligning to genome. Adapted from (Hoque et al. 2014).

Results

APA has been previously described to occur in damaging conditions from yeast to mammals (Graber et al. 2013; Dutertre et al. 2014). The most comprehensive characterization of APA has been in 3’UTR (Tian and Manley 2017). Splicing component U1 snRNA is a dose- dependent global regulator of APA in both mouse and human (Kaida et al. 2010; Berg et al.

2012). Previous studies showed that levels of U1 snRNA decrease dramatically after UV damage (Eliceiri and Smith 1983; Morra et al. 1986). Levels of canonical mRNA also undergo downregulation after UV treatment (Cevher and Kleiman 2010). Thus, we were interested whether UV treatment has an effect on APA as an induced mechanism of gene expression control. We performed 3’READS on samples from UV treated colorectal carcinoma epithelium

RKO cells (Brattain et al. 1981; Marks et al. 1983).

My contribution to this project was to both confirm the genome-wide analysis of APA occurrence under DDR conditions in a number of genes, and to further confirm the role of U1 snRNA in this response. Gene Ontology (GO) analysis of genes undergoing APA indicated that different biological processes were affected by 3ʹUTR-APA and intronic APA. To validate the genome-wide analysis, I examined 3ʹUTR- and intron-APAs for genes indicated in Table

1. I selected genes that encompassed a number of different biological pathways and mechanistic functions, as well as having bias for genes with a high reads per million (RPM) during sequencing to aid their detection.

To validate the genes selected from our genome-wide analysis, I examined 3ʹUTR- and intron-APAs following the strategies shown in Figure 9A. Briefly, nuclear RNA was isolated from colon carcinoma HCT116 cells after recovery from UV treatment, then complementary DNA

(cDNA) was synthesized using reverse transcription with oligo(dT) primers followed by quantitative reverse transcription–PCR (qRT–PCR) was performed. Specific primers were used to detect intron-APA products (short isoform) and full-length mRNAs (long isoform). A similar

strategy was used to detect 3ʹUTR-APA products. To allow the comparison of the amplified products, the primers were designed to keep the amplicons of similar lengths for both intronic and full-length sequences. The results are indicated in Figure 9B-C. The data analysis indicate that differential poly(A) site usage can be detected on an individual gene basis, and that both isoforms were sufficiently abundant to be measured via qPCR. The data also indicate that these events are indeed occurring and are not the result of false positives due to (dT) priming to internal adenosines. Major changes in the distal/proximal ratio for teach individual gene were not detected in the analysis of UV-induced 3ʹUTR-APA in the 0–0.5 h window (Figure 9B).

However, changes in the usage of poly(A) signal for individual genes were detected after UV treatment in the 0–2 h window, favoring either distal or proximal poly(A) signal. It is possible that the 3’READS analysis might represent the overall behavior of the total genes analyzed, indicating that there was no global direction of 3ʹUTR length changes under these conditions.

Using the same strategy, I observed that intronic-APA was being activated, usually at the 2 h recovery time point following UV damage. Interestingly, the intronic-APA/full-length canonical mRNA ratio showed that in some instances the levels of intronic transcript constituted

>30% of the transcriptional outcome, as was the case with POLR2A and EFNB2. Importantly,

CDKN1A and POLR2A were at the hub of the networks significantly associated with intronic poly(A) signal activation based on IPA analysis. Consistent with the 3ʹREADS analysis results,

UV treatment induced the formation of intron-APA transcripts that were polyadenylated (Figure

9C). Of the genes tested, I also saw that intron-APA isoforms levels were back down to basal levels by 10 h after UV treatment, a recovery time seen to restore normal CpA (Kleiman and

Manley 2001). Thus, my studies indicate that induction of intronic APA is a consequence of

DDR of transient nature and its activation/suppression cycle coincides with DDR-mediated regulation of CpA, suggesting a possible role for these intronic APA events in controlling gene expression during DDR.

Gene Function APA Direction

DUSP6 (Bagnyukova et al. 2013; Ma et al. Phosphatase Lengthening 2013)

NOTCH1 (Garcia et al. 2013; Vermezovic et al. Membrane Receptor Lengthening 2015)

SNRNPB2 (Folco et al. 2011; Sundaramoorthy Splicing Factor Shortening et al. 2014)

KDELR1 (Smith et al. 2000; Hou et al. 2015) Golgi Receptor Lengthening

POLR2A (Yao et al. 2007; Heine et al. 2008) Transcription Component Intronic

CDKN1A (Garner et al. 2008; Prives and Cell Cycle Inhibitor Intronic Gottifredi 2008)

EFNB2 (Genander et al. 2010; Wang et al. Receptor Tyrosine Intronic 2010) Kinase

E2F1 (Tort et al. 2006; Qi et a. 2015) Transcription Factor Intronic

DSCR3 (Li et al. 2015; Preker et al. 2015) Phosphatase Inhibitor Intronic

Table 1: List of genes validated for APA after UV damage by qPCR analysis.

Listed at the left is the annotated gene name, following by its generally accepted

function. In the last column is indicated whether the effect of UV is on

lengthening/shortening the transcripts 3’UTR or APA usage within an intron.

Figure 9: UV promotes alterations in both 3’UTR- and intron-APA. A) Schematic of primer design. For intron-APA, forward primer was in exon 1 and reverse primers were downstream of exon 1 either within intron 1 for short isoform or in exon 2 for canonical mRNA. For 3’UTR APA, forward primer was ~50 nt upstream of proximal poly(A) signal site and reverse primers were also upstream of proximal poly(A) signal for total 3ʹUTR-

APA detection or immediately downstream of proximal site for distal site usage. B) qRT-

PCR analysis of HCT116 samples for the effect of UV on 3’UTR poly(A) signal choice.

The ratio of distal/proximal of each analyzed gene is shown. Samples were analyzed as in (A) and monitored after the recovery for either 0.5 or 2 h after UV treatment. The qRT-

PCR values were calculated from three independent biological samples by triplicate. C)

Intron-APA is regulated on time dependent manner after UV treatment. Samples were analyzed as in (B) but the ratio intron/full-length of each mRNA is shown.

Next, I was interested to determine whether suppressing intronic APA events has any cellular effect. Intronic APA of a CpA factor has previously been shown to affect gene expression (Pan et al. 2006). Data from Dr. Devany (Kleiman’ lab) showed that functional depletion of U1 snRNA, but not U2 snRNA, increases intronic poly(A) signal usage, and that overexpression of U1 RNA diminishes UV-induced intronic APA. To further understand the cellular consequences of the U1 snRNA-mediated control of intronic poly(A) signal usage I overexpressed U1 snRNA in HCT116 cells to suppress UV-induced intronic APA (Devany et al.

2016) and then analyzed the apoptotic response. I analyzed the apoptotic response by examining fragmented DNA in cytoplasm using enzyme-linked immunosorbent assay (ELISA), as fragmentation of nucleosomal DNA has been described to occur during early apoptosis

(Gavrieli et al. 1992; Nagata 2000). Samples from cells transfected with empty vector were used as control for apoptotic effect of the transfection procedure. While samples from cells transfected/non-transfected with empty vector and treated with UV showed a ~2x fold increase in DNA fragmentation, interestingly, overexpression of U1 snRNA abrogated the apoptotic response (Figure 10). Thus, my data indicate that UV-induced usage of intronic poly(A) sites by the downregulation of U1 snRNA levels might play a role in apoptotic response during UV- induced DDR.

Discussion

In this Chapter, I have confirmed our bioinformatic data showing that APA occurs in individual genes after DNA damage in mammalian cells (Devany et al. 2016), affecting multiple functions in myriad pathways associated to the DDR. I have also shown data that suggests that there is bias towards activation of intronic poly(A) usage compared to repression, and that UV- mediated increase in intronic APA events by U1 snRNA depletion might have a role in the apoptotic response of cells after damage, as I observed that a decrease in the usage of

promoter- proximal poly(A) sites by overexpressing U1 snRNA abrogated apoptosis after UV treatment.

Figure 10: U1 snRNA overexpression suppresses UV-mediated apoptosis in

HCT116 cells. After 24 h of U1 snRNA overexpression, cells were exposed to UV

treatment followed by 6 h recovery. Cells were then counted and subjected to

ELISA (Roche) to measure DNA fragmentation. Data is the result of three

independent replicates. The qRT-PCR values were calculated from three

independent biological samples by triplicate.

The examples I validated of 3’UTR APA are genes found in a number of different pathways, many of which are not directly related to DDR. In these instances, it is likely that the different sizes of the 3’UTR are serving to either a) downregulate mRNA and thus protein abundance, or b) to upregulate mRNAs for genes that can regulate proteins involved in proliferation and cell cycle progression, such as phosphatases and trafficking proteins. It is also of worth noting that these examples of APA are indeed due to selection of different poly(A) signals giving a greater variety of 3’UTR composition and regulatory capacity, rather than alternative cleavage sites from the same poly(A) signal (Pauws et al. 2001), where the sequence variety would be only a few nucleotides. As the effect of U1 snRNA on APA is dosage-dependent, and given that the observed 3’UTR APA events included both lengthening 43

and shortening of transcripts, it is likely that U1 snRNA is not the primary only global regulator of distal/3’UTR APA. Also noting that 3’UTRs are globally shortened in a cancerous cellular environment (Mayr and Bartel 2009), it can be postulated that some tumor suppressor genes may play a role in regulating the usage of distal poly(A) signal keeping the 3’UTRs of proto- oncogenes long so that they may be regulated more extensively, for example, by microRNAs.

Early research on APA determined that many sites of CpA were in fact non-canonical poly(A) sites; sites less efficiently recognized and utilized by the CpA machinery and, in some instances, sites with no detectable poly(A) hexamer (Tian et al. 2005). As intronic polyadenylation is likely to be flanked by splice sites in a multi-exon gene, there are certain correlations between the strength of splice and poly(A) sites (Tian et al. 2007). For example, intronic poly(A) signals used that resulted in an extension of the previous exon (composite APA) are generally weaker and, thus, less conserved (eg. AUUAAA) than when an alternative last exon (skipped exon APA) are used. In my research, I observed a similar trend, whereby

POLR2A, an example of composite APA, has a weak poly(A) signal. On the other hand,

CDKN1A, a predicted example of skipped exon APA, had a strong poly(A) signal. This has two immediate implications. Firstly, this is highly relevant as to whether these shortened transcripts might possess any functional capacity; it is possible that intronic APA transcripts have the potential to generate a new protein product or, alternatively, those shorter transcripts might represent simply a fast way of regulating gene expression under changing cellular conditions, with no functional role. In the last scenario, intronic APA might resemble deadenylation as a mechanism of regulating gene expression. Secondly, U1 snRNA as a global regulator of APA might also balance the selection of splice and poly(A) sites. For example, as weaker poly(A) signals are much easier to suppress from CpA machinery, it is thus likely that different factors are necessary to suppress strong poly(A) signals to allow the generation of intronic APA transcripts. The rest of my thesis will attempt to characterize and determine the mechanistic aspects of these two points.

Research on the role of U1 snRNA in cell death is few and far between, but some observations have been made. For example, a mutated U1 snRNA with different binding patterns drove an increase in apoptosis (Jankowska et al. 2008). Interestingly, a study showed that apoptosis induced through activation of the Fas plasma membrane receptor, known as the extrinsic pathway, caused an endonucleolytic cleavage of the 5’ end of mature U1 snRNA partly mediated by caspases (Degen et al. 2000). The sequences in the 5’ end of U1 snRNA are responsible for base pairing with the nascent mRNA, so removal of this sequence would ultimately inhibit both splicing and promoter-proximal polyadenylation. A cleaved U1 snRNA at the 5’ end can compete with full-length U1 snRNA to form an inactive spliceosomal complex as well as lose its ability to inhibit poly(A)polymerase (Gunderson et al. 1998), affecting the balance to select either a splice or poly(A) sites. Other groups have found that aberrant levels of U1 snRNA can decrease its function in neural cells and that overexpression actually induces apoptosis (Cheng et al. 2017). However, the same group found that in cancer cells high levels of U1 snRNA do not significantly affect expression of a subset of apoptotic genes, while U1 snRNA knockdown induced cell death (Cheng et al. 2017).

Consistent with this group findings, I also did not observe a difference in apoptosis by U1 snRNA overexpression before UV treatment in cancer cell lines In relation to our model system, as I was combining overexpression with UV, it is feasible that the overexpression effect is being buffered by the endogenous reduction seen after UV damage (Eliceiri and Smith 1983; Devany et al. 2016). Like that group, I also did not observe a difference in apoptosis before UV, as I was also using cancer cell lines. When I included UV treatment to the overexpression studies, there was modulation of U1 snRNA levels by endogenous and exogenous sources. In those conditions, it is unclear whether Like that group, I also did not observe a difference in apoptosis before UV, as I was also using cancer cell lines the source of cell death inhibition was due to inhibited promoter-proximal APA or recovered splicing patterns. However, it has been shown that regulation of APA requires a smaller change in U1 snRNA levels than inhibition of splicing

(Berg et al. 2012). Consistent with this, our study did not show an increase in the inclusion of introns located downstream of intronic poly(A) site APA after UV treatment (Devany et al. 2016), suggesting that UV-induced decrease in U1 snRNA levels was not sufficient to inhibit splicing.

Thus, I suggest the effect on apoptosis is indeed due to modulated APA. The rationale is that

APA transcript(s) are modulating the apoptotic response and playing a part of DDR, rather than existing as transcriptional artefacts during DNA damage.

CHAPTER IV

INVESTIGATING RNA PROCESSING AND PROTEIN-CODING CAPACITY OF AN

INTRON-APA TRANSCRIPT FROM CDKN1A

Background

Splicing and polyadenylation are both prevalent in genes because they generate alternative RNA isoforms (Tian et al. 2005; Zavolan and van Nimwegen 2006). The dynamics and order of these mechanisms in relation to transcription have been the subject of intense speculation and research (Bentley 2014). For example, usage of multiple RNA-seq methods identified that the majority of splicing occurs while the RNA is still tethered to the RNAP II ternary complex, where RNAP II is only 100 nucleotides downstream of the 3’ splice site (ss) and, hence, is co-transcriptional (Oesterreich et al. 2016). This study used budding yeast, which prevalently possess only one intron, and thus limited alternative splicing. As budding yeast does undergo APA (Liu et al. 2017) and the distance between the splice site and the poly(A) can differ, considerable research has investigated the coordination and competition of splicing and polyadenylation, where site selection can be promoted or antagonized by the contrasting pathways, in this organism model. As discussed in Chapter III, CpA reaction can be negatively regulated by 5’ss splicing components (Gunderson et al. 1998) as well as the introduction of a canonical 5’ss close to and upstream of poly(A) signal (Niwa et al. 1992). Intriguingly, in stark contrast, the presence of a 3’ss close to a poly(A) signal can promote polyadenylation (Cooke and Alwine 1996). A 5’ss downstream of a poly(A) signal can also activate CpA in conjunction with polypyrimidine tract binding (PTB) protein (Lou et al. 1996). Splicing activators, such as

TRAP150, that interact with the core spliceosomal machinery have been implicated in a dual splicing/APA role (Lee and Tarn 2014).

The transcription process itself can play a major role in splicing decisions. It has been of interest to determine how quickly splicing can occur during transcription i.e is splicing completely post-transcriptional, that is, occurring after transcription and CpA have taken place?

Or is splicing co-transcriptional, that is, taking place during transcription and before CpA? The relevance of these questions is in by knowing the sequence of events, one can infer the

determining factor for each of these events, i.e which process is epistatic to which? Whether splicing is co- or post-transcriptional affects the pathways that the splicing reaction can be coupled with i.e transcription/polyadenylation or stability/nuclear export, respectively (Hansen et al. 2018).

One of the earliest examples depicting splicing as co-transcriptional are the electron micrograph images showing ribonucleoprotein deposition and looping during RNA synthesis in vitro (Beyer and Osheim 1988). Using budding yeast, it was estimated that the majority of splicing is post-transcriptional by the detection of U2 snRNP-associated pre-mRNA (Tardiff et al.

2006). In contrast, using nascent RNA single-nucleotide resolution assay to determine the distance between splicing and RNAPII, the distance estimated that exon ligation occurs from

RNAP II is only a ~24 nt downstream of the 3’ss (Oesterreich et al. 2016). It is important to note that certain genes can be spliced post-transcriptionally via a slow or inefficient reaction (Wallace and Beggs 2017).

Cellular stress can affect these mechanisms. In mammalian cells, heat shock inhibits post-transcriptional splicing in order to repress translation and downregulate gene expression

(Shalgi et al. 2014). It has also been shown that UV-mediated damage affects RNAP II elongation rates regulating alternative splicing (Muñoz et al. 2009). While slow elongation could permit splicing factor recruitment (Kornblihtt et al. 2013), slow elongation also permits recruitment of a U2 snRNP binding competitor and promote skipping (Dujardin et al. 2014).

Hence, the detection and decision of exon definition is complex and dynamic, even without considering APA.

Results

As described in Chapter III, work from our lab in collaboration with Dr. Tian (Rutgers

University) using a high-throughput sequencing strategy indicated a 2-fold increase in promoter-

proximal intronic poly(A) site selection (intron-APA) in cells treated with UV radiation. These studies prompt the question whether these APA-transcripts are involved in the DDR. One of the genes undergoing intron-APA include CDKN1A, encoding p53 transcriptional target CDKN1A.

To understand the extent of RNA processing the CDKN1A intron-APA transcript undergoes under DNA damage, I first examined CDKN1A gene using the UCSC Genome Browser

(Karolchik et al. 2007). As Figure 11A shows, a predicted transcript with two exons with the same transcription start site as canonical CDKN1A mRNA exists but with an alternative last exon terminating at a poly(A) signal in intron 1. Importantly, the poly(A) signal used in this predicted shorter transcript is the same determined to be used after UV treatment by our bioinformatic data (Devany et al. 2016). This predicted transcript was first annotated manually by the Human and Vertebrate Analysis and Annotation (HAVANA) group of the Vertebrate

Genome Annotation (VEGA) project from an expressed sequence tag (EST) (Ashurst et al.

2005). To date, no experimental research has been done on the existence or function of this alternative transcript.

Using the strategy described in Figure 11B, my data indicate that the CDKN1A intronic transcript undergoes splicing. A band corresponding to transcription of the entire region (~2,000 bp) between the primers was detected (Figure 11C). As the samples were treated with DNase I, the observed band was probably not due to amplification of genomic DNA. The amplification could correspond to either unspliced full-length pre-mRNA, as pre-mRNA can be detected by

RT-PCR (Lysenko et al. 2013), or intron-APA transcript. However, the usage of oligo(dT) primer for cDNA synthesis makes the detection of pre-mRNA unlikely. Interestingly, only after UV treatment, the appearance of a smaller isoform (~500 bp) corresponding to the size predicted by the genome browser of a splicing event (Figure 10A) was detected (Figure 10C). Sanger sequencing of the amplified fragment confirmed the presence of a canonical and, hence, strong

3’ splice site upstream of the poly(A) site (Burset et al. 2000). Thus, my data indicate that the intronic transcript generated from CDKN1A under stress conditions can undergo an alternative

splicing event using a strong splice site within intron 1 located upstream of the alternative poly(A) signal.

There are three conceivable possibilities for the generation of the spliced CDKN1A intronic transcript; either the splicing event is concomitant with intron-APA, or the alternative exon is spliced to the next exon downstream as part of the full-length mRNA, or a combination of both strategies can be utilized based on the conditions, such as transcriptional kinetics as described by Kornblihtt and colleagues (2013). To further analyze this I performed 3’ rapid amplification of cDNA ends (3’RACE) on RNA samples from UV-treated HCT116 cells. 3’RACE allows to determine the location of 3’ end of an RNA to be elucidated using oligo(dT) primer for cDNA synthesis with an adaptor sequence to act as reverse primer for PCR. In samples from non-treated cells, using oligo(dT)-primer-adapter and forward primer in exon 1, I was able to detect the polyadenylated/spliced CDKN1A intronic APA transcript with a 3’ end corresponding to the location predicted by 3’READS data (bad of ~350 bp, Figure 12). After UV treatment, the intensity of the band increased, supporting the 3’READS data that showed an increase in the usage of this poly(A) signal in intron 1 of CDKN1A. An additional band of higher molecular weight (~500 bp) was detected after UV treatment that might be generated from a second priming point during PCR, suggesting that the RNA template might have longer poly(A) tail to prime off. Thus, my studies indicate thatCDKN1A intronic transcript is both spliced and a bona fide product of APA from CDKN1A gene.

Figure 11: CDKN1A Intron APA transcript undergoes splicing. A) UCSC Genome Browser indicates an annotated transcript terminating at intron 1 (maroon diagram at the bottom). This intron-APA uses the same poly(A) signal in intron1 that the transcript detected via 3’ READS technique in samples from HCT116 cells treated with UV and allowed to recover for 2 h (20

J/m²). Detection was scored in Reads Per Million (RPM), calculated as the number of poly(A) site supporting (PASS) reads of that site in a million unique PASS reads per sample. Blue peak indicate CpA detected before UV using 3’READS, red peaks are CpA detected after UV treatment. Maroon boxes are exons and serrated lines are introns. The light blue area shows the length of the expected intronic transcript. Green diagram at the bottom of the figure is the phylogenetic analysis for coding region of the CDKN1A gene. Peaks facing upwards indicate conserved coding regions. B) Schematic of PCR strategies to detect splicing in CDKN1A APA transcript. Forward primer was in exon 1 and reverse primer in alternative last exon (“APA exon”). Isoform distinction is based on molecular weight. C) Experimental confirmation of splicing in CDKN1A intron transcript. HCT116 cells were treated with UV (20 J/m²) and allowed to recover for 2 h, and then harvested. cDNA was prepared using oligo(dT) primers from nuclear

RNA and used for PCR reaction described in (B). A representative gel from three independent samples is shown.

Next, I was interested to determine the protein-coding potential of this CDKN1A APA transcript.

In many instances, intronic polyadenylation occurs downstream of intron and, thus, the APA transcript contains much of the protein coding sequence, usually producing truncated isoforms with varied or antagonist functions (Thomas et al. 2007; Mueller et al. 2016). However, we found

APA was overrepresented genome wide in the first intron after UV treatment in mammalian cells

(Devany et al. 2016). For example, the APA transcript for POLR2A, encoding Rpb1, occurs in intron 1, but has protein-coding sequence beginning upstream in exon 1. The shorter transcript from POLR2A has the potential to generate a protein product with an extremely truncated N- terminal fragment and unknown function. Interestingly, the canonical AUG for CDKN1A mRNA begins in exon 2 (El Deiry et al. 1993), meaning that the APA transcript does not include any canonical CDKN1A coding sequence (phylogenetic diagram at the bottom of Figure 11A). As shown in Figure 13, both cell culture-based (panel A) and in vitro (panel C) translation assays failed to detect a protein product for either the unspliced or spliced isoforms, despite high levels of expression of both RNAs (Figure 13B). To confirm that the DNA preparation for the APA isoforms did not contain an inhibitor of the translation reaction, I performed the reaction with a mix of T7-driven plasmids containing HuR and either spliced or spliced/unspliced APA transcripts. As shown in Figure 13D, translation of HuR was detected discarding the possibility of an inhibitory impurity.

Figure 12: 3’ rapid amplification of cDNA ends (3’RACE) gives experimental evidence of an endogenously utilized polyadenylation site within intron 1 of

CDKN1A. Nuclear RNA from HCT116 cells was reverse-transcribed using an oligo(dT)-anchor primer and amplified using a forward primer that hybridizes with exon 1 and as reverse primer an equivalent to the adaptor sequence without the oligo(dT) sequence. Positive control for this experiment was luciferase mRNA provided by the kit (Invitrogen). The products were separated on an agarose gel and detected by ethidium bromide staining. A representative gel from three independent assays is shown. Molecular weight standard (MWS, 100-bp ladder from Promega) is also included

To explore the potential mechanism(s) involved in the generation of this APA event in

CDKN1A, first, I determined how conserved is this poly(A) signal evolutionarily. Are there particular groups of organisms that have this APA event in common? To answer these questions, I analyzed again the UCSC genome browser. As shown in Figure 14A, CDKN1A intron-APA signal is found in old world monkeys, primates, and humans (catarrhines). The sequence is slightly divergent, usually by one or two nucleotides, in new world monkeys, and diverges more amongst the other mammals. The alternative hexamers found do not correspond to any of the numerous redundant, less efficient poly(A) signals that exist (Tian et al. 2005). In some mammals, such as rodents, as well as the rest of the animal kingdom, the hexamer and surrounding sequence possess no synteny with the human one. This leaves only one likely possibility: that the intronic APA in CDKN1A signal originated after the emergence of new world monkeys approximately 35 million years ago (Ma) (Schrago and Russo 2003; Bond et al. 2015).

This finding is in line with the explosion in the number of long non-coding RNAs that have emerged specifically in primates (Awan et al. 2017). In contrast, a protein-coding sequence and canonical poly(A) signal corresponding to p21/CDKN1A is present in all mammals (Figure 14B), which are currently estimated to have diverged approximately 300 Ma (Kemp 2006). It is worth noting that organisms such as zebrafinch and chicken possess synteny for the coding sequence for p21 protein, but that the genomic context is entirely different.

Figure 13: Ex vivo and in vitro translation reactions yield no detectable protein product for both spliced and unspliced CDKN1A APA isoforms. A) Overexpression of CDKN1A APA transcripts make no detectable protein in HCT116 cells. CMV-driven expression plasmids with N-terminal

FLAG tags containing no transcript, GDP1 as positive control, or either spliced/unspliced APA transcripts were overexpressed. Total protein was extracted from transfected cells and immunoassayed with anti-FLAG antibodies. (*) indicates non-specific band detected by the antibody. A representative gel from three independent samples is shown. B) High levels of spliced and unspliced CDKN1A APA RNA are detected in transfected HCT116 cells. Total RNA samples from cells transfected as in A) were analyzed by qRT-PCR using the strategy described in Figure

11B for spliced isoform. For unspliced isoform, the reverse primer was in closer proximity to exon 1 to allow for qPCR limitation of detecting amplicons <500bp. Errors represent the SD derived from three independent experiments. C) In vitro translation reactions yield no detectable protein for

CDKN1A APA transcripts. T7-driven plasmids containing HuR as a positive control or either spliced or spliced/unspliced APA transcripts were in vitro translated in rabbit reticulocyte lysates.

