UNIVERSIDADE DE LISBOA FACULDADE DE CIÊNCIAS DEPARTAMENTO DE BIOLOGIA ANIMAL

INFLUENCE OF ERF3 A/GSPT1 GENE EXPRESSI ON ON SUSCEPTIBILITY TO CARCINOGENESIS

JOANA FERREIRA TOMÉ MALTA VACAS

Tese orientada por: Professor Doutor Rui Miguel Brito Professora Doutora Maria Manuela Coelho

DOUTORAMENTO EM BIOLOGIA (Biologia Molecular) 2009

This study was supported by the Fundação Para a Ciência e a Tecnologia: PhD fellowship SFRH/BD/21468/2005, projects POCTI/MGI/40071/2001 and PTDC/SAU-GMG/67031/2006.

This dissertation should be cited as: Malta-Vacas J. (2009) Influence of eRF3a/GSPT1 gene expression on susceptibility to carcinogenesis. PhD Thesis, University of Lisbon, Portugal.

“O erro é a noite dos espíritos e a armadilha da inocência” Luc de Clapiers, Marquês de Vauvenargues

NOTAS PRÉVIAS

Nos termos do n.º 1 do Artigo 40, Capítulo V, do Regulamento de Estudos Pós-Graduados da Universidade de Lisboa, publicado no Diário da República – II Série N.º 153, de 5 de Julho de 2003, esclarece-se que na elaboração da presente dissertação foram usados integralmente artigos científicos já publicados (4) ou submetidos para publicação (1) em revistas indexadas de circulação internacional, os quais integram os Capítulos II e III da presente tese. Tendo os referidos trabalhos sido realizados em colaboração, a candidata esclarece que participou integralmente no planeamento e na elaboração de todos os trabalhos, assim como na análise e discussão dos resultados. Esclarece-se ainda que a formatação dos vários artigos que integram a presente dissertação obedece às regras das revistas em que foram publicados ou submetidos para publicação. Por este motivo, não foi possível adoptar um critério uniforme ao longo dos vários capítulos.

CONTENTS

Agradecimentos / Acknowledgements xi Resumo xv Abstract xix

1. CHAPTER I – INTRODUCTION 1

1.1. Identification of eRF3 1 1.2. Characterization of human eRF3’s genes and proteins 2 1.3. Functions of eRF3a 5 1.3.1. The canonical role of eRF3a in translation termination 5 1.3.2. Other roles translation-related 7 1.3.3. Cytoskeleton assembly 9 1.3.4. Apoptosis regulation 10 1.4. Cancer 11 1.4.1. Translation and cancer 15 1.4.2. Trinucelotide repeats and cancer 17 1.5. Aims and Thesis Structure 19 1.6. References 21

2. CHAPTER II – ERF3 A/GSPT1 POLYMORPHISMS AND GENE EXPRESSION 33 ALTERATIONS IN CANCER

2.1. Paper 1 35 Malta-Vacas J, Ramos S, Aires C, Costa P, Conde AR, Martins AP, Monteiro C, Brito M. (2005) Differential expression of the eukaryotic release factor 3 (eRF3/GSPT1) according to gastric cancer histological type. J Clin Pathol 58: 621–625.

2.2. Paper 2 41 Brito M, Malta-Vacas J, Aires C, Costa P, Carmona B, Gaspar G, Monteiro C. (2005) Polyglycine Expansions in eRF3/GSPT1 are Associated With Gastric Cancer Susceptibility. Carcinogenesis 26: 2046-2049.

ix CONTENTS

3. CHAPTER III – ROLE OF ERF3 A DEREGULATION IN TUMORIGENESIS 45

3.1. Paper 3 47 Malta-Vacas J, Chauvin C, Gonçalves L, Nazaré A, Carvalho C, Monteiro C, Bagrel D, Jean-Jean O, Brito M (2009) eRF3a/GSPT1 12GGC allele increases the susceptibility for breast cancer development. Oncol Rep 21: 1551-1558.

3.2. Paper 4 55 Malta-Vacas J, Ferreira P, Monteiro C, Brito M. (submitted) eRF3a/GSPT1 (GGC)n alleles differential expression in cancer.

3.3. Paper 5 75 Malta-Vacas J, Nolasco S, Monteiro C, Soares H, Brito M (2009) Translation termination and protein folding pathway genes are not correlated in gastric cancer. Clin Chem Lab Med 47:427-31.

4. CHAPTER IV – DISCUSSION 81

4.1. Translation and cancer 82 4.2. eRF3a/GSPT1 DNA polymorphisms 83 4.2.1. eRF3a/GSPT1 polymorphisms in cancer 83 4.2.2. eRF3a/GSPT1 microssatelite polymorphism in inflammation 86 4.3. eRF3a/GSPT1 gene expression 87 4.4. eRF3a/GSPT1 as a proto-oncogene 89 4.4.1. eRF3a roles in translation 89 4.4.2. eRF3a role in cytoskeleton dynamics 91 4.4.3. eRF3a role in apoptosis and proliferation rates 93 4.5. References 95

5. CHAPTER V - FINAL REMARKS 103

x

AGRADECIMENTOS

Chegada ao fim deste percurso de trabalho de vários anos não poderia deixar de agradecer a todos quantos me ajudaram a percorrer este caminho. Para que ninguém fique esquecido, começo por agradecer a TODOS os que de alguma forma contribuíram para a realização deste trabalho. Em particular gostaria de agradecer:

Ao Professor Doutor Miguel Brito pela confiança que depositou em mim ao aceitar-me como sua aluna de doutoramento, pela ajuda, apoio e orientação, desde o início, na construção deste projecto de doutoramento e pelo trabalho que desenvolvemos nos últimos 7 anos. Pela enorme convicção, energia positiva e força de vontade, sem as quais o Grupo de Investigação da ESTESL nunca seria o que é… Obrigada pela amizade e os bons momentos partilhados. Todo este trabalho seria, sem dúvida, muito mais pobre não fossem os conhecimentos, o incentivo e o entusiasmo que me foi transmitindo.

À Professora Doutora Manuela Coelho da Faculdade de Ciências da Universidade de Lisboa por ter aceite o desafio de me aceitar como sua aluna de doutoramento, pela sua disponibilidade e pelo acompanhamento dado nas questões burocráticas/ administrativas do processo.

Ao Professor Doutor Carolino Monteiro, que ficará sempre lembrado como “Pai” deste projecto, por todo o apoio prestado desde o início até ao final deste projecto, pelo espírito crítico e entusiasmo demonstrado e transmitido ao longo destes anos.

Ao Doutor Olivier Jean-Jean, por ter aceite receber-me no seu Laboratório na Unité de Biochimie Cellulaire, Université Pierre et Marie Curie, de que resultou uma excelente colaboração entre ambos os grupos. Agradeço ao Olivier e a todos os membros da sua equipa, nomeadamente à Celine Chauvin, pelo acompanhamento de todo o trabalho que realizei em Paris e à Samia Salhi pelas dicas e sugestões quer relativas ao trabalho laboratorial, quer em relação à minha estadia naquela maravilhosa cidade!

À Fundação para a Ciência e a Tecnologia agradeço a concessão de uma bolsa de doutoramento que permitiu o desenvolvimento desta dissertação.

À Fundação Calouste Gulbenkian agradeço a concessão de bolsas de viagem que permitiram a participação em reuniões científicas internacionais e a realização do estágio na Unité de Biochimie Cellulaire, Université Pierre et Marie Curie, coordenado pelo Doutor Olivier Jean-Jean.

Aos colegas de laboratório Bruno Carmona, Cátia Aires e Patrícia Costa que me acompanharam desde o nascimento do projecto. Juntos “demos à luz” o actual Laboratório de Genética Humana da ESTESL. Obrigada por toda a ajuda no trabalho laboratorial, pela ambiente criado, pelas discussões e críticas e construtivas e pela amizade criada.

À Prof. Doutora Helena Soares por me ter recebido por um curto período no seu laboratório no IGC, e por toda a ajuda dada na produção dos anticorpos e na optimização e interpretação das imunos e dos westerns.

xi AGRADECIMENTOS

A todos os colegas e amigos que entretanto foram passando pelo Laboratório de Investigação da ESTESL e que contribuíram um pouco para o sucesso deste trabalho, não só pela ajuda com todos os pormenores laboratoriais mas principalmente pelos bons momentos de convívio. Agradeço especialmente a: Alice Melão, Ana Moleirinho, Carina Ladeira, Carla Mota, Catarina Sousa Guerreiro, Dolores Prudêncio, Elisabete Costa, Filipa Quintaneiro, Gilberto Matias, Joao Gonçalves, João Lourenço, Lourent Brault, Rui Placido, Sandra Raicar e Susana Gonçalves.

À Paula Ferreira pela enorme ajuda e apoio prestados no laboratório, pela simpatia e disponibilidade, boa disposição, e pelo excelente trabalho de colaboração ao longo destes anos.

À Prof. Doutora Ana Rita Conde da Faculdade de Farmácia da Universidade de Lisboa por toda a ajuda prestada na execução do trabalho prático e pela disponibilidade e amabilidade constantes.

Ao João Gonçalves pela grande ajuda e apoio prestado no laboratório quer na ESTESL quer mais tarde no IGC, pela disponibilidade constante, e pelo exemplo de entusiasmo e entrega à Ciência.

À Sofia Nolasco pela disponibilidade para a realização de inúmeras imunos e westerns no IGC, pela simpatia e boa disposição constantes, pelas aliquotas disto e daquilo que generosamente foram cedidas e pelas inúmeras dicas e conselhos práticos.

A todos os colegas docentes e não-docentes da ESTESL, por toda a ajuda prestada para o bom desenvolvimento deste trabalho, nas suas componentes técnicas, burocráticas e administrativas. Uma palavra especial à Luísa Veiga, pela sua boa disposição e disponibilidade constantes; ao Gilberto Matias, pela coragem e grande ajuda na luta contra as parafinas e os anticorpos; aos Prof. Fernando Belém, Prof. Ana Almeida e Prof. Renato Abreu, pela ajuda a recolha de sangue aos dadores voluntariados; à Prof. Susana Viegas por ter sido a força motriz para o início dos testes de micronúcleos e pelas simpáticas palavras de apoio; à Fernanda Dantas, Mónica Júlio, Ana Oliveira e Ruth Joaquim, pela constante disponibilidade no apoio aos laboratórios; aos colegas da Biologia e da Química que contribuíram com dicas e sugestões úteis quando nem tudo corria bem: Anita Gomes, Dulce Azevedo, Helena Soares, Lisete Fernandes, Mário Pádua, Mário Gomes, Sofia Nolasco.

A todos os médicos que gentilmente colheram e cederam as amostras e dados clínicos dos seus doentes, que constituíram o material de base para a execução do presente trabalho, nomeadamente: Dra. Sancia Ramos e Dra. Ana Paula Martins do Hospital de Santa Cruz, Dra. Marília Cravo e Dr. António Pinto do Instituto Português de Oncologia Francisco Gentil, ao Dr. Carlos Carvalho, Dra. Lucília Gonçalves e Dr. Raul Lobato-Faria e do Hospital Fernando da Fonseca. Uma palavra especial para a Dra. Lucília Gonçalves pelo esforço de envolvimento de toda a sua equipa, indispensável para os bons resultados obtidos, e ao Dr. António Pinto pela execução das análises no citometro de fluxo.

À Lisete Fernandes pela preciosa ajuda na amplificação dos plasmídeos, incluindo as células competentes, e por muitas outras dicas e sugestões úteis ao longo dos anos.

Ao Prof. Shin-Ichi Hoshino da Universidade de Tokyo, pelo generoso envio do anticorpo e péptido contra o eRF3.

À Doutora Joana Diamond por nos colocar à disposição a ajuda dos membros da sua equipa no Centro de Investigação de Patobiologia Molecular do Instituto Português de Oncologia (CIPM- IPO), assim como a utilização do equipamento; à Sofia Fragoso, pelas dicas e ajuda com o isolamento de linfócitos, à Lara e à Joana Dionísio pelas horas de trabalho no sequenciador.

xii AGRADECIMENTOS

Ao Celso Cunha do Instituto de Higiene e Medicina Tropical pela utilização do aparelho de PCR em Tempo Real da unidade que então coordenava.

Aos elementos do grupo de investigação do Professor Doutor Carolino Monteiro na Faculdade de Farmácia da Universidade de Lisboa, nomeadamente à Susana Santos, Margarida Alves, Cátia Evangelista por todo o apoio, sempre que necessário.

À Joana Morais, pela amizade que nasceu do convívio diário no meu primeiro laboratório e atravessou todos estes anos. Pelas constantes palavras de apoio e incentivo, pela grande ajuda nas questões burocráticas e processoais envolvidas no processo, e por tudo o resto.

À Cristina Luís pelos sábios conselhos de quem já passou pelas mesmas experiencias e está sempre disposto a ajudar os amigos.

A todos os meus amigos que de alguma forma me ajudaram a passar por estes anos. Sem os bons momentos de descompressão o resultado não seria o mesmo!

Ao Paulo, pelo incentivo que me deu, fazendo-me olhar para o futuro. E por ter esperado (im)pacientemente pelo fim deste projecto.

À minha família, por estar sempre presente nos momentos importantes, em especial à minha Mãe por me dar tudo o que só uma Mãe pode dar, incondicionalmente.

xiii

xiv

RESUMO

O envolvimento dos componentes da maquinaria de tradução no desenvolvimento de várias neoplasisas é hoje amplamente reconhecido, principalmente no que diz respeito a factores de iniciação e factores de alongamento da tradução. Neste contexto, os factores de tradução têm sido também encarados como potenciais alvos para a inibição da proliferação celular e consequentemente como alvos de terapia contra o cancro. O factor de terminação da tradução eucariótico 3 (eRF3) é uma pequena GTPase que se associa com o factor de terminação da tradução eucariótico 1 (eRF1) e com o GTP para formar o complexo de terminação da tradução. A proteína eRF3 humana existe em duas isoformas, designadas por eRF3a e eRF3b, codificadas respectivamente pelos genes eRF3a/GSPT1 e eRF3b/GSPT2 . Para além das funções que lhe são atribuídas no processo de tradução (terminação da tradução, reciclagem de ribossomas e iniciador da degradação do mRNA), este factor está também envolvido no controlo do ciclo celular, na organização do citoesqueleto e na regulação da apoptose. As proteínas eRF3a e eRF3b apresentam 87% de homologia, sendo a maior diferença entre ambas no seu domínio N- terminal. A extremidade amina do eRF3a apresenta uma expansão de poliglicinas codificada por uma expansão estável do tripleto GGC no exão 1 do gene eRF3a/GSPT1 . Este polimorfismo está ausente no gene eRF3b/GSPT2 . Vários genes contendo expansões de microssatélites exónicos têm sido associados ao desenvolvimento de cancro, sendo em alguns casos os polimorfismos STR (Short Tandem Repeat) relacionados com a transactivação da expressão dos genes respectivos. O principal objectivo deste trabalho foi avaliar o gene eRF3a/GSPT1 como potencial gene de susceptibilidade para o desenvolvimento de cancro. Pela análise do polimorfismo STR no gene eRF3a/GSPT1 , foram detectados cinco alelos diferentes na população portuguesa contendo 7, 9, 10, 11 e 12 repetições GGC, sendo o alelo 10GGC o mais comum (F=68.5% na população controlo saudável). O alelo mais longo (12GGC) foi detectado exclusivamente em 5.1% dos pacientes com cancro (N=411), com uma frequência alélica de 3%, correspondendo a um risco 12 vezes aumentado de desenvolvimento de cancro (OR= 11.8; SE=1.43; C.I.=0.71-195.46). Demonstrou-se que não se trata de uma mutação somática, mas sim da linha germinal, e que o alelo 12GGC está ausente na população controlo e em indivíduos com Doença de Crohn, uma doença inflamatória com elevada predisposição para o desenvolvimento de cancro colorectal. Recorrendo ao RT-PCR em Tempo Real, verificou-se que o gene eRF3a/GSPT1 se encontra sobre- expresso em vários tipos de cancro, nomeadamente em 70% dos tumores gástricos do tipo intestinal e em 44% dos tumores da mama. Mais ainda, demonstrou-se que existe uma variação significativa dos níveis de mRNA em função do tamanho dos alelos expressos, encontrando-se o alelo 12GGC sobre-expresso quer em linhas primárias de linfócitos (p<0.001) quer em células Jurkat transformadas (p<0.0001), quando comparado com o alelo 10GGC, tomado como referência. Os elevados níveis de expressão do gene eRF3a/GSPT1 detectados em tecidos

xv RESUMO

tumorais não estão relacionados com um aumento da taxa de tradução das células cancerígenas, visto que este aumento não se verifica no principal factor de terminação da tradução (eRF1). Também não foram detectadas alterações nos níveis de eRF3b/GSPT2 correlacionadas com as variações de expressão do eRF3a/GSPT1 , pelo que as alterações de expressão não serão ajustadas por um mecanismo de compensação entre as duas isoformas da proteína. A dosagem génica do eRF3a/GSPT1 foi também foi determinada através de PCR em Tempo Real mas não foram detectadas amplificações/delecções do gene em tecidos tumorais associadas às alterações nos padrões de expressão. Os níveis de metilação dos locais CpG localizados na expansão GGC foram quantificados por pirosequenciação, mas a variação de 7 a 12 repetições GGC não se encontra associada a alterações nos níveis de metilação, independentemente do tipo de tecido analisado. Assim, o mecanismo responsável pela sobre-expressão do gene continua por esclarecer. Estando envolvido em processos críticos e vitais para a célula, é de prever que alterações no domínio N-terminal do eRF3a possam ser altamente relevantes para a integridade celular. Para avaliar o efeito da variação do número de glicinas presentes no terminal amina do eRF3a foram analisados vários tipos de linhas celulares, expressando os diferentes alelos (GGC)n, e comparada a eficiência das proteínas codificadas, nas suas várias funções. Dado que a função canónica do eRF3a é como factor de terminação da tradução, utilizou-se a linha celular HEK293, que contém um gene repórter com um codão stop prematuro, para comparar a eficiência das proteínas na terminação da tradução. Sendo o gene repórter o da β- galactosidase, a determinação da quantidade desta proteína activa nas células reflete o nível de readthrough do codão SOPT prematuro no respectivo gene. Através da quantificação dos níveis de readthrough em células expressando proteínas eRF3a com 7-12 resíduos de glicina no terminal amina não foram detectadas diferenças significativas de eficiência entre as proteínas de diferentes tamanhos. Para além de outras funções relacionadas com o processo de tradução, sabe-se que o eRF3a está envolvido na passagem da fase G1 para a fase S do ciclo celular e também no controlo da apoptose. Apesar de, em ambos os casos, as vias em que o eRF3a participa não estarem ainda identificadas, pretendeu-se avaliar se proteínas com diferentes tamanhos poderiam ter eficiências diferentes nas funções que desempenham nas respectivas vias. Para tal, recorreu-se à citometria de fluxo de forma a determinar as taxas de proliferação e de apoptose em linhas primárias de linfócitos e em células Jurkat transformadas, expressando os cinco alelos diferentes. No entanto, não foram detectadas diferenças significativas entre as linhas celulares relativamente a qualquer dos parâmetros analisados quer em relação a índices de proliferação, quer no que diz respeito a taxas de apoptose. Está descrito que, em diferentes espécies, alterações de expressão ou mutações no gene eRF3 levam a malformações do fuso acromático, erros na segregação dos cromossomas durante a meiose, e bloqueio da citocinese. Sendo estes eventos potencialmente geradores de um fenótipo maligno, pretendeu-se averiguar se o tamanho da proteína teria alguma influência no seu papel