Translated proteins were labelled with biotinylated lysines, reactions were run on SDS-PAGE and immunoassayed against streptavidin-HRP conjugates. A representative gel from three independent samples is shown. D) In vitro translation as in (C) combining T7-driven plasmids containing HuR and either spliced or spliced/unspliced APA transcripts.

Figure 14: Comparative analysis of the poly(A) signal for intron-APA transcript and canonical CDKN1A mRNA. Bar above each analysis represents the transcript for which the comparative analysis is examining. Blue and red bars indicate 3’READS

CpA detection before and after UV treatment, respectively. Highlighted light blue area indicates the poly(A) signal aligned for each species. A) APA analysis. B) canonical poly(A) analysis.

Discussion

In this chapter, using 3’RACE assays, I have provided biochemical evidence that the

CDKN1A intron-APA transcript detected originally by bioinformatic and qRT-PCR analysis

(Devany et al. 2016) contains a bona fide poly(A) site, which usage is upregulated after UV treatment. In addition, I have shown that the transcript exists as two forms, a ~2 kbp unspliced form, as well as a ~500 bp spliced isoform. The sequencing of the spliced transcript confirmed that the splice site is annotated in the UCSC browser (transcript ID: ENST00000462537), indicating that CDKN1A intron-APA transcript might undergo skipped terminal exon APA. This alternative exon has an AG dinucleotide immediately upstream of the acceptor site and thus is a canonical strong 3’ss (Burset et al. 2000). The presence of a canonical 3’ss suggests that the splicing machinery could recognize this site, and that the site might be regulated through elements or factors present during DDR, for example, splicing cofactors with affinity to an intronic splicing silencer element (Carstens et al. 2000).

Recent research has uncovered a non-coding RNA generated after UV treatment from within a protein-coding gene as a result of APA (Williamson et al. 2017). According to

GENCODE lncRNA catalog (Derrien et al. 2012), up to 4% of lncRNAs are intragenic intronic sense-strand transcripts. Intriguingly, the coding region for CDKN1A mRNA begins in exon 2, downstream from the intron-APA site. Using PhyloCSF browser tracks, which scores whether a sequence represents a potential protein-coding region by multi-species nucleotide sequence alignment (Lin et al. 2011), the high score for protein coding was seed in exon 2 of CDKN1A

(green diagram at the bottom of Figure 11A). However, no such score was detected for any sequence of the intron-APA transcript. Interestingly, despite the low PhyloCSF score, an open reading frame (ORF) was detected within exon 1, which represents a putative upstream ORF

(uORF) (Kim et al. 2012; Collier et al. 2018), and a STOP codon in the APA signal in intron 1.

The translation of such a transcript might lead to a ~16 kDa polypeptide. However, I was unable

to detect any protein from CDKN1A intron-APA transcripts using ex vivo assays (Figure 13A).

To address the possibility that the lack of protein detection was not a result of some endogenous cell regulatory mechanism, I also performed in in vitro translation assays (Figure

13C-D). Again, I was unable to detect any protein expression from CDKN1A intron-APA transcripts using these in vitro assays. Consistent with this, BLAST analysis of the uORF identified no known protein or protein domains.

Together, my data suggests that a spliced noncoding RNA is produced from an intronic

CpA event in CDKN1A after UV damage. It is possible that this RNA might translate into a short peptide, and as many other lncRNAs (Ruiz-Orera et al. 2014), to interact with ribosomes controlling gene expression. In fact, a previously annotated lncRNA was demonstrated to be translated with cellular function (Matsumoto et al. 2017). Future experiments, such as ribosome profiling, might offer further information of the translational capacity of this transcript.

Alternatively, to determine whether function is attributed to an RNA or protein, I could modify

CDKN1A intron APA RNA introducing an early STOP codon to prevent translation and determine if function is affected.

CHAPTER V

EXAMINING THE CONDITIONS AND FACTORS INVOLVED IN CDKN1A INTRON-APA

INDUCTION

Background

As discussed in Chapters III-IV, my research has been focused in APA events induced by DNA damage. Published ata from our lab has shown that much of the regulation of these

APA events is dictated by U1 snRNA abundance (Devany et al. 2016). Besides, those studies showed that those APA transcripts can be detected between 2 and 6 h after UV treatment but not at 10 h of the recovery time. The previous research was limited on analyzing only one dose of UV treatment, only UV treatment with no other stressors tested, and only colorectal carcinoma epithelium HCT116 cells. Protein interactors or regulators other than U1 snRNA were also not determined. Therefore, I was interested in further understand how APA induction was affected in other cellular conditions and environments, and what proteins may be involved in

APA regulation.

As extensively discussed in Chapter I, considerable research has already been completed to identify APA regulators on a global scale. However, in my research, I was less interested in the obvious candidates of APA regulation, such as cleavage factors, and more interested in gene-specific examples that could be identified through sequence element recognition, present either at the DNA or RNA level, in proximity to the intron-APA signal in

CDKN1A.

As the data presented in Chapter IV indicate that the CDKN1A intron-APA transcript has the potential of being a lncRNA, investigating the regulation at the RNA level appeared to be relevant. As both APA and canonical full-length transcripts use the same TSS, I also reasoned that regulation of CDKN1A intron-APA that occurs at the DNA level by DNA-binding proteins would more likely affect both transcripts induction. In contrast, sequence elements around the intron-APA region recognized by RBPs would likely primarily regulate intron-APA transcript once released from the chromatin. While an RBP that binds to CDKN1A intronic sequence upstream of intron poly(A) site also has the potential to bind the canonical pre-mRNA, the binding of the

RBP to the intronic APA transcript might occur first. This is because the CpA reaction of the intronic site probably occurs before transcription of the entire CDKN1A gene has taken place i.e co-transcriptional CpA. Supporting this, it has been shown that RNAP II CTD enhances cleavage reaction while engaged in the transcription complex and that free RNA has low cleavage efficiency (Adamson et al. 2005). As previously described (Kaida et al. 2010), it is possible that any RBP investigated may impact the levels of APA in general and not exclusively the levels of CDKN1A intron-APA.

Overall, in this chapter, I propose to test whether CDKN1A intron-APA transcript is functional by elucidating any specificity in cellular conditions that allow its induction, as well as resources that cell is spending to regulate APA expression.

Results

As previously mentioned, p53 is a transcription factor responsible for the damage- induced expression and repression of cell cycle and apoptotic genes (Farmer et al. 1992).

CDKN1A is one of p53 major targets through binding to response elements upstream of the

TATA box in the CDKN1A promoter (el-Deiry et al. 1993). Therefore, it was of interest to determine whether p53 is involved in CDKN1A intron-APA induction. Using 3’READS assay in samples from colon carcinoma RKO (p53 +/+) and RKO-E6 (p53 -/-) cell lines exposed to UV treatment (20 J/m2), I determined that the level of CpA at CDKN1A intronic site was reduced in samples from RKO-E6 compared to RKO before and after UV treatment (Figure 15). Extending these studies, analysis of colon cancer HCT116 and p53-null HCT116 cell lines by qPCR indicated a similar induction of CDKN1A intron-APA usage in a p53-dependent manner before and after UV treatment. As previously described (Macleod et al. 1995), a modest increase in

CDKN1A full-length mRNA levels (compared to the APA transcript, Figure 15B) was observed in cells expressing p53 after UV treatment. This minimal increase in CDKN1A full-length mRNA

levels was lost in p53-null HCT116 cells (Figure 15C). My results are consistent with previous studies that showed that after UV treatment p53 recruitment increases at CDKN1A promoter at a greater fold change rate than the induction of CDKN1A full-length mRNA (Magrini et al. 2007).

Together and as previously

Figure 15: p53 is necessary for CDKN1A intron-APA induction. A) UCSC

Genome Browser view of detected poly(A) signal usage by 3’READS before and after UV treatment at CDKN1A in samples from RKO (p53+/+) and RKO-E6

(p53-/-) cells. Intronic poly(A) signal are shown along with the canonical poly(A) signal in 3’UTR. poly(A) signals are indicated, and their RPM values at different time points are shown. At the bottom, maroon boxes are exons and serrated lines are introns of expressed sequence tags (ESTs) from CDKN1A. B) and C) qPCR analysis of CDKN1A intron-APA and CDKN1A full-length mRNA, respectively, in samples from HCT116 and HCT116 p53-null cell lines. The qPCR strategy used is described in Figure 9A. The qRT-PCR values were calculated from three independent biological samples by triplicate.

described (Devany et al. 2016), these results suggest that p53 expression may impact the extent of CDKN1A intron-APA regulation.

To further understand the nature of the CDKN1A APA isoforms, I used an online software named AnnoLnc, which provides expression profiles for lncRNAs based on compiles of datasets from RNA-seq and CHIP-seq analysis, as well as information from other databases and serves as a method of annotating novel RNAs (Hou et al. 2016). As a control RNA for software analysis, I used the lncRNA HOTAIR. Several publications have described HOTAIR as oncogenic (Hajjari and Salavaty 2015), including in breast cancer (Pawlowska et al. 2017). In line with HOTAIR role in oncogenesis, the detectable expression profile of HOTAIR is exclusively in cancer with higher expression in breast and lung cancer (Figure 16A)

The expression profile of the CDKN1A APA isoforms yields some interesting observations (Figure 16B-C). First, both the unspliced and spliced transcripts have been detected in various RNA-seq collections. Second, the expression of both CDKN1A APA isoforms appears to have some tissue specificity, suggesting that this differential expression might reflect the ratio of unspliced/spliced in different tissues. Further analysis of the expression pattern of each isoform indicates that the expression of the CDKN1A spliced APA is abrogated in cancers of both lung and lymph tissue (Figure 16C). For the CDKN1A unspliced APA, while adrenal expression is also decreased in cancer cells, expression in kidney carcinoma and melanoma is increased. It is worth noting that unlike the CDKN1A spliced APA and HOTAIR, the unspliced APA transcript does not have a uniform direction of expression between normal and transformed cells. Finally, it is important to highlight that the expression profile for both

CDKN1A APA isoforms may be underrepresented because our studies indicate that those isoforms are expressed primarily during DDR (Devany et al. 2016). Besides, as CDKN1A is developmentally regulated (Nayak et al. 2018), it is possible that intron-APA may also undergo tht type of regulation.

Figure 16: Expression profiles for lncRNAs in normal tissue and cancer samples obtained from AnnoLnc software. A) Normal tissue and cancer expression for

HOTAIR lncRNA. B) Expression profile for CDKN1A unspliced intron-APA transcript. C) Expression profile for CDKN1A spliced intron-APA transcript. FPKM

= fragments per kilobase of transcript per million reads. The cutoff of 1 indicated by the red dotted line is set by AnnoLnc to determine fragment reads above background.

The metadata is interesting because it shows that other labs have also identified the existence of CDKN1A APA transcript by using RNA-seq in a variety of cellular backgrounds. As the program algorithm for AnnoLnc predicts the sequence of APA locus of sequences non- coding for protein, the inclusion of CDKN1A APA transcripts in this program supports my results presented in Chapter IV. Those results indicate that CDKN1A APA transcripts are lncRNA transcripts (Figures 13 and16). However, not all RNA-seq methods included in AnnoLnc are selected for poly(A)+ RNA, and so it is possible that the RNA detected might be fragments of pre-mRNA. As shown in Figures 11-12 and 14, the unspliced and spliced CDKN1A APA isoforms can exist as polyadenylated transcripts in HCT116 cells.

To test whether CDKN1A APA exists and is induced in other cell types I used MCF7 breast cancer cells, which are wildtype for p53 to allow APA induction under DNA damaging conditions. To examine whether APA induction occurred also in normal cells I analyzed non- transformed skin fibroblast BJ cells. BJ cells allowed me to compare APA induction in normal cells and cancer cell lines. The results are shown in Figure 17. In HCT116 cells, UV treatment induced both unspliced and spliced CDKN1A isoforms within 2 h recovery time after UV treatment, where the unspliced is the precursor i.e pre-RNA of the spliced transcript. Full-length

CDKN1A mRNA was also significantly induced, but not to the degree of APA isoforms (Figure

17A). This is consistent with the results shown in Figure 14 B-C and previous studies (Macleod et al. 1995) that showed a modest increase in CDKN1A full-length mRNA levels in cells after UV treatment. As previously described (Chen et al. 2011), etoposide treatment (20 µM) for 18 h strongly induced full-length CDKN1A mRNA. Interestingly, unspliced CDKN1A APA was also induced strongly by etoposide, reaching levels approximately 30 fold more than untreated cells and 2.5 fold more than UV treatment. Spliced CDKN1A APA was induced 11 fold more in etoposide treatment compared to non-treatment, and 1.5 fold more compare to UV induction.

The greater induction of unspliced compared to spliced CDKN1A isoforms in samples from

etoposide treated cells may represent a cellular cap for splicing activity during DDR. MCF7 cells showed a slightly different behavior

Figure 17: CDKN1A APA isoforms and full-length expression in a variety of cell

lines and stressor conditions. Total RNA was purified from cell culture at 80%

confluency. cDNA was synthesized using oligo(dT) primers. qPCR was then

performed using primers to detect individual CDKN1A isoforms as depicted in

Figures 9A and 11B. A-C) Effect on CDKN1A isoforms of DNA damage agents in

different cell lines. Cell lines are indicated. The qRT-PCR values were calculated

from three independent biological samples by triplicate. (* p<0.05, ** p<0.005, ***

p<0.0005, **** p<0.00005).

(Figure 17C), as induction of unspliced and spliced was similar after UV treatment, while full- length mRNA underwent a slight decrease, in agreement with p21 induction delay during UV response (Wang et al. 1999).

The non-cancerous BJ cells harbor some intriguing observations (Figure 17D). First, at the same UV dose (20 J/m2) and recovery time (2 h) as the cancer cells, unspliced APA increased approximately 3.5x, much lower than the increases seen for MCF7 (7.5x) and

HCT116 (8x). Second, the spliced APA isoform was not increased, suggesting that splicing of unspliced APA transcript occurs earlier or at a faster rate in cancer cells than normal cells, or that an inhibition of splicing that occurs during UV response in normal cells is lost or reduced in the cancer cells. However, these possibilities are challenged when taking etoposide treatment into consideration, as etoposide induced all APA isoforms as well as full-length mRNA. It is also possible that transcription regulation of CDKN1A differs depending on stress and cell type. It has been shown that CDKN1A transcription is regulated in a DDR-kinase CHK1 manner (Mattia et al. 2007), where the distinction is whether full-length CDKN1A mRNA is immediately strongly induced or not. Hence, the levels of unspliced APA transcript in normal cells may depend on levels of activation of transcription by kinases activation. To summarize, APA can be induced in a variety of cell lines, both cancer and normal. APA is also induced to varying degrees upon stresses that have been shown to delay p21 induction. The rate of splicing also differs between stresses and cell lines, and it is not clear whether all of the induced APA events are destined to become spliced, or whether some unspliced RNAs remain stable in the cell.

Several studies have shown that CDKN1A undergoes stress specific gene expression regulation at CDKN1A promoter (Gomes et al. 2006). The transactivation delay is at the level of transcription elongation (Mattia et al. 2007) and is dependent on Chk1, which was uncovered using chemical inhibitors of Chk1 as well as caffeine, which inhibits Chk1 activation (Lu et al.

2008; Beckerman et al. 2009). Inhibiting Chk1 during stresses that normally produce delayed p21 induction restored RNAP II serine 2 phosphorylation, a marker for elongation, as well as

increased CstF-64 recruitment to CDKN1A 3’ end, and restored CDKN1A full-length mRNA upregulation.

It is possible that the observed inhibition of transcription elongation of the full-length

CDKN1A mRNA might be due to CDKN1A APA (Devany et al. 2016). I hypothesized that the inhibition of transcription elongation is due to increased APA in the first intron of CDKN1A. To test that I used the conditions described to rescue CDKN1A full-length mRNA induction

(Beckerman et al. 2009) by treating HCT116 cells with hydroxyurea (HU) with or without a 1 h caffeine pretreatment to inhibit DDR kinase CHK1 activation. HU is a reversible ribonucleotide reductase inhibitor that depletes deoxyribonucleotide pools, thereby inhibiting DNA synthesis and mimicking DNA damage (Scully et al. 1997). If intron-APA plays a role in the inhibition of

CDKN1A full-length mRNA induction, rescuing CDKN1A full-length mRNA induction should have an opposing effect on HU-mediated induction of APA. My observations are found in Figure

18.

While the HU treatment induced the p21 protein levels, the induction was lower than the one observed after etoposide treatment (Figure 18A-B). As previously reported, caffeine treatment rescued both CDKN1A full-length mRNA and protein induction to levels comparable to etoposide (Beckerman et al. 2009). In contrast, caffeine pretreatment had a negligible effect when combined with etoposide, a strong inducer of p21. HU, like UV treatment, induced the levels of APA transcripts (Figure 18C). Interestingly, while both the levels of unspliced and spliced APA transcripts increased during rescue with caffeine, the level of unspliced was increased by a similar fold change relative to the control as the full-length mRNA. Thus, the data suggests that rescuing CDKN1A transcription elongation does not downregulate APA induction by stress conditions and, hence, that APA does not occur to prevent CDKN1A full-length transcription elongation to 3’ end of gene.

Figure 18: Rescuing CDKN1A full-lenght mRNA induction with caffeine pretreatment does not abrogate DNA damage-induced APA. HCT116 cells were treated or not with caffeine (4 mM) for 1 h before the media was replaced and supplemented with HU (1.7 mM). After 24 h, either total protein or total RNA were purified from the collected cells for analysis of p21 (A-B) and CDKN1A isoforms

(C), respectively. A) Lamin A was used as loading control in Western blot analysis. A representative Western blot from three independent assays is shown.

B) Errors represent the SD derived from three independent experiments. C) qRT-

PCR analysis of APA isoforms and full-length mRNA of CDKN1A gene after HU and/or caffeine treatments using total RNA samples. cDNA was synthesized using oligo(dT) primers. qRT-PCR was then performed using primers to detect individual

CDKN1A isoforms as depicted in Figures 9A and 11B. The qRT-PCR values were calculated from three independent biological samples by triplicate.

Role of RNA-binding protein HuR on CDKN1A APA

The typical RNA-binding regulatory effects on APA are those produced by U1 snRNP on promoter-proximal poly(A) suppression (Kaida et al. 2010; Berg et al. 2012). Some of the RBP regulators of APA include core factors in the CpA reaction (Takagaki et al. 1996; Jenal et al.

2012). The effect of an RBP on APA can also be context dependent, as in the case of polypyrimidine tract binding (PTB) protein (Moreira et al. 1998; Castelo-Branco et al. 2004), a protein typically involved in splicing regulation. Recently, the RBP human antigen R (HuR) has been described to play several roles in the regulation of different RNA-related mechanisms.

RBP HuR has roles in stability (Wang et al. 2000; Mazan-Mamczarz et al. 2003), splicing

(Izquierdo 2008; Akaike et al. 2014) and APA (Mansfield and Keene 2012). HuR role in APA does not appear to be global (Kraynik et al. 2015) and its role in splicing appears to be limited to cassette exons from data obtained (Mukherjee et al. 2011). HuR binding to RNA targets is also affected by DDR (Abdelmohsen et al. 2007; Masuda et al. 2011; Zhou et al. 2013).

Because my investigation potentially is implicated in all of these processes, I was interested to determine whether HuR might directly regulate CDKN1A APA. To test that I first determine whether a predicted binding site for HuR is present in the CDKN1A APA isoforms. I utilized a peer-reviewed program called RBPMap, which is a computational tool that enables accurate prediction and mapping of RBPs binding sites on any RNA sequence (Paz et al. 2014).

As the APA transcript appears to exist as both unspliced and spliced isoforms, I analyzed both sequences individually using RPBMap. Out of all the proteins predicted to bind, one of the most statistically relevant was HuR. Interestingly, HuR binding was predicted for only the unspliced isoform (Figure 19A) but not for the spliced isoform (data not shown). Specifically, two HuR sites in close proximity were predicted. Previous data has indicated that 75% of transcripts have 2 or more HuR binding sites (Mukherjee et al. 2011). When compared with the UCSC genome browser, the HuR binding sites matched with a region of high, dense conservation among both vertebrate and primate collections (Figure 19B).

Then, it was of interest to establish whether HuR binds to CDKN1A APA isoforms, and the dynamics of HuR binding to these isoforms during the progression of DDR. This was achieved by a) modified RNA immunoprecipitation (RIP) assays using recombinant His-HuR and total RNA from HCT116 cells exposed to UV treatment, and b) RNA pull-down assays with biotinylated in vitro transcribed CDKN1A APA isoforms and NEs from UV-treated HCT116 cells.

Consistent with the RBPMap prediction (Figure 19A), binding of HuR was detected only for unspliced but not spliced CDKN1A APA isoforms by RIP assays (Figures 20A-B). Full-length

CDKN1A mRNA binds to HuR by sequences present in the 3’UTR of the gene (Wang et al.

2000). Interestingly, HuR binding to APA isoforms is maintained during the progression of the

DDR (Figure 20C). Therefore, my data indicate that the binding of HuR to APA may be involved in regulating APA and thus the progression of DDR.

After the validation of HuR binding to CDKN1A unspliced APA transcript via both bioinformatic and biochemical approaches (Figures 19-20), I was interested to know whether

HuR expression levels might affect CDKN1A APA levels. Consistent with previous studies that show that HuR is a ubiquitously highly expressed protein (Ma et al. 1996; Srikantan and

Gorospe 2012), samples from cells overexpressing HuR did not show significant changes in the levels of CDKN1A isoforms (data not shown). This was also true when HuR was overexpressed and cells were exposed to UV stress, consistent with prior reports that most stresses, including

UV, do not affect HuR abundance (Abdelmohsen et al. 2009). So then I decided to perform siRNA-mediated knockdown of HuR rather than overexpression assays. Knockdown of HuR

(single-dose tranfection for 36 h) was confirmed by qRT-PCR and Western blot (Figure 21A-B).

The reduced level observed after UV treatment could be due to the export of HuR to the cytoplasm (Westmark et al. 2005). Interestingly, HuR knockdown induced both CDKN1A APA isoforms early in the recovery from UV treatment but had differerent effects on the levels of unspliced and spliced isoforms at later times in the recovery (Figure 21C-D). This is unexpected as HuR only binds to the CDKN1A unspliced APA isoform (Figure 19-20). However, levels of

spliced isoform could occur due to changes occurring in the unspliced isoform, as the unspliced isoform is the mandatory precursor from which the spliced isoform is derived.

To determine whether the effect of HuR on the levels of CDKN1A APA isoforms is transcriptional or posttranscriptional (Mukherjee et al. 2011) I depleted the expression of HuR in

HCT116 cells with siRNA followed by UV and/or with actinomycin D (Act-D) treatment and meassure CDKN1A APA isoforms levels. Act-D is thought to intercalate DNA and prevent progression of RNA polymerases and, hence, inhibits transcription (Perry and Kelley 1970). I used concentrations previously tested (Yoon et al. 2012). As CDKN1A APA is primarily induced during DNA damage (Devany et al. 2016) and HuR appeared to bind more the unspliced APA isoform during DDR (Figure 20), it was of interest to test the effect of independent HuR- mediated transcription on CDKN1A APA during DDR. Therefore, prior to Act-D treatment, I treated cells with UV, allowed them to recover for 2 h, and then either extracted RNA or added

Act-D for indicated time points (diagram in Figure 22A). Therefore, transcription had been active for only 2 h post-UV treatment for each time-point indicated.

As a non-HuR target gene and due to its long half-life (Wang et al. 2000), the RNA levels for GAPDHwere unaffected by either HuR knockdown or Act-D (Figure 22B). Surprisingly, the spliced APA isoform was similarly unaffected once transcription had been inactivated, suggesting that the spliced isoform is a particularly stable poly(A)+ lncRNA. The RNA levels of the CDKN1A spliced form were also not affected significantly by HuR knockdown. This is consistent with the results shown in Figure 19-20 that indicate that the spliced form does not bind to HUR. would be predicted as binding of HuR to the isoform was not observed (Figures

19-20. Interestingly, the CDKN1A unspliced APA isoform underwent Act-D-mediated decrease in RNA abundance, with a half-life of approximately 3 h, suggesting that the unspliced is less stable than its spliced counterpart. Knockdown of HuR further decreased the half-life of the unspliced in a UV background. Together, these results indicate that HuR plays a direct role in regulating the levels

Figure 19: Predicted HuR binding site overlaps with a dense conserved region in

CDKN1A intron 1. A) CDKN1A unspliced APA isoform was analyzed by RBPMap program and given Z-scores, which represents the derivation of the mean predicted binding for a series of randomly selected exonic and intronic elements, for sequences matching degenerate HuR motif. B) RBPMap data was aligned to

UCSC genome browser. Vertical teal lines in blue indicate the predicted HuR binding sites. Black boxes represent exon 1 (left) and the alternative exon (right), and thin black line is intron 1 sequence emcompassing APA transcript within

CDKN1A APA isoform. Dark green peaks show primate conservation of regions in the CDKN1A intron-APA transcript.

Figure 20: HuR binds to unspliced but not spliced CDKN1A APA isoform. A) Total

RNA from HCT116 cells was incubated with recombinant His-HuR protein and immunoprecipitated with either antibodies against His-tag or control IgG. Then qRT-

PCR analysis was performed for CDKN1A isoforms using primers to detect individual

CDKN1A isoforms as depicted in Figures 9A and 11B. Errors represent the SD (n =

3). B) RNA pull-down assays were performed using in vitro transcribed biotinylated

RNA from the CDKN1A APA isoforms mixed with NEs from HCT116 cells exposed to

UV treatment (20 J/m2). In vitro transcribed biotinylated Pet14-b RNA was used as nonspecific sequence (no HuR sequence is present in this fragment), while RNA from

TP53 3’UTR was used as positive control for binding (Zhang et al. 2015). Lamin A was used as negative control for binding. A representative pull-down reaction from three independent assays is shown. Five percent of the NEs used in the pull-down reactions is shown as input. C) RNA pull-down as in (B) except performed over a time course of revovery after UV exposure. D) Quantification of RNA pull-down assays represented in (C). The presented ratios were calculated for each samples related to its own input.

Figure 21: HuR expression leves affect the abundance of CDKN1A APA transcripts. A-B)

Validation of HuR knockdown by Western blot (A) and qRT-PCR (B). HCT116 cells (~5 x 105 cells per plate) were treated with either control (siCTRL) or HuR siRNA (200 pmols) and UV irradiation (20 J/m2). Either nuclear protein or total RNA were analyzed for HuR expression using anti-HuR antibodies or specific primers for HuR mRNA, respectively. A) Lamin A was used as loading control in Western blot analysis. A representative Western blot from three independent assays is shown. B) cDNA was synthesized using oligo(dT) primers. qRT-PCR was then performed using primers to detect HuR. The qRT-PCR values were calculated from three independent biological samples by triplicate. C-D) Levels of spliced (C) and unspliced (D)

APA isoforms are shown as the HuR siRNA/CTRL ratio. Values for the qRT-PCR for each isoform were normalized to the ones of GAPDH. Samples were preared as in (A). The qRT-

PCR values were calculated from three independent biological samples by triplicate. E) qRT-

PCR analysis of CDKN1A isoforms from samples of cells treated with UV irradiation and allowed to recover for 8 h, when APA levels decline and approach basal levels (Devany et al.

2016). Intron 2 is included as negative control for amplification. Full-length CDKN1A mRNA is

included as positive control for effect of HuR siRNA-mediated depletion (Wang et al. 2000), ubiquitin is included as loading control.

Figure 22: HuR regulates abundance of CDKN1A APA isoforms in transcription-

independent manner. A) Schematic showing experimental design. The time

points are indicated by color-coding in panel B. B) mRNA decay rates for

CDKN1A APA isoforms and GAPDH, a non-HuR target gene, were determined

by qRT-PCR at different time points following HuR/control siRNA-, UV- and Act D

treatment. cDNA was synthesized using oligo(dT) primers. qRT-PCR was then

performed using primers to detect GAPDH and the APA isoforms with strategy

shown in Figure 11B. The RNA levels are expressed as a percentage of the

values detected for each RNA in the 2 h recovery post-UV treatment. The

percentages were calculated from three independent samples. Errors represent

the SD derived from three independent experiments.

of CDKN1A unspliced APA isoform, but not the spliced isoform, which is the product of the unspliced isoform, in a transcription independent manner by direct interaction of HuR with the

APA transcript during the progression of DDR.

p21-/- HCT116 cells

The Vogelstein group described for first time some of the functions of p21 by using cells with an homozygous deletion in CDKN1A gene generated by homologous recombination

(Waldman et al. 1995). As all of the protein-coding sequence of p21 exists in exons 2 and 3, the group recombined out only those regions, replaced them with resistance markers, and left the rest intact, such as exon 1 and the majority of intron 1. Therefore, I hypothesized that CDKN1A intron APA would be expressed in p21-/- HCT116 cells and possibly dysregulated due to the recombination event that took place. As demonstrated in the original manuscript and others

(Chen et al. 2011), CDKN1A mRNA and p21 protein expression are entirely absent from this cell line. Therefore, I performed qPCR to examine the abundance of APA transcripts in this cellular background. My initial observations are found in Figure 23.

Unfortunately, although it appeared that APA isoforms were highly expressed basally in the p21 knockout cell line and were additionally induced after UV treatment, qRT-PCR analysis of full-length CDKN1A mRNA indicated presence of such mRNA in levels lower than the detected in the parental cell line and unaffected by UV irradiation. Therefore, I could not be certain that APA was indeed more highly expressed in a p21-/- background. As the negative control samples to account for contamination of tubes, reagents, or pipettes came up with no amplification (not shown), I concluded that the cell line themselves were harboring p21+/+ cells.

A second order from the Johns Hopkins repository produced similar results. According to the literature, this concept of cell line to cell line contamination is not a rare or new issue (Nelson-

Rees et al. 1981; Lucey et al. 2009; Serge and Halffman 2017). To purify the cell line I performed two-step antibiotic selection of groups of 5,000 cells, comparing how the p21-/- cell

line responded versus the parental HCT116 line, which are not resistant to either G418

(neomycin) or hygromycin B. I used

Figure 23: Levels of CDKN1A APA isoforms are higher in p21-/- cells compared

to the parental cell line. A-C) Cells were cultured to ~85% confluency and then

dosed with UV irradiation (20 J/m2) and allowed to recover for 2 h before total

RNA extraction. cDNA was synthesized using oligo(dT) primers. qRT-PCR was

then performed using primers to detect individual CDKN1A isoforms as depicted

in Figures 9A and 11B. The qRT-PCR values were calculated from three

independent biological samples by triplicate. D) Following double antibiotic

selection (post-drug), cells were RNA extracted and subjected to qRT-PCR for

full-length and spliced CDKN1A transcripts as in (A). The products were

separated on an agarose gel and detected by ethidium bromide staining. A

representative gel from three independent assays is shown. E-F) Following

double antibiotic selection (post-drug), cells were RNA extracted and subjected

to qRT-PCR for individual CDKN1A isoforms as in (A). The qRT-PCR values

were calculated from three independent biological samples by triplicate.

the antibiotic concentrations described by the original manuscripts (Waldman et al. 1995). After

3 days, all of the HCT116 parental cells were dead, whereas the p21-/- were viable and growing for 10 days of G418 treatment and a subsequent 10 days of hygromycin B treatment. Following the treatments, I extracted the RNA and performed qRT-PCR, comparing the sample to both

HCT116 cells as well as the p21-/- pre-drug treatment (Figure 24D). I observed that the abundance of mRNA detected pre-drug treatment was ablated, thus a cell culture contamination was the most likely primary source of full-length CDKN1A mRNA detected. In the absence of full-length CDKN1A mRNA expression, the levels of spliced CDKN1A APA increased after drug treatment, as a greater proportion of the cells were now fully isogenic for p21 deficiency.

However, unspliced CDKN1A APA levels appeared to be decreased. It is possible that in a situation where the full-length mRNA exons (exons 2 and 3 have been removed, that the retained APA transcript is now bias towards splicing, for example if the splicing components recruited to CDKN1A that would have been otherwise used for exons 2 and 3 splicing, are now available to increase the splicing of APA transcript instead.

Discussion

The studies presented in this Chapter showed that CDKN1A APA induction is tightly linked with the regulation and expression of other key DDR factors, such as p53 and HuR

(Figure 15 and 22). Besides CDKN1A APA can be observed to be induced in a number of different cell lines of both tumorigenic and normal origin in a non stress-specific manner (Figure

17). Rescuing CDKN1A gene from transcription elongation inhibition with caffeine, I observed that the expression of both intronic APA isoforms and full-length mRNA correlate (Figure 18).

Finally, I observe a direct binding and regulation of APA isoforms by the RBP HuR (Figure 20).

The results of partial p53-dependence on CDKN1A intronic APA is not surprising, given that full-length CDKN1A mRNA induction after stress is p53 dependent (Macleod et al. 1995).

However, the qRT-PCR (Figure 15) and 3’READS (Devany et al. 2016) data produces a disparity with one another in that CpA at canonical site appears to be higher after UV in RKO-E6

(p53 deficient) cells compared to parental RKO cells. In Figure 15, qRT-PCR data of HCT116 cells shows that full-length CDKN1A mRNA is higher in parental cells compared to p53 deficient cells. This discrepancy could be explained by the different ways in which p53 expression is prevented in these two cell lines. RKO-E6 expresses human papillomavirus E6 protein which forms complex with p53 and targets it for rapid degradation (Thomas et al. 1999), whereas

HCT116 p53 -/- cells are homozygous knockout. Thus the difference in cell line usage between bioinformatic and biochemical detection methods may be a factor. Alternatively, the discrepancy could be due to the differences in the method of detection, as 3’READS detects CpA events and requires a much longer oligo(dT) primer than does qRT-PCR, which the latter then may be enriching mRNAs with shorter poly(A) tails. For APA, as 3’READS data concurs with qPCR data, it is likely that cell line difference or poly(A) tail length are not major factors.

The AnnoLnc datasets (Hou et al. 2016) are interesting in that they represent an external source of detection of CDKN1A APA transcripts other than our lab. While the expression of the

RNA-seq datasets of either unspliced or spliced above the FPKM cutoff is limited to approximately 2 tissue types in normal cells (Figure 16). This limited increase may be due to the fact that these transcripts are induced rather than suppressed during DDR, and their expression levels may have been higher should these tissue types be stressed. The qPCR data I obtained from the cell lines available show that the cancer cells are generally more inducible for intronic

APA compared to normal cells (Figure 17). There are several possibilities for this. First, it may be a difference in the source of the cell lines, as both the HCT116 and MCF7 cells that were tested are from adult patients, whereas the BJ cells are neonatal. Importantly, all cell lines tested are wild-type for p53. Second, it fits the model by which cancer cells generally undergo more APA via transcript shortening compared to normal cells (Flavell et al. 2008; Mayr and

Bartel 2009) in a U1 snRNA-dependent manner (Kaida et al. 2010). The primary reason for this

is unsure but may either be reduced U1 snRNA levels or increased transcriptional output in cancer cells leading to reduced U1/transcript available (Berg et al. 2012). The third possibility is that while cancer cells are more inducible than normal cells, the normal cells examined may have higher basal expression of CDKN1A intron APA, which BJ cells appeared to when normalized to housekeeping gene (Figure 17).

The positive correlation of full-length CDKN1A mRNA with APA induction is a surprising finding (Figure 18C). At the beginning of this study, my hypothesis was that the selection of

CDKN1A mRNA canonical poly(A) signal was in competition with APA poly(A) signal, as would be assumed to be the case for signals in the same transcriptional unit on the same strand. As is previously described, caffeine (and hence Chk1 inhibition) rescues the transcription elongation of CDKN1A (Mattia et al. 2007; Beckerman et al. 2009). Interestingly, rescuing full-length mRNA induction with caffeine does not abrogate APA induction during DDR. It is unclear where exactly the inhibition of elongation occurs. The Prives group (Mattia et al. 2007) did not detect any difference in CDKN1A primary transcript levels for an intronic region corresponding to the unspliced APA transcript studied here between HU and HU+Caffeine treatment. However, I detected a strong increase in unspliced, and weaker for spliced, CDKN1A APA transcript upon caffeine pre-treatment (Figure 18C). This may be due to the fact that the Prives group synthesized cDNA using both oligo(dT) and random hexamers, and thus they would be detecting the intron 1 region in pre-mRNA as well as APA. As I used only oligo(dT) primers, my assays specifically detect intron APA transcripts.

As the amount of full-length CDKN1A mRNA via raw Ct values is approximately 100x greater than the amount APA transcripts in unstressed cells (Table 2), the total transcription of the full-length relative to APA is high. It is possible that unstable pre-mRNA intronic sequences may be masking any increase in APA observed. Interestingly, an increase in serine 2 phosphorylation (Ser2p) of RNAP II CTD is detected downstream of APA site by ChIP assays upon conditions that rescue transcription elongation of CDKN1A (Beckerman et al. 2009). It is

also apparent from their ChIP data shows a 50% increase in RNAP II Ser2p at the poly(A) site used in CDKN1A intronic APA. My data suggests that while upstream DDR kinases, such as

ATR and CHK1, can rescue the transcription elongation of full-length CDKN1A, those kinases are not necessary for intron APA induction in stress conditions.

Ubiquitin C Unspliced Spliced Full-length CDKN1A CDKN1A CDKN1A Untreated 1 19.94808 31.82752 31.80608 22.7532

Untreated 2 18.166122 30.9347 32.09334 22.96431

Untreated 3 19.235859 31.53358 32.54991 24.07069

UV 1 20.192856 28.50216 27.86771 23.28235

UV 2 19.733307 28.92945 29.37959 23.12796

UV 3 19.453285 28.54096 29.17277 23.03979

Table 2: Representative example of raw Ct values for control and CDKN1A

isoforms. Column 1 indicates each biological replicative of a sample. Each

proceeding column represents the Ct values derived for each primer set, indicated

in Row 1. Each Ct values is drawn from 2 technical replicates with standard

deviation <0.5. Each Ct integer represents a 2-fold difference.

One could assume that a conserved nucleotide sequence exists as such out of chance, such as in a region with a very low spontaneous mutation rate or that it serves as a recognizable region for RNA or protein docking factors, or that the conserved sequence serves some topological function in relation to those docking factors. In the case of the particular sequence within CDKN1A intron APA transcript, data suggests it serves partially as a docking element for RBP HuR (Figures 20-22). My data shows binding of HuR to unspliced but not

spliced CDKN1A transcript before UV treatment by both RIP of endogenous RNA as well as

RNA pull-down of endogenous HuR (Figure 20). After UV treatment, I consistently observed a transient decrease in HuR binding to unspliced CDKN1A transcript at 2 h, but binding is restored after 4 h (Figure 20C-D). Similar results were observed using HuR depletion approach,

HuR knockdown at 2 h recovery time post-UV treatment induced significantly both APA isoforms and this is lost at 8 h for the unspliced form (Figure 21), indicating that binding of HuR to the unspliced transcript plays role in its stabilization to recover the levels observed in untreated cells. In order to understand the role HuR in CDKN1A APA, several observations need to be taken into account. First, HuR is not binding to the spliced isoform and, thus, it does not directly regulate spliced APA isoform levels. Second, the position of HuR binding to the unspliced is relevant to inferring its function in the light of the data. Previous studies showed that HuR is implicated in regulating APA of its own gene by binding in close proximity (less than 200 bp) from the poly(A) signals (Dai et al. 2012). As HuR binding to the unspliced transcript is >1 kbp from the poly(A) site used in APA and HuR has a transcription-independent effect on unspliced

APA transcript (Figure 22), I conclude that HuR is not likely to be directly involved on the CpA event. Likewise, as with APA regulation, HuR regulation of splicing is dependent on sequences in close proximity (20-100 bp) to the acceptor sites (Izquierdo 2008; Lebedeva et al. 2011).

Global PAR-CLIP indicate that HuR binding sites are mostly intronic (Mukherjee et al. 2011) and individual biochemical examples have identified some HuR binding sequences in exons (Akaike et al. 2014). HuR binding to CDKN1A intron APA occurs >300bp upstream of the acceptor site of the alternative APA exon. Additionally, I have not observed a negative correlation between unspliced and spliced isoforms before or in early UV response, as all stresses and conditions tested either increase both isoforms, or increase one leaving the other unchanged.

Together, my data suggests that the direct role of HuR is on stability of unspliced isoform. Although HuR knockdown also appears to increase the levels of the spliced APA isoform (Figure 21), this can be explained by the initial induction of APA caused by HuR

knockdown coupled with the long half-life of the spliced isoform (Figure 22). The long half-life of the spliced APA isoform is a surprising observation, but not completely abnormal, as a number of lncRNAs have been characterized with half-life of >12 h (Clark et al. 2012). The reasons for the initial induction of APA after UV treatment during HuR knockdown is not clear but may reflect an indirect effect caused by the increase in mRNA processing factors levels observed when HuR levels are low (Mukherjee et al. 2011). Thus, RBP HuR may be a direct binding partner and regulator of intronic APA isoforms.

CHAPTER VI

INVESTIGATING THE CELLULAR FUNCTION OF CDKN1A INTRONIC APA TRANSCRIPTS

Background

Previously, we and others have shown that APA can occur for a specific function from a particular gene or genome wide to enact a global response (Shi 2012; Lianoglou et al. 2013;

Devany et al. 2016). One such example would be the global reduction in mRNA levels observed after UV treatment (Cevher and Kleiman 2010), occurring in part due to the reduction in CpA at canonical 3’ gene ends (Kleiman and Manley 2001) and U1 snRNA-mediated upregulation of promoter-proximal intronic APA (Devany et al. 2016). The global reduction in mRNA and full- length transcription is a mechanism that controls gene-expression while the damage is repaired.

The reduction in mRNA levels also reflects a decrease in transcription by RNAP II to avoid its collision and stalling at intrastrand crosslink lesions, which would affect DNA repair and induce apoptosis (Arima et al. 2005; Cevher et al. 2008). The idea of competition-as-function makes sense for APA events, as the levels of transcription for both full-length and APA transcripts are similar the occurrence of an APA event results in the reduction of the usage of the canonical poly(A) signal and the levels of those mRNA isoforms. This appears to be the case for the transmembrane protein Ephrin B2 (Devany et al. 2016), whose alternative poly(A) usage is on par with canonical poly(A) site usage after DNA damage. Alternatively, APA expression can occur in negative correlation with the usage of the canonical poly(A), as in the case of IgM heavy chain (Takagaki et al. 1996), whereby the levels of transcription are not sufficient to drive expression of both poly(A) isoforms at the same time. Many of APA functions can also be inferred from protein domains that are truncated due to proximal poly(A) events leading to distal exon exclusion. Proteins missing domains that also dimerize or oligomerize can also act as dominant negative isoforms for the expressed full-length versions (Singh et al. 2018). Likewise, intronic APA leading to retention of certain intronic sequences can extend the open reading frame from the 5’ exon and add extra amino acid sequences (Movassat et al. 2016).

The picture becomes rather more complicated when the promoter-proximal APA event occurs in an exon/intron very close to the promoter and omits most of the canonical exons

resulting in the complete deletion of the coding region. The relevance of promoter-proximal APA is bolstered by the observation that having long first introns is a general characteristic of eukaryotic genes (Bradnam and Korf 2008) and that many UV-mediated APA events occur in the first intron (Devany et al. 2016). Additionally, while the average length of 5’UTR is estimated to be ~200 nt in humans (Mignone et al. 2002), the average length of exons in the human genome is ~175 nt (Sakharkar et al. 2004), meaning that in many cases coding regions could begin in exons downstream of long first introns, which average length could be thousand base pairs in length, and after APA events. The ultimate outcome of this is a wealth of intragenic potentially functional lncRNAs produced during DDR, something which has already been observed (Williamson et al. 2017). Thus, in this Chapter I propose to determine whether the intragenic lncRNA produced from CDKN1A intronic APA possess functions in different cellular conditions other than sequestering resources during CDKN1A transcription.

Results

Before I tested the potential function CDKN1A intronic APA isoforms, both unspliced and spliced, I considered it was important to determine the cellular localization of these isoforms.

RNA from different cellular fractions was obtained from HCT116 cells by lysing the cellular membranes and leaving the nuclei intact, and RNA was extracted from either the supernatant

(cytoplasm) or the pellet (nuclear) (Hwang et al. 2007; protocol described in Chapter VIII). Both

GAPDH and mature U2 snRNA were used as cellular fraction purification controls, as GAPDH mRNA is predominantly cytoplasmic and U2 snRNA is predominantly nuclear (Huang and

Pederson 1999). Unfortunately, UV exposure prevented GAPDH from being used as a control for efficient fractionation, as I observed a nuclear retention following DNA damage (Figure 24).

Figure 24: Localization of CDKN1A APA isoforms. HCT116 cells were treated

UV irradiation (20 J/m2) and allowed to recover for 2 h before cytoplasmic and

nuclear RNA fractionation. cDNA was synthesized using oligo(dT) primers. RNA

extracted was treated with DNase. qRT-PCR for each CDKN1A isoforms was

performed using primers as depicted in Figures 9A and 11B. U2 snRNA and

GAPDH mRNA (Integrated DNA Technologies) were used as fractionation

control with primers directed towards separate coding exons for forward and

reverse primer to control for possible DNA amplification. Data is presented as the

abundance of RNA detected in the nucleus relative to that detected in the

cytoplasm.

As shown in Figure 24, U2 snRNA was predominantly (~90%) nuclear. As previously mentioned, GAPDH was mostly cytoplasmic but seemed to undergo a nuclear retention following UV treatment. Interestingly, CDKN1A full-length mRNA (p21 mRNA in the figure) showed a similar behavior after UV treatment. This may be due in part to the upstream kinase

ATM’s phosphorylation of an RNA export component, reducing its ability to bind mRNA in the nucleus (Ramachandran et al. 2011). In terms of APA isoforms, I observed that the unspliced

transcript was even more predominantly nuclear than mature U2 snRNA, as <0.01% detected was cytoplasmic. In contrast, the spliced isoform was predominantly cytoplasmic (~ 66%) with only a small fraction nuclear (~ 33%), and this ratio did not change under stress conditions, despite its UV-mediated induction. Thus, CDKN1A intronic APA spliced isoform localizes to the cytoplasm, as the transcript is stable, processed and transported it is unlikely to be a product of aberrant transcriptional output.

My results on the spliced CDKN1A isoform indicated that transcripts carrying the alternative exon present in the annotated intron 1 region are polyadenylated, suggesting that the spliced isoform could be a polyadenylated RNA. However, one possibility is that the qRT-PCR product analyzed might be from an alternative splicing event to exon 2 of the canonical full- length CDKN1A mRNA, and thus merely an extension of the 5’UTR (as the coding region of

CDKN1A begins in exon 2). To address this point, I performed a) 3’RACE on the cytoplasmic and nuclear fractions to determine whether the qPCR data shown in Figure 21 mirror the pattern of 3’RACE bands (Figure 25), b) qRT-PCR using a forward primer in the APA exon coupled with a reverse primer in exon 2,and c) analysis of the sequence within and downstream of the alternative exon generated from splicing/APA of CDKN1A gene for any conserved 5’ splice sites

(Figure 26).

As shown in Figure 25, the 3’RACE mirrored the qPCR data (Figure 24), suggesting that the spliced APA isoform is predominantly cytoplasmic. Performing qPCR with a forward primer in the APA exon coupled with a reverse primer in exon 2 produced no amplicon (not shown), indicating that a splicing event between the APA exon and exon 2 did not occur. Searching for potential splicing donor site in the APA exon and region downstream using the Human Splicing

Finder software did not find any predicted donor sites (Figure 26; Yeo and Burge 2004).

Together, these studies indicate that the spliced CDKN1A APA transcript is poly(A)+ RNA enriched in the cytoplasm, and unlikely to be part of the canonical full-length mRNA.

As the spliced CDKN1A APA lncRNA is a stable transcript that localize in the cytoplasm (Figures 24, I wonder whether this transcript possess any cellular function. As it is

Figure 25: Nested PCR of 3’RACE to detect CDKN1A spliced APA intronic

isoform. Cytoplasmic and nuclear RNA from HCT116 cells underwent cDNA

synthesis with an adaptor attached to oligo(dT). Amplification was done by 2

rounds of PCR using the adaptor as reverse primer and two different forward

primers within exon 1. Any amplification product could not be priming the poly(A)

of the canonical mRNA as the distance from exon 1 to the canonical poly(A)

would be too large (>2 kbp) for 3’RACE protocol. Thus, only amplification

products at a lower size would represent a poly(A) tail in proximity to exon 1. The

products were separated on an agarose gel and detected by ethidium bromide

staining. A representative gel from three independent assays is shown. Molecular

weight standard (MWS) is also included.

Figure 26: Analysis of potential donor site strengths within exon 1 and alternative exon in intron 1 of CDKN1A gene. Sequences were analyzed with the Human

Splicing Finder software and given a MaxEnt score (y-axis). The software simultaneously analyses adjacent and non-adjacent sequences for the highest probability for donor and acceptor sites for splicing (Yeo and Burge 2004). A

MaxEnt score above 3 indicates a potential splice site, indicated by the black line. A) Analysis of the CDKN1A exon 1 sequence, where the known donor site is indicated as . B) Analysis of the alternative exon in intron 1 sequence encompasses the 3’ end of APA exon as well as the intronic sequences ~400 bp downstream.

mainly localized in the cytoplasm I foresee a potential effect on the expression levels of some target proteins affecting a cellular pathway. As the spliced CDKN1A APA transcript was expressed in positive correlation with CDKN1A full-length mRNA (Figure 18), I hypothesized that CDKN1A intronic APA may affect the levels of p21 protein expression. This idea is supported by previous studies that showed a role for lncRNA with antagonistic function to the coded protein from the same gene (Williamson et al. 2017). To test this hypothesis, I overexpressed the spliced CDKN1A intronic transcript in HCT116 cells using the same FLAG- tagged plasmid as in Figure 13. I used the empty FLAG-tag expression vector as negative control. Consistent with previous work (Gottifredi et al. 2001), my results indicate that UV treatment did not induce full-length CDKN1A mRNA levels (Figure 27). The overexpression of the spliced APA transcript did also not significantly affect full-length CDKN1A mRNA abundance. As previously described (Bendjennat et al. 2003; Nishitani et al. 2008), UV irradiation (20 J/m2) caused a downregulation of p21 protein levels 2 h after the treatment. While overexpression of spliced CDKN1A intronic APA did not affect p21 protein levels in non- stressed cells, high levels of spliced APA transcript rescued the UV-induced decrease of p21 protein levels (at 2 h recovery after UV treatment). These results suggest that overexpression of spliced CDKN1A APA transcript may be affecting one of the two mechanism involved in controlling protein abundance, translation or degradation.

It has been previously described that another CDKN1A-associated lncRNA has sequence complementarity to certain mRNAs regulating their translation (Yoon et al. 2012).