xvi RESUMO

de regulação do citoesqueleto. Através da realização de um teste de micronúcleos com bloqueio da citocinese (CBMN assay), foi determinada a frequência de micronúcleos (MN) em células binucleadas, em linhas celulares com diferentes genótipos. Os nossos resultados demonstram que as linhas celulares que expressam alelos mais longos, especificamente as que expressam o alelo 12GGC, apresentam maiores frequências de MN em células binucleadas, possivelmente como resultado de defeitos na formação do fuso acromático. Em consequência, é de prever que ocorra uma acumulação de erros a nível dos cromossomas, característica de células cancerígenas, levando à promoção da tumorigenese. Apesar do envolvimento do gene eRF3a/GSPT1 no desenvolvimento de cancro não estar ainda totalmente esclarecido, os nossos resultados indicam que a presença do alelo 12GGC por si só poderá ser considerado como marcador de susceptibilidade para o desenvolvimento de cancro. Uma melhor compreensão dos mecanismos de regulação da expressão do gene eRF3a/GSPT1 e a sua associação com a proliferação celular poderá também contribuir para progressos quer ao nível do prognóstico da doença quer a nível de aplicações terapêuticas. Em conclusão, os nossos resultados indicam que o gene eRF3a/GSPT1 deve ser considerado um potencial proto-oncogene. Espera-se que, no seu todo, esta dissertação tenha contribuído para o desenvolvimento de futuras investigações sobre a regulação da expressão do gene eRF3a/GSPT1 e a sua contribuição na génese tumoral e possa vir a melhorar o nosso conhecimento sobre o diagnóstico, prognóstico e tratamento de cancro.

Palavras chave: eRF3a/GSPT1 , cancro, expansão GGC, expressão génica, proto-oncogene

xv

xviii

ABSTRACT

The eukaryotic release factor 3 (eRF3) associates with eRF1 in a complex that mediates translation termination. In addition to its roles in translation, eRF3 is also involved in cell cycle regulation, apoptosis and cytoskeleton assemble. Human eRF3 has two distinct isoforms, eRF3a and eRF3b, encoded by eRF3a/GSPT1 and eRF3b/GSPT2 genes. eRF3a/GSPT1 contains a stable (GGC)n expansion coding for proteins with different N-terminal extremities. We identified five alleles encoding 7, 9, 10, 11 and 12 GGC repeats in the Portuguese population, being the 10GGC allele the most frequent (F= 68.5% in the control population). The longer allele (12GGC) was exclusively detected in 5.1% of the cancer patients (N=411) with an allele frequency of 3%, corresponding to a 12-fold increased cancer risk. Our results show that the mRNA levels of eRF3a/GSPT1 are overexpressed in a significant proportion of different types of cancer. Moreover, the transcript levels of eRF3a/GSPT1 show variation between alleles, being the 12GGC allele significantly overexpressed (p<0.001). The levels of eRF3a/GSPT1 transcription are not associated with eRF3a/GSPT1 amplification neither with the methylation pattern of the GGC expansion region. Using an in vivo assay for readthrough efficiency, we do not detect any difference in the activity of the eRF3a proteins encoded by the five different eRF3a/GSPT1 alleles. Also, no differences in the levels of apoptosis and proliferation rates were found between cells lines. Finally, using a cytokinesis-block micronucleos assay, we show that cells with the longer alleles have higher frequencies of MN, which is probably a result of defects in mitotic spindle formation. Although the connection between eRF3a/GSPT1 and tumorigenesis is not completely elucidated, our data suggests that the presence of the 12GGC allele provides a novel risk marker for cancer. Taken together, our results show that eRF3a should be considered as a potential proto-oncogene.

Key-words: eRF3a/GSPT1 , cancer, GGC repeats, gene expression, proto-oncogene

xix

1. CHAPTER I

INTRODUCTION

1.1. Identification of eRF3

Long before the identification of the eukaryotic Release Factor 3 (eRF3), it was known that the translation termination process in eukaryotes was GTP-dependent. However, no GTP binding motif was identified in eRF1, the main factor acting in translation termination, which suggested the existence of an additional unidentified protein involved in the process. This suspicion was further reinforced by the knowledge of the prokaryotic termination factor RF3, which has no release activity by itself, being a GTP stimulator of the termination step of translation (Zhouravleva et al., 1995). In 1988, the Japanese group from Kikuchi isolated a new temperature sensitive mutant strain of Saccharomyces cerevisae, gst1 (G-to-S transition), which affected the G1-to-S phase transition of the cell cycle. A DNA clone complementing the gst1-1 mutation was isolated from a yeast gene library and the gene product was a protein of ~76 KDa which contained consensus sequence for GTPases and had extensive homology to polypeptide chain elongation factor EF1 α ( Kikuchi et al., 1988). In the same year, Kushnirov’s group in Russia cloned the sup35 gene (also named SUP2 ) from S. cerevisae when looking for omnipotent suppressor mutants. Mutations in both GST1 and SUP35 increased the level of translation ambiguity, suggesting that the gene product could be a regulator of translation accuracy. Both turned out to be the same gene. One year later, the Japanese group cloned the human homologue gene ( GST1-Hs ) from the cDNA library of human KB cells (Hoshino et al., 1989). This gene was latter renamed GSPT1 and mapped on human chromosome 16p13.1 (Ozawa et al., 1992). In this study, the authors also showed the existence of a homologous gene on the X chromosome. In 1995, it was demonstrated that the Sup-35 like protein from Xenopus laevis directly interacts with the Sup45 (eRF1) and enhances its activity in a GTP-dependent manner (Zhouravleva et al., 1995). Thus, the gene product was finally named eRF3, following the nomenclature from the prokaryote factors.

1 CHAPTER I | INTRODUCTION

Later, Hoshino et al. (1998) isolated two mouse GSPT genes, the counterpart of human GSPT1 and a novel member of the family, GSPT2 . Both protein products interact with eRF1 to function as eRF3 in mammalian translation termination. Subsequently, the human GSPT2 gene has been mapped in Xp11.21-23 (Hansen et al., 1999), and the protein encoded characterized and described as eRF3b (Jakobsen et al., 2001). Despite the diversity of names that were given to these genes and encoded proteins during the past two decades, it is now consensual to call eRF3a and eRF3b to the mammalian proteins, and eRF3a/GSPT1 and eRF3b/GSPT2 to the respective genes. This is the terminology that will be used in the present dissertation.

1.2. Characterization of human eRF3’s genes and proteins

Human eRF3 has two distinct isoforms, eRF3a and eRF3b, encoded by eRF3a/GSPT1 and eRF3b/GSPT2 genes, located in 16p13.1 (Ozawa et al., 1992) and Xp11.21-23 (Hansen et al., 1999), respectively. It was recently proposed that eRF3b/GSPT2 was originated through retrotransposition of processed eRF3a/GSPT1 . The putative eRF3b/GSPT2 retroposon included a copy of the endogenous eRF3a/GSPT1 5’UTR sequence, therefore being a functional retrogene (Zhouravleva et al., 2006). eRF3a/GSPT1 contains 15 exons and spans along 43,27Kb in chromosome 16p (Figure 1). Although the promoter region(s) remains to be characterized, there are two alternative initiation codons identified. Even so, it was demonstrated that translation is initiated at the first AUG encountered at the 5' end of eRF3a/GSPT1 (Jean-Jean et al., 1996). The corresponding mRNA (Accession Number: NM_002094; 2585 bp) is ubiquitously expressed in all tissues, and its level varies during the cell cycle, being its expression inducible under growth stimulation (Hoshino et al., 1998).

16p13.1 43.27 Kb reverse strand

Figure 1: Transcript structure of eRF3a/GSPT1 (Src: http://www.ensembl.org/Homo_sapiens/geneview?gene=ENSG00000103342)

eRF3b/GSPT2 is an intronless gene that lies upon 2,5Kb in chromosome Xp (Figure 2). eRF3b/GSPT2 mRNA (NM_018094; 2503 bp) is poorly expressed in most mouse tissues tested except the brain, and does not fluctuate during the cell cycle (Hoshino et al., 1998). It’s expression in human tissues is still not clearly characterized.

2 CHAPTER I | INTRODUCTION

Xp11.21-23

forward strand 2.5 Kb

Figure 2: Transcript structure of eRF3b/GSPT2 (Src: http://www.ensembl.org/Homo_sapiens/geneview?gene=ENSG00000189369 )

The coding sequence of both genes share 88% homology, being the most important difference in the nucleotide sequences the presence of a GGC expansion close to the initiation codon in eRF3a/GSPT1 that eRF3b/GSPT2 lacks. The eRF3 proteins consist of three main regions, a non-homologous amino (N) terminal domain (~200 residues), a middle (M) domain, and a conserved EF1 α-like carboxyl (C) terminal domain of 428 residues (see Figure 3 for details). The three domains were defined based on amino acid features and functions. The amino acid sequence of the human eRF3a protein (Hoshino et al., 1989) presents extensive homology with other eukaryotes like the Xenopus laevis (Zhouravleva et al., 1995), Sacaromices cerevisae (Kushnirov et al., 1988), Pinchia pinus (Kushnirov et al., 1990), Mus musculus (Hoshino et al., 1998) and Podospora anserina (Gagny & Silar, 1998). All these proteins exhibit GTP-binding motifs in the C-terminal domain, which is similar to EF1 α (Kushnirov et al., 1988) and to the prokaryotic RF3 (Grentzmann et al., 1994). However, eukaryotic eRF3 and the prokaryotic counterpart have a distinctive feature: the gene encoding the prokaryotic RF3 is nonessential (Grentzmann et al., 1994) while at least the C-domain of the eukaryotic eRF3 has been shown to be essential for cell viability in different species, including Homo sapiens (Kushnirov et al., 1988; Gagny & Silar, 1998; Frolova et al., 1996). The C-terminal region of eRF3 proteins is highly conserved through evolution, and carries the four canonical GTP-binding motifs of the GTPase superfamily. The N-terminal region varies in both length and sequence among species.

3 CHAPTER I | INTRODUCTION

1 100 200 300 400 500 600 700 K210 M1 M139 h_eRF3a GGGG (637)

M1 M138 K208

m_eRF3a GGGG (635)

M1 M130 K201

h_eRF3b (632) M1 M136 K205 m_eRF3b (632)

M1 M124 K258 y_eRF3 QQQQ (685)

M1 M75 K146 x_eRF3 GGGG (573)

N M C

eEF1 ααα−α−−−like domain

m_eEF1 ααα G1 G2 G3 G4 (461)

Figure 3: Schematic representation of the eRF3 family. Proteins belonging to the eRF3 family could be divided into three regions: an amino terminal non-conserved region (N), a median domain (M) of unknown function and a homologous C-terminal domain (C). h: H. sapiens ; m: M. musculus; y: S. cerevisae ; x: Xenopus laexis .

The human eRF3a and eRF3b protein sequences are about 87% identical (Figure 4) being the differences in amino acid sequence concentrated near the amino terminus. The N-domain of eRF3a is rich in acidic amino acids and contains a high percentage of Pro, Ser and Gly residues (10%, 15% and 20%, respectively). Also, eRF3a includes a stable polyglycine expansion encoded by a (GGC)n tract in eRF3a/GSPT1 gene, with five different known alleles (Riggins et al., 1992; see chapter 1.5 for details). eRF3a is abundant in all tissues, while eRF3b expression pattern still needs further elucidation, although it was reported to be absent in the majority of human cell lines tested (Chauvin et al., 2005). From the first functional studies reported, the C-terminal domain of eRF3 has been described as essential for eRF1 binding and sufficient for the protein’s role as a translation termination factor, while the N-terminal domain remained poorly understood (Ter-Avanesyan et al., 1993; Zhouravleva et al., 1995; Kisselev & Frolova, 1995; Mugnier & Tuite, 1999) being sometimes viewed as functionally nonessential (Merkulova et al., 1999).

4 CHAPTER I | INTRODUCTION

1.3. Functions of eRF3a

1.3.1. The canonical role of eRF3a in translation termination

Eukaryotic translation termination is governed by two release factors, eRF1 and eRF3. These factors associate in a complex which binds to the ribosomal A site. eRF1 is the key factor of translation termination, recognising the three stop codons in the mRNA (UAA, UAG and UGA), catalyzing the ester bond hydrolysis of the peptidyl-tRNA and promoting the release of the nascent peptide chain. eRF3 is a small GTPase protein that enhances eRF1 activity (Zhouravleva et al., 1995). Hoshino et al. (1998) demonstrated that both mammalian eRF3a and eRF3b can interact with eRF1. Surprisingly, it was reported later that mouse eRF3b, but not eRF3a, could substitute for yeast eRF3 in vivo (Le Goff et al., 2002), which possible means that in mammalian cells eRF3a and eRF3b share the multiple functions fulfilled by yeast’s eRF3 (Inge-Vechtomov et al., 2003). GTP hydrolysis is required for fast and efficient termination of translation (Mitkevich et al., 2006). It was demonstrated that eRF3 is a GTP-binding protein capable of a negligible, if any, intrinsic GTPase activity that is greatly stimulated by the joint action of eRF1 and the ribosome (Salas- Marco & Bedwell, 2004). Neither eRF1 nor the ribosome displays this effect de per se (Frolova et al., 1996). Thus, eRF3 functions as a GTPase in the quaternary complex with the ribosome, eRF1, and GTP. Binding of eRF3 to eRF1, as revealed in vivo and in vitro (Stansfield et al., 1995; Zhouravleva et al., 1995), is mediated by the C-terminal domains of both proteins (Ebihara & Nakamura, 1999; Merkulova et al., 1999; Kononenko et al., 2008). This finding was further reinforced by Chauvin et al. (2005) observations that X. laevis eRF3, which is highly homologous to eRF3b in its N-terminal extension, can substitute for human eRF3a. In contrast, neither the entire S. cerevisiae eRF3, which is highly divergent from human and Xenopus eRF3’s in the N- terminal domain, nor the N-terminally truncated form of S. cerevisiae eRF3 carrying the conserved C terminal domain only, efficiently substitutes eRF3a in termination. The crystal structure of the eEF1 α− like region of eRF3 from S. pombe led to the identification of the eRF1 binding region (Figure 4) and revealed that the N-terminal extension, rich in acidic amino acids, can block the proposed eRF1 binding site, potentially regulating eRF1 binding to eRF3 in a competitive manner (Kong et al., 2004).

5 CHAPTER I | INTRODUCTION

h_eRF3a MDPGSGGGGG GGGGGGSSSG SSSSDSAPDC WDQADMEAPG PGPCGGGGS- ---LAAA--- AEAQRENLSA m_eRF3a MDPSSGGGGG GGGGGSSSS- ---SDSAPDC WDQTDMEAPG PGPCGGGGSG SGSMAAV--- AEAQRENLSA h_eRF3b M------DSG SSSSDSAPDC WDQVDMESPG SAPSGDGVS- ----SAV--- AEAQREPLSS m_eRF3b M------DLG SSS-DSAPDC WDQVDMEAPG SAPSGDGIAP AAMAAAEAAE AEAQRKHLSL Sc_eRF3 M---SDSNQG NNQQNYQQYS QNGNQQQGNN RYQGYQAYNA QAQPAGGYYQ NYQGYSGYQQ GGYQQYNPDA

h_eRF3a AFSRQLNVNA KPF VPNVH-- -AAEFVP------SF--- --LRG----- PAAPP–PPVG GAANN--HGA m_eRF3a AFSRQLNVNA KPFVPNVH-- -AAEFVP------SF--- --LRG----- PAQPPLSPAG AAGGD--HGA h_eRF3b AFSRKLNVNA KPFVPNVH-- -AAEFVP------SF--- --LRG----- PTQPPTL-PA GSGSNDETCT m_eRF3b AFSSQLNIHA KPFVPSVS-- -AAEFVP------SF--- --LPG----- SAQPPAPTAS SCDETCIGGA Sc_eRF3 GYQQQYNPQG GYQQYNPQGG YQQQFNPQGG RGNYKNFNYN NNLQGYQAGF QPQSQGMSLN DFQKQQKQAA