However, using BLASTn (NCBI) software, I could not find complementary of the CDKN1A APA lncRNA to the full-length CDKN1A mRNA, nor to any other mRNA (not shown). I use as a positive control the number of binding sites previously described (Yoon et al. 2012). If the spliced CDKN1A APA transcript cannot bind to the full-length CDKN1A mRNA or have an effect on the full-length CDKN1A mRNA levels, it is possible that the transcript is involved in preventing the p21 protein degradation process, which has been described to occur at

overlapping time points with UV-induced APA upregulation (Bendjennat et al. 2003). The long half-life of the spliced isoform

Figure 27: Overexpression of spliced CDKN1A APA transcript rescued the UV-

induced decrease of p21 protein levels with no effect on full-length CDKN1A

mRNA levels. A) HCT116 cells were transfected with CMV-driven expression

plasmid (10 μg) with N-terminal FLAG tags containing no transcript or spliced

APA transcripts. Total RNA samples were analyzed by qRT-PCR using the

strategy described in Figure 11B. Errors represent the SD derived from three

independent experiments. B) Total protein was extracted from cells transfected

as in A) and immunoassayed with anti-FLAG antibodies. Tubulin was used as

loading control. A representative gel from three independent samples is shown.

Figure 28: Overexpression of spliced CDKN1A APA transcript increases p21

protein levels after UV treatment but does not prevent p21 degradation. A)

Pattern of p21 levels reduction following CHX treatment (2 μg/ml). Cytoplasmic

proteins were extracted from cells transfected with either control or spliced

plasmid for 24 h as in Figure 27 and immunoassayed with anti-p21 antibodies.

Tubulin was used as loading control. A representative gel from three independent

samples is shown. B) HCT116 cells transfected as in A) were exposed to UV

treatment (20 J/m2) and simultaneously with CHX (2 μg/ml). p53 was used as

marker for UV damage. Samples were analyzed as in A).

(Figure 23) would also allow CDKN1A intron APA transcript to be expressed during p21 protein recovery time.

Supporting this idea, it has also been shown that lncRNAs can be directly implicated in ubiquitin ligase-mediated protein degradation (Yoon et al. 2013). To determine whether spliced

CDKN1A APA transcript plays a role in p21 degradation I treated HCT116 cells with cycloheximide (CHX), which inhibits translation through both prevention of polysome aggregation as well as chain elongation (Baliga et al. 1969), and analyzed the samples for p21

expression by Western blot analysis. The rationale was that if protein synthesis was inhibited in conditions of increased p21degradation and APA induction (UV treatment), I would be able to measure the effect of APA on the steady-state levels of p21. Interestingly, samples from cells overexpressing spliced APA transcript showed higher p21 levels than samples from control

(Figure 28). Overexpression of the spliced CDKN1A APA transcript was not able to prevent p21 degradation. It is important to highlight that p21 levels in samples from cells overexpressing

APA transcript and undergoing CHX/UV treatment are much lower than in samples from cells undergoing only UV treatment (compare lane 9 to 7). The difference in p21 levels was not observed between CHX/UV and UV treated samples in the control background, suggesting APA induction may affect a process CHX is affecting.

To further understand the effect of spliced CDKN1A APA transcript on p21 levels, I decided to perform cellular assays where p21 is known to be involved, such as cell-cycle arrest

(Xiong et al. 1991; Harper et al. 1993) and senescence (Herbig et al. 2004). To test the role of the APA transcript in cell-cycle arrest I performed flow cytometry on cells transfected with spliced CDKN1A APA transcript for 24 h and treated with UV irradiation. Cellular DNA content was detected via propidium iodide after fixing the cells in 100% ethanol. Surprisingly, I did not see any change in any particular cell cycle stage in the different cells and conditions analyzed

(Figure 29A). I was also not able to detect an addition or reduction of cells in sub-G1, indicating apoptotic or necrotic cells. This is in contrast with protein expression analysis by Western blot that showed that overexpression of spliced CDKN1A APA transcript affects the levels of known markers for apoptosis, such as p21 (Figures 27-28) but also cleaved PARP (Figure 29B).

Overexpression of APA transcript decreased the levels of cleaved PARP after UV treatment

(Boulares et al. 1999; Chaitanya et al. 2010). Thus, the effect of overexpression of this particular transcript appeared to be limited to early time points after UV, and was perhaps insufficient to drive a significant cell-cycle arrest.

Figure 29: Discrepancy between detection of apoptosis markers and FACs analysis is observed in samples form cells overexpressing spliced CDKN1A APA transcript.

A) Bar graph obtained from cell-cycle analysis of HCT116 cells transfected with

FLAG-tagged plasmids of spliced/unspliced CDKN1A intronic transcript (described in

Figure 13). I used the empty FLAG-tag expression vector as negative control. Flow cytometry indicating that overexpression does not produce a difference in the proportion of sub-G1 cells 24 h after UV treatment (20 J/m2). Percentage of cells in different phases of cell cycle (G1, S, G2m [G2 and mitosis], and apoptosis) are shown. B) Western blotting for cleaved PARP, a known biomarker for apoptosis

(Boulares et al. 1999), measured in cytoplasmic protein samples from cells transfected with spliced CDKN1A intronic transcript as described in A) and treated with UV irradiation (20 J/m2). Protein samples were purified 6 h after the UV treatment. Samples were immunoassayed with anti-PARP antibodies. Tubulin was

used as loading control. A representative gel from three independent samples is

shown.

As p21 has been shown to be involved in the induction of senescence (Han et al 2002;

Shtutman et al. 2017) I decided to perform senescence assays in cells overexpressing either unspliced or spliced CDKN1A APA transcript and treated with etoposide to induce senescence in growing cells (Litwiniec et al. 2013; Nagano et al. 2016). In Figure 17, my data indicate that etoposide treatment strongly increases the levels of all the CDKN1A transcripts (unspliced, spliced and full-length) reaching levels much higher than the observed with UV treatment.

I also used CHX in combination with etoposide to observe if a) CDKN1A spliced intronic transcript affected p21 expression during a strong upregulation of p21 protein, and b) whether the inhibition of translation affected any modification of protein levels observed by APA expression. The data is available in Figure 30. Surprisingly, overexpression of spliced APA transcript did not appear to have an additive effect of p21 protein induction as had been observed with UV treatment. Most likely because the effect was negated, As CHX treatment did not present any difference between the control and the APA overexpression samples, it is possible that the effect of the spliced APA transcript was negated

I also used a kit based on the detection of senescence-associated β-galactosidase expressing lysosomes in cells (Debacq-Chainiaux et al. 2009). Cells were fixed to prevent cellular decomposition and allow visualization of β-galactosidase expression as described in

Chapter VII. Etoposide treatment of non-transfected cells or transfected with empty vector

(Figure 31A) induced a number of blue stained cells (Figure 31A). Quantification is shown in

Figure 31B. However, overexpressing of spliced/unspliced CDKN1A APA transcripts alone or in combination with etoposide did not have any significant effect on senescence-mediated pathway. Together, all these negative results led me to look for a simpler and more effective way of studying the potential functions of CDKN1A APA transcripts.

Figure 30: Etoposide treatment masks the increase in p21 levels observed with overexpression of spliced CDKN1A APA transcript (Figures 27 and 28). HCT116 cells were treated with etoposide (20 µM as in Figure 17) or CHX (2 μg/ml as in

Figure 28) as indicated before protein extraction and Western blotting. Total protein was extracted from cells transfected with either control or spliced plasmid for 24 h and treated with etoposide for 16 h during transfection time and CHX for the times indicated in the figure. Samples ran on SDS-PAGE were immunoassayed with anti-p21 antibodies. GAPDH was used as loading control.

A representative gel from three independent samples is shown.

100

Figure 31: CDKN1A APA isoforms overexpression does not enhance or suppress etoposide-mediated senescence. A) HCT116 cells were transfected with CMV-driven expression plasmid containing no transcript (FLAG) or spliced/unspliced APA transcripts and treated with etoposide (20 µM) for 48 h.

Detection of senescence associated β-galactosidase activity was done using X- gal (Sigma-Aldrich). Cells were observed via phase-contrast microscopy.

Representative images from three independent assays are shown B) Bar graph represents quantification of percentage of cells counted with positive stain for β- galactosidase activity. Errors represent the SD derived from three independent experiments.

101

The new strategy involved the specific siRNA-mediated knockdown of CDKN1A APA isoforms. Here, I input the full CDKN1A APA sequence into a program designed by Dharmacon, which suggested possible siRNA sequences that would be specific, have affinity for APA transcript, and be thermodynamically viable for use as a complementary oligonucleotide. It was also of interest to have an siRNA that would target both the spliced and unspliced isoforms to determine the cellular effect of total APA knockdown. Figure 32A displays the schematic of the targeting sequence of the siRNA against APA transcripts (siAPA). To identify the function of lncRNAs, most of the times, knockdown/knockout experiments are preferred over overexpression assays (Yoon et al. 2012; Dimitrova et al. 2014; Williamson et al. 2017).

However, in the case of CDKN1A APA transcript it poses a risk as the the APA sequence is technically part of the full-length CDKN1A pre-mRNA. While the mechanism for siRNA has been characterized mostly in the cytoplasm due to the localization of the miRISC complex (Carthew and Sontheimer 2009), more recent work has identified functional roles for miRNA machinery in the nucleus (Zhang et al. 2015). In addition, mechanistic studies on siRNA have found it to work within the nucleus (Castel and Martienssen 2013; Gagnon et al. 2014), and even to work on pre-mRNA (Bosher et al. 1999). Therefore, to avoid false positive results I tested concentrations and time points at which CDKN1A APA was significantly affected but not the full-length

CDKN1A mRNA. Figures 32B-C shows the depletion effect of 24 h treatment with siAPA (750 pmols) to a 10 cm plate containing approximately 5 x 106 HCT116 cells. Approximately 50% of

CDKN1A APA transcripts were reduced with not a significant effect on the full-length mRNA, which was expected as the oligonucleotide targeted the APA exon and thus would target both unspliced and spliced isoforms but not full-length. Interestingly, a small (5-10%) but not significant decrease in CDKN1A full-length mRNA abundance was observed. The negative control GAPDH was not affected by siAPA. Importantly, while siAPA treatment under non-stress conditions decreased the levels of CDKN1A APA transcripts, these changes in APA transcripts did not affect the basal levels of CDKN1A full-length mRNA. This is consistent with result

102

observed with the overexpression CDKN1A APA transcripts (Figure 27A). Together, these experiments indicate that siRNA-mediated depletion of CDKN1A APA isoforms can be achieved without significantly affecting full-length mRNA levels.

Figure 32: siRNA-mediated knockdown of CDKN1A intronic APA isoforms can

be achieved without significantly affecting CDKN1A full-length mRNA levels. A)

Schematic of the target location of siAPA relative in the CDKN1A gene. The

black line represents the location of siRNA, the representation is not to scale. B-

C) Effect of siAPA treatment for 24 h on levels of CDKN1A intronic APA isoforms

and full-length mRNA. RT-PCR (B) and qRT-PCR (C) results are shown. The

products were separated on an agarose gel and detected by ethidium bromide

staining. A representative gel from three independent assays is shown. Total

RNA samples were analyzed by qRT-PCR using the strategy described in Figure

11B. Errors represent the SD derived from three independent experiments.

103

Then I tested whether siRNA-mediated knockdown of CDKN1A intronic APA isoforms had an effect on p21 protein levels (Figure 33). Intriguingly, the levels of p21 protein were drastically reduced, particularly in the cytoplasmic fraction. While the nuclear fraction appeared to undergo an approximately 50% decrease in p21 protein, the cytoplasmic fraction decrease was around 90%. Then I decided to test whether the decrease in p21 expression by CDKN1A intronic APA depletion plays a role in cell proliferation. p21 is a strong inhibitor of cellular proliferation and promotor of differentiation and cellular senescence (Abbas and Dutta 2009).

After HCT116 cells were treated with control or APA siRNA, I performed a cell count every 24 h to determine the fold change in proliferation. siAPA-mediated knockdown of CDKN1A APA isoforms led not only to a decrease in p21 levels (Figure 33) but also to an increase in the cell count compared to siCtrl treated cells (Figure 34), indicating a loss in cell-cycle arrest capabilities. Finally, to confirm that this effect was p21 specific, I performed the same cell counting assay on HCT116 p21-/- cells following their antibiotic selection (data shown in Figure

23). No difference in cell count was detected in p21 -/- cells transfected with either siCTLR or siAPA, suggesting siAPA effect on proliferation is p21 dependent.

Discussion

Most aberrant short and non-polyadenylated RNAs from improper transcription termination are degraded in the nucleus by the exosome (Vanacova and Stefl 2007). Under certain conditions mRNAs and polyadenylated RNAs can be degraded in the cytoplasm by the exosome (Raijmakers et al. 2004). While the mere detection of a spliced CDKN1A APA isoform primarily in the cytoplasm (Figure 24) does not conclude function it suggests that there might be one. The lack of an apparent 5’ss anywhere close to the APA exon (Figure 26) combined with the 3’RACE mirroring the qPCR data for the spliced CDKN1A APA isoform (Figure 25), and low

104

abundance of spliced APA isoform suggest that the alternative splicing event occurs exclusively on the APA transcript and not on the full-length mRNA. If an alternative splicing event occurred

Figure 33: Knockdown of CDKN1A APA isoforms decreases the level of p21

protein. HCT116 cells were transfected with either control (siCTRL) or APA

siRNA (siAPA) as in Figure 32. Either nuclear (50 ug) or cytoplasmic (15 ug)

protein were analyzed for p21 expression using anti-p21 antibodies. GAPDH

was used as loading control in Western blot analysis. A representative Western

blot from three independent assays is shown.

105

Figure 34: Knockdown of APA increases proliferation rate in p21-dependent

manner. A) siAPA treatment of increase HCT116 cells count at a greater fold

change rate than siCTRL treatment. siAPA/siCtrl ratio of the total cell number

counted on hemocytometer for each transfection time is presented. B) After

antibiotic selection (Figure 23), p21-/- cells were transfected for 48 h as

described in (A). Cell number of siAPA treated cells are presented relative to the

number of siCtrl treated cells.

on the CDKN1A full-length transcript, one could expect the expression of an alternative or truncated protein C-terminus (Lee and Tarn 2014). However, in this event, as in many others that result from intronic APA events, there is no known protein-coding domain in the CDKN1A

APA isoforms.

The observation that the spliced CDKN1A APA isoform but not the unspliced isoform localizes in the cytoplasm is not totally surprising. Splicing is often a necessary pre-requisite for active RNA export from the nucleus (Luo and Reed 1999). The question is whether the unspliced merely serves as a precursor for the spliced isoform. This seems unlikely based on the stability of the unspliced form (~3 h half-life, Figure 22), as one would expect a transcript

106

whose function is only to be spliced to have very low half-life. However, it is possible that a pool of unspliced exists ready to be spliced post-transcriptionally. In the context of stability, surprisingly, the half-life of the spliced CDKN1A APA isoform is very high (>10 h; Figure 22) comparable to house-keeping gene GAPDH, suggesting a cellular role for this isoform.

While the overexpression data is interesting by itself, it seems to better serve as confirmation of some of the knockdown data, as the design of the expression vectors may be flawed. When the CMV-driven expression vectors with either spliced or unspliced APA transcripts (Figure 13) were designed for translation assays, the cloned sequence began at an

ATG found in exon 1 of CDKN1A full-length mRNA. The ATG in CDKN1A exon1 is not known to code for protein but instead to suppress translation of p21 protein (Kim et al. 2012; Collier et al.

2018). My data indicate that the presence of this upstream ATG on a separate RNA, such as the APA isoforms, does not seem to reduce p21 protein levels (Figure 33). As the cloned sequence begins a the exon 1 ATG, it misses ~30 nt upstream of the ATG not included in the expression vector for the APA isoforms. If the spliced APA transcript indeed acts as a lncRNA, its function may be stunted if the first 30 nt of the sequence are missing. This may explain the negative results observed for cell-cycle, apoptosis and senescence. Therefore, manipulating the endogenous levels of APA transcript appears to produce more consistent results. However, I cannot disregard another explanation for these negative results. As discussed in the results section, it is also possible that overexpression of an abundant lncRNA does not induce a noticeable change in the cellular function.

The biggest concern for the knockdown experiment is a “off-target” effect. It is important to determine that changes full-length CDKN1A mRNA abundance are due to the effect of the lncRNA and not due to siAPA treatment. The role of CDKN1A APA isoform not as a regulator of the full-length mRNA abundance is support by not only siRNA depletion assays (Figure 32) but also by the overexpression one (Figure 27) and the proportional changes of the isoforms (Figure

32-33). My results indicate that while the expression of the APA isoforms has not a significant

107

effect on the full-length mRNA, it reduced p21 expression levels to <50% of its original pool.

Together, these studies indicate that CDKN1A APA transcripts are regulating levels of the protein from which it is endogenously made. Having an intragenic transcript capable of regulating protein levels is an ingenious way for the cell to have another layer of control of factors involved in highly regulated pathways. What is also interesting is that APA isoforms role in proliferation depends on the expression of p21, as observed in an isogenic cell line deficient in p21 (Figure 34). Thus, CDKN1A APA transcripts appear to have roles beyond transcription competition with the full-length transcript. My data suggest the potential for a feedback loop, involving p21 protein keeping APA transcripts levels low, while APA maintains p21 protein levels. Future experiments could investigate this potential by knocking down p21 protein levels in non-stress conditions to see if APA levels increase.

108

CHAPTER VII: FUTURE DIRECTIONS

109

Future Directions

CDKN1A gene and p21 regulation has long been studied. The tumor suppressor p21 is a key CDK inhibitor that negatively regulates cell-cycle progression to prevent aberrant transmission of damaged DNA to daughter cells. Because of the potent effect of p21 presence or absence in the cell, the expression of CDKN1A under normal conditions and during DDR is tightly regulated.

The findings presented in this dissertation show novel features of CDKN1A gene. First, that CDKN1A undergoes intronic APA during DDR, which is regulated by U1 snRNP (Chapter

III) as a result of endogenous reduction of U1 snRNA levels. Second, that CDKN1A intronic

APA undergoes additional alternative splicing and is a putative lncRNA (Chapter IV).

Furthermore, as part of this dissertation, I described that CDKN1A intronic APA is expressed in a variety of cell lines and conditions, both cancer and normal cells. CDKN1A intronic APA is additionally regulated by the RBP HuR (Chapter V). Extending those studies, I also described that depending on whether CDKN1A intronic APA transcript is spliced or not affects its cellular localization. Importantly, that intronic APA regulates p21 protein and thus cell proliferation without affecting CDKN1A full-length mRNA (Chapter VI).

Now, it is important to further elucidate the complete mechanism behind APA-mediated regulation of p21 protein levels and how APA is regulated outside of global U1 snRNA effect.

Based on my results, I proposed the following model (Figure 35). Under non-stress conditions, basal levels of both CDKN1A full-length mRNA and intron APA transcript are detected. Under stress conditions induced by UV or HU treatments, CDKN1A intron APA levels are induced, which is then spliced and exported from the nucleus to the cytoplasm, where it appears to possess a role in regulating p21 protein levels. The expression of CDKN1A intron APA probably plays a role in the degradation/delay in p21 protein induction observed by following UV or HU treatments (Gottifredi et al. 2001; Bendjennat et al. 2003; Gottifredi et al. 2004).

110

Now, it is important to further elucidate the complete mechanism behind APA-mediated regulation of p21 protein levels and how APA is regulated outside of global U1 snRNA effect.

The following proposed studies might help to understand some aspects of the working model:

Figure 35: Model for CDKN1A intronic APA induction and function. Under non-

stress conditions, a default expression of CDKN1A full-length mRNA and protein

occurs. APA is induced weakly, but is necessary for basal p21 protein

expression. Under stress conditions, both CDKN1A full-length mRNA and APA

are induced strongly, where the APA transcript aids in the upregulation of p21

protein levels during DDR.

111

Ribosome profiling of CDKN1A intronic APA

The results presented in this dissertation indicate that CDKN1A intronic APA is a lncRNA, similar to others examples of APA-derived lncRNAs induced after DNA damage

(Williamson et al. 2017). It has been shown that many lncRNAs that localize to the cytoplasm are associated with ribosomes (Carlevaro-Fita et al. 2016). However, association with the ribosome is not sufficient to indicate that translation of RNA is taking place (Guttman et al.

2013). The results presented here lay the groundwork for further studies on how APA events can produce transcripts that are vastly different from the canonical RNAs, and the potential for these transcripts to be non-coding. My results show that the open reading frame present in

CDKN1A intron APA is not sufficient to produce protein endogenously (Figure 13).

Understanding the ribosome profile of CDKN1A intron APA has the potential to provide information on the binding to ORFs relative to untranslated regions (UTRs), and thus the coding potential of a transcript. If CDKN1A indeed associates with ribosomes, one can infer that it codes for protein if the binding occurs in regions encompassed by ORF. Besides, if association is determined but that it is not enriched in ORF regions, it suggests that intron APA may be involved in regulating ribosome-associated processes, such as translation.

Evidence of expression differences of CDKN1A APA isoforms in normal and tumor tissues from cancer patient

Some expressed lncRNAs have been shown to have oncogenic or tumor suppressor functions. For example, the lncRNA HOTAIR is highly expressed in a number of different cancers, with a positive tumorigenic role (Hajjari and Salavaty 2015). While differences in expression do not directly implicate an RNA as having a role in the transformation process, some RNAs can also act as biomarkers for a developing cancer (Das et al. 2016).

My data presented in this thesis indicate that CDKN1A intron APA isoform expression has been detected in a small number of tissue types, both cancer and normal from RNA-seq

112

datasets (Figure 16). APA events occurring in a few established cell lines have also been detected by quantitative PCR (Figure 17). Understanding the expression and inducibility of

CDKN1A intron APA in patient’s tissues, contrasting cancer and normal tissue, will indicate as whether expression of APA is correlated with an oncogenic or tumor suppressive potential. This aim is particularly supported by my results that indicate that CDKN1A intronic APA events positively correlate with as p21 expression, which has been shown to act as both oncogene and tumor suppressor in different contexts (Abbas and Dutta 2009). In addition, testing whether

CDKN1A intron APA expression also correlates with p21 expression in patient samples will help to support the data I have obtained in this dissertation.

Determination of additional RBP partners of CDKN1A intron APA transcripts

My studies have shown that CDKN1A intron APA RNA binds directly to RBP HuR under both non-stress and stress conditions, and transcript stability is regulated by presence of HuR.

Because of these findings, it is likely that HuR plays a direct role in regulating CDKN1A intron

APA transcript stability, and not in the regulation of its potential function in controlling p21 protein levels. Therefore, it is pertinent to identify additional binding partners of intron APA transcript that may influence intron CDKN1A intron APA RNA function.

On the other hand, studies have shown that lncRNAs expressed during DDR are capable of binding to transcription factors, such as p53, affecting transcriptional output and thus cellular response (Puvvula et al. 2014; Schmitt et al. 2016). Independent of transcription, lncRNAs have been shown to bind and regulate ubiquitin-proteasome pathway by associating with E3 ligases (Yoon et al. 2013). Therefore, it is possible that protein-binding partners that are not canonically known to regulate RNA pathways may associate with the CDKN1A intron APA transcript, resulting in the mutual regulation of their functions.

To find protein binding partners of the CDKN1A intron APA transcript I propose to perform RNA pull-down assays using a biotinylated APA RNA isoforms and protein extracts as

113

detailed in this report when studying HuR (Figure 20). An antisense APA transcript would serve as ideal negative control transcript. Following incubation with protein extracts, the resultant eluates from streptavidin-mediated enrichment of RNA-protein complexes will be run on SDS-

PAGE followed by silver staining to identify proteins pulled-down. Differences in band intensity between the sense and antisense transcripts would allow the identification of specific protein binding partners of CDKN1A APA transcript. Proteins will be identified by either mass- spectrometry of excised bands or estimated via investigative Western blotting based on molecular weight.

Further characterization of the regulation of p21 protein expression by CDKN1A intron

APA transcript and downstream effects

p21 is regulated by a complex network of pathways dependent on the genetic background and cellular conditions. For example, p21 transient degradation (Bendjennat et al.

2003) and p21 transcriptional output (Mattia et al. 2007) are regulated under certain stress conditions and intensities but not others. Because of such curious phenomena, much research has gone into understanding p21/CDKN1A regulation.

APA offers a new paradigm in p21 regulation, as CDKN1A intron APA transcript expression appears to be necessary for sustained p21 expression in basal conditions, resulting in changes in cell growth. To confirm that this effect is not an indirect role of siRNA knockdown,

I propose to create an isogenic knockout cell line that will offer a clear view of CDKN1A intron

APA role in p21 protein abundance. This could be achieved by either deletion of intronic poly(A) signal or a base change that inactivate it. This cell line will not harbor CDKN1A intron APA but will possess high conservation for p21 protein. Studying APA in this manner could also address the question as to whether transcription of the CDKN1A intron APA transcript or its CpA are involved in the regulation of the CpA of the canonical CDKN1A mRNA.

114

Finally, an additional possibility with research potential is to generate knock-in mice, whereby an intronic poly(A) signal can be incorporated in a region that did not previously harbor intronic APA (Figure 14A – mouse sequence is similar to Pika), such that CDKN1A intronic APA transcript could be endogenously expressed. This model will help us to further understand the role of intron APA in p21 protein regulation and, hence, in cell growth.

115

CHAPTER VIII: EXPERIMENTAL PROCEDURES

116

Experimental procedures

Cell lines, plasmids, and treatments

HCT116, HCT116 p21-/-, HCT116 p53 -/-, RKO, RKO-E6, BJ, and MCF7 cells were grown in

Dulbecco’s Modified Eagle Medium (DMEM) without sodium pyruvate and supplemented with

5% fetal bovine serum (FBS) and 1% penicillin/streptomycin antibiotic and harvested at ~90% confluency after treatments. Mammalian expression vectors were prepared with cDNA of APA isoforms were cloned into p3xFLAG-CMV10 between EcoRI and BamHI sites. For RNA pulldown and in vitro translation reactions, cDNA of APA transcripts were cloned into pET-

42a(+) between Nde1 and Xho1 sites. For UV treatment, 90% confluent cultures were exposed to UV and harvested at different times. UV doses (20 Jm-2) were delivered in two pulses using a

Stratalinker 1800 (Stratagene). Medium was removed prior to pulsing and cells were washed with PBS. Media was replaced immediately after treatment. 1.7 mM hydroxyurea (HU) (Sigma-

Aldrich) or 10 µM etoposide (MilliporeSigma) were added directly to media 24 h before harvesting, except in caffeine experiments where samples were pretreated with 4 mM caffeine for 1 h (Beckerman et al. 2009; Chen et al. 2011).

Plasmid mutagenesis

To create a mammalian cell expression vector expressing only the unspliced APA isoform, the full-length APA isoform cloned in p3xFLAG-CMV10 plasmid was subjected to a deletion mutagenesis of the alternative 3’ splice site present in the sequence in order to express only the unspliced APA transcript. APA sequence 3’ splice site was deleted using Q5 Site-Directed

Mutagenesis Kit (New England Biolabs) as per the manufacturer’s instructions. Deletion mutation was achieved using 10 ng of template plasmid and 0.5 µM of forward primer (5’-

TCCCCACC CCAAAATGACGCGCAGCC-3’) and reverse primer (5’-

GGGGGAGAATGGGAGGGG-3’).

117

RNA extraction and qRT-PCR assays

Total RNA was purified from approximately 1 x 10⁶ cells using RNeasy Mini Kit (Qiagen). cDNA was synthesized from 1 g of RNA using either oligo (dT)₁₅ and GoScript reverse transcriptase

(Promega), or qScript cDNA synthesis kit (Quantabio). qPCR was performed using PowerUP

SYBR (Applied Biosystems) in StepOnePlus (ThermoFisher) machine. Relative RNA levels were calculated using 2-ΔΔCT method (Livak and Schmittgen 2001) and normalized against either

Ubiquitin C (UBC) or β-Actin.

Knockdown expression siRNA specific for human HuR, a custome-made siRNA for CDKN1A intronic APA and a control siRNA were obtained from Dharmacon RNA technologies. For HuR knockdown, 60% confluent cells in 6 well plates were transfected with 5 l of Lipofectamine RNAiMAX according to the manufacturer’s protocol (Invitrogen) and 200 pmols of siRNA for a total of 36 h. Lipofectamine- siRNA complexes were formed in reduced serum Opti-MEM for 5 minutes, during which time cells to be transfected were washed with warm PBS. Wells to be transfected were incubated with complete DMEM and Opti-MEM at a 60/40 ratio. To determine the effectiveness and specificity of HuR siRNA used, protein levels were monitored by Western blot. To knockdown

APA, cells were transfected as for HuR except that 150 pmols of siRNA was used and 3 l of

RNAiMAX for a total of 24 h. Effectiveness and specificity of siAPA was analyzed by qRT-PCR.

RNA stability assay

During transfection of siRNAs, cells at 90% confluency were first treated with UV (20 J/m2) as described earlier. After 2 h of recovery time, cells were then treated with 2 µg/ml actinomycin D into the existing media for the time points indicated (Yoon et al. 2012). After RNA extraction,

118

cDNA synthesis and qRT-PCR, analysis was performed by measuring the % remaining RNA after x number of hours of actinomycin D treatment relative to the amount of RNA detected after

2 h UV treatment.

Cytoplasmic and nuclear RNA extraction

RNA from nuclear and cytoplasmic compartments was extracted essentially as described

(Hwang et al. 2007), with some modification. Instead of subjecting the nuclear pellet and cytoplasmic supernatant to Trizol reagent, separated samples were put through RNA extraction kit (Qiagen)

Protein extraction, Western blot analysis and antibodies

After treatments, samples were washed in PBS, scraped, and centrifuged at 4,000 rpm for 10 minutes. Cell pellets were incubated in Buffer A (10 mM Tris pH 7.9, 1.5 mM MgCl₂, 10 mM KCl,

0.5 mM DTT, 0.5 mM PMSF and 100 x Protease Inhibitor Cocktail (PIC; Sigma) for 10 minutes, prior to douncing 20 times. After centrifugation, cytoplasmic supernatant was extracted.

Remaining pellet was treated with Buffer C (20 mM Tris, 25% glycerol, 1.5 mM MgCl₂, 0.45 M

NaCl, 0.5 mM DTT, 0.5 mM PMSF, and 100 x PIC) and rotated at 4°C for 30 minutes. Samples were then centrifuged at 13,000 rpm for 15 minutes, and the supernatant was saved as the nuclear fraction. In most cases, 25 g of protein was analyzed by immunoblotting with mAbs targeted against p21 (N-20; Devany et al. 2016), PARP (9542; Cell Signalling), HuR (3A2;

(Zhang et al. 2015), FLAG (4GFR; GeneTex), GPD1 (Atlas Antibodies; Menon et al. 2017),

GAPDH (G9; Cell Signalling), or Lamin A (H-102; Fonseca et al. 2018).

Purification of recombinant vectors

To clone plasmids, transformation was performed in DH5α competent cells. Transformations were completed as per the9 manufacturers instructions (ThermoFisher). To prepare large 119

quantities of plasmid (>50 g), transformed bacteria were grown to O.D> 2.5 in 100ml. Plasmid was extracted via maxiprep according to manufacturers protocol (Qiagen). Plasmids for mammalian expression utilized the endotoxin removal component of Qiagen kit.

ELISA cell death detection

Cell death was detected with photometric enzyme immunoassay. Known number of cells from 6 well plate wells were diluted in culture medium. Cells were pelleted and sample was treated as per manufacturer’s instructions (Roche). Once the procedure was run, samples were analyzed on PowerWave HT Microplate Spectrophotometer (Biotek) (Devany et al. 2013).

3’ RACE

3’RACE was completed using the 3’ RACE System for Rapid Amplification of cDNA ends

(ThermoFisher) as per the manufacturer’s protocol. 1 g of RNA was reverse-transcribed using oligo(dT)-adaptor primer (5’-GGCCACGCGTCGACTAGTACTTTTTTTTTTTTTTTTT-3’) and

GoScript Reverse Transcriptase (Promega). 1 µl of each cDNA was used for PCR amplification by GoTaq PCR mix (Promega) using CDKN1A Exon 1 specific primer (5’-

ATGCGTGTTCGCGGGTGT-3’) located 400 bp upstream of poly(A) site and adaptor (5’-

GGCCACGCGTCGACTAGTAC 3’). For nested PCR, a second CDKN1A specific forward primer in APA exon was used (5’-AGCCGGAGTGGAAGCAGA-3’) and the same adaptor. PCR products were separated in 1.5% agarose gel and the gels were stained with 0.2 mg/ml ethidium bromide embedded in the gel. Bands were visualized using DyNA Light UV

Transilluminator.

120

Protein translation assays

For FLAG-tagged APA expression, cDNA of APA transcripts were overexpressed and immunoblotted against FLAG. For in vitro translation reactions, we used the Transcend Non-

Radioactive Translation Detection System (Promega) as per the manufacturer’s instructions.

Equivalent amounts of sample were then run on SDS-PAGE and analyzed by chemiluminescence following a reaction of Lysine-biotin bound streptavidin-HRP to the substrate.

RNA immunoprecipitation

Protein A magnetic beads (Pierce) were washed with 1ml PBS containing 0.1% Tween-20 and vortexed vigorously for 10 seconds. Buffer was removed and 600 l of new PBS-T was added as well as 1 g of recombinant HuR protein. Samples were incubated and mixed for 30 minutes at room temperature, followed by 3 x wash in PBS-T using magnetic rack (Millipore). 1 g of total RNA was then added and sample was incubated for 3 h at 4ºC with rotation. Sample was washed 3 x in PBS-T before phenol chloroform extraction and qRT-PCR (Zhang et al. 2015).

RNA pull-down

T7-driven pet42a plasmid containing APA transcript cDNA was used as template for in vitro transcription using RNA Biotin Labelling Mix (Sigma) and T7 polymerase (Promega).

Biotinylated RNA was purified by ethanol precipitation and mixed with 1 mg protein extract overnight at 4°C. RNA-protein mixture was then incubated with 50 μl washed magnetic streptavidin beads (ThermoFisher) for 1 h prior to 5 times wash with Buffer A + 500 mM NaCl, suspending in 2X Laemmli buffer and heating at 95°C before SDS-PAGE and immunoassays.

121

Flow cytometry

HCT116 cells at ~60% confluency at 2 x 6 well plate wells/sample were transfected and/or damaged by UV (20 J/m2) as described earlier. After 24 hours, cells were washed with ice-cold

PBS and scraped using plastic cell scraper. Cells were then pelleted at 750 rcf for 7.5 mins at

4ºC. Cell pellets were resuspended in 1ml of ice-cold PBS and added drop-wise to pre-cooled

100% ethanol with gentle vortexing to fix. Fixed cells were left at -30ºC for 12-24 h before centrifuging to pellet. Pellets were resuspended in 400ul of staining mixture consisting of 0.1%

Triton X-100, 2 mg RNAse A and 20 µg/ml propidium iodide. Cells were then strained using

40µm mesh into polystyrene tubes and incubated at room temperature for 30 minutes. Samples were then stored on ice away from light and analysed on FACSCalibur Flow Cytometer (BD

Biosciences).

Senescence Assay

To detect senescence-associated β-galactosidase activity, the ‘senescence cells histochemical staining kit’ (Sigma Aldrich) was used. HCT116 cells were grown to ~50% confluency prior to etoposide and/or plasmid expression for 48 h. Treated cells at ~90% confluency were fixed and stained as per the manufacturers instructions. Samples were incubated at 37ºC and monitored for approximately 6 hours to obtain maximum signal. Images were taken at 30x magnification with phase-contrast microscope.

122

Primers

Primer Name Sequence (5’ – 3’) U2 snRNA Forward GGCCTTTTGGCTAAGATCAA U2 snRNA Reverse TATTCCATCTCCCTGCTCCA p21 Exon 2 Forward CTGGAGACTCTCAGGGTCGAAA p21 Exon 3 Reverse GATTAGGGCTTCCTCTTGGAGAA HuR Forward CAGAAGAGGCAATTACCAGTTTCAATGG HuR Reverse GCTTCTTCATAGTTTGTCATGGTCAC Actin Exon 3 Forward GCATCCTGACCCTCAAGTACCC Actin Exon 4 Reverse TAGCACAGCTTCTCCTTGATGTCC CDKN1A Exon 1 Forward ATGCGTGTTCGCGGGTGT CDKN1A APA Exon Reverse AGTGATGAGTCAGTTTCCTGCAAG CDKN1A APA Exon Forward AGCCGGAGTGGAAGCAGA CDKN1A Intron 1 Forward GGCGGAGAGCGGGATTACAAGT CDKN1A Intron 1 Reverse AGGTGGTGGACACAGTGGCGTA p53 3’UTR Long Forward AGCCGCATTAACCCTCACTAAA -GGGACATTCTCCACTTCTTGTT p53 3’UTR Long Reverse GGAATAAGCTTAAAAAAAAAAAAA -AAAAATGGGATATAAAAAGGG Ubiquitin C Forward TGGCACAGCTAGTTCCGTCGCA Ubiquitin C Reverse CGAGGGTGATGGTCTTACCAGTC GAPDH Forward ACCACAGTCCATGCCATCAC GAPDH Reverse TCCACCACCCTGTTGCTGTA

E2F1 Exon 1 Forward TGACCTGCTGCTCTTCGCCACA E2F1 Intron 1 Reverse CTGGCTTGAAGTCGCCCAAAG E2F1 Exon 2 Reverse GTCAGTTTCCAGGTCCAGCCT DSCR3 Exon 1 Forward GGACCGCCCTGGACATCAAGAT DSCR3 Intron 1 Reverse TCAAGGGGCCAGATGGGAAGAG DSCR3 Exon 2 Reverse GTTACCCTTCAAGTGCAGAGG NOTCH1 3’UTR Forward AACGTCTCCGACTGGTCCGA NOTCH1 Proximal Reverse TGGCATCCACAGAGCGCACACAGA NOTCH1 Distal Reverse GAAGGTGAGCCAGCTTTGCCT KDELR1 3’UTR Forward GGAAGGCGGCAGAAGATGAAGAG KDELR1 3’UTR Proximal Reverse CAAGACCTGGATCCTCCACTG KDELR1 3’UTR Distal Reverse GATGGGTGTCGGCAGATTTAGTG DUSP6 Forward ACACCAAATCATGGGCTCACTT DUSP6 Proximal Reverse GAGGTGACACTCCCTGAAGAAT DUSP6 Distal Reverse CCTTGCCCTACTATGCCTACAA SNRNPB2 Forward TAATCAGTTCCCTGGCTTCAAGG SNRNPB2 Proximal Reverse CACCAAGGCTAAAGAAACACTGG SNRNPB2 Distal Reverse GATGATAGGGAGATGGGTCAATC

123

CHAPTER IX: REFERENCES

124

References

Abbas, Tarek, and Anindya Dutta. 2009. “p21 in Cancer: Intricate Networks and Multiple Activities.” Nature Reviews. Cancer 9 (6): 400–414. Abdelmohsen, Kotb, Rudolf Pullmann Jr, Ashish Lal, Hyeon Ho Kim, Stefanie Galban, Xiaoling Yang, Justin D. Blethrow, et al. 2007. “Phosphorylation of HuR by Chk2 Regulates SIRT1 Expression.” Molecular Cell 25 (4): 543–57. Abdelmohsen, Kotb, Subramanya Srikantan, Xiaoling Yang, Ashish Lal, Hyeon Ho Kim, Yuki Kuwano, Stefanie Galban, et al. 2009. “Ubiquitin-Mediated Proteolysis of HuR by Heat Shock.” The EMBO Journal 28 (9): 1271–82. Adams, M. D., J. M. Kelley, J. D. Gocayne, M. Dubnick, M. H. Polymeropoulos, H. Xiao, C. R. Merril, A. Wu, B. Olde, and R. F. Moreno. 1991. “Complementary DNA Sequencing: Expressed Sequence Tags and Human Genome Project.” Science 252 (5013): 1651–56. Adamson, Todd E., Damon C. Shutt, and David H. Price. 2005. “Functional Coupling of Cleavage and Polyadenylation with Transcription of mRNA.” The Journal of Biological Chemistry 280 (37): 32262–71. Adelman, Karen, and John T. Lis. 2012. “Promoter-Proximal Pausing of RNA Polymerase II: Emerging Roles in Metazoans.” Nature Reviews. Genetics 13 (10): 720–31. Ahn, Seong Hoon, Minkyu Kim, and Stephen Buratowski. 2004. “Phosphorylation of Serine 2 within the RNA Polymerase II C-Terminal Domain Couples Transcription and 3’ End Processing.” Molecular Cell 13 (1): 67–76. Akaike, Yoko, Kiyoshi Masuda, Yuki Kuwano, Kensei Nishida, Keisuke Kajita, Ken Kurokawa, Yuzuru Satake, Katsutoshi Shoda, Issei Imoto, and Kazuhito Rokutan. 2014. “HuR Regulates Alternative Splicing of the TRA2β Gene in Human Colon Cancer Cells under Oxidative Stress.” Molecular and Cellular Biology 34 (15): 2857–73. Anantharaman, Vivek, Eugene V. Koonin, and L. Aravind. 2002. “Comparative Genomics and Evolution of Proteins Involved in RNA Metabolism.” Nucleic Acids Research 30 (7): 1427–64. Andersen, Pia K., Søren Lykke-Andersen, and Torben Heick Jensen. 2012. “Promoter-Proximal Polyadenylation Sites Reduce Transcription Activity.” Genes & Development 26 (19): 2169–79. Arima, Yoshimi, Masayuki Nitta, Shinji Kuninaka, Dongwei Zhang, Toshiyoshi Fujiwara, Yoichi Taya, Mitsuyoshi Nakao, and Hideyuki Saya. 2005. “Transcriptional Blockade Induces p53-Dependent Apoptosis Associated with Translocation of p53 to Mitochondria.” The Journal of Biological Chemistry 280 (19): 19166–76. Ashe, M. P., A. Furger, and N. J. Proudfoot. 2000. “Stem-Loop 1 of the U1 snRNP Plays a Critical Role in the Suppression of HIV-1 Polyadenylation.” RNA 6 (2): 170–77. Ashurst, J. L., C-K Chen, J. G. R. Gilbert, K. Jekosch, S. Keenan, P. Meidl, S. M. Searle, et al. 2005. “The Vertebrate Genome Annotation (Vega) Database.” Nucleic Acids Research 33 (Database issue): D459–65. Aström, J., A. Aström, and A. Virtanen. 1991. “In Vitro Deadenylation of Mammalian mRNA by a HeLa Cell 3’ Exonuclease.” The EMBO Journal 10 (10): 3067–71. Atwood, Blake L., Jessica L. Woolnough, Gaelle M. Lefevre, Mariana Saint Just Ribeiro, Gary Felsenfeld, and Keith E. Giles. 2016. “Human Argonaute 2 Is Tethered to Ribosomal RNA through MicroRNA Interactions.” The Journal of Biological Chemistry 291 (34): 17919–28. Awan, Hassaan Mehboob, Abdullah Shah, Farooq Rashid, and Ge Shan. 2017. “Primate- Specific Long Non-Coding RNAs and MicroRNAs.” Genomics, Proteomics & Bioinformatics 15 (3): 187–95. Awasthi, Sita, and James C. Alwine. 2003. “Association of Polyadenylation Cleavage Factor I with U1 snRNP.” RNA 9 (11): 1400–1409.

125

Bagnyukova, T. V., D. Restifo, N. Beeharry, L. Gabitova, T. Li, I. G. Serebriiskii, E. A. Golemis, and I. Astsaturov. 2013. “DUSP6 Regulates Drug Sensitivity by Modulating DNA Damage Response.” British Journal of Cancer 109 (4): 1063–71. Baliga, B. S., A. W. Pronczuk, and H. N. Munro. 1969. “Mechanism of Cycloheximide Inhibition of Protein Synthesis in a Cell-Free System Prepared from Rat Liver.” The Journal of Biological Chemistry 244 (16): 4480–89. Beaudoing, E., S. Freier, J. R. Wyatt, J. M. Claverie, and D. Gautheret. 2000. “Patterns of Variant Polyadenylation Signal Usage in Human Genes.” Genome Research 10 (7): 1001–10. Beckerman, Rachel, Aaron J. Donner, Melissa Mattia, Melissa J. Peart, James L. Manley, Joaquin M. Espinosa, and Carol Prives. 2009. “A Role for Chk1 in Blocking Transcriptional Elongation of p21 RNA during the S-Phase Checkpoint.” Genes & Development 23 (11): 1364–77. Bendjennat, Mourad, Jérôme Boulaire, Thomas Jascur, Howard Brickner, Valerie Barbier, Alain Sarasin, Arun Fotedar, and Rati Fotedar. 2003. “UV Irradiation Triggers Ubiquitin- Dependent Degradation of p21(WAF1) to Promote DNA Repair.” Cell 114 (5): 599–610. Bentley, David L. 2014. “Coupling mRNA Processing with Transcription in Time and Space.” Nature Reviews. Genetics 15 (3): 163–75. Berg, Michael G., Larry N. Singh, Ihab Younis, Qiang Liu, Anna Maria Pinto, Daisuke Kaida, Zhenxi Zhang, et al. 2012. “U1 snRNP Determines mRNA Length and Regulates Isoform Expression.” Cell 150 (1): 53–64. Berkovits, Binyamin D., and Christine Mayr. 2015. “Alternative 3’ UTRs Act as Scaffolds to Regulate Membrane Protein Localization.” Nature 522 (7556): 363–67. Bernstein, P., S. W. Peltz, and J. Ross. 1989. “The poly(A)-poly(A)-Binding Protein Complex Is a Major Determinant of mRNA Stability in Vitro.” Molecular and Cellular Biology 9 (2): 659–70. Beyer, A. L., and Y. N. Osheim. 1988. “Splice Site Selection, Rate of Splicing, and Alternative Splicing on Nascent Transcripts.” Genes & Development 2 (6): 754–65. Blasius, Melanie, Sebastian A. Wagner, Chunaram Choudhary, Jiri Bartek, and Stephen P. Jackson. 2014. “A Quantitative 14-3-3 Interaction Screen Connects the Nuclear Exosome Targeting Complex to the DNA Damage Response.” Genes & Development 28 (18): 1977–82. Boelens, W. C., E. J. Jansen, W. J. van Venrooij, R. Stripecke, I. W. Mattaj, and S. I. Gunderson. 1993. “The Human U1 snRNP-Specific U1A Protein Inhibits Polyadenylation of Its Own Pre-mRNA.” Cell 72 (6): 881–92. Bond, Mariano, Marcelo F. Tejedor, Kenneth E. Campbell Jr, Laura Chornogubsky, Nelson Novo, and Francisco Goin. 2015. “Corrigendum: Eocene Primates of South America and the African Origins of New World Monkeys.” Nature 525 (7570): 552. Bosher, J. M., P. Dufourcq, S. Sookhareea, and M. Labouesse. 1999. “RNA Interference Can Target Pre-mRNA: Consequences for Gene Expression in a Caenorhabditis Elegans Operon.” Genetics 153 (3): 1245–56. Boulares, A. Hamid, Alexander G. Yakovlev, Vessela Ivanova, Bogdan A. Stoica, Geping Wang, Sudha Iyer, and Mark Smulson. 1999. “Role of Poly(ADP-Ribose) Polymerase (PARP) Cleavage in Apoptosis: CASPASE 3-RESISTANT PARP MUTANT INCREASES RATES OF APOPTOSIS IN TRANSFECTED CELLS.” The Journal of Biological Chemistry 274 (33): 22932–40. Bradnam, Keith R., and Ian Korf. 2008. “Longer First Introns Are a General Property of Eukaryotic Gene Structure.” PloS One 3 (8): e3093. Brattain, M. G., D. E. Brattain, W. D. Fine, F. M. Khaled, M. E. Marks, P. M. Kimball, L. A. Arcolano, and B. H. Danbury. 1981. “Initiation and Characterization of Cultures of Human Colonic Carcinoma with Different Biological Characteristics Utilizing Feeder

126

Layers of Confluent Fibroblasts.” Oncodevelopmental Biology and Medicine: The Journal of the International Society for Oncodevelopmental Biology and Medicine 2 (5): 355–66. Brockdorff, N., A. Ashworth, G. F. Kay, V. M. McCabe, D. P. Norris, P. J. Cooper, S. Swift, and S. Rastan. 1992. “The Product of the Mouse Xist Gene Is a 15 Kb Inactive X-Specific Transcript Containing No Conserved ORF and Located in the Nucleus.” Cell 71 (3): 515– 26. Brown, C. J., A. Ballabio, J. L. Rupert, R. G. Lafreniere, M. Grompe, R. Tonlorenzi, and H. F. Willard. 1991. “A Gene from the Region of the Human X Inactivation Centre Is Expressed Exclusively from the Inactive X Chromosome.” Nature 349 (6304): 38–44. Burger, K., W. Li, M. Hoque, R. Patel, and B. Tian. 2016. “Subcellular RNA Profiling Links Splicing and Nuclear DICER1 to Alternative Cleavage and Polyadenylation.” Genome / National Research Council Canada = Genome / Conseil National de Recherches Canada. http://genome.cshlp.org/content/26/1/24.short. Burset, M., I. A. Seledtsov, and V. V. Solovyev. 2000. “Analysis of Canonical and Non- Canonical Splice Sites in Mammalian Genomes.” Nucleic Acids Research 28 (21): 4364–75. Carlevaro-Fita, Joana, Anisa Rahim, Roderic Guigó, Leah A. Vardy, and Rory Johnson. 2016. “Cytoplasmic Long Noncoding RNAs Are Frequently Bound to and Degraded at Ribosomes in Human Cells.” RNA 22 (6): 867–82. Carstens, R. P., E. J. Wagner, and M. A. Garcia-Blanco. 2000. “An Intronic Splicing Silencer Causes Skipping of the IIIb Exon of Fibroblast Growth Factor Receptor 2 through Involvement of Polypyrimidine Tract Binding Protein.” Molecular and Cellular Biology 20 (19): 7388–7400. Carthew, Richard W., and Erik J. Sontheimer. 2009. “Origins and Mechanisms of miRNAs and siRNAs.” Cell 136 (4): 642–55. Castelo-Branco, Pedro, Andre Furger, Matthew Wollerton, Christopher Smith, Alexandra Moreira, and Nick Proudfoot. 2004. “Polypyrimidine Tract Binding Protein Modulates Efficiency of Polyadenylation.” Molecular and Cellular Biology 24 (10): 4174–83. Castel, Stephane E., and Robert A. Martienssen. 2013. “RNA Interference in the Nucleus: Roles for Small RNAs in Transcription, Epigenetics and beyond.” Nature Reviews. Genetics 14 (2): 100–112. Cevher, M. A., J. L. Manley, and F. E. Kleiman. 2008. “The 3′ Processing Factor CstF Functions in the DNA Repair Response.” Nucleic Acids. http://nar.oxfordjournals.org/content/36/6/1792.short. Cevher, Murat A., and Frida E. Kleiman. 2010. “Connections between 3’-End Processing and DNA Damage Response.” Wiley Interdisciplinary Reviews. RNA 1 (1): 193–99. Cevher, Murat A., Xiaokan Zhang, Sully Fernandez, Sergey Kim, Jorge Baquero, Per Nilsson, Sean Lee, Anders Virtanen, and Frida E. Kleiman. 2010. “Nuclear Deadenylation/polyadenylation Factors Regulate 3′ Processing in Response to DNA Damage.” The EMBO Journal 29 (10): 1674–87. Chaitanya, Ganta Vijay, Alexander J. Steven, and Phanithi Prakash Babu. 2010. “PARP-1 Cleavage Fragments: Signatures of Cell-Death Proteases in Neurodegeneration.” Cell Communication and Signaling: CCS 8 (December): 31. Cheng, Zhi, Yingchun Shang, Shan Gao, and Tao Zhang. 2017. “Overexpression of U1 snRNA Induces Decrease of U1 Spliceosome Function Associated with Alzheimer’s Disease.” Journal of Neurogenetics 31 (4): 337–43. Cheng, Zhi, Yu Sun, Xiaoran Niu, Yingchun Shang, Zhenfeng Wu, Jinsong Shi, Shan Gao, and Tao Zhang. 2017. “Gene Expression Profiling Reveals U1 snRNA Regulates Cancer Gene Expression.” bioRxiv. https://doi.org/10.1101/099929. Chen, J., P. K. Jackson, M. W. Kirschner, and A. Dutta. 1995. “Separate Domains of p21 Involved in the Inhibition of Cdk Kinase and PCNA.” Nature 374 (6520): 386–88.