h_eRF3a GSGAGG-R-- ---AAPVESS QEEQSL-C-E G--SNSAVSM ELSEPIVENG ETE--MSPEE SWEHKEEISE m_eRF3a GSGAGG-P-- ---SEPVESS QD-QS--C-E G--SNSTVSM ELSEPVVENG ETE--MSPEE SWEHKEEISE h_eRF3b GAGYPQ-GKR MGRGAPVEPS REEPLVSL-E G--SNSAVTM ELSEPVVENG EVE--MALEE SWEHSKEVSE m_eRF3b GEPEGK-RME --WGAPVEPS KDGPLVS-WE G--SSSVVTM ELSEPVVENG EVE--MALEE SWEL-KEVSE Sc_eRF3 PKPKKTLKLV SSSGIKLANA TKKVGTKPAE SDKKEEEKSA ETKEPTKEPT KVEEPVKKEE KPVQTEEKTE G1 h_eRF3a AE---PGGGS LGDGRPPEES AHEMMEEEEE IPKPKSVVAP PGAPK----- KEHVN VVFIG HVDAGKSTIG m_eRF3a AE---PGGGS SGDGRPPEES TQEMMEEEEE IPKPKSAVAP PGAPK----- KEHVN VVFIG HVDAGKSTIG h_eRF3b AE---PGGGS SGDSGPPEES GQEMMEEKEE IRKSKSVIVP SGAPK----- KEHVN VVFIG HVDAGKSTIG m_eRF3b AK---PEA-S LGDAGPPEES VKEVMEEKEE VRKSKSVSIP SGAPK----- KEHVN VVFIG HVDAGKSTIG Sc_Erf3 EKSELPKVED LKISESTHNT NNANVTSADA LIKEQEEEVD DEVVNDMFGG KDHVS LIFMG HVDAGKSTMG G2 G3 h_eRF3a GQIMYLTGMV DKRTLEKYER EAKEKNRETW YLSWAL DTNQ EERDKGKTVE VGR AYFETEK KH FTILDAPG m_eRF3a GQIMYLTGMV DKRTLEKYER EAKEKNRETW YLSWAL DTNQ EERDKGKTVE VGR AYFETEK KH FTILDAPG h_eRF3b GQIMFLTGMV DKRTLEKYER EAKEKNRETW YLSWAL DTNQ EERDKGKTVE VGR AYFETEK KH FTILDAPG m_eRF3b GQIMFLTGMV DRRTLEKYER EAKEKNRETW YLSWAL DTNQ EERDKGKTVE VGR AYFETEK KH FTILDAPG Sc_eRF3 GNLLYLTGSV DKRTIEKYER EAKDAGRQGW YLSWVM DTNK EERNDGKTIE VGK AYFETEK RR YTILDAPG G4 h_eRF3a HKSF VPNMIG GASQADLAVL VISARKGEFE TGFEKGGQTR EHAMLAKTAG VKHL IVLINK MDDP TVNWSN M_eRF3a HKSF VPNMIG GASQADLAVL VISARKGEFE TGFEKGGQTR EHAMLAKTAG VKHL IVLINK MDDP TVNWSN h_eRF3b HKSF VPNMIG GASQADLAVL VISARKGEFE TGFEKGGQTR EHAMLAKTAG VKHL IVLINK MDDP TVNWSI m_eRF3b HKSF VPNMIG GASQADLAVL VISARKGEFE TGFEKGGQTR EHAMLAKTAG VKYL IVLINK MDDP TVDWSS Sc_eRF3 HKMY VSEMIG GASQADVGVL VISARKGEYE TGFERGGQTR EHALLAKTQG VNKM VVVVNK MDDP TVNWSK

h_eRF3a ERYEECKEKL VPFLKKVGFN PKKDIHFMPC SGLTGANLKE QSD--FCPWY IGLPFIPYLD NLPNF NRSVD m_eRF3a ERYEECKEKL VPFLKKVGFN PKKDIHFMPC SGLTGANLKE QSD--FCPWY IGLPFIPYLD NLPNF NRSVD h_eRF3b ERYEECKEKL VPFLKKVGFS PKKDIHFMPC SGLTGANIKE QSD--FCPWY TGLPFIPYLD NLPNF NRSID m_eRF3b ERYEECKEKL VPFLKKVGFS PKKDIHFMPC SGLTGANIKE QSD--FCPWY TGLPFIPYLD SLPNF NRSID Sc_eRF3 ERYDQCVSNV SNFLRAIGYN IKTDVVFMPV SGYSGANLKD HVDPKECPWY TGPTLLEYLD TMNHV DRHIN

h_eRF3a GPIRLPIVDK YKDMGTVVLG KLESGSICKG QQLVMMPNKH NVEVLGILSD DVE-TDTVAPG ENLKIRLKGI m_eRf3a GPIRLPIVDK YKDMGTVVLG KLESGSICKG QQLVMMPNKH NVEVLGILSD DVE-TDSVAPG ENLKIRLKGI h_eRF3b GPIRLPIVDK YKDMGTVVLG KLESGSIFKG QQLVMMPNKH NVEVLGILSD DTE-TDFVAPG ENLKIRLKGI m_eRF3b GPIRLPIVDK YKDMGTVVLG KLESGSIFKG QQLVMMPNKH SVEVLGIVSD DAE-TDFVAPG ENLKIRLKGI Sc_eRF3 APFMLPIAAK MKDLGTIVEG KIESGHIKKG QSTLLMPNKT AVEIQNIYNE TENEVDMAMCG EQVKLRIKGV

h_eRF3a EEEEILPGFI LCDPNNLCHS GRTFDAQIVI IEHKSIICPG YNAVLHIHTC IEEVEITALIC LVDKKSGEKS m_eRF3a EEEEILPGFI LCDLNNLCHS GRTFDAQIVI IEHKSIICPG YNAVLHIHTC IEEVEITALIC LVDKKSGEKS h_eRF3b EEEEILPGFI LCDPSNLCHS GRTFDVQIVI IEHKSIICPG YNAVLHIHTC IEEVEITALIS LVDKKSGEKS m_eRF3b EEEEILPGFI LCEPSNLCHS GRTFDVQIVI IEHKSIICPG YNAVLHIHTC IEEVEITALIS LVDKKSGEKS Sc_eRF3 EEEDISPGFV LTSPKNPIKS VTKFVAQIAI VELKSIIAAG FSCVMHVHTA IEEVHIVKLLH KLEKGTNRKS

h_eRF3a KTRPRFVKQD QVCIARLRTA GTICLETFKD FPQMGRFTLR DEGKTIAIGK VLKLVPEKD 637 m_eRF3a KTRPRFVKQD QVCIARLRTA GTICLETFKD FPQMGRFTLR DEGKTIAIGK VLKLVPEKD 636 h_eRF3b KTRPRFVKQD QVCIARLRTA GTICLETFKD FPQMGRFTLR DEGKTIAIGK VLKLVPEKD 628 m_eRF3b KTRPRFVKQD QVCIARLRTA GTICLETFKD FPQMGRFTLR DEGKTIAIGK VLKLVPEKD 632 Sc_eRF3 KKPPAFAKKG MKVIAVLETE APVCVETYQD YPQLGRFTLR DQGTTIAIGK IVKIAE--- 685

Figure 4: Alignment of the amino acid sequences of human and mouse eRF3a and eRF3b and S. cerevisae eRF3 proteins. The eRF3 protein family is characterized by a non-homologous amino- terminal domain, and a conserved EF1 α-like C-terminal domain of 428 residues. The start of the EF1 α- like domain is shown in a vertical line. This domain is subdivided in the G domain (amino acid residues in grey) and the C-terminal domain. The conservative G1-G4 consensus sequences involved in GTP binding are indicated by shadow boxes. The consensus sequence for PABP interaction (RQLNVNAKPFVP) is indicated in a dotted line box; the IAP-binding motif (AKPF) is underlined, inside the box. The consensus sequence for eRF1 interaction (GRFTLRD) is indicated in a round box.

6 CHAPTER I | INTRODUCTION

It was recently reported that the DEAD-box RNA helicase and mRNA export factor DBP5 controls the eRF3-eRF1 interaction and thus eRF3-mediated downstream events (Gross et al., 2007). DBP5 is reported to be required for efficient stop-codon recognition, directly binding to eRF1 to remodel the mRNA/protein complex to allow proper eRF1 positioning on the stop codon. Subsequent dissociation of DBP5 from eRF1 is followed by the entry of eRF3 into the complex. The precise mechanism by which eRF1 and eRF3 promote translation termination when a stop codon reaches the A site of the ribosome is still not completely elucidated. It is generally accepted that the mechanism is comparable with the elongation system, which is much better characterized: eRF1 structurally mimics the stem of an aminoacil-tRNA, whereas eRF3 mimics the function of an EF1 α, which carries the aminoacil-tRNA to the A site in a GTP-dependent manner (Nakamura & Ito, 1998; Hoshino et al., 1998; Inge-Vechtomov et al., 2003). This model is consistent with the knowledge that only the EF1 α− like C-domain of eRF3 is required for eRF1 interaction.

1.3.2. Other roles in translation

There is a functional conservation of eRF3 family from yeast to human proteins in what concerns its role as a release factor in translation termination. However, the differences in the amino domain of the eRF3 revealed interactions with several different proteins, pointing out the involvement of eRF3 in several cellular pathways. When searching for new eRF3a binding proteins, Hoshino et al. (1999a) identified the polyadenylate-binding protein (PABP), whose amino extremity associates with the poli(A) tail of mRNAs. Both eRF3a and eRF3b directly interact with PABP via its amino terminal domains, through the carboxyl domain of PABP. This interaction results in the inability of PABP to multimerize and consequently inhibits it to perform the typical regularly spaced complexes on the poli(A) tail of mRNAs that regulate mRNA degradation. This may facilitate shortening of the poly(A) tail of mRNAs by an RNase (Hoshino et al., 1999a; Hoshino et al., 1999b; Hosoda et al., 2003). The PABP also mediates mRNA circularization through binding the eIF4F translation initiation complex, which is associated with the mRNA 5’ cap structure (Kozlov et al., 2001). Therefore, the termination of translation might regulate the next initiation step via the eRF3- PABP-eIF4G signalling cascade. These studies revealed that eRF3a may play an important role in mRNA stability, as an initiator of the mRNA degradation machinery, and/or in the recycling of ribosomes in successive cycles of translation (Hoshino et al., 1999a; Hoshino et al., 1999b; Uchida et al., 2002). Another role of eRF3 in mRNA degradation, through the nonsense-mediated mRNA decay (NMD) pathway, was revealed by Czaplinski et al. (1998). The NMD pathway is a process that rids the cell out of transcripts that contain premature termination codons (PTCs). The biological and medical significance of NMD is highlighted by an increasing number of known genetic diseases that are caused by C-terminally truncated proteins that may be non-functional or could exert a

7 CHAPTER I | INTRODUCTION

toxic effect in a dominant-negative manner (Holbrook et al ., 2004; Kuzmiak & Maquat, 2006; Diop et al., 2007). Three core factors involved in NMD have been identified (UPF1, UPF2 and UPF3), but several other proteins are known to be involved in this pathway. It was demonstrated that these three UPF proteins and both release factors, eRF1 and eRF3, function as part of a “surveillance complex” that recognizes PTCs and triggers NMD in S. cerevisae . Direct interactions between UPF proteins and eRF1 and eRF3 were demonstrated in vitro (Czaplinski et al., 1998) and in vivo (Kobayashi et al., 2004). Although the GTPase activity of eRF3 is not necessary for its binding with both UPF1 and PABP, the GTP/eRF3-dependent termination exerts direct influence on the subsequent mRNA degradation (Kobayashi et al., 2004). In mammalian cells, translation termination codons context and exon–exon junctions are cis- acting elements that allow recognition of stop codons. Recently, Kashima et al. (2006) showed that the recognition of PTCs occurs in a complex named SURF (SMG1–UPF1–eRF1–eRF3 complex) associated with the EJC (exon junction complex) on mRNPs. The presence of translation termination factors eRF1 and eRF3 suggested that transient formation of SURF complex most likely occurs after recognition of the stop codon, and that the eRF1–eRF3 complex probably recruits UPF1 and SMG-1 to a PTC. The SURF associates with the post-splicing mRNA through UPF2–EJC to form the DECID (decay-inducing complex). Subsequent UPF1 phosphorylation finally leads to mRNA degradation (Behm-Ansmant & Izaurralde, 2006; Kashima et al., 2006). This model was later considered simplistic because different alternative pathways were reported (Ivanov et al., 2008). The most recent publications suggest that the recognition of a PTC is mediated by competition between the 3’ UTR–associated factors, being the PABP a human NMD antagonizing factor inhibiting the interaction between eRF3 and UPF1 in vitro (Amrani et al., 2006; Eberle et al., 2008; Singh et al., 2008). The NMD appears to be triggered by a ribosome’s failure to terminate adjacent to a properly configured 3’-UTR (untranslated region), an event that may promote binding of the UPF/NMD factors to stimulate mRNA decapping. The physical distance between the stop codon and the PABP is considered a crucial determinant for PTC recognition. NMD can only take place when an extended 3’ UTR places PABP distally to the termination codon, leaving a downstream exon junction complex in between. The EJC acts enhancing NMD, likely through increasing the affinity of UPF proteins. Although the precise model is still a matter of controversy, eRF3 plays a central role in the process of triggering mRNA decay upon the recognition of a termination codon, being part of a transient complex involved in the process.

The outstanding feature of eRF3 is its ability to interact with many other factors, relevant or not to the translational machineries (summarized in Table 1). Therefore, it is tempting to speculate that eRF3 plays a molecular hub to regulate the translation termination complex functionality

8 CHAPTER I | INTRODUCTION

through binding to a repertoire of cellular factors or to couple translation termination to other divergent cellular processes.

Table 1: Properties of known eRF3-binding proteins.

Binding domain Gene Function Species Reference on eRF3 eRF1 CTD translation termination mammalian Hoshino et al ., 1998 Mtt1 CTD helicase S. cerevisiae Czaplinski et al. , 2000 Upf1 CTD mRNA survaillence human Ivanov et al. , 2008 Upf2, Upf3 CTD mRNA survaillence S. cerevisiae Wang et al ., 2001 Ask1 unkown apoptosis regulator human Lee et al. , 2008 Cct subunits unkown chaperonin mammalian King et al ., 2000 cIAP1 (BIRC2) NTD inhibitor of apoptosis human Hedge et al. , 2003 cIAP2 (BIRC3) NTD inhibitor of apoptosis human Hedge et al ., 2003 Itt1 NTD Unknown S. cerevisiae Urakov et al ., 2001 Pabp1 NTD Poly(A) binding human Hoshino et al ., 1999a RnaseL NTD Rnase human Le Roy et al ., 2005 Sla1 NTD actin assenbly S. cerevisiae Bailleul et al ., 1999 Xiap NTD inhibitor of apoptosis human Hedge et al ., 2003

NTD: N-terminal domain; CTD: C-terminal domain

1.3.3. Cytoskeleton assembly

The cytoskeleton is a cytoplasmatic dynamic and complex network of filaments responsible for cell movement, shape, intracellular transport and cellular division, composed essentially of actin filaments, tubulin microtubules and intermediate filaments in the cytoplasm (Honore et al . 2005). After translation termination, the biogenesis process of some proteins, like actins and tubulins, involve interaction of nascent chains with the heterohexameric protein prefoldin (PFDN), whose function is to deliver non-native target proteins to the eukaryotic cytosolic chaperonins for facilitated folding (Simons et al., 2004) protecting them from aggregation while being transferred to chaperonin for the final step(s) in their folding (Vainberg et al., 1998). The target proteins are transferred by PFDN to the cytosolic chaperonin CCT (chaperonin containing TCP-1), which is a hetero-oligomeric complex with double-ring-like structure showing eightfold rotational symmetry of eight different subunits in mammalian somatic cells. The CCT complex is an important pathway that regulates microtubules stability and, consequently, cytoskeleton organization. CCT has been shown to assist in the folding of actin and tubulin in the presence of ATP in vitro (Tian et al., 1995; Farr et al., 1997) and to bind newly synthesized actin and tubulin in vivo (Thulasiraman et al., 1999). Each subunit of the complex recognizes specific target proteins and they collectively modulate the ATPase activity (Kubota et al., 1999). An interaction between CCT subunits and eRF3 was first predicted using a theoretical model (Eisenberg et al., 2000), and experimentally confirmed by immunoprecipitation (King et al.,

9 CHAPTER I | INTRODUCTION

2000; Martin Carden, personal comm). The CCT expression level correlate with growth rates in mammalian cultured cells, and is markedly up-regulated in the early S phase of the cell cycle (Yokota et al ., 1999). Interestingly, the eRF3 protein is also essential for G1 to S phase transition of the cell cycle (Hoshino et al., 1998; Chauvin et al., 2007). Using different organisms as study models, eRF3 has been shown to affect both tubulin and actin cytoskeleton. Deregulation of eRF3 expression and/or mutations in the N-terminal domain of the protein resulted in abnormal meiotic chromosome segregation and defects in the cytoskeleton assembly in spermatids of Drosophila melanogaster (Basu et al., 1998). In S. cerevisiae, eRF3 is also involved in regulatory interactions with intracellular structural networks, through interactions with the yeast cytoskeletal assembly protein SLA1, via its N-terminal domain (Bailleul et al., 1999). The eRF3 was also shown to affect the tubulin cytoskeleton, suggesting a role in the control of chromosome segregation at the anaphase (Borhsenius et al., 2000). More recently, its involvement in the assembly of the actin cytoskeleton in yeast was also demonstrated (Valouev et al., 2002), affecting the impairment of the mitotic spindle structure and chromosome segregation. Chai et al. (2006) showed that the eRF3 is distributed around the macronucleus and in the basal bodies in the cortex of Euplotes octocarinatus cells, suggesting that this protein may be involved in cytoskeleton organization. From these studies, it is not clear whether the aberrant phenotypes reported are either an indirect consequence of disruptions of translation caused by deficient activity of eRF3 in translation termination, or, instead, reflect a more direct interaction of this protein with the microtubule cytoskeleton.

1.3.4. Apoptosis regulation

A proteolytically processed isoform of the eRF3a protein was reported to function as an inhibitor of apoptosis binding proteins (IAP-BPs) (Hedge et al., 2003; Verhagen et al., 2007). IAP-BPs are a group of proteins characterized by the presence of a conserved 4-residue IAP-binding motif (IBM) at their N termini, which allows them to bind to the Baculovirus IAP Repeat (BIR) domain of IAPs. The processed eRF3a protein contains the conserved N-terminal IAP-binding motif (AKPF), which is exposed after proteolytic cleavage of a 69-residue leader sequence (Figure 4). eRF3 directly interacts with IAPs (such as cIAP1, cIAP2 and XIAP), and can promote caspase activation, IAP ubiquitination and apoptosis (Hegde et al., 2003). In the model proposed, eRF3a could potentiate apoptosis by liberating caspases from IAP inhibition, and/or target IAPs and the processed eRF3a for proteasome-mediated degradation. Interestingly, the authors also demonstrated that the processed protein localized in both the cytoplasm and nuclear compartments of MCF-7 cells, suggesting that its association with the endoplasmic reticulum (ER) (which was expected and confirmed for the normal complete protein) is disrupted by deletion of its N terminus.