127

Chen, Shaoyun, Hairong Liang, Hui Yang, Kairu Zhou, Longmei Xu, Jiaxian Liu, Bei Lai, et al. 2017. “LincRNa-p21: Function and Mechanism in Cancer.” Medical Oncology 34 (5): 98. Chen, Wei, Qi Jia, Yifan Song, Haihui Fu, Gang Wei, and Ting Ni. 2017. “Alternative Polyadenylation: Methods, Findings, and Impacts.” Genomics, Proteomics & Bioinformatics 15 (5): 287–300. Chen, Yupeng, Lirong Zhang, and Katherine A. Jones. 2011. “SKIP Counteracts p53-Mediated Apoptosis via Selective Regulation of p21Cip1 mRNA Splicing.” Genes & Development 25 (7): 701–16. Chester, N., F. Kuo, C. Kozak, C. D. O’Hara, and P. Leder. 1998. “Stage-Specific Apoptosis, Developmental Delay, and Embryonic Lethality in Mice Homozygous for a Targeted Disruption in the Murine Bloom’s Syndrome Gene.” Genes & Development 12 (21): 3382–93. Clark, Michael B., Paulo P. Amaral, Felix J. Schlesinger, Marcel E. Dinger, Ryan J. Taft, John L. Rinn, Chris P. Ponting, et al. 2011. “The Reality of Pervasive Transcription.” PLoS Biology 9 (7): e1000625; discussion e1001102. Clark, Michael B., Rebecca L. Johnston, Mario Inostroza-Ponta, Archa H. Fox, Ellen Fortini, Pablo Moscato, Marcel E. Dinger, and John S. Mattick. 2012. “Genome-Wide Analysis of Long Noncoding RNA Stability.” Genome Research 22 (5): 885–98. Cleutjens, K. B., H. A. van der Korput, C. C. van Eekelen, H. C. van Rooij, P. W. Faber, and J. Trapman. 1997. “An Androgen Response Element in a Far Upstream Enhancer Region Is Essential for High, Androgen-Regulated Activity of the Prostate-Specific Antigen Promoter.” Molecular Endocrinology 11 (2): 148–61. Colgan, D. F., and J. L. Manley. 1997. “Mechanism and Regulation of mRNA Polyadenylation.” Genes & Development 11 (21): 2755–66. Collier, Ann E., Dan F. Spandau, and Ronald C. Wek. 2018. “Translational Control of a Human CDKN1A mRNA Splice Variant Regulates the Fate of UVB-Irradiated Human Keratinocytes.” Molecular Biology of the Cell 29 (1): 29–41. Connelly, S., and J. L. Manley. 1988. “A Functional mRNA Polyadenylation Signal Is Required for Transcription Termination by RNA Polymerase II.” Genes & Development 2 (4): 440– 52. Cooke, C., and J. C. Alwine. 1996. “The Cap and the 3’splice Site Similarly Affect Polyadenylation Efficiency.” Molecular and Cellular Biology. http://mcb.asm.org/content/16/6/2579.short. Cooke, C., H. Hans, and J. C. Alwine. 1999. “Utilization of Splicing Elements and Polyadenylation Signal Elements in the Coupling of Polyadenylation and Last-Intron Removal.” Molecular and Cellular Biology 19 (7): 4971–79. Crick, F. 1970. “Central Dogma of Molecular Biology.” Nature 227 (5258): 561–63. Dai, Weijun, Gen Zhang, and Eugene V. Makeyev. 2012. “RNA-Binding Protein HuR Autoregulates Its Expression by Promoting Alternative Polyadenylation Site Usage.” Nucleic Acids Research 40 (2): 787–800. Darnell, J. E., R. Wall, and R. J. Tushinski. 1971. “An Adenylic Acid-Rich Sequence in Messenger RNA of HeLa Cells and Its Possible Relationship to Reiterated Sites in DNA.” Proceedings of the National Academy of Sciences of the United States of America 68 (6): 1321–25. Das, Dibash K., Joseph R. Osborne, Hui-Yi Lin, Jong Y. Park, and Olorunseun O. Ogunwobi. 2016. “miR-1207-3p Is a Novel Prognostic Biomarker of Prostate Cancer.” Translational Oncology 9 (3): 236–41. Debacq-Chainiaux, Florence, Jorge D. Erusalimsky, Judith Campisi, and Olivier Toussaint. 2009. “Protocols to Detect Senescence-Associated Beta-Galactosidase (SA-βgal) Activity, a Biomarker of Senescent Cells in Culture and in Vivo.” Nature Protocols 4 (November): 1798.

128

Decorsière, Adrien, Anne Cayrel, Stéphan Vagner, and Stefania Millevoi. 2011. “Essential Role for the Interaction between hnRNP H/F and a G Quadruplex in Maintaining p53 Pre- mRNA 3′-End Processing and Function during DNA Damage.” Genes & Development 25 (3): 220–25. Degen, W. G., Y. Aarssen, G. J. Pruijn, P. J. Utz, and W. J. van Venrooij. 2000. “The Fate of U1 snRNP during Anti-Fas Induced Apoptosis: Specific Cleavage of the U1 snRNA Molecule.” Cell Death and Differentiation 7 (1): 70–79. Deiry, W. S. el-, T. Tokino, V. E. Velculescu, D. B. Levy, R. Parsons, J. M. Trent, D. Lin, W. E. Mercer, K. W. Kinzler, and B. Vogelstein. 1993. “WAF1, a Potential Mediator of p53 Tumor Suppression.” Cell 75 (4): 817–25. Derrien, Thomas, Rory Johnson, Giovanni Bussotti, Andrea Tanzer, Sarah Djebali, Hagen Tilgner, Gregory Guernec, et al. 2012. “The GENCODE v7 Catalog of Human Long Noncoding RNAs: Analysis of Their Gene Structure, Evolution, and Expression.” Genome Research 22 (9): 1775–89. Derti, Adnan, Philip Garrett-Engele, Kenzie D. Macisaac, Richard C. Stevens, Shreedharan Sriram, Ronghua Chen, Carol A. Rohl, Jason M. Johnson, and Tomas Babak. 2012. “A Quantitative Atlas of Polyadenylation in Five Mammals.” Genome Research 22 (6): 1173–83. Devany, Emral, Ji Yeon Park, Michael R. Murphy, George Zakusilo, Jorge Baquero, Xiaokan Zhang, Mainul Hoque, Bin Tian, and Frida E. Kleiman. 2016. “Intronic Cleavage and Polyadenylation Regulates Gene Expression during DNA Damage Response through U1 snRNA.” Cell Discovery 2 (June): 16013. Devany, Emral, Xiaokan Zhang, Ji Yeon Park, Bin Tian, and Frida Esther Kleiman. 2013. “Positive and Negative Feedback Loops in the p53 and mRNA 3′ Processing Pathways.” Proceedings of the National Academy of Sciences 110 (9): 3351–56. Dhanraj, Santhosh, Sethu Madhava Rao Gunja, Adam P. Deveau, Mikael Nissbeck, Boonchai Boonyawat, Andrew J. Coombs, Alessandra Renieri, et al. 2015. “Bone Marrow Failure and Developmental Delay Caused by Mutations in poly(A)-Specific Ribonuclease (PARN).” Journal of Medical Genetics 52 (11): 738–48. Di Giammartino, Dafne Campigli, Kensei Nishida, and James L. Manley. 2011. “Mechanisms and Consequences of Alternative Polyadenylation.” Molecular Cell 43 (6): 853–66. Dimitrova, Nadya, Jesse R. Zamudio, Robyn M. Jong, Dylan Soukup, Rebecca Resnick, Kavitha Sarma, Amanda J. Ward, et al. 2014. “LincRNA-p21 Activates p21 in Cis to Promote Polycomb Target Gene Expression and to Enforce the G1/S Checkpoint.” Molecular Cell 54 (5): 777–90. Donner, Aaron Joseph, Jennifer Michelle Hoover, Stephanie Aspen Szostek, and Joaquín Maximiliano Espinosa. 2007. “Stimulus-Specific Transcriptional Regulation within the p53 Network.” Cell Cycle 6 (21): 2594–98. Drummond, D. R., J. Armstrong, and A. Colman. 1985. “The Effect of Capping and Polyadenylation on the Stability, Movement and Translation of Synthetic Messenger RNAs in Xenopus Oocytes.” Nucleic Acids Research 13 (20): 7375–94. Dujardin, Gwendal, Celina Lafaille, Manuel de la Mata, Luciano E. Marasco, Manuel J. Muñoz, Catherine Le Jossic-Corcos, Laurent Corcos, and Alberto R. Kornblihtt. 2014. “How Slow RNA Polymerase II Elongation Favors Alternative Exon Skipping.” Molecular Cell 54 (4): 683–90. Dutertre, Martin, Fatima Zahra Chakrama, Emmanuel Combe, François-Olivier Desmet, Hussein Mortada, Micaela Polay Espinoza, Lise Gratadou, and Didier Auboeuf. 2014. “A Recently Evolved Class of Alternative 3’-Terminal Exons Involved in Cell Cycle Regulation by Topoisomerase Inhibitors.” Nature Communications 5 (February): 3395.

129

Early, P., J. Rogers, M. Davis, K. Calame, M. Bond, R. Wall, and L. Hood. 1980. “Two mRNAs Can Be Produced from a Single Immunoglobulin Mu Gene by Alternative RNA Processing Pathways.” Cell 20 (2): 313–19. Eckmann, Christian R., Christiane Rammelt, and Elmar Wahle. 2011. “Control of poly(A) Tail Length.” Wiley Interdisciplinary Reviews. RNA 2 (3): 348–61. Eddy, S. R. 2001. “Non-Coding RNA Genes and the Modern RNA World.” Nature Reviews. Genetics 2 (12): 919–29. Eliceiri, G. L., and J. H. Smith. 1983. “Sensitivity to UV Radiation of Small Nuclear RNA Synthesis in Mammalian Cells.” Molecular and Cellular Biology 3 (12): 2151–55. Elkon, Ran, Alejandro P. Ugalde, and Reuven Agami. 2013. “Alternative Cleavage and Polyadenylation: Extent, Regulation and Function.” Nature Reviews. Genetics 14 (7): 496–506. ENCODE Project Consortium, Ewan Birney, John A. Stamatoyannopoulos, Anindya Dutta, Roderic Guigó, Thomas R. Gingeras, Elliott H. Margulies, et al. 2007. “Identification and Analysis of Functional Elements in 1% of the Human Genome by the ENCODE Pilot Project.” Nature 447 (7146): 799–816. Espinosa, Joaquín M., Ramiro E. Verdun, and Beverly M. Emerson. 2003. “p53 Functions through Stress- and Promoter-Specific Recruitment of Transcription Initiation Components before and after DNA Damage.” Molecular Cell 12 (4): 1015–27. Eulalio, Ana, Eric Huntzinger, Tadashi Nishihara, Jan Rehwinkel, Maria Fauser, and Elisa Izaurralde. 2009. “Deadenylation Is a Widespread Effect of miRNA Regulation.” RNA 15 (1): 21–32. Farmer, G., J. Bargonetti, H. Zhu, P. Friedman, R. Prywes, and C. Prives. 1992. “Wild-Type p53 Activates Transcription in Vitro.” Nature 358 (6381): 83–86. Fitzgerald, Molly, and Thomas Shenk. 1981. “The Sequence 5′-AAUAAA-3′ Forms Part of the Recognition Site for Polyadenylation of Late SV40 mRNAs.” Cell 24 (1): 251–60. Flavell, Steven W., Tae-Kyung Kim, Jesse M. Gray, David A. Harmin, Martin Hemberg, Elizabeth J. Hong, Eirene Markenscoff-Papadimitriou, Daniel M. Bear, and Michael E. Greenberg. 2008. “Genome-Wide Analysis of MEF2 Transcriptional Program Reveals Synaptic Target Genes and Neuronal Activity-Dependent Polyadenylation Site Selection.” Neuron 60 (6): 1022–38. Flynn, Ryan A., and Howard Y. Chang. 2014. “Long Noncoding RNAs in Cell-Fate Programming and Reprogramming.” Cell Stem Cell 14 (6): 752–61. Folco, Eric G., Kaitlyn E. Coil, and Robin Reed. 2011. “The Anti-Tumor Drug E7107 Reveals an Essential Role for SF3b in Remodeling U2 snRNP to Expose the Branch Point-Binding Region.” Genes & Development 25 (5): 440–44. Fonseca, Danae, Jorge Baquero, Michael R. Murphy, Gamage Aruggoda, Sophia Varriano, Carmen Sapienza, Oksana Mashadova, Shadaqur Rahman, and Frida E. Kleiman. 2018. “mRNA Processing Factor CstF-50 and Ubiquitin Escort Factor p97 Are BRCA1/BARD1 Cofactors Involved in Chromatin Remodeling during the DNA Damage Response.” Molecular and Cellular Biology 38 (4): e00364–17. Freire-Picos, M. A., L. J. Lombardía-Ferreira, E. Ramil, M. González-Domínguez, and M. E. Cerdán. 2001. “The KlCYC1 Gene, a Downstream Region for Two Differentially Regulated Transcripts.” Yeast 18 (14): 1347–55. Fuke, Hiroyuki, and Mutsuhito Ohno. 2008. “Role of Poly (A) Tail as an Identity Element for mRNA Nuclear Export.” Nucleic Acids Research 36 (3): 1037–49. Fusby, Becky, Soojin Kim, Benjamin Erickson, Hyunmin Kim, Martha L. Peterson, and David L. Bentley. 2016. “Coordination of RNA Polymerase II Pausing and 3′ End Processing Factor Recruitment with Alternative Polyadenylation.” Molecular and Cellular Biology 36 (2): 295–303.

130

Gagnon, Keith T., Liande Li, Yongjun Chu, Bethany A. Janowski, and David R. Corey. 2014. “RNAi Factors Are Present and Active in Human Cell Nuclei.” Cell Reports 6 (1): 211– 21. Gallie, D. R. 1991. “The Cap and poly(A) Tail Function Synergistically to Regulate mRNA Translational Efficiency.” Genes & Development 5 (11): 2108–16. Garcia, Thomas Xavier, and Marie-Claude Hofmann. 2013. “NOTCH Signaling in Sertoli Cells Regulates Gonocyte Fate.” Cell Cycle 12 (16): 2538–45. Garner, Elizabeth, and Kenneth Raj. 2008. “Protective Mechanisms of p53-p21-pRb Proteins against DNA Damage-Induced Cell Death.” Cell Cycle 7 (3): 277–82. Gautheret, D., O. Poirot, F. Lopez, S. Audic, and J. M. Claverie. 1998. “Alternate Polyadenylation in Human mRNAs: A Large-Scale Analysis by EST Clustering.” Genome Research 8 (5): 524–30. Gavrieli, Y., Y. Sherman, and S. A. Ben-Sasson. 1992. “Identification of Programmed Cell Death in Situ via Specific Labeling of Nuclear DNA Fragmentation.” The Journal of Cell Biology 119 (3): 493–501. Genander, Maria, and Jonas Frisén. 2010. “Ephrins and Eph Receptors in Stem Cells and Cancer.” Current Opinion in Cell Biology 22 (5): 611–16. Gilbert, Walter. 1986. “Origin of Life: The RNA World.” Nature 319 (February): 618. Glover-Cutter, Kira, Soojin Kim, Joaquin Espinosa, and David L. Bentley. 2008. “RNA Polymerase II Pauses and Associates with Pre-mRNA Processing Factors at Both Ends of Genes.” Nature Structural & Molecular Biology 15 (1): 71–78. Goldstrohm, Aaron C., and Marvin Wickens. 2008. “Multifunctional Deadenylase Complexes Diversify mRNA Control.” Nature Reviews. Molecular Cell Biology 9 (4): 337–44. Gomes, Nathan P., Glen Bjerke, Briardo Llorente, Stephanie A. Szostek, Beverly M. Emerson, and Joaquin M. Espinosa. 2006. “Gene-Specific Requirement for P-TEFb Activity and RNA Polymerase II Phosphorylation within the p53 Transcriptional Program.” Genes & Development 20 (5): 601–12. Gorospe, M., X. Wang, and N. J. Holbrook. 1998. “p53-Dependent Elevation of p21Waf1 Expression by UV Light Is Mediated through mRNA Stabilization and Involves a Vanadate-Sensitive Regulatory System.” Molecular and Cellular Biology 18 (3): 1400– 1407. Gottifredi, Vanesa, Sheau-Yann Shieh, Yoichi Taya, and Carol Prives. 2001. “p53 Accumulates but Is Functionally Impaired When DNA Synthesis Is Blocked.” Proceedings of the National Academy of Sciences 98 (3): 1036–41. Graber, Joel H., Fathima I. Nazeer, Pei-Chun Yeh, Jason N. Kuehner, Sneha Borikar, Derick Hoskinson, and Claire L. Moore. 2013. “DNA Damage Induces Targeted, Genome-Wide Variation of poly(A) Sites in Budding Yeast.” Genome Research 23 (10): 1690–1703. Graham, Robert R., Chieko Kyogoku, Snaevar Sigurdsson, Irina A. Vlasova, Leela R. L. Davies, Emily C. Baechler, Robert M. Plenge, et al. 2007. “Three Functional Variants of IFN Regulatory Factor 5 (IRF5) Define Risk and Protective Haplotypes for Human Lupus.” Proceedings of the National Academy of Sciences of the United States of America 104 (16): 6758–63. Gunderson, S. I., M. Polycarpou-Schwarz, and I. W. Mattaj. 1998. “U1 snRNP Inhibits Pre- mRNA Polyadenylation through a Direct Interaction between U1 70K and poly(A) Polymerase.” Molecular Cell 1 (2): 255–64. Guttman, Mitchell, Ido Amit, Manuel Garber, Courtney French, Michael F. Lin, David Feldser, Maite Huarte, et al. 2009. “Chromatin Signature Reveals over a Thousand Highly Conserved Large Non-Coding RNAs in Mammals.” Nature 458 (7235): 223–27. Guttman, Mitchell, Pamela Russell, Nicholas T. Ingolia, Jonathan S. Weissman, and Eric S. Lander. 2013. “Ribosome Profiling Provides Evidence That Large Noncoding RNAs Do Not Encode Proteins.” Cell 154 (1): 240–51.

131

Hajjari, Mohammadreza, and Abbas Salavaty. 2015. “HOTAIR: An Oncogenic Long Non-Coding RNA in Different Cancers.” Cancer Biology & Medicine 12 (1): 1–9. Hall, J. R., Z. J. Messenger, H. W. Tam, S. L. Phillips, L. Recio, and R. C. Smart. 2015. “Long Noncoding RNA lincRNA-p21 Is the Major Mediator of UVB-Induced and p53-Dependent Apoptosis in Keratinocytes.” Cell Death & Disease 6 (March): e1700. Hansen, Maike M. K., Winnie Y. Wen, Elena Ingerman, Brandon S. Razooky, Cassandra E. Thompson, Roy D. Dar, Charles W. Chin, Michael L. Simpson, and Leor S. Weinberger. 2018. “A Post-Transcriptional Feedback Mechanism for Noise Suppression and Fate Stabilization.” Cell 173 (7): 1609–21.e15. Han, Zhiyong, Wenyi Wei, Stephen Dunaway, James W. Darnowski, Paul Calabresi, John Sedivy, Eric A. Hendrickson, Kannan V. Balan, Panayotis Pantazis, and James H. Wyche. 2002. “Role of p21 in Apoptosis and Senescence of Human Colon Cancer Cells Treated with Camptothecin.” The Journal of Biological Chemistry 277 (19): 17154–60. Harper, J. Wade, Guy R. Adami, Nan Wei, Khandan Keyomarsi, and Stephen J. Elledge. 1993. “The p21 Cdk-Interacting Protein Cip1 Is a Potent Inhibitor of G1 Cyclin-Dependent Kinases.” Cell 75 (4): 805–16. Heine, George F., Andrew A. Horwitz, and Jeffrey D. Parvin. 2008. “Multiple Mechanisms Contribute to Inhibit Transcription in Response to DNA Damage.” The Journal of Biological Chemistry 283 (15): 9555–61. Herbig, Utz, Wendy A. Jobling, Benjamin P. C. Chen, David J. Chen, and John M. Sedivy. 2004. “Telomere Shortening Triggers Senescence of Human Cells through a Pathway Involving ATM, p53, and p21CIP1, but Not p16INK4a.” Molecular Cell 14 (4): 501–13. Hilgers, Valérie, Michael W. Perry, David Hendrix, Alexander Stark, Michael Levine, and Benjamin Haley. 2011. “Neural-Specific Elongation of 3’ UTRs during Drosophila Development.” Proceedings of the National Academy of Sciences of the United States of America 108 (38): 15864–69. Hill, Richard, Ewelina Bodzak, Michael D. Blough, and Patrick W. K. Lee. 2008. “p53 Binding to the p21 Promoter Is Dependent on the Nature of DNA Damage.” Cell Cycle 7 (16): 2535–43. Hoagland, Mahlon B., Mary Louise Stephenson, Jesse F. Scott, Liselotte I. Hecht, and Paul C. Zamecnik. 1958. “A Soluble Ribonucleic Acid Intermediate in Protein Synthesis.” The Journal of Biological Chemistry 231 (1): 241–57. Hollerer, Ina, Tomaz Curk, Bettina Haase, Vladimir Benes, Christian Hauer, Gabriele Neu-Yilik, Madhuri Bhuvanagiri, Matthias W. Hentze, and Andreas E. Kulozik. 2016. “The Differential Expression of Alternatively Polyadenylated Transcripts Is a Common Stress- Induced Response Mechanism That Modulates Mammalian mRNA Expression in a Quantitative and Qualitative Fashion.” RNA 22 (9): 1441–53. Hoque, Mainul, Zhe Ji, Dinghai Zheng, Wenting Luo, Wencheng Li, Bei You, Ji Yeon Park, Ghassan Yehia, and Bin Tian. 2012. “Analysis of Alternative Cleavage and Polyadenylation by 3′ Region Extraction and Deep Sequencing.” Nature Methods 10 (December): 133. Hoque, Mainul, Wencheng Li, and Bin Tian. 2014. “Accurate Mapping of Cleavage and Polyadenylation Sites by 3’ Region Extraction and Deep Sequencing.” Methods in Molecular Biology 1125: 119–29. Hou, Junwei, Xin Li, Changfei Li, Lu Sun, Yulai Zhao, Jingmin Zhao, and Songdong Meng. 2015. “Plasma Membrane gp96 Enhances Invasion and Metastatic Potential of Liver Cancer via Regulation of uPAR.” Molecular Oncology 9 (7): 1312–23. Hou, Mei, Xing Tang, Feng Tian, Fangyuan Shi, Fenglin Liu, and Ge Gao. 2016. “AnnoLnc: A Web Server for Systematically Annotating Novel Human lncRNAs.” BMC Genomics 17 (1): 931.