10 CHAPTER I | INTRODUCTION

Two possible explanations for these findings were suggested: the processing of eRF3a might be triggered by ER stress or other cellular stress conditions or, alternatively, could be a regulatory mechanism to modulate the protein levels during the cell cycle by targeting it for proteosomal degradation via the IAP pathway. The last hypothesis is supported by Chauvin’s et al . (2008) results showing that eRF3a is degraded by the proteasome when not associated with eRF1. Nevertheless, disturbance of the correct interaction/balance between eRF3a and IAPs can release these proteins and consequently repress or even block the apoptosis pathways in which they are involved. Conversely, it can promote the apoptosis process targeting the IAPs for degradation. Recently, eRF3a was also reported to interact with the apoptosis signal-regulating kinase 1 (ASK1), a mitogen-activated protein kinase (MAPK) kinase kinase of the c-Jun N-terminal kinase (JNK) and p38 MAPK pathways (Lee et al., 2008). ASK1 plays a critical role in mediating apoptosis signals initiated by various stresses, such as reactive oxygen species (ROS), endoplasmic reticulum (ER) stress, hydrogen peroxide (H 2O2) and tumor necrosis factor-α (TNF- α). Although the authors did not clarify what signal activates eRF3a to regulate ASK1, they showed that the processing of eRF3a is not critical for ASK1 binding. In addition, they also show that H 2O2 and TNF-α have no effect on the transcription of eRF3a/GSPT1 .

1.4. Cancer

During the past century, the clinical behavior of human cancer has been predicted using its histological features. In the 1980s, at the dawn of the era of molecular medicine, researchers started to believe that cancer was caused by deregulation of a few oncogenes or tumour- suppressor genes. In the past decades, substantial progress has been made in discovering cancer-associated genes that are altered through point mutations, deletions, amplifications, rearrangements or other events. Therefore, it has become clear that human tumours are more complex and heterogeneous than expected, and are caused by defects in numerous pathways and factors that operate at many levels (Liotta & Petricoin, 2000; Hanash, 2004; Bodmer & Bonilla, 2008; Dong et al., 2008). Cancer is a genetically and biologically highly heterogeneous disease that likely requires individually tailored therapies based on the patient’s individual genetic and biologic alterations. The multifactorial process of carcinogenesis involves mutations in oncogenes, or tumor suppressor genes, as well as the influence of environmental etiological factors. During the last few decades, extensive effort has been invested in identifying sources of genetic susceptibility to cancer. Common DNA polymorphisms in low penetrance genes have emerged as genetic factors that seem to modulate an individual's susceptibility to malignancy (Fearnhead et al., 2004; Kryukov et al., 2007; Iyengar & Elston, 2007; Milne & Benítez, 2008). Both the International Human Genome Sequencing Project and the International HapMap Project have generated a very large amount of data on the location, quantity, type and frequency of genetic variants in the

11 CHAPTER I | INTRODUCTION

human genome. A large and increasing number of observational studies investigating the association between variants in candidate genes and cancer risk have emerged. Given their abundance and stability, single nucleotide polymorphisms (SNPs) hold great promise as markers for mapping disease susceptibility loci for common, complex disorders by association studies (Bodmer & Bonilla, 2008; Polychronakos, 2008). For this purpose the development of non- invasive, inexpensive, accurate, high-throughput methods for scoring large numbers of SNPs from hundreds of patients and controls is critical. Despite the intensive effort devoted to the issue, the ability to detect the genetic components of cancer etiology has been very limited. Exceptions include genes that cause rare, mainly monogenic family cancer syndromes such as Brca1 and Brca2 in familial breast and ovarian cancer (Narod & Foulkes, 2004), Mlh1 and Mlh2 in hereditary nonpolyposis colorectal cancer (Plotz et al., 2006), Cdkn2a in familial melanoma (Bishop et al., 2007) and p53 in Li-Fraumeni syndrome (Evans & Lozano, 1997; Varley, 2003). However, such exceptions tend to account for only a small portion of disease heritability. For example, the breast cancer susceptibility genes Brca1 and Brca2 explain only a minority (<30%) of familial breast cancers and a negligible proportion of sporadic breast cancers (Narod & Foulkes, 2004). In conclusion, the genetic etiology of most cancers remains largely unclear.

Cancer is now a major public health problem in Europe, and the ageing of the European population will most certainly cause these numbers to continue to increase. According to the World Health Organization (WHO) cancer is the second cause of death in Portugal and so it will be until 2030, according to projections based on 2002 WHO burden of disease estimates (http://apps.who.int/infobase/report.aspx?iso=PRT&rid=119&goButton=Go). The most common incident forms of cancer are breast and prostate cancer for women and men respectively, followed by colorectal cancer, lung cancer and stomach cancer in both genders. The same types of tumors are within the top five most common causes of cancer deaths (Boyle & Ferlay, 2005; Ferlay et al., 2007; Karim-Kos et al., 2008). The promise of early detection is that it will identify cancer while still localized and curable, not only preventing mortality but also morbidity and health costs. However, despite that our knowledge of cancer has increased greatly during the past decades, many of the genetic alterations underlying cancer development remain to be clarified. Which of these alterations are the key players in the initial development of cancer is still not known in most of the cancer types. Moreover, the ability to translate this knowledge into clinical practice remains elusive.

Here follows a brief description of the types of cancer used as models in our research work. Breast cancer is the leading cause of cancer in women worldwide (Hinestrosa et al., 2007; Perry et al., 2008). Breast tumors vary greatly in clinical behavior, morphological appearance, and molecular alterations. In general, the genes that have been identified as being associated with hereditary breast cancer ( Brca1, Brca2 , p53 , Chk2 , and Atm ) are involved in the maintenance of

12 CHAPTER I | INTRODUCTION

genomic integrity and DNA repair (Narod & Foulkes, 2004). However, less than 10% of women who develop breast cancer have an identifiable inherited mutation to the disease, and another 15%–20% have a family history but no readily identifiable genetic pattern (Easton et al., 2007; Hinestrosa et al., 2007). The majority of the women develop somatic tumors, in which any known genetic mutation is identified as being the driving force in the origin of the disease. Therefore, although much knowledge has been achieved about breast cancer in the past decades, it continues to be the leading cause of cancer-related death in women. Despite gastric cancer incidence and mortality have decreased over the past decades, it is still the second most frequent cause of cancer-related death in the world (Crew & Neugut, 2006). Multiple genetic and epigenetic alterations in cell cycle regulators, cell adhesion molecules, DNA repair genes and telomerases, as well as genetic instability at microsatellite loci are the most common events implicated in the multistep process of gastric carcinogenesis (Tahara, 2004). However, gastric cancer is essentially a heterogeneous disease, and the events that underlie the malignant transformation of the gastric mucosa during the multistep process of gastric cancer pathogenesis remain uncertain (Zheng et al., 2006). Several histological classification for gastric cancer have been proposed, being the Lauren’s (1965) classification the most usual - two major forms of gastric tumors are distinguished according to their morphological and clinicopathological classifications: intestinal (well-differentiated) and diffuse (undifferentiated) type tumors. They differ in genetic susceptibility, pathologic profile, clinical presentation, and prognosis (Crew & Neugut, 2006; Cervantes et al., 2007). The intestinal type carcinoma is frequently preceded my multifocal atrophic gastritis and is more common in elderly man; the tumors show gland formation and are usually well demarcated. For the diffuse type tumors the precursor lesions are usually not identified and the prognosis is less favorable, they show no cohesiveness of tumors cells infiltrating the stroma and occurs preferably in women under 50 years old (Werner et al., 2001). Molecular pathology supports this classification by showing differences in the genetics pathways in the origin of both kinds of tumors (Werner et al., 2001; Tahara, 2004; Cervantes et al., 2007). Nevertheless, the prognosis for patients with advanced gastric cancer remains poor, much because gastric cancer is often diagnosed at an advanced stage. Therefore, it is still a challenge to detect stage-specific genetic abnormalities that may result in early diagnosis and aid in selecting therapy. Colorectal cancer (CRC) is the most common cancer in Europe. Approximately 70% of colorectal cancers are sporadic, with no inherited predisposition (Shen et al., 2007). Although highly penetrant mutations in single genes are known to be responsible for hereditary syndromes, low penetrance susceptibility genes account for a high proportion of the tumors (Mecklin, 2008). Several subgroups with different precursor lesions and behavior can already be distinguished (Shen et al., 2007; Takayama et al., 2007; Li & Lai, 2009). There is heterogeneity in the genetic pathways leading to CRCs, and there are two major tumorigenic pathways. The first is driven by chromosomal instability (CIN), in which accumulating mutations in genes of K-ras (v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog), Apc (adenomatous polyposis coli), p53 (tumor

13 CHAPTER I | INTRODUCTION

protein P53), and Dcc (deleted in colorectal carcinoma), are thought to be of significance. An alternative genetic pathway, related to genetic instability, evolves as a consequence of the alteration in mismatch repair (MMR) genes. However, these two distinct pathways are not able to account for all CRCs. Moreover, there is still an extend gap between basic research and clinical practice, probably due to the genetic and molecular complexity of the tumors (Gil-Bazo, 2007; Huerta, 2008; Nannini et al., 2009). Interaction of genetics and environmental effects has an important role in colorectal carcinogenesis. High body-mass index, increased meat or alcohol consumption and tobacco smoking are examples of confirmed risk factors. A positive family history of CRC increases the estimated risk for CRC by 2- to 4-fold (Mecklin, 2008). Chronic and persistent inflammation has long been associated with the development of cancer. The genetic changes that occur within cancer cells themselves, such as activated oncogenes or dysfunctional tumor suppressors, are responsible for many aspects of cancer development but they are not sufficient. Tumor promotion and progression are dependent on cells of the tumor environment, that are not necessarily cancerous themselves (Rakoff-Nahoum, 2006). Mediators of the inflammatory response, e.g., cytokines, free radicals, prostaglandins and growth factors, can induce genetic and epigenetic changes, DNA methylation and post-translational modifications, causing alterations in critical pathways responsible for maintaining the normal cellular homeostasis and leading to the development and progression of cancer (Hussain & Harris, 2007). Nowadays, the association between Crohn’s disease (CD) and increased risk for CRC is widely accepted (Zisman & Rubin, 2008). Crohn’s disease (CD) is a chronic inflammatory disease that can affect the entire gastrointestinal tract from the mouth to the anus. CRC is the most common type of cancer in inflammatory bowel disease (IBD), although cancer in other organs can occur. Although CRC associated to IBD accounts only for 1%-2% of all cases of CRC in the general population, it is considered a serious complication of this disease and accounts for approximately 10%-15% of all deaths in IBD patients (Munkholm, 2003). Several of the molecular alterations that contribute to sporadic CRC are also found in IBD-associated CRC (Zisman & Rubin, 2008). CD is therefore a complex disease in which multiple genetic and environmental factors are likely to contribute to pathogenesis, and the search for CD susceptibility genes therefore poses similar problems to those in other complex disorders, like cancer. Despite these types of cancer are of the most prevalent cancer types in the world today, only a limited number of biomarkers are available for detection and prognostic evaluation. New advances in identifying molecular biomarkers are essential. The intricate nature of the contributions of many factors ultimately determines the impact that a particular alteration has on the properties of a tumour or a precursor lesion (Hanash, 2004). In the future, cancer screening tests will probably combine the result of multiple diagnostic tests and biomarker assays with patient’s specific risk factors.

14 CHAPTER I | INTRODUCTION

1.4.1. Translation and cancer

Regulation of translation plays a major role in the control of eukaryotic gene expression (Gebauer & Hentze, 2004). Altering the rate of protein synthesis at the level of translation enables cells to respond rapidly to changes in the intra or extracellular conditions. There are several lines of evidence that support the involvement of translation in the regulation of cell proliferation and cancer development (Clemens & Bommer, 1999; Watkins & Norbury, 2002; Rajasekhar & Holland, 2004; Pandolfi 2004; Bilanges & Stokoe, 2007). Protein synthesis is coupled with cell cycle progression and is regulated in response to nutrient availability, hormones, mitogenic and growth factor stimulation (Caraglia et al., 2000; Meyuhas 2000; Proud 2002). However, the transduction pathways activated do not stimulate the translation of all the mRNAs equally (Holland et al., 2004). The expression of the components of the translation machinery might be selectively regulated by effector proteins, increasing the translation rate of specific oncogenic transcripts (Dua et al., 2001; Meric & Hunt, 2002; Holland et al., 2004). The transcriptome of a cell is a pool of mRNAs with different efficiencies. Several genes present typical structural features that allow a regulation of their expression at the translation level (Kochetov et al., 1998; Clemens & Bommer, 1999; Meyuhas, 2000). Differential recruitment of mRNA populations to the polisomes might be a rapid response of a cell to the signal transduction pathways activated, resulting in the alterations of the proteome that characterize a cancer cell (Clemens & Bommer, 1999; Watkins & Norbury, 2002; Rajasekhar & Holland, 2004). According to the ribosome filter hypothesis (Mauro & Edelman, 2002), the ribosomal subunits are also considered regulatory elements in translation. Specific sequences at the mRNA molecules are sites of interaction with either rRNAs or ribosomal proteins, especially in the 40S subunit, affecting translation efficiency (Tranque et al., 1998). These interactions are modulated by ribosomal heterogeneity, as a consequence of variation in rRNA or protein composition. Three main alterations at the translational level can occur in cancer cells: (i) variations in mRNA sequences that increase or decrease the translation efficiency of the transcript (mutations, alternative splicing, alternate polyadenylation sites); (ii) changes in the expression or availability of the components of the translation machinery and (iii) activation of translation through aberrantly activated signal transduction pathways. Translation of mRNA can be divided in three stages: initiation, elongation and termination. Each stage involves multiple protein factors, though the initiation step is considered the most complex and most tightly regulated (Gebauer & Hentze, 2004; Sonenberg & Hinnebusch, 2009). Therefore, it has been suggested that the initiation step represents the most suitable target for cancer therapy. Accordingly, several studies can be found in literature reporting that the genes involved in the regulation of cell proliferation, growth and death are subject to control at the initiation of translation level (Meric & Hunt, 2002; Stoneley & Willis, 2003; Sonenberg & Dever, 2003; Fingar et al., 2004; Pickering & Willis, 2005; Bilanges & Stokoe, 2007). Effectively, several initiation and also elongation translation factors have been described to be overexpressed in

15 CHAPTER I | INTRODUCTION

different human tumours (Table 2). Also, a few reports also show a down-regulation of translation factors expression. In addition, cancer associated point mutations were described in translation elongation factor genes (Frazier et al., 1998; Abbott & Proud, 2004). About translation termination factors, very few reports are found in literature which associate them with cancer development. An exception is eRF3b/GSPT2, which was reported to be over- expressed in a study where the role of X-linked genes in breast cancer was investigated (Thakur et al., 2005), and was also reported as a susceptibility gene for hepatocellular carcinoma (Zondervan et al., 2000).

Table 2: Translation factors reported to be altered in human cancers.

Translation Factor Effect Type of tumor Reference

eIF2 α
protein Non-Hodgkin’s linfoma Wang et al. , 1999 nuclear localization Gastrointestinal carcinoma Lobo et al ., 2000
protein Melanocytic and colonic epithelial neoplasms Rosenwald et al ., 2003 eIF3a (p170)
protein Lung cancer Pincheira et al. , 2001 eIF3c (p110)
mRNA Testicular seminoma Rothe et al. , 2000 eIF3e (p48) LOH; protein Breast and Lung cancer Marchetti et al. , 2001 eIF3f (p47) - DNA; LOH;  mRNA & protein Pancreatic cancer Dolan et al. , 2008a - DNA; LOH; protein Melanoma Dolan et al ., 2008b eIF3h (p40) + DNA;
mRNA Prostate and breast cancer Nupponen et al ., 1999 InitiantionFactors eIF4A1
mRNA Melanoma Eberle et al ., 1997 eIF4E
protein Non-Hodgkin’s linfoma Wang et al ., 1999 eIF4G + DNA;
mRNA Squamous cell lung carcinoma Bauer et al ., 2001

eEF1 γγγ SNPs Gastrointestinal carcinoma Fraizer et al. , 1998
mRNA Oesophageal carcinoma Mimori et al. , 1996
protein Colorectal cancer Mathur et al ., 1998
mRNA Gastric carcinoma Mimori et al ., 1995 eEF1A2
mRNA & protein Ovarian cancer Anand et al ., 2002
protein Breast cancer Tomlinson et al ., 2005

Elongation Factors Elongation
mRNA & protein Lung adenocarcinoma Li et al ., 2006

eRF3b - DNA Hepatocelular carcinoma Zondervan et al ., 2000
mRNA Breast cancer Thakur et al ., 2005 Factors Release Release

/: overexpression / underexpression; LOH: Loss of Heterozygosity; - /+: delection/amplification

Whether if the alterations found in the components of the translation machinery are a cause or a consequence of malignant transformation was still a matter of debate at the time of the beginning of this project. However, it was already demonstrated that eIF3e (Mayeur & Hershey, 2002), eIF4E (De Benedetti & Harris, 1999) and eEF1A2 (Wang et al., 1999), are able to transform cells de per se.

The mammalian target of rapamycin (mTOR) pathway plays a central role in regulating protein synthesis, particularly cap-dependent translation. Signalling by P13K/Akt/mTOR pathway profoundly affects mRNA translation through phosphorylation of downstream targets. mTOR functions by integrating extracellular signals (such as mitogens, growth factors and hormones) with amino-acid availability and the intracellular energy status to control translation

16 CHAPTER I | INTRODUCTION

rates (and additional metabolic processes). The mTOR promotes the phosphorylation and consequent activation of S6K, and the hierarchical phosphorylation of 4E-BPs. Hyperfosphorylated 4E-BPs are released from eIF4E resulting in enhanced cap-dependent translation (Mamane et al., 2006). Recently, Chauvin et al (2007) suggested that eRF3a also belongs to the regulatory pathway of mTOR activity. Although the precise role and the partners of eRF3a in mTOR signaling pathway were not determined, the authors suggested that eRF3a would exert a retrocontrol on the whole translation process, adjusting the rate of translation initiation to the efficiency of translation termination. Deregulations in mTOR signalling are frequently associated with tumorigenesis, angiogenesis, tumor growth and metastasis. mTOR has been extensively studied in the past years because rapamycin (Rapamune), a specific inhibitor of mTOR activity, shows a potent activity against a wide panel of cancers (Mita et al., 2003; Averous & Proud, 2006; Mamane et al., 2006).

1.4.2. Trinucelotide repeats and cancer

Short tandem repeats (STRs), also called microsatellites, composed of multiple di-, tri- or tetranucleotide repeats are widely spread in the human genome. Repetitive sequences are known to be hot spots for recombination as well as sites for random integration. Thus, alterations in simple repetitive sequences lie at the centre of DNA evolution and sequence diversity. On the other hand, changes in repetitive sequences can result in deleterious effects on gene expression and function, leading to disease. Looped DNA structures comprising trinucleotide repeats are frequently incorrectly processed during replication and/or repair to generate deletions or expansions (Di Prospero & Fischbeck, 2005; Kovtun & McMurray, 2008). Unstable DNA trinucleotide repeat expansion diseases represent a group of disorders that include mental retardation and autism, as well as several neurodegenerative and other diseases (some examples in Table 3). Expansion or contraction of STRs, due to increase or decrease in the number of repeat elements, gives rise to what is called microsatellite instability (MSI), often found in human cancers. The most common underlying cause of MSI is a defective mismatch repair (MMR) system. As a consequence, errors that occur during replication of DNA cannot be repaired and lead to nucleotide mutations and alterations in the length of repetitive microsatellite sequences. Loss of heterozygosity (LOH) may also occur in tumor tissues. In contrast to MSI, where new alleles are generated, LOH is related with the loss of a wild type allele in tumor cells. The prognostic and predictive value of both phenomena has been of great interest in some kinds of human tumors (De Schutter et al., 2007; Imai & Yamamoto, 2008).

17 CHAPTER I | INTRODUCTION

Table 3: Examples of unstable triplet repeat expansion disorders.

Triplet Gene Protein Range Non-coding normal mutant Fragil X Sindrome A CGG Fmr1 Fragile X Mental Retardation 1 5-50 200-2000 Fragil X Sindrome E GCC Fmr2 Fragile X Mental Retardation 2 6-60 >200 Friedrich ataxia GAA Fxn Frataxina 7-34 200-900 Dystrophia Myotonica 1 CTG Dmpk DM protein kinase 5-37 80-1000 Spinocerebellar ataxia 12 CTG ppp2r2b Regulatory subunit of PP2A 16-91 110-130 Huntington-like Disease (HDL-3) CTG Jph3 Junctophilin-3 8-20 >40

Coding Poliglutamine (PoliQ) Huntington Disease CAG It15 Huntington 11-34 36-121 Machado-Joseph Disease CAG Sca3/MJD Ataxin 3 13-40 68-69 Spinocerebellar ataxia 1 CAG Sca1 Ataxin 1 6-40 40-82 Kennedy's Disease (SBMA) CAG Ar Androgen Receptor 4-44 40-130 Dentatorubral-Pallidoluysian atrophy (DRPLA) CAG Drpla Atrophin 1 6-35 49-88 Spinocerebellar ataxia 17 CAG/CAA Tbp TATA box binding protein 25-42 43-63 Polialanine (PoliA) Oculopharyngeal muscular dystrophy GCG Pabpn1 Poly(A)-binding protein 2 6-10 12-17 Congenital Central Hypoventilation Syndrome (CCHS) GCN Phox2b Paired-like homeobox 2B 6 9-13 Synpolydactyly GCN Hoxd13 Homeobox D13 undetermined Infantile Spasms GCC Arx Aristaless-related homeobox 10-12 17-20 Adapted from: Di Prospero & Fishbeck, 2005

Microsatellites include both noncoding markers as well as repeats that are included within the coding regions of some genes. Some STRs may affect gene transcription, mRNA stability and splicing and protein structure and function. Several trinucleotide repeats have been associated with oncological pathologies, either conferring a protective effect or associated with elevated risk for disease (Table 4). The stable trinucleotide repeats (CAG)n and a (GGC)n in the androgen receptor ( AR ) gene have been extensively studied for their potential role in cancer (Ferro et al., 2002). Although the molecular mechanisms underlying the polyglutamine and polyglycine length modulation of AR function have not been totally elucidated, the length of the alleles has been linked to prostate cancer survival and breast cancer risk (Ding et al., 2005; Schildkraut et al., 2007; Zhang & Yu, 2007). However, results from different groups working with different racial– ethnic populations are often inconsistent and sometimes even conflicting (Li et al., 2003; Schildkraut et al., 2007). The gene eRF3a/GSPT1 contains an exonic trinucleotide repeat in exon 1, coding for a stable polyglycine expansion in the N-terminal of the protein. This polymorphism in eRF3a/GSPT1 gene was first described in a study published in 1992 by Riggins et al., Because of a confusion between the names of the genes, the authors designed primers specific for eRF3a/GSPT1 gene, which was formerly designated by GST1 (as mentioned in section 1.1.), but reported in the paper that the gene studied was the gene encoding Glutathione-S-transferase-1 ( GST1 ). Nevertheless, using those primers, they identified 5 different alleles that enclosed 8, 10, 11, 12 and 13 GGC repeats in the 5’UTR of the gene. A few years later, Prof Carolino Monteiro (Faculdade de Farmácia da Universidade de Lisboa) was engaged in a project about the association between p53 genomic instability with Glutathione-S-transferase-1 and decided to use the primers from the paper cited above to analyse the reported polymorphism. He found

18 CHAPTER I | INTRODUCTION

interesting preliminary results: the frequencies of the alleles were significantly different between gastric cancer patients and control healthy individuals, being some of the alleles detected exclusively in the cancer patients (Carolino Monteiro, personal communication). Thus, he decided to sequence the fragments amplified, and realized that the region amplified was located in exon 1 of eRF3a/GSPT1 gene and not in the GST1 gene encoding Glutathione-S-transferase-1, as mentioned in the original paper.

Table 4: Genes with STR polymorphisms associated with cancer.

Gene Protein Repeat Position Disease Reference Aib1 Nuclear receptor coactivator 3 CAG Exon 1 Prostate cancer Hsing et al. , 2002 Breast cancer Dai & Wong, 2003 Ar Androgen receptor CAG, GGC Exon 1 Prostate cancer Chang et al. , 2002 Breast cancer Suter et al ., 2003 Urothelial carcinoma Liu et al ., 2008 Cyp11a Cytochrome P450, family 11 TAAAA Promotor Prostate cancer Kumazawa et al ., 2004 Breast cancer Zheng et al ., 2004 Cyp19 Cytochrome P450, family 19 TTTA Intron 4 Breast cancer Haiman et al ., 2000 Prostate cancer Suzuki et al. , 2003 Ecrg2 (esophageal cancer-related protein 2) TCA Exon 4 Esophageal cancer Kaifi et al ., 2007a Pancreatic carcinoma Kaifi et al ., 2007b Er Estrogen receptor GT Promotor Breast cancer Cai et al. , 2003 Erbb-1 Epidermal growth factor receptor CA Intron 1 Breast cancer Tidow et al ., 2003 Lung cancer Nie et al. , 2007 E2f-4 E2F transcription factor 4 AGC Exon 7 Colorectal cancer Zhong et al. , 2000 Breast cancer Ho et al ., 2001 Ho-1 Heme Oxygenase-1 GT Promotor Chronic Pulmunary Emphysema Yamada et al ., 2000 Melanoma Okamoto et al. , 2006 Male oral squamous cell carcinoma Vashist et al. , 2008 Infg Interferon, gamma CA Intron 1 Breast cancer Saha et al ., 2005 IGF-1 Insulin-like growth factor 1 CA Promotor Prostate cancer Friedrichsen et al ., 2005 Breast cancer Cleveland et al ., 2006 Colorectal cancer Zecevic et al. , 2006 Smyd3 SET and MYND domain containing 3 CCGCC Promotor Colorectal Cancer Uthoff et al ., 2002 Tcr-gamma T-cell receptor-gamma GATA Intronic Non small cell lung cancer Tseng et al ., 2005 Different types of cancer Tsuge et al. , 2005 Hepatocellular carcinoma Hsu et al ., 2006

1.5. Aims and thesis structure

In spite of the extensive data available about the involvement of translation (de)regulation in association with cancer development, the contribution of the eukaryotic translation release factors remained to be evaluated. Being the eRF3a involved in several essential pathways in the cell, it was an appealing idea to evaluate it’s involvement in the carcinogenesis process.

To accomplish this purpose, six specific aims were established as the basis for this thesis:

1) To quantify eRF3a/GSPT1 gene expression at the mRNA and protein level in different types of human cancers, and correlate the level of expression with the length of the STR alleles.

19 CHAPTER I | INTRODUCTION

2) To determine the genotype of the STR polymorphism in eRF3a/GSPT1 exon 1 in patients with different kinds of human tumors, and compare the allele frequencies with a control healthy population.

3) To analyse and compare the efficiency of eRF3a proteins encoded by alleles with different number GGC repeats, as translation termination factors.

4) To analyse and compare the viability and apoptosis rates of cells expressing the eRF3a protein variants with different N-terminal lenghts.

5) To analyse and compare the efficiency of the eRF3a protein variants in cytoskeleton organization.

6) Integrate the above results and discuss how eRF3a/GSPT1 can be involved in malignant transformation.

To address the specified aims, the dissertation is organized in five chapters. Chapter I corresponds to the general introduction of this dissertation. Chapters II and III are composed of a total of 5 papers, already published (4) or submitted for publication (1) in international scientific journals: Papers 1 and 2 in Chapter II and Papers 3, 4 and 5 in Chapter III. Chapter IV comprises an integrative discussion of the results obtained and published in the papers presented. Finally, Chapter V contains the final remarks of the thesis. The first aim is addressed in papers 1, 3 and 4. In Paper 1 we quantified the mRNA levels of expression of eRF3a/GSPT1 gene in gastric cancer patients, and correlated the pattern of expression with gene dosage in each sample. Paper 3 analyses the expression of eRF3a/GSPT1 in breast tumors and reinforces that the expression of this gene is deregulated in cancer cells; this paper also suggests that the levels of expression of eRF3a/GSPT1 are correlated with the size of the (GGC)n microsatellite alleles. This suggestion if confirmed in Paper 4 using primary lymphocyte cultures with different genotypes and Jurkat-modified cell lines expressing different alleles. In this paper, the methylation levels of the CpG sites within the GGC expansion were quantified in each allele and correlated with the mRNA levels. Our second aim is addressed in papers 2, 3 and 4. In Paper 2 we determined the genotypes of the STR polymorphism of eRF3a/GSPT1 in gastric cancer patients and screened for additional genetic variability in linkage with the alleles detected. We also estimated the relative risk of cancer development associated with each allele and genotype. In Paper 3, we analyzed the frequencies of the alleles and genotypes in the breast cancer patients, and the same analysis was performed in Paper 4 for patients with colorectal cancer and Crohn Disease.

20 CHAPTER I | INTRODUCTION

The third aim is addressed in Paper 3, using a cell line stably expressing β-galactosidase gene with a premature stop codon. The efficiency of eRF3a variants as translation termination factors was evaluated by quantifying the level of readthrough in the reporter gene. The fourth aim is addressed in Paper 4 using cytometry to measure and compare several parameters of cell cycle and apoptosis between primary lymphocyte cultures with different genotypes and between Jurkat-modified cell lines expressing different alleles. The fifth aim is addressed in Papers 4 and 5. In Paper 4 we used a cytokinesis-block micronucleus assay to quantify the frequency of micronucleus in the same cell lines, as a marker of chromosomal damage caused by defects in mitotic spindle formation. In Paper 5 we investigated the existence of correlations between the expression of eRF3a/GSPT1 and the pattern of expression of several genes encoding proteins that belong to tubulin folding pathway, that ultimately regulate the formation of microtubules that compose the cytoskeleton. The fifth and last aim of this thesis is partly addressed in all the papers that compose Chapters II and III, but is fully explored in Chapter IV, in which all the results are integrated and examined in detail to evaluate the contribution of eRF3a/GSPT1 (de)regulation to the carcinogenesis process.

1.6. References

Abbott CM, Proud CG. (2004) Translation factors: in sickness and in health. Trends Biochem Sci 29(1):25-31.

Amrani N, Dong S, He F, Ganesan R, Ghosh S, Kervestin S, Li C, Mangus DA, Spatrick P, Jacobson A. (2006) Aberrant termination triggers nonsense-mediated mRNA decay. Biochem Soc Trans 34(Pt 1):39-42.

Anand N, Murthy S, Amann G, Wernick M, Porter LA, Cukier IH, Collins C, Gray JW, Diebold J, Demetrick DJ, Lee JM. (2002) Protein elongation factor EEF1A2 is a putative oncogene in ovarian cancer. Nat Genet 31:301-5.

Averous J, Proud CG. (2006) When translation meets transformation: the mTOR story. Oncogene 25(48):6423-35.

Bailleul PA, Newnam GP, Steenbergen JN, Chernoff YO. (1999) Genetic study of interactions between the cytoskeletal assembly protein sla1 and prion-forming domain of the release factor Sup35 (eRF3) in Saccharomyces cerevisiae. Genetics 153(1):81-94.

Basu J, Williams BC, Li Z, Williams EV, Goldberg ML. (1998) Depletion of a Drosophila homolog of yeast Sup35p disrupts spindle assembly, chromosome segregation, and cytokinesis during male meiosis. Cell. Motil. Cytoskeleton 39: 286-302.

Bauer C, Diesinger I, Brass N, Steinhart H, Iro H, Meese EU. (2001) Translation initiation factor eIF-4G is immunogenic, overexpressed, and amplified in patients with squamous cell lung carcinoma. Cancer 92(4):822-9.

Behm-Ansmant I, Izaurralde E. (2006) Quality control of gene expression: a stepwise assembly pathway for the surveillance complex that triggers nonsense-mediated mRNA decay. Genes Dev 20(4):391-8.

21 CHAPTER I | INTRODUCTION

Bilanges B, Stokoe D. (2007) Mechanisms of translational deregulation in human tumors and therapeutic intervention strategies. Oncogene. 26(41):5973-90.

Bishop JN, Harland M, Randerson-Moor J, Bishop DT. (2007) Management of familial melanoma. Lancet Oncol 8(1):46-54.

Bodmer W, Bonilla C. (2008) Common and rare variants in multifactorial susceptibility to common diseases. Nat Genet 40(6):695-701.

Borhsenius AG, Tchourikova AA, Inge-Vechtomov SG (2000) Recessive mutations in SUP35 and SUP45 genes coding for translation release factors affect chromosome stability in Saccharomyces cerevisiae. Curr Genet 37: 285-91.

Boyle P, Ferlay J. (2005) Cancer incidence and mortality in Europe, 2004. Ann Oncol 16(3):481-8.

Cai Q, Gao YT, Wen W, Shu XO, Jin F, Smith JR, Zheng W. (2003) Association of breast cancer risk with a GT dinucleotide repeat polymorphism upstream of the estrogen receptor-alpha gene. Cancer Res 63:5727–30.

Caraglia M, Budillon A, Vitale G, Lupoli G, Tagliaferri P, Abbruzzese A. (2000) Modulation of molecular mechanisms involved in protein synthesis machinery as a new tool for the control of cell proliferation. Eur J Biochem 267(13):3919-36.

Cervantes A, Rodríguez Braun E, Pérez Fidalgo A, Chirivella González I. (2007) Molecular biology of gastric cancer. Clin Transl Oncol 9(4):208-15.

Chai BF, Wang W, Liang AH. (2006) Expression, characterization and immunolocalization of translation termination factor eRF3 in the ciliate Euplotes octocarinatus. Res Microbiol 157(3):235-40.

Chang BL, Zheng SL, Hawkins GA, Isaacs SD, Wiley KE, Turner A, Carpten JD, Bleecker ER, Walsh PC, Trent JM, Meyers DA, Isaacs WB, Xu J. (2002) Polymorphic GGC repeats in the androgen receptor gene are associated with hereditary and sporadic prostate cancer risk. Hum Genet 110(2):122-9.

Chauvin C, Salhi S, Le Goff C, Viranaicken W, Diop D, Jean-Jean O. (2005). Involvement of Human Release Factors eRF3a and eRF3b in Translation Termination and Regulation of the Termination Complex Formation. Mol Cell Biol 25:5801–11.

Chauvin C, Salhi S, Jean-Jean O. (2007) Human eukaryotic release factor 3a depletion causes cell cycle arrest at G1 phase through inhibition of the mTOR pathway. Mol Cell Biol 27(16):5619-29.

Chauvin C, Jean-Jean O. (2008) Proteasomal degradation of human release factor eRF3a regulates translation termination complex formation. RNA 14(2):240-5.

Clemens MJ, Bommer UA. (1999). Translational control: the cancer connection. Int J Biochem Cell Biol 31:1-23.

Cleveland RJ, Gammon MD, Edmiston SN, Teitelbaum SL, Britton JA, Terry MB, Eng SM, Neugut AI, Santella RM, Conway K. (2006) IGF1 CA repeat polymorphisms, lifestyle factors and breast cancer risk in the Long Island Breast Cancer Study Project. Carcinogenesis 27(4):758–65.

Crew KD, Neugut AI. (2006) Epidemiology of gastric cancer. World J Gastroenterol 12(3):354-62.

Czaplinski K, Ruiz-Echevarria MJ, Paushkin SV, Han X, Weng Y, Perlick HA, Dietz HC, Ter-Avanesyan MD, Peltz SW. (1998) The surveillance complex interacts with the translation release factors to enhance termination and degrade aberrant mRNAs. Genes Dev 12(11):1665-77.

Czaplinski K, Majlesi N, Banerjee T, Peltz SW. (2000) Mtt1 is a Upf1-like helicase that interacts with the translation termination factors and whose overexpression can modulate termination efficiency. RNA 6(5):730-43.

22 CHAPTER I | INTRODUCTION

Dai P, Wong LJC. (2003) Somatic instability of the DNA sequences encoding the polymorphic polyglutamine tract of the AIB1 gene. J Med Genet 40:885–90.

De Benedetti A, Harris AL (1999). eIF4E expression in tumors: its possible role in progression of malignancies. Int J Biochem Cell Biol 31(1):59-72.

De Schutter H, Spaepen M, Mc Bride WH, Nuyts S. (2007) The clinical relevance of microsatellite alterations in head and neck squamous cell carcinoma: a critical review. Eur J Hum Genet 15(7):734- 41.

Di Prospero NA, Fischbeck KH. (2005) Therapeutics development for triplet repeat expansion diseases. Nat Rev Genet 6(10):756-65.