132

Huang, L., Y. Sowa, T. Sakai, and A. B. Pardee. 2000. “Activation of the p21WAF1/CIP1 Promoter Independent of p53 by the Histone Deacetylase Inhibitor Suberoylanilide Hydroxamic Acid (SAHA) through the Sp1 Sites.” Oncogene 19 (50): 5712–19. Huang, Qian, and Thoru Pederson. 1999. “A Human U2 RNA Mutant Stalled in 3′ End Processing Is Impaired in Nuclear Import.” Nucleic Acids Research 27 (4): 1025–31. Huang, Yan, Wencheng Li, Xiao Yao, Qi-Jiang Lin, Jing-Wen Yin, Yan Liang, Monika Heiner, Bin Tian, Jingyi Hui, and Gang Wang. 2012. “Mediator Complex Regulates Alternative mRNA Processing via the MED23 Subunit.” Molecular Cell 45 (4): 459–69. Hung, Tiffany, Yulei Wang, Michael F. Lin, Ashley K. Koegel, Yojiro Kotake, Gavin D. Grant, Hugo M. Horlings, et al. 2011. “Extensive and Coordinated Transcription of Noncoding RNAs within Cell-Cycle Promoters.” Nature Genetics 43 (7): 621–29. Hu, Wenwei, Chang S. Chan, Rui Wu, Cen Zhang, Yvonne Sun, Jun S. Song, Laura H. Tang, Arnold J. Levine, and Zhaohui Feng. 2010. “Negative Regulation of Tumor Suppressor p53 by microRNA miR-504.” Molecular Cell 38 (5): 689–99. Hwang, Hun-Way, Erik A. Wentzel, and Joshua T. Mendell. 2007. “A Hexanucleotide Element Directs MicroRNA Nuclear Import.” Science 315 (5808): 97–100. Inoue, Tomomi, Rory K. Geyer, Zhong Kang Yu, and Carl G. Maki. 2001. “Downregulation of MDM2 Stabilizes p53 by Inhibiting p53 Ubiquitination in Response to Specific Alkylating Agents.” FEBS Letters 490 (3): 196–201. Izquierdo, José M. 2008. “Hu Antigen R (HuR) Functions as an Alternative Pre-mRNA Splicing Regulator of Fas Apoptosis-Promoting Receptor on Exon Definition.” The Journal of Biological Chemistry 283 (27): 19077–84. Jankowska, Anna, Samuel I. Gunderson, Miroslaw Andrusiewicz, Beata Burczynska, Anna Szczerba, Artur Jarmolowski, Ewa Nowak-Markwitz, and Jerzy B. Warchol. 2008. “Reduction of Human Chorionic Gonadotropin Beta Subunit Expression by Modified U1 snRNA Caused Apoptosis in Cervical Cancer Cells.” Molecular Cancer 7 (March): 26. Jenal, Mathias, Ran Elkon, Fabricio Loayza-Puch, Gijs van Haaften, Uwe Kühn, Fiona M. Menzies, Joachim A. F. Oude Vrielink, et al. 2012. “The poly(A)-Binding Protein Nuclear 1 Suppresses Alternative Cleavage and Polyadenylation Sites.” Cell 149 (3): 538–53. Jenny, A., L. Minvielle-Sebastia, P. J. Preker, and W. Keller. 1996. “Sequence Similarity between the 73-Kilodalton Protein of Mammalian CPSF and a Subunit of Yeast Polyadenylation Factor I.” Science 274 (5292): 1514–17. Jing, Qing, Shuang Huang, Sabine Guth, Tyler Zarubin, Andrea Motoyama, Jianming Chen, Franco Di Padova, Sheng-Cai Lin, Hermann Gram, and Jiahuai Han. 2005. “Involvement of microRNA in AU-Rich Element-Mediated mRNA Instability.” Cell 120 (5): 623–34. Ji, Zhe, Ju Youn Lee, Zhenhua Pan, Bingjun Jiang, and Bin Tian. 2009. “Progressive Lengthening of 3′ Untranslated Regions of mRNAs by Alternative Polyadenylation during Mouse Embryonic Development.” Proceedings of the National Academy of Sciences 106 (17): 7028–33. Ji, Zhe, Wenting Luo, Wencheng Li, Mainul Hoque, Zhenhua Pan, Yun Zhao, and Bin Tian. 2011. “Transcriptional Activity Regulates Alternative Cleavage and Polyadenylation.” Molecular Systems Biology 7 (September): 534. Kadyrova, Lyudmila Y., Yasuaki Habara, Tammy H. Lee, and Robin P. Wharton. 2007. “Translational Control of Maternal Cyclin B mRNA by Nanos in the Drosophila Germline.” Development 134 (8): 1519–27. Kaida, Daisuke, Michael G. Berg, Ihab Younis, Mumtaz Kasim, Larry N. Singh, Lili Wan, and Gideon Dreyfuss. 2010. “U1 snRNP Protects Pre-mRNAs from Premature Cleavage and Polyadenylation.” Nature 468 (7324): 664–68. Karolchik, Donna, Angie S. Hinrichs, and W. James Kent. 2007. “The UCSC Genome Browser.” Current Protocols in Bioinformatics / Editoral Board, Andreas D. Baxevanis ... [et Al.] Chapter 1 (March): Unit 1.4.

133

Kastan, M. B., O. Onyekwere, D. Sidransky, B. Vogelstein, and R. W. Craig. 1991. “Participation of p53 Protein in the Cellular Response to DNA Damage.” Cancer Research 51 (23 Pt 1): 6304–11. Katayama, S., Y. Tomaru, T. Kasukawa, K. Waki, M. Nakanishi, M. Nakamura, H. Nishida, et al. 2005. “Antisense Transcription in the Mammalian Transcriptome.” Science 309 (5740): 1564–66. Kemp, T. S. 2006. “The Origin and Early Radiation of the Therapsid Mammal-like Reptiles: A Palaeobiological Hypothesis.” Journal of Evolutionary Biology 19 (4): 1231–47. Kim, Kyoung Mi, Hana Cho, and Yoon Ki Kim. 2012. “The Upstream Open Reading Frame of Cyclin-Dependent Kinase Inhibitor 1A mRNA Negatively Regulates Translation of the Downstream Main Open Reading Frame.” Biochemical and Biophysical Research Communications 424 (3): 469–75. Kim, Tae-Kyung, Martin Hemberg, and Jesse M. Gray. 2015. “Enhancer RNAs: A Class of Long Noncoding RNAs Synthesized at Enhancers.” Cold Spring Harbor Perspectives in Biology 7 (1): a018622. Kleiman, Frida E., and James L. Manley. 1999. “Functional Interaction of BRCA1-Associated BARD1 with Polyadenylation Factor CstF-50.” Science 285 (5433): 1576–79. ———. 2001. “The BARD1-CstF-50 Interaction Links mRNA 3′ End Formation to DNA Damage and Tumor Suppression.” Cell 104 (5): 743–53. Kleiman, Frida E., Foon Wu-Baer, Danae Fonseca, Syuzo Kaneko, Richard Baer, and James L. Manley. 2005. “BRCA1/BARD1 Inhibition of mRNA 3′ Processing Involves Targeted Degradation of RNA Polymerase II.” Genes & Development 19 (10): 1227–37. Kornblihtt, Alberto R., Ignacio E. Schor, Mariano Alló, Gwendal Dujardin, Ezequiel Petrillo, and Manuel J. Muñoz. 2013. “Alternative Splicing: A Pivotal Step between Eukaryotic Transcription and Translation.” Nature Reviews. Molecular Cell Biology 14 (February): 153. Körner, Christof G., and Elmar Wahle. 1997. “Poly(A) Tail Shortening by a Mammalian Poly(A)- Specific 3′-Exoribonuclease.” The Journal of Biological Chemistry 272 (16): 10448–56. Koumenis, Constantinos, Rodolfo Alarcon, Ester Hammond, Patrick Sutphin, William Hoffman, Maureen Murphy, Jennifer Derr, Yoichi Taya, Scott W. Lowe, and Michael Kastan. 2001. “Regulation of p53 by Hypoxia: Dissociation of Transcriptional Repression and Apoptosis from p53-Dependent Transactivation.” Molecular and Cellular Biology 21 (4): 1297– 1310. Krämer, A., W. Keller, B. Appel, and R. Lührmann. 1984. “The 5’ Terminus of the RNA Moiety of U1 Small Nuclear Ribonucleoprotein Particles Is Required for the Splicing of Messenger RNA Precursors.” Cell 38 (1): 299–307. Kraynik, Stephen M., Andrew Gabanic, Sarah R. Anthony, Melissa Kelley, Waltke R. Paulding, Anne Roessler, Michael McGuinness, and Michael Tranter. 2015. “The Stress-Induced Heat Shock Protein 70.3 Expression Is Regulated by a Dual-Component Mechanism Involving Alternative Polyadenylation and HuR.” Biochimica et Biophysica Acta 1849 (6): 688–96. Kühn, U., M. Gündel, A. Knoth, Y. Kerwitz, and S. Rüdel. 2009. “Poly (A) Tail Length Is Controlled by the Nuclear Poly (A)-Binding Protein Regulating the Interaction between Poly (A) Polymerase and the Cleavage and Polyadenylation ….” Journal of Biological. http://www.jbc.org/content/284/34/22803.short. Kumari, Geeta, Tanja Ulrich, and Stefan Gaubatz. 2013. “A Role for p38 in Transcriptional Elongation of p21CIP1 in Response to Aurora B Inhibition.” Cell Cycle 12 (13): 2051– 60. Laptenko, Oleg, Rachel Beckerman, Ella Freulich, and Carol Prives. 2011. “p53 Binding to Nucleosomes within the p21 Promoter in Vivo Leads to Nucleosome Loss and

134

Transcriptional Activation.” Proceedings of the National Academy of Sciences of the United States of America 108 (26): 10385–90. Latchman, D. S. 1997. “Transcription Factors: An Overview.” The International Journal of Biochemistry & Cell Biology 29 (12): 1305–12. Lebedeva, Svetlana, Marvin Jens, Kathrin Theil, Björn Schwanhäusser, Matthias Selbach, Markus Landthaler, and Nikolaus Rajewsky. 2011. “Transcriptome-Wide Analysis of Regulatory Interactions of the RNA-Binding Protein HuR.” Molecular Cell 43 (3): 340–52. Lee, Kuo-Ming, and Woan-Yuh Tarn. 2014. “TRAP150 Activates Splicing in Composite Terminal Exons.” Nucleic Acids Research 42 (20): 12822–32. Lee, Seahyoung, Hyang-Hee Seo, Chang Youn Lee, Jiyun Lee, Sunhye Shin, Sang Woo Kim, Soyeon Lim, and Ki-Chul Hwang. 2017. “Human Long Noncoding RNA Regulation of Stem Cell Potency and Differentiation.” Stem Cells International 2017 (August): 6374504. Le, Minh T. N., Cathleen Teh, Ng Shyh-Chang, Huangming Xie, Beiyan Zhou, Vladimir Korzh, Harvey F. Lodish, and Bing Lim. 2009. “MicroRNA-125b Is a Novel Negative Regulator of p53.” Genes & Development 23 (7): 862–76. Léveillé, Nicolas, Carlos A. Melo, Koos Rooijers, Angel Díaz-Lagares, Sonia A. Melo, Gozde Korkmaz, Rui Lopes, et al. 2015. “Genome-Wide Profiling of p53-Regulated Enhancer RNAs Uncovers a Subset of Enhancers Controlled by a lncRNA.” Nature Communications 6 (March): 6520. Li, Andrew G., Landon G. Piluso, Xin Cai, Brian J. Gadd, Andreas G. Ladurner, and Xuan Liu. 2007. “An Acetylation Switch in p53 Mediates Holo-TFIID Recruitment.” Molecular Cell 28 (3): 408–21. Lianoglou, Steve, Vidur Garg, Julie L. Yang, Christina S. Leslie, and Christine Mayr. 2013. “Ubiquitously Transcribed Genes Use Alternative Polyadenylation to Achieve Tissue- Specific Expression.” Genes & Development 27 (21): 2380–96. Lin, Michael F., Irwin Jungreis, and Manolis Kellis. 2011. “PhyloCSF: A Comparative Genomics Method to Distinguish Protein Coding and Non-Coding Regions.” Bioinformatics 27 (13): i275–82. Litwiniec, Anna, Lidia Gackowska, Anna Helmin-Basa, Agnieszka Żuryń, and Alina Grzanka. 2013. “Low-Dose Etoposide-Treatment Induces Endoreplication and Cell Death Accompanied by Cytoskeletal Alterations in A549 Cells: Does the Response Involve Senescence? The Possible Role of Vimentin.” Cancer Cell International 13 (1): 9. Liu, Xiaochuan, Mainul Hoque, Marc Larochelle, Jean-François Lemay, Nathan Yurko, James L. Manley, François Bachand, and Bin Tian. 2017. “Comparative Analysis of Alternative Polyadenylation in S. Cerevisiae and S. Pombe.” Genome Research 27 (10): 1685–95. Livak, K. J., and T. D. Schmittgen. 2001. “Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2(-Delta Delta C(T)) Method.” Methods 25 (4): 402–8. Li, Wencheng, Bei You, Mainul Hoque, Dinghai Zheng, Wenting Luo, Zhe Ji, Ji Yeon Park, et al. 2015. “Systematic Profiling of Poly (A)+ Transcripts Modulated by Core 3’end Processing and Splicing Factors Reveals Regulatory Rules of Alternative Cleavage and Polyadenylation.” PLoS Genetics 11 (4): e1005166. Li, Y., Z. Y. Chen, W. Wang, C. C. Baker, and R. M. Krug. 2001. “The 3’-End-Processing Factor CPSF Is Required for the Splicing of Single-Intron Pre-mRNAs in Vivo.” RNA 7 (6): 920–31. Lou, H., R. F. Gagel, and S. M. Berget. 1996. “An Intron Enhancer Recognized by Splicing Factors Activates Polyadenylation.” Genes & Development 10 (2): 208–19. Lou, H., K. M. Neugebauer, R. F. Gagel, and S. M. Berget. 1998. “Regulation of Alternative Polyadenylation by U1 snRNPs and SRp20.” Molecular and Cellular Biology 18 (9): 4977–85.

135

Loya, Travis J., and Daniel Reines. 2016. “Recent Advances in Understanding Transcription Termination by RNA Polymerase II.” F1000Research 5 (June). https://doi.org/10.12688/f1000research.8455.1. Lucey, Brendan P., Walter A. Nelson-Rees, and Grover M. Hutchins. 2009. “Henrietta Lacks, HeLa Cells, and Cell Culture Contamination.” Archives of Pathology & Laboratory Medicine 133 (9): 1463–67. Luo, M. J., and R. Reed. 1999. “Splicing Is Required for Rapid and Efficient mRNA Export in Metazoans.” Proceedings of the National Academy of Sciences of the United States of America 96 (26): 14937–42. Luo, Wenting, Zhe Ji, Zhenhua Pan, Bei You, Mainul Hoque, Wencheng Li, Samuel I. Gunderson, and Bin Tian. 2013. “The Conserved Intronic Cleavage and Polyadenylation Site of CstF-77 Gene Imparts Control of 3′ End Processing Activity through Feedback Autoregulation and by U1 snRNP.” PLoS Genetics 9 (7): e1003613. Lupiáñez, Darío G., Katerina Kraft, Verena Heinrich, Peter Krawitz, Francesco Brancati, Eva Klopocki, Denise Horn, et al. 2015. “Disruptions of Topological Chromatin Domains Cause Pathogenic Rewiring of Gene-Enhancer Interactions.” Cell 161 (5): 1012–25. Lutz, Carol S., and Alexandra Moreira. 2011. “Alternative mRNA Polyadenylation in Eukaryotes: An Effective Regulator of Gene Expression.” Wiley Interdisciplinary Reviews. RNA 2 (1): 23–31. Lu, Yao-Ping, You-Rong Lou, Qing-Yun Peng, Jian-Guo Xie, Paul Nghiem, and Allan H. Conney. 2008. “Effect of Caffeine on the ATR/Chk1 Pathway in the Epidermis of UVB- Irradiated Mice.” Cancer Research 68 (7): 2523–29. Lysenko, E. A., A. A. Klaus, and V. V. Kuznetsov. 2013. “Analysis of Intron-Containing Pre- mRNA and Spliced mRNA in Maize Chloroplasts by RT-PCR.” Molecular Biology 47 (1): 112–19. Macleod, K. F., N. Sherry, G. Hannon, D. Beach, T. Tokino, K. Kinzler, B. Vogelstein, and T. Jacks. 1995. “p53-Dependent and Independent Expression of p21 during Cell Growth, Differentiation, and DNA Damage.” Genes & Development 9 (8): 935–44. Magrini, Roberta, Debora Russo, Gilberto Fronza, Alberto Inga, and Paola Menichini. 2007. “The Kinetics of p53-Binding and Histone Acetylation at Target Promoters Do Not Strictly Correlate with Gene Expression after UV Damage.” Journal of Cellular Biochemistry 100 (5): 1276–87. Ma, Jianjuan, Xiying Yu, Liping Guo, and Shih Hsin Lu. 2013. “DUSP6, a Tumor Suppressor, Is Involved in Differentiation and Apoptosis in Esophageal Squamous Cell Carcinoma.” Oncology Letters 6 (6): 1624–30. Mandel, Corey R., Syuzo Kaneko, Hailong Zhang, Damara Gebauer, Vasupradha Vethantham, James L. Manley, and Liang Tong. 2006. “Polyadenylation Factor CPSF-73 Is the Pre- mRNA 3’-End-Processing Endonuclease.” Nature 444 (7121): 953–56. Mangone, Marco, Arun Prasad Manoharan, Danielle Thierry-Mieg, Jean Thierry-Mieg, Ting Han, Sebastian D. Mackowiak, Emily Mis, et al. 2010. “The Landscape of C. Elegans 3’UTRs.” Science 329 (5990): 432–35. Manley, J. L. 1983. “Accurate and Specific Polyadenylation of mRNA Precursors in a Soluble Whole-Cell Lysate.” Cell 33 (2): 595–605. Mansfield, Kyle D., and Jack D. Keene. 2012. “Neuron-Specific ELAV/Hu Proteins Suppress HuR mRNA during Neuronal Differentiation by Alternative Polyadenylation.” Nucleic Acids Research 40 (6): 2734–46. Mansilla, Sabrina F., Gastón Soria, María Belén Vallerga, Martín Habif, Wilner Martínez-López, Carol Prives, and Vanesa Gottifredi. 2013. “UV-Triggered p21 Degradation Facilitates Damaged-DNA Replication and Preserves Genomic Stability.” Nucleic Acids Research 41 (14): 6942–51.

136

Marks, Michael E., Bernice H. Danbury, Charles A. Miller, and Michael G. Brattain. 1983. “Cell Surface Proteins and Glycoproteins From Biologically Different Human Colon Carcinoma Cell Lines.” Journal of the National Cancer Institute 71 (4): 663–71. Martınez,́ J., Y. G. Ren, A. C. Thuresson, and U. Hellman. 2000. “A 54-kDa Fragment of the Poly (A)-Specific Ribonuclease Is an Oligomeric, Processive, and Cap-Interacting Poly (A)-Specific 3′ Exonuclease.” Journal of Biological. http://www.jbc.org/content/275/31/24222.short. Masamha, Chioniso P., Zheng Xia, Jingxuan Yang, Todd R. Albrecht, Min Li, Ann-Bin Shyu, Wei Li, and Eric J. Wagner. 2014. “CFIm25 Links Alternative Polyadenylation to Glioblastoma Tumour Suppression.” Nature 510 (7505): 412–16. Masuda, Kiyoshi, Kotb Abdelmohsen, Mihee M. Kim, Subramanya Srikantan, Eun Kyung Lee, Kumiko Tominaga, Roza Selimyan, et al. 2011. “Global Dissociation of HuR–mRNA Complexes Promotes Cell Survival after Ionizing Radiation.” The EMBO Journal 30 (6): 1040–53. Matsumoto, Akinobu, Alessandra Pasut, Masaki Matsumoto, Riu Yamashita, Jacqueline Fung, Emanuele Monteleone, Alan Saghatelian, Keiichi I. Nakayama, John G. Clohessy, and Pier Paolo Pandolfi. 2017. “mTORC1 and Muscle Regeneration Are Regulated by the LINC00961-Encoded SPAR Polypeptide.” Nature 541 (7636): 228–32. Mattia, Melissa, Vanesa Gottifredi, Kristine McKinney, and Carol Prives. 2007. “p53-Dependent p21 mRNA Elongation Is Impaired When DNA Replication Is Stalled.” Molecular and Cellular Biology 27 (4): 1309–20. Ma, W. J., S. Cheng, C. Campbell, A. Wright, and H. Furneaux. 1996. “Cloning and Characterization of HuR, a Ubiquitously Expressed Elav-like Protein.” The Journal of Biological Chemistry 271 (14): 8144–51. Mayr, Christine, and David P. Bartel. 2009. “Widespread Shortening of 3′ UTRs by Alternative Cleavage and Polyadenylation Activates Oncogenes in Cancer Cells.” Cell 138 (4): 673– 84. Mazan-Mamczarz, Krystyna, Stefanie Galbán, Isabel López de Silanes, Jennifer L. Martindale, Ulus Atasoy, Jack D. Keene, and Myriam Gorospe. 2003. “RNA-Binding Protein HuR Enhances p53 Translation in Response to Ultraviolet Light Irradiation.” Proceedings of the National Academy of Sciences of the United States of America 100 (14): 8354–59. McCracken, S., N. Fong, K. Yankulov, S. Ballantyne, G. Pan, J. Greenblatt, S. D. Patterson, M. Wickens, and D. L. Bentley. 1997. “The C-Terminal Domain of RNA Polymerase II Couples mRNA Processing to Transcription.” Nature 385 (6614): 357–61. Menon, Deepak, Darin Salloum, Elyssa Bernfeld, Elizabeth Gorodetsky, Alla Akselrod, Maria A. Frias, Jessica Sudderth, Pei-Hsuan Chen, Ralph DeBerardinis, and David A. Foster. 2017. “Lipid Sensing by mTOR Complexes via de Novo Synthesis of Phosphatidic Acid.” The Journal of Biological Chemistry 292 (15): 6303–11. Michelini, Flavia, Sethuramasundaram Pitchiaya, Valerio Vitelli, Sheetal Sharma, Ubaldo Gioia, Fabio Pessina, Matteo Cabrini, et al. 2017. “Damage-Induced lncRNAs Control the DNA Damage Response through Interaction with DDRNAs at Individual Double-Strand Breaks.” Nature Cell Biology 19 (12): 1400–1411. Mignone, Flavio, Carmela Gissi, Sabino Liuni, and Graziano Pesole. 2002. “Untranslated Regions of mRNAs.” Genome Biology 3 (3): REVIEWS0004. Mirkin, Nurit, Danae Fonseca, Samia Mohammed, Murat A. Cevher, James L. Manley, and Frida E. Kleiman. 2008. “The 3′ Processing Factor CstF Functions in the DNA Repair Response.” Nucleic Acids Research 36 (6): 1792–1804. Moorhead, Greg B. G., Laura Trinkle-Mulcahy, and Annegret Ulke-Lemée. 2007. “Emerging Roles of Nuclear Protein Phosphatases.” Nature Reviews. Molecular Cell Biology 8 (3): 234–44.

137

Moreira, A., Y. Takagaki, S. Brackenridge, M. Wollerton, J. L. Manley, and N. J. Proudfoot. 1998. “The Upstream Sequence Element of the C2 Complement poly(A) Signal Activates mRNA 3’ End Formation by Two Distinct Mechanisms.” Genes & Development 12 (16): 2522–34. Morra, D. S., S. H. Lawler, B. P. Eliceiri, and G. L. Eliceiri. 1986. “Inhibition of Small Nuclear RNA Synthesis by Ultraviolet Radiation.” The Journal of Biological Chemistry 261 (7): 3142–46. Mount, S. M., I. Pettersson, M. Hinterberger, A. Karmas, and J. A. Steitz. 1983. “The U1 Small Nuclear RNA-Protein Complex Selectively Binds a 5’ Splice Site in Vitro.” Cell 33 (2): 509–18. Movassat, Maliheh, Tara L. Crabb, Anke Busch, Chengguo Yao, Derrick J. Reynolds, Yongsheng Shi, and Klemens J. Hertel. 2016. “Coupling between Alternative Polyadenylation and Alternative Splicing Is Limited to Terminal Introns.” RNA Biology 13 (7): 646–55. Mueller, Alisa A., Cindy T. van Velthoven, Kathryn D. Fukumoto, Tom H. Cheung, and Thomas A. Rando. 2016. “Intronic Polyadenylation of PDGFRα in Resident Stem Cells Attenuates Muscle Fibrosis.” Nature 540 (7632): 276–79. Mukherjee, Neelanjan, David L. Corcoran, Jeffrey D. Nusbaum, David W. Reid, Stoyan Georgiev, Markus Hafner, Manuel Ascano Jr, Thomas Tuschl, Uwe Ohler, and Jack D. Keene. 2011. “Integrative Regulatory Mapping Indicates That the RNA-Binding Protein HuR Couples Pre-mRNA Processing and mRNA Stability.” Molecular Cell 43 (3): 327– 39. Muñoz, Manuel J., M. Soledad Pérez Santangelo, Maria P. Paronetto, Manuel de la Mata, Federico Pelisch, Stéphanie Boireau, Kira Glover-Cutter, et al. 2009. “DNA Damage Regulates Alternative Splicing through Inhibition of RNA Polymerase II Elongation.” Cell 137 (4): 708–20. Munson, L. M., and W. S. Reznikoff. 1981. “Abortive Initiation and Long Ribonucleic Acid Synthesis.” Biochemistry 20 (8): 2081–85. Murthy, K. G., and J. L. Manley. 1995. “The 160-kD Subunit of Human Cleavage- Polyadenylation Specificity Factor Coordinates Pre-mRNA 3’-End Formation.” Genes & Development 9 (21): 2672–83. Nag, Anita, Kazim Narsinh, and Harold G. Martinson. 2007. “The poly(A)-Dependent Transcriptional Pause Is Mediated by CPSF Acting on the Body of the Polymerase.” Nature Structural & Molecular Biology 14 (7): 662–69. Nagano, Taiki, Masayuki Nakano, Akio Nakashima, Kengo Onishi, Shunsuke Yamao, Masato Enari, Ushio Kikkawa, and Shinji Kamada. 2016. “Identification of Cellular Senescence- Specific Genes by Comparative Transcriptomics.” Scientific Reports 6 (August): 31758. Nagata, S. 2000. “Apoptotic DNA Fragmentation.” Experimental Cell Research 256 (1): 12–18. Nayak, Gowri, Yoshinobu Odaka, Vikram Prasad, Alyssa F. Solano, Eun-Jin Yeo, Shruti Vemaraju, Jeffery D. Molkentin, et al. 2018. “Developmental Vascular Regression Is Regulated by a Wnt/β-Catenin, MYC and CDKN1A Pathway That Controls Cell Proliferation and Cell Death.” Development 145 (12): dev154898. Nazeer, F. I., E. Devany, S. Mohammed, D. Fonseca, B. Akukwe, C. Taveras, and F. E. Kleiman. 2011. “p53 Inhibits mRNA 3’ Processing through Its Interaction with the CstF/BARD1 Complex.” Oncogene 30 (27): 3073–83. Nelson-Rees, W. A., D. W. Daniels, and R. R. Flandermeyer. 1981. “Cross-Contamination of Cells in Culture.” Science 212 (4493): 446–52. Newman, Michelle, Rym Sfaxi, Abhijit Saha, David Monchaud, Marie-Paule Teulade-Fichou, and Stéphan Vagner. 2017. “The G-Quadruplex-Specific RNA Helicase DHX36 Regulates p53 Pre-mRNA 3′-End Processing Following UV-Induced DNA Damage.” Journal of Molecular Biology 429 (21): 3121–31.