Ding D, Xu L, Menon M, Reddy GP, Barrack ER. (2005) Effect of GGC (glycine) repeat length olymorphism in the human androgen receptor on androgen action. Prostate 62(2):133-9.

Diop D, Chauvin C, Jean-Jean O. (2007) Aminoglycosides and other factors promoting stop codon readthrough in human cells. C R Biol 330(1):71-9.

Doldan A, Chandramouli A, Shanas R, Bhattacharyya A, Cunningham JT, Nelson MA, Shi J. (2008a) Loss of the eukaryotic initiation factor 3f in pancreatic cancer. Mol Carcinog 47(3):235-44.

Doldan A, Chandramouli A, Shanas R, Bhattacharyya A, Leong SP, Nelson MA, Shi J. (2008b) Loss of the eukaryotic initiation factor 3f in melanoma. Mol Carcinog 47(10):806-13.

Dong LM, Potter JD, White E, Ulrich CM, Cardon LR, Peters U. (2008) Genetic susceptibility to cancer: the role of polymorphisms in candidate genes. JAMA 299(20):2423-36.

Dua K, Williams TM, Beretta L. (2001). Translational control of the proteome: Relevance to cancer. Proteomics 1:1191-9.

Easton DF, Pooley KA, Dunning AM, Pharoah PD, Thompson D, Ballinger DG, Struewing JP, Morrison J, Field H, Luben R, Wareham N, Ahmed S, Healey CS, Bowman R; SEARCH collaborators, Meyer KB, Haiman CA, Kolonel LK, Henderson BE, Le Marchand L, Brennan P, Sangrajrang S, Gaborieau V, Odefrey F, Shen CY, Wu PE, Wang HC, Eccles D, Evans DG, Peto J, Fletcher O, Johnson N, Seal S, Stratton MR, Rahman N, Chenevix-Trench G, Bojesen SE, Nordestgaard BG, Axelsson CK, Garcia- Closas M, Brinton L, Chanock S, Lissowska J, Peplonska B, Nevanlinna H, Fagerholm R, Eerola H, Kang D, Yoo KY, Noh DY, Ahn SH, Hunter DJ, Hankinson SE, Cox DG, Hall P, Wedren S, Liu J, Low YL, Bogdanova N, Schürmann P, Dörk T, Tollenaar RA, Jacobi CE, Devilee P, Klijn JG, Sigurdson AJ, Doody MM, Alexander BH, Zhang J, Cox A, Brock IW, MacPherson G, Reed MW, Couch FJ, Goode EL, Olson JE, Meijers-Heijboer H, van den Ouweland A, Uitterlinden A, Rivadeneira F, Milne RL, Ribas G, Gonzalez- Neira A, Benitez J, Hopper JL, McCredie M, Southey M, Giles GG, Schroen C, Justenhoven C, Brauch H, Hamann U, Ko YD, Spurdle AB, Beesley J, Chen X; kConFab; AOCS Management Group, Mannermaa A, Kosma VM, Kataja V, Hartikainen J, Day NE, Cox DR, Ponder BA. (2007) Genome-wide association study identifies novel breast cancer susceptibility loci. Nature 447(7148):1087-93.

Eberle J, Krasagakis K, Orfanos CE. (1997) Translation initiation factor eIF-4A1 mRNA is consistently overexpressed in human melanoma cells in vitro. Int J Cancer 71(3):396-401.

Eberle AB, Stalder L, Mathys H, Orozco RZ, Mühlemann O. (2008) Posttranscriptional gene regulation by spatial rearrangement of the 3' untranslated region. PLoS Biol 6(4):e92.

Ebihara K, Nakamura Y. (1999) C-terminal interaction of translational release factors eRF1 and eRF3 of fission yeast: G-domain uncoupled binding and the role of conserved amino acids. RNA 5:739–50.

Eisenberg D, Marcotte EM, Xenarios I, Yeates TO. (2000) Protein function in the post-genomic era. Nature 405:823-6.

Evans SC, Lozano G. (1997) The Li-Fraumeni syndrome: an inherited susceptibility to cancer. Mol Med Today 3(9):390-5.

23 CHAPTER I | INTRODUCTION

Fearnhead NS, Wilding JL, Winney B, Tonks S, Bartlett S, Bicknell DC, Tomlinson IP, Mortensen NJ, Bodmer WF. (2004) Multiple rare variants in different genes account for multifactorial inherited susceptibility to colorectal adenomas. Proc Natl Acad Sci USA 101(45):15992-7.

Farr GW, Scharl EC, Schumacher RJ, Sondek S, Horwich AL (1997) Chaperonin-mediated folding in the eukaryotic cytosol proceeds through rounds of release of native and nonnative forms. Cell 89:927–37.

Ferlay J, Autier P, Boniol M, Heanue M, Colombet M, Boyle P. (2007) Estimates of the cancer incidence and mortality in Europe in 2006. Ann Oncol 18(3):581-92.

Ferro P, Catalano MG, Dell'Eva R, Fortunati N, Pfeffer U. (2002) The androgen receptor CAG repeat: a modifier of carcinogenesis? Mol Cell Endocrinol 193(1-2):109-20.

Fingar DC, Richardson CJ, Tee AR, Cheatham L, Tsou C, Blenis J. (2004) mTOR controls cell cycle progression through its cell growth effectors S6K1 and 4E-BP1/eukaryotic translation initiation factor 4E. Mol Cell Biol 24(1):200-16.

Frazier ML, Inamdar N, Alvula S, Wu E, Kim YH. (1998) Few point mutations in elongation factor- 1gamma gene in gastrointestinal carcinoma. Mol Carcinog 22(1):9-15.

Friedrichsen DM, Hawley S, Shu J, Humphrey M, Sabacan L, Iwasaki L, Etzioni R, Ostrander EA, Stanford JL. (2005) IGF-I and IGFBP-3 polymorphisms and risk of prostate cancer. Prostate 65(1):44- 51.

Frolova L, Le Goff X, Zhouravleva G, Davydova E, Philippe M, Kisselev L. (1996) Eukaryotic polypeptide chain release factor eRF3 is an eRF1- and ribosome-dependent guanosine triphosphatase. RNA 2(4):334-41.

Gagny B, Silar P. (1998) Identification of the genes encoding the cytosolic translation release factors from Podospora anserina and analysis of their role during the life cycle. Genetics 149(4):1763-75.

Gebauer F, Hentze MW. (2004) Molecular mechanisms of translational control. Nat Rev Mol Cell Biol 5(10):827-35.

Gil-Bazo I. (2007) Novel translational strategies in colorectal cancer research. World J Gastroenterol 13(44):5902-10.

Grentzmann G, Brechemier-Baey D, Heurgue V, Mora L, Buckingham RH. (1994) Localization and characterization of the gene encoding release factor RF3 in Escherichia coli. Proc Natl Acad Sci U S A 91(13):5848-52.

Gross T, Siepmann A, Sturm D, Windgassen M, Scarcelli JJ, Seedorf M, Cole CN, Krebber H. (2007) The DEAD-box RNA helicase Dbp5 functions in translation termination. Science 315:646-9.

Haiman CA, Hankinson SE, Spiegelman D, De Vivo I, Colditz GA, Willett WC, Speizer FE, Hunter DJ. (2000) A tetranucleotide repeat polymorphism in CYP19 and breast cancer risk. Int J Cancer 87:204– 10.

Hanash S. (2004) Integrated global profiling of cancer. Nat Rev Cancer 4(8):638-44.

Hansen LL, Jakobsen CG, Justesen J. (1999) Assignment of the human peptide chain release factor 3 (GSPT2) to Xp11.23-->p11.21 and of the distal marker DXS1039 by radiation hybrid mapping. Cytogenet Cell Genet 86(3-4):250-1.

Hegde R, Srinivasula SM, Datta P, Madesh M, Wassell R, Zhang Z, Cheong N, Nejmeh J, Fernandes- Alnemri T, Hoshino S, Alnemri ES. (2003) The polypeptide chain-releasing factor GSPT1/eRF3 is proteolytically processed into an IAP-binding protein. J Biol Chem 278(40):38699-706.

Hinestrosa MC, Dickersin K, Klein P, Mayer M, Noss K, Slamon D, Sledge G, Visco FM. (2007) Shaping the future of biomarker research in breast cancer to ensure clinical relevance. Nat Rev Cancer 7: 309– 15.

24 CHAPTER I | INTRODUCTION

Ho GH, Calvano JE, Bisogna M, Van Zee KJ. (2001) Expression of E2F-1 and E2F-4 is reduced in primary and metastatic breast carcinomas. Breast Cancer Res Treat 69:115–22.

Holbrook JA, Neu-Yilik G, Hentze MW, Kulozik AE. (2004) Nonsense-mediated decay approaches the clinic. Nat Genet 36(8):801-8.

Holland EC, Sonenberg N, Pandolfi PP, Thomas G. (2004) Signaling control of mRNA translation in cancer pathogenesis. Oncogene 23(18):3138-44.

Honore S, Pasquier E, Braguer D. (2005) Understanding microtubule dynamics for improved cancer therapy. Cell Mol Life Sci 62(24):3039-56.

Hoshino S, Miyazawa H, Enomoto T, Hanaoka F, Kikuchi Y, Kikuchi A, Ui M. (1989) A human homologue of the yeast GST1 gene codes for a GTP-binding protein and is expressed in a proliferation- dependent manner in mammalian cells. EMBO J 8(12):3807-14.

Hoshino S, Imai M, Mizutani M, Kikuchi Y, Hanaoka F, Ui M, Katada T. (1998) Molecular cloning of a novel member of the eukaryotic polypeptide chain-releasing factors (eRF). Its identification as eRF3 interacting with eRF1. J Biol Chem 273(35):22254-9.

Hoshino S, Imai M, Kobayashi T, Uchida N, Katada T. (1999a) The eukaryotic polypeptide chain releasing factor (eRF3/GSPT) carrying the translation termination signal to the 3'-Poly(A) tail of mRNA. Direct association of erf3/GSPT with polyadenylate-binding protein. J Biol Chem 274(24):16677-80.

Hoshino S, Hosoda N, Araki Y, Kobayashi T, Uchida N, Funakoshi Y, Katada T. (1999b) Novel function of the eukaryotic polypeptide-chain releasing factor 3 (eRF3/GSPT) in the mRNA degradation pathway. Biochemistry (Mosc) 64(12):1367-72.

Hosoda N, Kobayashi T, Uchida N, Funakoshi Y, Kikuchi Y, Hoshino S, Katada T. (2003) Translation termination factor eRF3 mediates mRNA decay through the regulation of deadenylation. J Biol Chem 278(40):38287-91.

Hsing AW, Chokkalingam AP, Gao YT, Wu G, Wang X, Deng J, Cheng J, Sesterhenn IA, Mostofi FK, Chiang T, Chen YL, Stanczyk FZ, Chang C. (2002) Polymorphic CAG/CAA repeat length in the AIB1/SRC-3 gene and prostate cancer risk: a population-based case-control study. Cancer Epidemiol Biomarkers Prev 11(4):337-41.

Hsu LM, Huang YS, Yang SY, Chang FY, Lee SD. (2006) Polymorphism of T-cell receptor gamma short tandem repeats as a susceptibility risk factor of hepatocellular carcinoma. Anticancer Res 26(5B):3787-91.

Huerta S. (2008) Recent advances in the molecular diagnosis and prognosis of colorectal cancer. Expert Rev Mol Diagn 8(3):277-88.

Hussain SP, Harris CC. (2007) Inflammation and cancer: an ancient link with novel potentials. Int J Cancer 121(11):2373-80.

Imai K, Yamamoto H. (2008) Carcinogenesis and microsatellite instability: the interrelationship between genetics and epigenetics. Carcinogenesis 29(4):673-80.

Inge-Vechtomov S, Zhouravleva G, Philippe M. (2003) Eukaryotic release factors (eRFs) history. Biol Cell 95(3-4):195-209.

International Human Genome Sequencing Consortium. (2004) Finishing the euchromatic sequence of the human genome. Nature 431(7011):931-45.

Ivanov PV, Gehring NH, Kunz JB, Hentze MW, Kulozik AE. (2008) Interactions between UPF1, eRFs, PABP and the exon junction complex suggest an integrated model for mammalian NMD pathways. EMBO J 27(5):736-47.

25 CHAPTER I | INTRODUCTION

Iyengar SK, Elston RC. (2007) The genetic basis of complex traits: rare variants or "common gene, common disease"? Methods Mol Biol 376:71-84.

Jakobsen CG, Segaard TM, Jean-Jean O, Frolova L, Justesen J. (2001) Identification of a novel termination release factor eRF3b expressing the eRF3 activity in vitro and in vivo. Mol Biol (Mosk) 35(4):672-81.

Jean-Jean O, Le Goff X, Philippe M. (1996) Is there a human [psi]? C R Acad Sci III 319(6):487-92.

Kaifi JT, Rawnaq T, Schurr PG, Yekebas EF, Mann O, Merkert P, Link BC, Kalinin V, Pantel K, Sauter G, Strate T, Izbicki JR. (2007a) Short tandem repeat polymorphism in exon 4 of esophageal cancer- related gene 2 detected in genomic DNA is a prognostic marker for esophageal cancer. Am J Surg 194(3):380-4.

Kaifi JT, Cataldegirmen G, Wachowiak R, Schurr PG, Kleinhans H, Kosti G, Yekebas EF, Mann O, Kutup A, Kalinin V, Strate T, Izbicki JR. (2007b) Short tandem repeat polymorphisms of exon 4 in Kazal-type gene ECRG2 in pancreatic carcinoma and chronic pancreatitis. Anticancer Res 27(1A):69-73.

Karim-Kos HE, de Vries E, Soerjomataram I, Lemmens V, Siesling S, Coebergh JW. (2008) Recent trends of cancer in Europe: a combined approach of incidence, survival and mortality for 17 cancer sites since the 1990s. Eur J Cancer 44(10):1345-89.

Kashima I, Yamashita A, Izumi N, Kataoka N, Morishita R, Hoshino S, Ohno M, Dreyfuss G, Ohno S. (2006) Binding of a novel SMG-1-Upf1-eRF1-eRF3 complex (SURF) to the exon junction complex triggers Upf1 phosphorylation and nonsense-mediated mRNA decay. Genes Dev 20(3):355-67.

King MDA, Roobol A, Carden MJ (2000). Confirmation of an interaction between eRF3 (Sup35p/GSPT1) and chaperonin CCT. Mol Biol Cell 11S:617.

Kisselev LL, Frolova LYu. (1995) Termination of translation in eukaryotes. Biochem Cell Biol 73(11- 12):1079-86.

Kikuchi Y, Shimatake H, Kikuchi A (1988) A yeast gene required for the G1-to-S transition encodes a protein containing an A-kinase target site and GTPase domain. EMBO J 7:1175–82.

Kobayashi T, Funakoshi Y, Hoshino S, Katada T. (2004) The GTP-binding release factor eRF3 as a key mediator coupling translation termination to mRNA decay. J Biol Chem 279(44):45693-700.

Kochetov AV, Ischenko IV, Vorobiev DG, Kel AE, Babenko VN, Kisselev LL, Kolchanov NA. (1998) Eukaryotic mRNAs encoding abundant and scarce proteins are statistically dissimilar in many structural features. FEBS Lett 440(3):351-5.

Kong C, Ito K, Walsh MA, Wada M, Liu Y, Kumar S, Barford D, Nakamura Y, Song H. (2004) Crystal structure and functional analysis of the eukaryotic class II release factor eRF3 from S. pombe. Mol. Cell 14:233–45.

Kononenko AV, Mitkevich VA, Dubovaya VI, Kolosov PM, Makarov AA, Kisselev LL. (2008) Role of the individual domains of translation termination factor eRF1 in GTP binding to eRF3. Proteins 70(2):388- 93.

Kovtun IV, McMurray CT. (2008) Features of trinucleotide repeat instability in vivo. Cell Res 18(1):198-213.

Kozlov G, Trempe JF, Khaleghpour K, Kahvejian A, Ekiel I, Gehring K. (2001) Structure and function of the C-terminal PABC domain of human poly(A)-binding protein. Proc Natl Acad Sci U S A 98(8):4409- 13.

Kryukov GV, Pennacchio LA, Sunyaev SR. (2007) Most rare missense alleles are deleterious in humans: implications for complex disease and association studies. Am J Hum Genet 80(4):727-39.

26 CHAPTER I | INTRODUCTION

Kubota H, Yokota S, Yanagi H, YuraKubota T (1999) Structures and co-regulated expression of the genes encoding mouse cytosolic chaperonin CCT subunits. Eur J Biochem 262: 492-500.

Kumazawa T, Tsuchiya N, Wang L, Sato K, Kamoto T, Ogawa O, Nakamura A, Kato T, Habuchi T. (2004) Microsatellite polymorphism of steroid hormone synthesis gene CYP11A1 is associated with advanced prostate cancer. Int J Cancer 110(1):140-4.

Kushnirov VV, Ter-Avanesyan MD, Telckov MV, Surguchov AP, Smirnov VN, Inge-Vechtomov SG. (1988) Nucleotide sequence of the SUP2 (SUP35) gene of Saccharomyces cerevisiae. Gene 66(1):45- 54.

Kushnirov VV, Ter-Avanesyan MD, Didichenko SA, Smirnov VN, Chernoff YO, Derkach IL, Novikova ON, Inge-Vechtomov SG, Neistat MA, Tolstorukov II. (1990) Divergence and conservation of SUP2 (SUP35) gene of yeast Pichia pinus and Saccharomyces cerevisiae. Yeast 6(6):461-72.

Kuzmiak HA, Maquat LE. (2006) Applying nonsense-mediated mRNA decay research to the clinic: progress and challenges. Trends Mol Med 12(7):306-16.

Lauren P. (1965) The two histological main types of gastric carcinoma: diffuse and so-called intestinal- type carcinoma. An attempt at a histo-clinical classification. Acta Pathol Microbiol Scand 64:31-49.

Le Goff C, Zemlyanko O, Moskalenko S, Berkova N, Inge-Vechtomov S, Philippe M, Zhouravleva G. (2002) Mouse GSPT2, but not GSPT1, can substitute for yeast eRF3 in vivo. Genes Cells 7(10):1043- 57.

Le Roy F, Salehzada T, Bisbal C, Dougherty JP, Peltz SW. (2005) A newly discovered function for RNase L in regulating translation termination. Nat Struct Mol Biol 12(6):505-12.

Lee JA, Park JE, Lee DH, Park SG, Myung PK, Park BC, Cho S. (2008) G1 to S phase transition protein 1 induces apoptosis signal-regulating kinase 1 activation by dissociating 14-3-3 from ASK1. Oncogene 27(9):1297-305.

Li C, Grönberg H, Matsuyama H, Weber G, Nordenskjöld M, Naito K, Bergh A, Bergerheim U, Damber JE, Larsson C, Ekman P. (2003) Difference between Swedish and Japanese men in the association between AR CAG repeats and prostate cancer suggesting a susceptibility-modifying locus overlapping the androgen receptor gene. Int J Mol Med 11:529–33.

Li FY, Lai MD. (2009) Colorectal cancer, one entity or three. J Zhejiang Univ Sci B 10(3):219-29.

Li R, Wang H, Bekele BN, Yin Z, Caraway NP, Katz RL, Stass SA, Jiang F. (2006) Identification of putative oncogenes in lung adenocarcinoma by a comprehensive functional genomic approach. Oncogene 25(18):2628-35.

Liu CH, Huang JD, Huang SW, Hour TC, Huang YK, Hsueh YM, Chiou HY, Lee TC, Jan KY, Chen CJ, Pu YS. (2008) Androgen receptor gene polymorphism may affect the risk of urothelial carcinoma. J Biomed Sci 15(2):261-9.

Liotta L, Petricoin E. (2000) Molecular profiling of human cancer. Nat Rev Genet 1(1):48-56.

Lobo MV, Martín ME, Pérez MI, Alonso FJ, Redondo C, Alvarez MI, Salinas M. (2000) Levels, phosphorylation status and cellular localization of translational factor eIF2 in gastrointestinal carcinomas. Histochem J 32(3):139-50.

Mamane Y, Petroulakis E, LeBacquer O, Sonenberg N. (2006) mTOR, translation initiation and cancer. Oncogene 25(48):6416-22.

Marchetti A, Buttitta F, Pellegrini S, Bertacca G, Callahan R. (2001) Reduced expression of INT-6/eIF3- p48 in human tumors. Int J Oncol 18(1):175-9.

Mathur S, Cleary KR, Inamdar N, Kim YH, Steck P, Frazier ML. (1998) Overexpression of elongation factor-1gamma protein in colorectal carcinoma. Cancer 82(5):816-21.

27 CHAPTER I | INTRODUCTION

Mauro VP, Edelman GM. (2002) The ribosome filter hypothesis. Proc Natl Acad Sci U S A 99(19):12031-6.

Mayeur GL, Hershey JW. (2002) Malignant transformation by the eukaryotic translation initiation factor 3 subunit p48 (eIF3e). FEBS Lett 514:49–54.

Mecklin JP. (2008) The implications of genetics in colorectal cancer. Ann Oncol 19 Suppl 5:v87-90.

Meric F, Hunt KK (2002) Translation Initiation in Cancer: A Novel Target for Therapy. Molec Cancer Therapeutics 1:971-9.

Merkulova TI, Frolova LY, Lazar M, Camonis J, Kisselev LL. (1999) C-terminal domains of human translation termination factors eRF1 and eRF3 mediate their in vivo interaction. FEBS Lett 443(1):41-7.

Meyuhas O. (2000) Synthesis of the translational apparatus is regulated at the translational level. Eur J Biochem 267(21):6321-30.

Milne RL, Benítez J. (2008) Current strategies in the search for low penetrance genes in cancer. Histol Histopathol 23(4):507-14.

Mimori K, Mori M, Inoue H, Ueo H, Mafune K, Akiyoshi T, Sugimachi K. (1996) Elongation factor 1 gamma mRNA expression in oesophageal carcinoma. Gut 38(1):66-70.

Mimori K, Mori M, Tanaka S, Akiyoshi T, Sugimachi K. (1995) The overexpression of elongation factor 1 gamma mRNA in gastric carcinoma. Cancer 75(6 Suppl):1446-9.

Mita MM, Mita A, Rowinsky EK. (2003) The molecular target of rapamycin (mTOR) as a therapeutic target against cancer. Cancer Biol Ther 2(4 Suppl 1):S169-77.

Mitkevich VA, Kononenko AV, Petrushanko IY, Yanvarev DV, Makarov AA, Kisselev LL. (2006) Termination of translation in eukaryotes is mediated by the quaternary eRF1*eRF3*GTP*Mg2+ complex. The biological roles of eRF3 and prokaryotic RF3 are profoundly distinct. Nucleic Acids Res 34(14):3947-54.

Mugnier P, Tuite MF. (1999) Translation termination and its regulation in eukaryotes- recent insights provided by studies in yeast. Biochemistry (Mosc) 64(12):1360-6.

Munkholm P. (2003) Review article: the incidence and prevalence of colorectal cancer in inflammatory bowel disease. Aliment Pharmacol Ther 18:1-5.

Nakamura Y, Ito K. (1998) How protein reads the stop codon and terminates translation. Genes to Cells 3:265-78.

Nannini M, Pantaleo MA, Maleddu A, Astolfi A, Formica S, Biasco G. (2009) Gene expression profiling in colorectal cancer using microarray technologies: results and perspectives. Cancer Treat Rev 35(3):201-9.

Narod SA, Foulkes WD. (2004) BRCA1 and BRCA2: 1994 and beyond. Nat Rev Cancer 4(9):665-76.

Nie Q, Wang Z, Zhang GC, An SJ, Lin JY, Guo AL, Li R, Gan B, Huang Y, Mok TS, Wu YL. (2007) The epidermal growth factor receptor intron1 (CA) n microsatellite polymorphism is a potential predictor of treatment outcome in patients with advanced lung cancer treated with Gefitinib. Eur J Pharmacol 570(1-3):175-81.

Nupponen NN, Porkka K, Kakkola L, Tanner M, Persson K, Borg A, Isola J, Visakorpi T. (1999) Amplification and overexpression of p40 subunit of eukaryotic translation initiation factor 3 in breast and prostate cancer. Am J Pathol 154(6):1777-83.

28 CHAPTER I | INTRODUCTION

Okamoto I, Krögler J, Endler G, Kaufmann S, Mustafa S, Exner M, Mannhalter C, Wagner O, Pehamberger H. (2006) A microsatellite polymorphism in the heme oxygenase-1 gene promoter is associated with risk for melanoma. Int J Cancer 119(6):1312-5.

Ozawa K, Murakami Y, Eki T, Yokoyama K, Soeda E, Hoshino S, Ui M, Hanaoka F. (1992) Mapping of the human GSPT1 gene, a human homolog of the yeast GST1 gene, to chromosomal band 16p13.1. Somat Cell Mol Genet 18(2):189-94.

Pandolfi PP. (2004) Aberrant mRNA translation in cancer pathogenesis: an old concept revisited comes finally of age. Oncogene 23(18):3134-7.

Perry N, Broeders M, de Wolf C, Törnberg S, Holland R, von Karsa L. (2008) European guidelines for quality assurance in breast cancer screening and diagnosis. Fourth edition--summary document. Ann Oncol 19(4):614-22.

Pickering BM, Willis AE. (2005) The implications of structured 5' untranslated regions on translation and disease. Semin Cell Dev Biol 16(1):39-47.

Pincheira R, Chen Q, Zhang JT. (2001) Identification of a 170-kDa protein over-expressed in lung cancers. Br J Cancer 84(11):1520-7.

Plotz G, Zeuzem S, Raedle J. (2006) DNA mismatch repair and Lynch syndrome. J Mol Histol 37(5- 7):271-83.

Polychronakos C. (2008) Common and rare alleles as causes of complex phenotypes. Curr Atheroscler Rep 10(3):194-200.

Proud CG. (2002) Regulation of mammalian translation factors by nutrients. Eur J Biochem 269(22):5338-49.

Rajasekhar VK, Holland EC. (2004). Postgenomic global analysis of translational control induced by oncogenic signaling. Oncogene 23: 3248-64.

Rakoff-Nahoum S. (2006) Why cancer and inflammation? Yale J Biol Med 79(3-4):123-30.

Riggins GJ, Lokey LK, Chastain JL, Leiner HA, Sherman SL, Wilkinson KD, Warren ST. (1992) Human genes containing polymorphic trinucleotide repeats. Nat Genet 2(3):186-91.

Rosenwald IB, Wang S, Savas L, Woda B, Pullman J. (2003) Expression of translation initiation factor eIF-2alpha is increased in benign and malignant melanocytic and colonic epithelial neoplasms. Cancer 98(5):1080-8.

Rothe M, Ko Y, Albers P, Wernert N. (2000) Eukaryotic initiation factor 3 p110 mRNA is overexpressed in testicular seminomas. Am J Pathol 157(5):1597-604.

Saha A, Dhir A, Ranjan A, Gupta V, Bairwa N, Bamezai R. (2005) Functional IFNG polymorphism in intron 1 in association with an increased risk to promote sporadic breast cancer. Immunogenetics 57(3e4):165–71.

Salas-Marco J, Bedwell DM. (2004) GTP hydrolysis by eRF3 facilitates stop codon decoding during eukaryotic translation termination. Mol Cell Biol 24:7769-78.

Schildkraut JM, Murphy SK, Palmieri RT, Iversen E, Moorman PG, Huang Z, Halabi S, Calingaert B, Gusberg A, Marks JR, Berchuck A. (2007) Trinucleotide repeat polymorphisms in the androgen receptor gene and risk of ovarian cancer. Cancer Epidemiol Biomarkers Prev 16(3):473-80.

Shen L, Toyota M, Kondo Y, Lin E, Zhang L, Guo Y, Hernandez NS, Chen X, Ahmed S, Konishi K, Hamilton SR, Issa JP. (2007) Integrated genetic and epigenetic analysis identifies three different subclasses of colon cancer. Proc Natl Acad Sci U S A 104(47):18654-9.

29 CHAPTER I | INTRODUCTION

Simons CT, Staes A, Rommelaere H, Ampe C, Lewis SA, Cowan NJ. (2004) Selective contribution of eukaryotic prefoldin subunits to actin and tubulin binding. J Biol Chem 279:4196-203.

Singh G, Rebbapragada I, Lykke-Andersen J. (2008) A competition between stimulators and antagonists of Upf complex recruitment governs human nonsense-mediated mRNA decay. PLoS Biol 6(4):e111.

Sonenberg N, Dever TE. (2003) Eukaryotic translation initiation factors and regulators. Curr Opin Struct Biol 13(1):56-63.

Sonenberg N, Hinnebusch AG. (2009) Regulation of translation initiation in eukaryotes: mechanisms and biological targets. Cell 136(4):731-45.

Stansfield I, Jones KM, Kushnirov VV, Dagkesamanskaya AR, Poznyakovski AI, Paushkin SV, Nierras CR, Cox BS, Ter-Avanesyan MD, Tuite MF. (1995) The products of the SUP45 (eRF1) and SUP35 genes interact to mediate translation termination in Saccharomyces cerevisiae. EMBO J 14(17):4365-73.

Stoneley M, Willis AE. (2003) Aberrant regulation of translation initiation in tumorigenesis. Curr Mol Med 3(7):597-603.

Suter NM, Malone KE, Daling JR, Doody DR, Ostrander EA. (2003) Androgen receptor (CAG)n and (GGC)n polymorphisms and breast cancer risk in a population-based case-control study of young women. Cancer Epidemiol Biomarkers Prev 12:127–35.

Suzuki K, Nakazato H, Matsui H, Koike H, Okugi H, Ohtake N, Takei T, Nakata S, Hasumi M, Yamanaka H. (2003) Association of the genetic polymorphism of the CYP19 intron 4[TTTA]n repeat with familial prostate cancer risk in a Japanese population. Anticancer Res 23(6D):4941-6.

Tahara E. (2004) Genetic pathways of two types of gastric cancer. IARC Sci Publ (157):327-49.

Takayama T, Miyanishi K, Hayashi T, Sato Y, Niitsu Y. (2006) Colorectal cancer: genetics of development and metastasis. J Gastroenterol 41(3):185-92.

Ter-Avanesyan MD, Kushnirov VV, Dagkesamanskaya AR, Didichenko SA, Chernoff YO, Inge- Vechtomov SG, Smirnov VN. (1993) Deletion analysis of the SUP35 gene of the yeast Saccharomyces cerevisiae reveals two non-overlapping functional regions in the encoded protein. Mol Microbiol 7(5):683-92.

Thakur A, Xu H, Wang Y, Bollig A, Biliran H, Liao JD. (2005) The role of X-linked genes in breast cancer. Breast Cancer Res Treat 93(2):135-43.

The International HapMap Consortium. (2003) The International HapMap Project. Nature 426(6968):789-96.

Thulasiraman V, Yang C, Frydman J (1999) In vivo newly translated polypeptides are sequestered in a protected folding environment. EMBO J 18:85–95.

Tian G, Vainberg IE, Tap WD, Lewis SA, Cowan NJ. (1995) Specificity in chaperonin-mediated protein folding. Nature 375:250–3.

Tidow N, Boecker A, Schmidt H, Agelopoulos K, Boecker W, Buerger H, Brandt B. (2003) Distinct amplification of an untranslated regulatory sequence in the EGFR gene contributes to early steps in breast cancer development. Cancer Res 63:1172–8.

Tomlinson VA, Newbery HJ, Wray NR, Jackson J, Larionov A, Miller WR, Dixon JM, Abbott CM. (2005) Translation elongation factor eEF1A2 is a potential oncoprotein that is overexpressed in two-thirds of breast tumours. BMC Cancer 5:113.

Tranque P, Hu MC, Edelman GM, Mauro VP. (1998) rRNA complementarity within mRNAs: A possible basis for mRNA-ribosome interactions and translational control. Proc Natl Acad Sci U S A 95(21):12238-43

30 CHAPTER I | INTRODUCTION

Tseng RC, Chang JW, Hsien FJ, Chang YH, Hsiao CF, Chen JT, Chen CY, Jou YS, Wang YC. (2005) Genomewide loss of heterozygosity and its clinical associations in non small cell lung cancer. Int J Cancer 117(2):241-7.

Tsuge M, Hamamoto R, Silva FP, Ohnishi Y, Chayama K, Kamatani N, Furukawa Y, Nakamura Y. (2005) A variable number of tandem repeats polymorphism in an E2F-1 binding element in the 50 flanking region of SMYD3 is a risk factor for human cancers. Nat Genet 37:1104–7.

Uchida N, Hoshino S, Imataka H, Sonenberg N, Katada T. (2002) A novel role of the mammalian GSPT/eRF3 associating with poly(A)-binding protein in Cap/Poly(A)-dependent translation. J Biol Chem 277(52):50286-92.

Urakov VN, Valouev IA, Lewitin EI, Paushkin SV, Kosorukov VS, Kushnirov VV, Smirnov VN, Ter- Avanesyan MD. (2001) Itt1p, a novel protein inhibiting translation termination in Saccharomyces cerevisiae. BMC Mol Biol 1:2-9.

Uthoff SM, Hunt LE, Grant BS, Young VV, Eichenberger MR, Cobbs GA, Galandiuk S. (2002) T-cell receptor gamma: a microsatellite marker for colorectal cancer. Ann Surg Oncol 9(1):88-93.

Vainberg IE, Lewis SA, Rommelaere H, Ampe C, Vandekerckhove J, Klein HL, Cowan NJ. (1998) Prefoldin, a chaperone that delivers unfolded proteins to cytosolic chaperonin. Cell 93:863–73.

Valouev IA, Kushnirov VV, Ter-Avanesyan MD (2002) Yeast polypeptide chain release factors eRF1 and eRF3 are involved in cytoskeleton organization and cell cycle regulation. Cell Motil Cytoskeleton 52:161-73.

Varley JM. (2003) Germline TP53 mutations and Li-Fraumeni syndrome. Hum Mutat 21(3):313-20.

Vashist YK, Blessmann M, Trump F, Kalinin V, Kutup A, Schneider C, Gawad K, Kaifi JT, Schmelzle R, Izbicki JR, Yekebas EF. (2008) Microsatellite GTn-repeat polymorphism in the promoter of heme oxygenase-1 gene is an independent predictor of tumor recurrence in male oral squamous cell carcinoma patients. J Oral Pathol 37(8):480-4.

Verhagen AM, Kratina TK, Hawkins CJ, Silke J, Ekert PG, Vaux DL. (2007) Identification of mammalian mitochondrial proteins that interact with IAPs via N-terminal IAP binding motifs. Cell Death Differ 14(2):348-57.

Wang S, Rosenwald IB, Hutzler MJ, Pihan GA, Savas L, Chen JJ, Woda BA. (1999) Expression of the eukaryotic translation initiation factors 4E and 2alpha in non-Hodgkin's lymphomas. Am J Pathol 155(1):247-55.

Wang W, Czaplinski K, Rao Y, Peltz SW. (2001) The role of Upf proteins in modulating the translation read-through of nonsense-containing transcripts. EMBO J 20(4):880-90.

Watkins SJ, Norbury CJ. (2002) Translation initiation and its deregulation during tumorigenesis. Br J Cancer 86(7):1023-7.

Werner M, Becker KF, Keller G, Höfler H. (2001) Gastric adenocarcinoma: pathomorphology and molecular pathology. J Cancer Res Clin Oncol 127(4):207-16.

Yamada N, Yamaya M, Okinaga S, Nakayama K, Sekizawa K, Shibahara S, Sasaki H. (2000) Microsatellite polymorphism in the heme oxygenase-1 gene promoter is associated with susceptibility to emphysema. Am J Hum Genet 66(1):187-95.

Yokota S, Yanagi H, Yura T, Kubota H. (1999) Cytosolic chaperonin is upregulated during cell growth: preferential expression and binding to tubulin at G1/S transition through early S phase. J Biol Chem 274:37070–8.

Zecevic M, Amos CI, Gu X, Campos IM, Jones JS, Lynch PM, Rodriguez-Bigas MA, Frazier ML. (2006) IGF1 gene polymorphism and risk for hereditary nonpolyposis colorectal cancer. J Natl Cancer Inst 98(2):139-43.

31 CHAPTER I | INTRODUCTION

Zhang W, Yu WW (2007) Polymorphisms of short tandem repeat of genes and breast cancer susceptibility. Eur J Surg Oncol 33(5):529-34.