138

Ng, Karen, Dieter Pullirsch, Martin Leeb, and Anton Wutz. 2007. “Xist and the Order of Silencing.” EMBO Reports 8 (1): 34–39. Nishitani, Hideo, Yasushi Shiomi, Hiroka Iida, Masato Michishita, Toshihiro Takami, and Toshiki Tsurimoto. 2008. “CDK Inhibitor p21 Is Degraded by a Proliferating Cell Nuclear Antigen- Coupled Cul4-DDB1Cdt2 Pathway during S Phase and after UV Irradiation.” The Journal of Biological Chemistry 283 (43): 29045–52. Niwa, Maho, Clinton C. MacDonald, and Susan M. Berget. 1992. “Are Vertebrate Exons Scanned during Splice-Site Selection?” Nature 360 (November): 277. Niwa, M., and S. M. Berget. 1991. “Mutation of the AAUAAA Polyadenylation Signal Depresses in Vitro Splicing of Proximal but Not Distal Introns.” Genes & Development 5 (11): 2086– 95. Oesterreich, Fernando Carrillo, Lydia Herzel, Korinna Straube, Katja Hujer, Jonathon Howard, and Karla M. Neugebauer. 2016. “Splicing of Nascent RNA Coincides with Intron Exit from RNA Polymerase II.” Cell 165 (2): 372–81. Ozsolak, Fatih, Philipp Kapranov, Sylvain Foissac, Sang Woo Kim, Elane Fishilevich, A. Paula Monaghan, Bino John, and Patrice M. Milos. 2010. “Comprehensive Polyadenylation Site Maps in Yeast and Human Reveal Pervasive Alternative Polyadenylation.” Cell 143 (6): 1018–29. Pan, Zhenhua, Haibo Zhang, Lisa K. Hague, Ju Youn Lee, Carol S. Lutz, and Bin Tian. 2006. “An Intronic Polyadenylation Site in Human and Mouse CstF-77 Genes Suggests an Evolutionarily Conserved Regulatory Mechanism.” Gene 366 (2): 325–34. Pauws, E., A. H. van Kampen, S. A. van de Graaf, J. J. de Vijlder, and C. Ris-Stalpers. 2001. “Heterogeneity in Polyadenylation Cleavage Sites in Mammalian mRNA Sequences: Implications for SAGE Analysis.” Nucleic Acids Research 29 (8): 1690–94. Pawłowska, Elżbieta, Joanna Szczepanska, and Janusz Blasiak. 2017. “The Long Noncoding RNA HOTAIR in Breast Cancer: Does Autophagy Play a Role?” International Journal of Molecular Sciences 18 (11). https://doi.org/10.3390/ijms18112317. Paz, Inbal, Idit Kosti, Manuel Ares Jr, Melissa Cline, and Yael Mandel-Gutfreund. 2014. “RBPmap: A Web Server for Mapping Binding Sites of RNA-Binding Proteins.” Nucleic Acids Research 42 (Web Server issue): W361–67. Pelham, Hugh R. B., and Richard J. Jackson. 1976. “An Efficient mRNA-Dependent Translation System from Reticulocyte Lysates.” The FEBS Journal 67 (1): 247–56. Perry, Robert P., and Dawn E. Kelley. 1970. “Inhibition of RNA Synthesis by Actinomycin D: Characteristic Dose-Response of Different RNA Species.” Journal of Cellular Physiology 76 (2): 127–39. Pinto, Pedro A. B., Telmo Henriques, Marta O. Freitas, Torcato Martins, Rita G. Domingues, Paulina S. Wyrzykowska, Paula A. Coelho, et al. 2011. “RNA Polymerase II Kinetics in Polo Polyadenylation Signal Selection.” The EMBO Journal 30 (12): 2431–44. Plass, Mireya, Simon H. Rasmussen, and Anders Krogh. 2017. “Highly Accessible AU-Rich Regions in 3’ Untranslated Regions Are Hotspots for Binding of Regulatory Factors.” PLoS Computational Biology 13 (4): e1005460. Ponting, Chris P., Peter L. Oliver, and Wolf Reik. 2009. “Evolution and Functions of Long Noncoding RNAs.” Cell 136 (4): 629–41. Preker, Pascal, Jesper Nielsen, Susanne Kammler, Søren Lykke-Andersen, Marianne S. Christensen, Christophe K. Mapendano, Mikkel H. Schierup, and Torben Heick Jensen. 2008. “RNA Exosome Depletion Reveals Transcription Upstream of Active Human Promoters.” Science 322 (5909): 1851–54. Prives, Carol, and Vanesa Gottifredi. 2008. “The p21 and PCNA Partnership: A New Twist for an Old Plot.” Cell Cycle 7 (24): 3840–46. Proudfoot, N. J., and G. G. Brownlee. 1976. “3’ Non-Coding Region Sequences in Eukaryotic Messenger RNA.” Nature 263 (5574): 211–14.

139

Purvis, Jeremy E., Kyle W. Karhohs, Caroline Mock, Eric Batchelor, Alexander Loewer, and Galit Lahav. 2012. “p53 Dynamics Control Cell Fate.” Science 336 (6087): 1440–44. Puvvula, Pavan Kumar, Rohini Devi Desetty, Pascal Pineau, Agnés Marchio, Anne Moon, Anne Dejean, and Oliver Bischof. 2014. “Long Noncoding RNA PANDA and Scaffold- Attachment-Factor SAFA Control Senescence Entry and Exit.” Nature Communications 5 (November): 5323. Qi, Jun-Juan, Ling Liu, Ji-Xiang Cao, Guo-Shun An, Shu-Yan Li, Gang Li, Hong-Ti Jia, and Ju- Hua Ni. 2015. “E2F1 Regulates p53R2 Gene Expression in p53-Deficient Cells.” Molecular and Cellular Biochemistry 399 (1-2): 179–88. Raijmakers, Reinout, Geurt Schilders, and Ger J. M. Pruijn. 2004. “The Exosome, a Molecular Machine for Controlled RNA Degradation in Both Nucleus and Cytoplasm.” European Journal of Cell Biology 83 (5): 175–83. Ramachandran, Sheetal, Doan Duy Hai Tran, Sabine Klebba-Faerber, Christian Kardinal, Anthony D. Whetton, and Teruko Tamura. 2011. “An Ataxia-Telangiectasia-Mutated (ATM) Kinase Mediated Response to DNA Damage down-Regulates the mRNA-Binding Potential of THOC5.” RNA 17 (11): 1957–66. Rehfeld, Anders, Mireya Plass, Anders Krogh, and Lennart Friis-Hansen. 2013. “Alterations in Polyadenylation and Its Implications for Endocrine Disease.” Frontiers in Endocrinology 4 (May): 53. Reuter, Jason A., Damek V. Spacek, and Michael P. Snyder. 2015. “High-Throughput Sequencing Technologies.” Molecular Cell 58 (4): 586–97. Ruiz-Orera, Jorge, Xavier Messeguer, Juan Antonio Subirana, and M. Mar Alba. 2014. “Long Non-Coding RNAs as a Source of New Peptides.” eLife 3 (September): e03523. Sakharkar, Meena Kishore, Vincent T. K. Chow, and Pandjassarame Kangueane. 2004. “Distributions of Exons and Introns in the Human Genome.” In Silico Biology 4 (4): 387– 93. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. “DNA Sequencing with Chain-Terminating Inhibitors.” Proceedings of the National Academy of Sciences of the United States of America 74 (12): 5463–67. Scheuermann, Johanna C., and Laurie A. Boyer. 2013. “Getting to the Heart of the Matter: Long Non-Coding RNAs in Cardiac Development and Disease.” The EMBO Journal 32 (13): 1805–16. Schlereth, Katharina, Rasa Beinoraviciute-Kellner, Marie K. Zeitlinger, Anne C. Bretz, Markus Sauer, Joël P. Charles, Fotini Vogiatzi, et al. 2010. “DNA Binding Cooperativity of p53 Modulates the Decision between Cell-Cycle Arrest and Apoptosis.” Molecular Cell 38 (3): 356–68. Schloss, Jeffery A. 2008. “How to Get Genomes at One Ten-Thousandth the Cost.” Nature Biotechnology 26 (10): 1113–15. Schmidt, Marie-Joëlle, and Chris J. Norbury. 2010. “Polyadenylation and beyond: Emerging Roles for Noncanonical poly(A) Polymerases.” Wiley Interdisciplinary Reviews. RNA 1 (1): 142–51. Schmitt, Adam M., Julia T. Garcia, Tiffany Hung, Ryan A. Flynn, Ying Shen, Kun Qu, Alexander Y. Payumo, et al. 2016. “An Inducible Long Noncoding RNA Amplifies DNA Damage Signaling.” Nature Genetics 48 (11): 1370–76. Schrago, Carlos G., and Claudia A. M. Russo. 2003. “Timing the Origin of New World Monkeys.” Molecular Biology and Evolution 20 (10): 1620–25. Scully, R., J. Chen, A. Plug, Y. Xiao, D. Weaver, J. Feunteun, T. Ashley, and D. M. Livingston. 1997. “Association of BRCA1 with Rad51 in Mitotic and Meiotic Cells.” Cell 88 (2): 265– 75.

140

Seila, Amy C., J. Mauro Calabrese, Stuart S. Levine, Gene W. Yeo, Peter B. Rahl, Ryan A. Flynn, Richard A. Young, and Phillip A. Sharp. 2008. “Divergent Transcription from Active Promoters.” Science 322 (5909): 1849–51. Serge P J, and Willem Halffman. 2017. “The Ghosts of HeLa: How Cell Line Misidentification Contaminates the Scientific Literature.” PloS One 12 (10): e0186281. Shalgi, Reut, Jessica A. Hurt, Susan Lindquist, and Christopher B. Burge. 2014. “Widespread Inhibition of Posttranscriptional Splicing Shapes the Cellular Transcriptome Following Heat Shock.” Cell Reports 7 (5): 1362–70. Shamovsky, Ilya, and Evgeny Nudler. 2006. “Gene Control by Large Noncoding RNAs.” Science’s STKE: Signal Transduction Knowledge Environment 2006 (355): e40. Shangary, Sanjeev, and Shaomeng Wang. 2009. “Small-Molecule Inhibitors of the MDM2-p53 Protein-Protein Interaction to Reactivate p53 Function: A Novel Approach for Cancer Therapy.” Annual Review of Pharmacology and Toxicology 49: 223–41. Sharp, P. A. 1994. “Split Genes and RNA Splicing.” Cell 77 (6): 805–15. Shen, Yingjia, Guoli Ji, Brian J. Haas, Xiaohui Wu, Jianti Zheng, Greg J. Reese, and Qingshun Quinn Li. 2008. “Genome Level Analysis of Rice mRNA 3′-End Processing Signals and Alternative Polyadenylation.” Nucleic Acids Research 36 (9): 3150–61. Shi, X., M. Chang, A. J. Wolf, C. H. Chang, A. A. Frazer-Abel, P. A. Wade, Z. F. Burton, and J. A. Jaehning. 1997. “Cdc73p and Paf1p Are Found in a Novel RNA Polymerase II- Containing Complex Distinct from the Srbp-Containing Holoenzyme.” Molecular and Cellular Biology 17 (3): 1160–69. Shi, Yongsheng. 2012. “Alternative Polyadenylation: New Insights from Global Analyses.” RNA 18 (12): 2105–17. Shi, Yongsheng, Dafne Campigli Di Giammartino, Derek Taylor, Ali Sarkeshik, William J. Rice, John R. Yates III, Joachim Frank, and James L. Manley. 2009. “Molecular Architecture of the Human Pre-mRNA 3′ Processing Complex.” Molecular Cell 33 (3): 365–76. Shtutman, Michael, Bey-Dih Chang, Gary P. Schools, and Eugenia V. Broude. 2017. “Cellular Model of p21-Induced Senescence.” Methods in Molecular Biology 1534: 31–39. Shyu, A. B., J. G. Belasco, and M. E. Greenberg. 1991. “Two Distinct Destabilizing Elements in the c-Fos Message Trigger Deadenylation as a First Step in Rapid mRNA Decay.” Genes & Development 5 (2): 221–31. Singh, Irtisha, Shih-Han Lee, Adam S. Sperling, Mehmet K. Samur, Yu-Tzu Tai, Mariateresa Fulciniti, Nikhil C. Munshi, Christine Mayr, and Christina S. Leslie. 2018. “Widespread Intronic Polyadenylation Diversifies Immune Cell Transcriptomes.” Nature Communications 9 (1): 1716. Siomi, Mikiko C., Kaoru Sato, Dubravka Pezic, and Alexei A. Aravin. 2011. “PIWI-Interacting Small RNAs: The Vanguard of Genome Defence.” Nature Reviews. Molecular Cell Biology 12 (4): 246–58. Smibert, Peter, Pedro Miura, Jakub O. Westholm, Sol Shenker, Gemma May, Michael O. Duff, Dayu Zhang, et al. 2012. “Global Patterns of Tissue-Specific Alternative Polyadenylation in Drosophila.” Cell Reports 1 (3): 277–89. Smith, J. S., I. Tachibana, U. Pohl, H. K. Lee, U. Thanarajasingam, B. P. Portier, K. Ueki, et al. 2000. “A Transcript Map of the Chromosome 19q-Arm Glioma Tumor Suppressor Region.” Genomics 64 (1): 44–50. Soria, Gaston, Juliana Speroni, Osvaldo L. Podhajcer, Carol Prives, and Vanesa Gottifredi. 2008. “p21 Differentially Regulates DNA Replication and DNA-Repair-Associated Processes after UV Irradiation.” Journal of Cell Science 121 (19): 3271–82. Srikantan, Subramanya, and Myriam Gorospe. 2012. “HuR Function in Disease.” Frontiers in Bioscience 17 (January): 189–205. Subramanian, Murugan, Matthew F. Jones, and Ashish Lal. 2013. “Long Non-Coding RNAs Embedded in the Rb and p53 Pathways.” Cancers 5 (4): 1655–75.

141

Sundaramoorthy, Sriramkumar, María Dolores Vázquez-Novelle, Sergey Lekomtsev, Michael Howell, and Mark Petronczki. 2014. “Functional Genomics Identifies a Requirement of Pre-mRNA Splicing Factors for Sister Chromatid Cohesion.” The EMBO Journal 33 (22): 2623–42. Szczepińska, Teresa, Katarzyna Kalisiak, Rafal Tomecki, Anna Labno, Lukasz S. Borowski, Tomasz M. Kulinski, Dorota Adamska, Joanna Kosinska, and Andrzej Dziembowski. 2015. “DIS3 Shapes the RNA Polymerase II Transcriptome in Humans by Degrading a Variety of Unwanted Transcripts.” Genome Research 25 (11): 1622–33. Takagaki, Y., R. L. Seipelt, M. L. Peterson, and J. L. Manley. 1996. “The Polyadenylation Factor CstF-64 Regulates Alternative Processing of IgM Heavy Chain Pre-mRNA during B Cell Differentiation.” Cell 87 (5): 941–52. Takano, S., R. Wadhwa, Y. Mitsui, and S. C. Kaul. 2001. “p53-Independent Upregulation of p21WAF1 in NIH 3T3 Cells Malignantly Transformed by Mot-2.” Cell Research 11 (1): 55–60. Tardiff, Daniel F., Scott A. Lacadie, and Michael Rosbash. 2006. “A Genome-Wide Analysis Indicates That Yeast Pre-mRNA Splicing Is Predominantly Posttranscriptional.” Molecular Cell 24 (6): 917–29. Thomas, Christie P., Janet I. Andrews, and Kang Z. Liu. 2007. “Intronic Polyadenylation Signal Sequences and Alternate Splicing Generate Human Soluble Flt1 Variants and Regulate the Abundance of Soluble Flt1 in the Placenta.” The FASEB Journal, July. https://doi.org/10.1096/fj.07-8809com. Thomas, M., D. Pim, and L. Banks. 1999. “The Role of the E6-p53 Interaction in the Molecular Pathogenesis of HPV.” Oncogene 18 (53): 7690–7700. Tian, Bin, Jun Hu, Haibo Zhang, and Carol S. Lutz. 2005. “A Large-Scale Analysis of mRNA Polyadenylation of Human and Mouse Genes.” Nucleic Acids Research 33 (1): 201–12. Tian, Bin, and James L. Manley. 2013. “Alternative Cleavage and Polyadenylation: The Long and Short of It.” Trends in Biochemical Sciences 38 (6): 312–20. ———. 2017. “Alternative Polyadenylation of mRNA Precursors.” Nature Reviews. Molecular Cell Biology 18 (1): 18–30. Tian, Bin, Zhenhua Pan, and Ju Youn Lee. 2007. “Widespread mRNA Polyadenylation Events in Introns Indicate Dynamic Interplay between Polyadenylation and Splicing.” Genome Research 17 (2): 156–65. Tosi, M., R. A. Young, O. Hagenbüchle, and U. Schibler. 1981. “Multiple Polyadenylation Sites in a Mouse Alpha-Amylase Gene.” Nucleic Acids Research 9 (10): 2313–23. Ulitsky, Igor, Alena Shkumatava, Calvin H. Jan, Alexander O. Subtelny, David Koppstein, George W. Bell, Hazel Sive, and David P. Bartel. 2012. “Extensive Alternative Polyadenylation during Zebrafish Development.” Genome Research 22 (10): 2054–66. Valin, Alvaro, Jian Ouyang, and Grace Gill. 2013. “Transcription Factor Sp3 Represses Expression of p21CIP1 via Inhibition of Productive Elongation by RNA Polymerase II.” Molecular and Cellular Biology 33 (8): 1582–93. Vanacova, Stepanka, and Richard Stefl. 2007. “The Exosome and RNA Quality Control in the Nucleus.” EMBO Reports 8 (7): 651–57. Venter, J. C., M. D. Adams, E. W. Myers, P. W. Li, R. J. Mural, G. G. Sutton, H. O. Smith, et al. 2001. “The Sequence of the Human Genome.” Science 291 (5507): 1304–51. Vermezovic, Jelena, Marek Adamowicz, Libero Santarpia, Alessandra Rustighi, Mattia Forcato, Caterina Lucano, Lucia Massimiliano, et al. 2015. “Notch Is a Direct Negative Regulator of the DNA-Damage Response.” Nature Structural & Molecular Biology 22 (5): 417–24. Volders, Pieter-Jan, Kenny Helsens, Xiaowei Wang, Björn Menten, Lennart Martens, Kris Gevaert, Jo Vandesompele, and Pieter Mestdagh. 2013. “LNCipedia: A Database for Annotated Human lncRNA Transcript Sequences and Structures.” Nucleic Acids Research 41 (Database issue): D246–51.

142

Wahle, E. 1995. “Poly (A) Tail Length Control Is Caused by Termination of Processive Synthesis.” The Journal of Biological Chemistry. http://www.jbc.org/content/270/6/2800.short. Wakiyama, Motoaki, Koji Takimoto, Osamu Ohara, and Shigeyuki Yokoyama. 2007. “Let-7 microRNA-Mediated mRNA Deadenylation and Translational Repression in a Mammalian Cell-Free System.” Genes & Development 21 (15): 1857–62. Waldman, T., K. W. Kinzler, and B. Vogelstein. 1995. “p21 Is Necessary for the p53-Mediated G1 Arrest in Human Cancer Cells.” Cancer Research 55 (22): 5187–90. Wallace, Edward W. J., and Jean D. Beggs. 2017. “Extremely Fast and Incredibly Close: Cotranscriptional Splicing in Budding Yeast.” RNA 23 (5): 601–10. Wang, H. U., Z. F. Chen, and D. J. Anderson. 1998. “Molecular Distinction and Angiogenic Interaction between Embryonic Arteries and Veins Revealed by Ephrin-B2 and Its Receptor Eph-B4.” Cell 93 (5): 741–53. Wang, J. A., S. Fan, R. Q. Yuan, Y. X. Ma, Q. Meng, I. D. Goldberg, and E. M. Rosen. 1999. “Ultraviolet Radiation down-Regulates Expression of the Cell-Cycle Inhibitor p21WAF1/CIP1 in Human Cancer Cells Independently of p53.” International Journal of Radiation Biology 75 (3): 301–16. Wang, Qianben, Jason S. Carroll, and Myles Brown. 2005. “Spatial and Temporal Recruitment of Androgen Receptor and Its Coactivators Involves Chromosomal Looping and Polymerase Tracking.” Molecular Cell 19 (5): 631–42. Wang, W., H. Furneaux, H. Cheng, M. C. Caldwell, D. Hutter, Y. Liu, N. Holbrook, and M. Gorospe. 2000. “HuR Regulates p21 mRNA Stabilization by UV Light.” Molecular and Cellular Biology 20 (3): 760–69. Weill, Laure, Eulàlia Belloc, Felice-Alessio Bava, and Raúl Méndez. 2012. “Translational Control by Changes in poly(A) Tail Length: Recycling mRNAs.” Nature Structural & Molecular Biology 19 (June): 577. Westmark, Cara J., Virginia B. Bartleson, and James S. Malter. 2005. “RhoB mRNA Is Stabilized by HuR after UV Light.” Oncogene 24 (3): 502–11. Williamson, Laura, Marco Saponaro, Stefan Boeing, Philip East, Richard Mitter, Theodoros Kantidakis, Gavin P. Kelly, et al. 2017. “UV Irradiation Induces a Non-Coding RNA That Functionally Opposes the Protein Encoded by the Same Gene.” Cell 168 (5): 843– 55.e13. Wu, Ligang, Jihua Fan, and Joel G. Belasco. 2006. “MicroRNAs Direct Rapid Deadenylation of mRNA.” Proceedings of the National Academy of Sciences of the United States of America 103 (11): 4034–39. Wu, Xiaohui, Yumin Zhang, and Qingshun Q. Li. 2016. “PlantAPA: A Portal for Visualization and Analysis of Alternative Polyadenylation in Plants.” Frontiers in Plant Science 7 (June): R106. Xiao, Mei-Sheng, Bin Zhang, Yi-Sheng Li, Qingsong Gao, Wei Sun, and Wei Chen. 2016. “Global Analysis of Regulatory Divergence in the Evolution of Mouse Alternative Polyadenylation.” Molecular Systems Biology 12 (12): 890. Xiong, Yue, Gregory J. Hannon, Hui Zhang, David Casso, Ryuji Kobayashi, and David Beach. 1991. “p21 Is a Universal Inhibitor of Cyclin Kinases.” Ried 49: 370. Yang, Yan, Wencheng Li, Mainul Hoque, Liming Hou, Steven Shen, Bin Tian, and Brian D. Dynlacht. 2016. “PAF Complex Plays Novel Subunit-Specific Roles in Alternative Cleavage and Polyadenylation.” PLoS Genetics 12 (1): e1005794. Yan, Jun, and Thomas G. Marr. 2005. “Computational Analysis of 3’-Ends of ESTs Shows Four Classes of Alternative Polyadenylation in Human, Mouse, and Rat.” Genome Research 15 (3): 369–75.

143

Yao, Jie, M. Behfar Ardehali, Christopher J. Fecko, Watt W. Webb, and John T. Lis. 2007. “Intranuclear Distribution and Local Dynamics of RNA Polymerase II during Transcription Activation.” Molecular Cell 28 (6): 978–90. Yarbro, J. W. 1992. “Mechanism of Action of Hydroxyurea.” Seminars in Oncology 19 (3 Suppl 9): 1–10. Yeo, Gene, and Christopher B. Burge. 2004. “Maximum Entropy Modeling of Short Sequence Motifs with Applications to RNA Splicing Signals.” Journal of Computational Biology: A Journal of Computational Molecular Cell Biology 11 (2-3): 377–94. Yoda, Mayuko, Daniel Cifuentes, Natsuko Izumi, Yuriko Sakaguchi, Tsutomu Suzuki, Antonio J. Giraldez, and Yukihide Tomari. 2013. “Poly(A)-Specific Ribonuclease Mediates 3’-End Trimming of Argonaute2-Cleaved Precursor microRNAs.” Cell Reports 5 (3): 715–26. Yoon, Je-Hyun, Kotb Abdelmohsen, Jiyoung Kim, Xiaoling Yang, Jennifer L. Martindale, Kumiko Tominaga-Yamanaka, Elizabeth J. White, et al. 2013. “Scaffold Function of Long Non- Coding RNA HOTAIR in Protein Ubiquitination.” Nature Communications 4: 2939. Yoon, Je-Hyun, Kotb Abdelmohsen, Subramanya Srikantan, Xiaoling Yang, Jennifer L. Martindale, Supriyo De, Maite Huarte, Ming Zhan, Kevin G. Becker, and Myriam Gorospe. 2012. “LincRNA-p21 Suppresses Target mRNA Translation.” Molecular Cell 47 (4): 648–55. Zavolan, Mihaela, and Erik van Nimwegen. 2006. “The Types and Prevalence of Alternative Splice Forms.” Current Opinion in Structural Biology 16 (3): 362–67. Zeng, Cheng-Wu, Xing-Ju Zhang, Kang-Yu Lin, Hua Ye, Shu-Ying Feng, Hua Zhang, and Yue- Qin Chen. 2012. “Camptothecin Induces Apoptosis in Cancer Cells via microRNA-125b- Mediated Mitochondrial Pathways.” Molecular Pharmacology 81 (4): 578–86. Zhang, Haibo, Ju Youn Lee, and Bin Tian. 2005. “Biased Alternative Polyadenylation in Human Tissues.” Genome Biology 6 (12): R100. Zhang, Huimin, Frank Rigo, and Harold G. Martinson. 2015. “Poly(A) Signal-Dependent Transcription Termination Occurs through a Conformational Change Mechanism That Does Not Require Cleavage at the Poly(A) Site.” Molecular Cell 59 (3): 437–48. Zhang, Xiaokan, Emral Devany, Michael R. Murphy, Galina Glazman, Mirjana Persaud, and Frida E. Kleiman. 2015. “PARN Deadenylase Is Involved in miRNA-Dependent Degradation of TP53 mRNA in Mammalian Cells.” Nucleic Acids Research 43 (22): 10925–38. Zheng, Dinghai, Xiaochuan Liu, and Bin Tian. 2016. “3’READS+, a Sensitive and Accurate Method for 3' End Sequencing of Polyadenylated RNA.” RNA 22 (10): 1631–39. Zhou, Hua-Lin, Cuiyu Geng, Guangbin Luo, and Hua Lou. 2013. “The p97–UBXD8 Complex Destabilizes mRNA by Promoting Release of Ubiquitinated HuR from mRNP.” Genes & Development 27 (9): 1046–58.

144