Zheng L, Wang L, Ajani J, Xie K. (2004) Molecular basis of gastric cancer development and progression. Gastric Cancer 7(2):61-77.

Zheng W, Gao YT, Shu XO, Wen W, Cai Q, Dai Q, Smith JR. (2004) Population-based case-control study of CYP11A gene polymorphism and breast cancer risk. Cancer Epidemiol Biomarkers Prev 13:709–14.

Zhong X, Hemmi H, Koike J, Tsujita K, Shimatake H. (2000) Various AGC repeat numbers in the coding region of the human transcription factor gene E2F-4. Hum Mutat 15(3):296-7.

Zhouravleva G, Frolova L, Le Goff X, Le Guellec R, Inge-Vechtomov S, Kisselev L, Philippe M. (1995) Termination of translation in eukaryotes in governed by two interacting polypeptide chain release factors, eRF1 and eRF3. EMBO J 14:4065-72.

Zhouravleva G, Schepachev V, Petrova A, Tarasov O, Inge-Vechtomov S. (2006) Evolution of translation termination factor eRF3: is GSPT2 generated by retrotransposition of GSPT1's mRNA? IUBMB Life 58(4):199-202.

Zisman Y, Rubin DT. (2008) Colorectal cancer and dysplasia in inflammatory bowel disease. World J Gastroenterol 14:2662-9.

Zondervan PE, Wink J, Alers JC, IJzermans JN, Schalm SW, de Man RA, van Dekken H. (2000) Molecular cytogenetic evaluation of virus-associated and non-viral hepatocellular carcinoma: analysis of 26 carcinomas and 12 concurrent dysplasias. J Pathol 192(2):207-15.

32

2. CHAPTER II

ERF3 A/GSPT1 POLYMORPHISMS AND GENE EXPRESSION ALTERATIONS IN CANCER

PARER 1. Differential expression of the eukaryotic release factor 3 (eRF3/GSPT1) according to gastric cancer histological type. Malta-Vacas J, Ramos S, Aires C, Costa P, Conde AR, Martins AP, Monteiro C, Brito M. Published in: J Clin Pathol. 2005 Jun;58(6):621-5.

PAPER 2. Polyglycine expansions in eRF3/GSPT1 are associated with gastric cancer susceptibility. Brito M, Malta-Vacas J, Aires C, Costa P, Carmona B, Gaspar G, Monteiro C. Published in: Carcinogenesis. 2005 Dec;26(12):2046-9.

33

34 CHAPTER II | PAPER 1

35 CHAPTER II | PAPER 1

36 CHAPTER II | PAPER 1

37 CHAPTER II | PAPER 1

38 CHAPTER II | PAPER 1

39

40 CHAPTER II | PAPER 2

41 CHAPTER II | PAPER 2

42 CHAPTER II | PAPER 2

43 CHAPTER II | PAPER 2

44

3. CHAPTER III ROLE OF ERF3 A DEREGULATION IN TUMORIGENESIS

PAPER 3. eRF3a/GSPT1 12GGC allele increases the susceptibility for breast cancer development. Malta-Vacas J, Chauvin C, Gonçalves L, Nazaré A, Carvalho C, Monteiro C, Bagrel D, Jean-Jean O, Brito M Published in: Oncol Rep 2009 Jun;21(6):1551-8.

PAPER 4. eRF3a/GSPT1 (GGC)n alleles differential expression in cancer. Malta-Vacas J, Ferreira P, Monteiro C, Brito M Submitted to: Cancer, Genetics and Cytogenetics

PAPER 5. Translation termination and protein folding pathway genes are not correlated in gastric cancer. Malta-Vacas J, Nolasco S, Monteiro C, Soares H, Brito M (2009) Published in: Clin Chem Lab Med 2009;47(4):427-31.

45

46 CHAPTER III | PAPER 3

47 CHAPTER III | PAPER 3

48 CHAPTER III | PAPER 3

49 CHAPTER III | PAPER 3

50 CHAPTER III | PAPER 3

51 CHAPTER III | PAPER 3

52 CHAPTER III | PAPER 3

53 CHAPTER III | PAPER 3

54 CHAPTER III | PAPER 4

eRF3a/GSPT1 (GGC)n alleles differential expression in cancer

Joana Malta-Vacas 1, Paula Ferreira 1, Carolino Monteiro 2, Miguel Brito 1

1Escola Superior de Tecnologia da Saúde de Lisboa, 1990-096 Lisboa, Portugal; 2Faculdade de Farmácia da Universidade de Lisboa, Lisboa, Portugal

ABSTRACT

The human eukaryotic release factor 3a (eRF3a), encoded by eRF3a/GSPT1 gene, is up- regulated in various human cancers. eRF3a/GSPT1 contains a (GGC)n polymorphism in exon 1, encoding a polyglycine expansion in the N-terminal of the protein. The longer allele (12-GGC) was previously shown to be associated to cancer. Here we show that the 12-GGC allele is present in colorectal cancer patients (allele frequency = 1.09%) but not in Crohn Disease patients and the control population. Using real time quantitative RT-PCR we show that the 12- GGC allele present up to 10-fold higher transcription levels than the 10-GGC allele (p<0.001). No eRF3a/GSPT1 amplifications were detected and there was no correlation between the length of the alleles and methylation levels of the CpG sites inside the GGC expansion. Using flow cytometry, we compared the levels of apoptosis and proliferation rates between cell lines with different genotypes, but no significant differences were detected. Finally, we used a cytokinesis-block micronucleus assay to evaluate the frequency of micronucleus in the same cell lines. Our results show that cell lines with the longer alleles have higher frequencies of micronucleus in binucleated cells, which is probably a result of defects in mitotic spindle formation. Taken together, our results show that eRF3a should be considered as a potential proto-oncogene.

55 CHAPTER III | PAPER 4

INTRODUCTION

In humans, the eukaryotic release factor 3 (eRF3) has two distinct isoforms: eRF3a, encoded by eRF3a/GSPT1 gene located in 16p13.1 [1] and eRF3b, encoded by eRF3b/GSPT2 gene located in Xp11.21-23 [2]. eRF3a/GSPT1 mRNA is abundant in all tissues and its level varies during the cell cycle, whereas eRF3b/GSPT2 mRNA is poorly expressed in most mouse tissues tested, except in brain [3]. It was previously reported that eRF3a/GSPT1 mRNA level is increased in intestinal type gastric tumors and breast cancer [4,5] and strongly decreased during human chondrocytes differentiation [6]. Eukaryotic translation termination is governed by two release factors, eRF1 and eRF3. These factors associate in a complex which binds to the ribosomal A site. eRF1 recognises the three stop codons, and promotes the hydrolysis of the peptidyl-tRNA and the release of the nascent polypeptide chain. eRF3 is a small GTPase that enhances eRF1 activity [7]. eRF3a and eRF3b proteins share 87% identity, most of the differences being concentrated in their N-terminal domains. The C-terminal region of eRF3 proteins is highly conserved and essential for translation termination and interaction with eRF1 whereas the N- terminal region varies in length and sequence among species [7]. It was recently shown that this domain also influences eRF3 functions in translation and possibly in other cellular processes [8,9]. Beside eRF3 roles in translation termination and related pathways, this factor was also reported to be involved in cell cycle progression [3,10], apoptosis regulation [11] and cytoskeleton organization [12-14]. The N-terminal domain of human eRF3a contains a polyglycine expansion encoded by a stable (GGC)n polymorphism in eRF3a/GSPT1 first exon. As it is implicated in essential cellular processes, modifications in the amino-terminal domain of eRF3a might be of crucial relevance. We recently reported a strong association between the longest allele (12-GGC) and cancer development [5,15], which was shown to be a germline mutation. In this study we aimed to gain new insights into the role of the (GGC)n expansion in eRF3a/GSPT1 gene expression regulation, and ultimately to evaluate eRF3a/GSPT1 as a biomarker for cancer diagnosis. Screening for the 12GGC allele in eRF3a/GSPT1 exon 1 might provide a molecular tool able to identify individuals at risk, as well as possible targets for therapy. Furthermore, a better understanding of eRF3a/GSPT1 gene expression regulation can shed light on understanding the origin and progression of tumors in general. Colorectal cancer (CRC) is one of the most prevalent cancers and leading cause of cancer mortality worldwide. Five to ten percent of all cases are due to highly penetrant mutations in single genes, giving rise to hereditary syndromes that are mostly transmitted as autosomal dominant traits. Low penetrance susceptibility genes account for a high proportion of colorectal cancer in both familial and sporadic CRC [16]. Crohn’s disease (CD) is a chronic inflammatory disease that can affect the entire gastrointestinal tract from the mouth to the anus. Inflammation has long been associated with the development of cancer. Nowadays, the association between CD and increased risk for CRC is widely accepted [17]. CRC is the most common type of cancer in inflammatory bowel disease (IBD), although cancer in other organs can occur. Although CRC associated to IBD accounts only for 1%-2% of all cases of CRC in the general population, it is considered a serious complication of these diseases and accounts for approximately 10%-15% of all deaths in IBD patients [18]. Several of the molecular alterations that contribute to sporadic

56 CHAPTER III | PAPER 4

CRC are also found in IBD-associated CRC [17]. CD is a complex disease in which multiple genetic and environmental factors are likely to contribute to pathogenesis, and the search for CD susceptibility genes therefore poses similar problems to those in other complex disorders. In this study, we detected the 12-GGC allele in 2,2% of the CRC patients, but not in the CD and control populations. Also, we confirmed that the 12-GGC allele of eRF3a/GSPT1 mRNA levels are significantly up-regulated, when compared with the shorter (GGC)n alleles, both in primary lymphocyte cultures and in Jurkat modified cell lines. To explore which mechanisms might be responsible for 12-GGC up-regulation, we analysed and correlated eRF3a/GSPT1 expression with CpG methylation within the GGC expansion and eRF3a/GSPT1 gene copy number. Further, we have determined and compared proliferation and apoptosis rates in cells expressing eRF3a proteins with 7-12 Gly residues. Finally, we evaluated the impact of the length of the N-terminal domain of eRF3a in ensuring a correct mitotic spindle assembling. Our data show that there are similar overall efficiencies in what concerns eRF3a role in apoptosis, and we did not detect quantitative differences on the cell cycle progression parameters between all the (GGC)n alleles tested. However, the longer alleles seem to differentially ensure the genome stability, as revealed by the occurrence of greater number of micronucleus in cells expressing eRF3a/GSPT1 12-GGC allele. Our data suggest that specific gene expression profiles that distinguish eF3a/GSPT1 alleles may contribute to their different roles in the tumorigenesis process.

MATERIALS AND METHODS

Study subjects Study subjects were patients from Instituto Português de Oncologia – Lisboa, and were included in the study after informed consent was obtained. This study was approved by the Scientific and the Ethical Committees. Our samples included 138 individuals with colo-rectal cancer (CRC) and 94 individuals with Crohn Disease (CD). The tumors were diagnosed as CRC after histopathological examination performed in the department of pathology. The control population was composed of 135 healthy blood donors, adjusted for age and sex.

DNA isolation DNA from CRC patients was isolated from blood spots using The Generation Capture Card Kit (Gentra Systems, Minneapolis, USA), according to the manufacturer instructions. DNA from controls and CD patients was extracted from peripheral blood using a standard phenol-chloroform extraction [19].

Patients genotyping for the STR alleles The (GGC)n fragment in eRF3a/GSPT1 was PCR amplified using a 6’-FAM labelled forward primer (5’- CATTTCTCGCTCTCTGTCCAC-3’) and a non-labelled reverse primer (5’-CTGGTCCCAGCAGTCAGG- 3’) as described previously [4], being genotyped in an ABI 310 sequencer and analysed with GeneScan 3.7 software (Applied Biosystems, Foster City, California, USA). Direct DNA sequencing of each detected allele was performed to confirm the GGC repeat length.

57 CHAPTER III | PAPER 4

Quantitative Methylation analysis After bisulphite conversion of genomic DNA, the target region including the GGC expansion was PCR 2+ amplified. PCR reactions included 1x buffer USB containing 1.5 mmol Mg , 0.5 mM MgCl 2, 0.35 mM dNTP, 0.22 µM Forward primer, 0.22 µM 5’-biotinylated Reverse primer and 0.04U USB HotStartTaq IT DNA polymerase (USB Corporation, Cleaveland USA), in a total of 45 volume reaction. Cycling conditions were as follows: 94°C 3’, 50x (94°C 35’’, 63.6°C 35’’, 72°C 35’’), 72°C 5’. For heterozygous samples, an extra PCR reaction was performed (reverse assay) in order to analyse both alleles independently. Reaction conditions were the same as described above. Primers are listed in Table 1.

Table 1 : Primer’s sequences for pyrosequencing assays Forward Assay Reverse Assay Forward atggtttttttgattatggatttgggtagtgg gggattggagttgttgttgtggtgatg Reverse Biotin-cccaacccaaaaacttccatatccacctaa Biotin-aaaaacccaacccaaaaacttccatatccacctaat Sequencing ttttttgattatggatttg actactactaccactactactcc

Sample preparation was carried out using Vacuum Prep Tool according to standard procedures. 40-45 µl PCR product was immobilized to 3 µl Streptavidin Sepharose™ HP beads (GE Healthcare, Germany) followed by annealing to 0.2 µM sequencing primer for 2’ at 80°C. Pyrosequencing reaction is performed using the PSQ ID System (Biotage, Uppsala, Sweeden) by the sequential addition of single nucleotides in a predefined order. CpG analyses were done with Pyro Q-CpG software (Biotage).

Primary lymphocyte cultures Thirty patients were selected according to their genotypes, and 10ml of peripheral blood were drawn into tubes containing heparine (Sigma, St. Louis, USA) as anticoagulant. Lymphocytes were isolated by density centrifugation (Ficoll-Paque; GE Healtcare) and cultured in a humidified 5% CO 2 incubator at 37°C in RPMI 1640 medium (Sigma) supplemented with 10% fetal bovine serum (Sigma), antibiotics (100 U/ml penicillin and 50 µg /ml streptomycin) and 10 µg/ml phytohemagglutinin (Sigma). Lymphocytes (10 5 cells/well) were incubated in six-well tissue culture plates in 5 ml medium. eRF3a modified cell lines The human eRF3a/GSPT1 cDNA containing 10 GGC repeats was cloned into the pBK-CMV expression vector (Stratagene, La Jolla, USA), as described previously [20]. This original plasmid pCMV-heRF3a was used to construct other plasmids expressing eRF3a with different GGC repeat length alleles. eRF3a/GSPT1 exon 1 fragments with GGC repeat length of 7, 9, 10, 11, and 12 were amplified by PCR from genomic DNA of previously genotyped patients, using 5’CCATTTCTCGCTCTCTGTCCACC3’ and 5’ACTCAACGTCAACGCCAAG3’ primers. The PCR fragments were digested with XmaI and BamHI, purified, and ligated into the XmaI/ BamHI fragment of pCMV-heRF3a, as described previously [5]. The five eRF3a-(GGC)n expression plasmids obtained were sequenced to verify the correct sequence and GGC repeat length of the inserts.

58 CHAPTER III | PAPER 4

Jurkat cells (ATCC Cat. No. TIB-152) were maintained in RPMI medium (Sigma) supplemented with 10% fetal bovine serum and antibiotics (100 U/ml penicillin and 50 µg /ml streptomycin). 2x10 5 cells were transfected with 1 µg of each eRF3a-(GGC)n plasmid using Lipofectamine™ LTX Reagent (Invitrogen, Carlsbag, CA, USA) added by Plus Reagent (Invitrogen), according to the manufacturer’s protocol. Five distinct Jurkat-eRF3a(GGC)n cell lines were obtained, each expressing an eRF3a protein with different N- terminal domain length. eRF3a/GSPT1 gene expression 48h after the establishment of lymphocyte primary cultures, 10 5 cells were collected and washed with ice- cold PBS 1X (Sigma). In what concerns the Jurkat-(GGC)n cell lines, 48h after transfections, 10 5 cells were harvested for analysis of RNA levels. Total RNA was extracted using the SV Total RNA Isolation System (Promega, Mannheim, Germany), as recommended by the manufacturer. First strand cDNA was synthesised using MultiScribeTM reverse transcriptase (Applied BioSystems), with random hexamers, according to the manufacturer’s instructions in a total volume of 50 µl; samples were incubated at 25˚C 10’, 48˚C 30’, 95˚C 5’. Relative expression of eRF3a/GSPT1 was investigated using real time quantitative RT-PCR using gene- specific primers and TaqMan probes, as described in Malta-Vacas et al. [15]. Relative quantification of the mRNA levels of eRF3a/GSPT1 was determined using the ∆∆ CT method [21]. Briefly, the amount of target was normalised to the endogenous reference gene (18S rRNA PDAR, Applied BioSystems) and its expression was calculated relative to a calibrator sample. Final results are expressed as N-fold difference in target sample expression relative to a calibrator sample. eRF3a/GSPT1 genomic DNA quantification Genomic DNA was isolated from the remaining pellet of lysed cells used for RNA extraction, following a standard protocol of phenol-chlorophorm extraction. Gene dosage was assessed by quantitative real time PCR using SYBR Green dye I as the fluorescent signal. This assay relies on a comparison of the amount of product generated from the target gene (eRF3/GSPT1) and that generated from a disomic reference gene ( β-actin). Equal PCR efficiencies for both genes have been validated previously [15]. A fragment of genomic DNA from eRF3/GSPT1 was amplified using SYBR Green PCR Master Mix (Applied BioSystems) in a 20 µl reaction volume and the endogenous control gene β-actin was measured simultaneously. Each series of PCR reactions included triplicates for all tumor and normal samples, a non-template control, and a five point standard curve, established using serial dilutions (1/2, 1/5, 1/10, 1/100 and 1/500) of a known disomic sample for both genes. PCR reactions were performed in the iCycler iQ Real-Time PCR Detection System (BioRad, Hercules, California, USA). Cycling conditions were: 50˚C 2’, 95˚C 10’, 40x (95˚C 15’’, 60˚C 1’). In each experiment the threshold cycle was manually adjusted and Ct values were averaged for each sample. A standard curve was established for each gene using the serial dilutions. For each sample, the amount of eRF3/GSPT1 and β-actin was determined from the standard curve. The gene dosage of eRF3/GSPT1 was calculated by the ratio of its amount and the amount of the reference gene. The ratio of tumor to

59 CHAPTER III | PAPER 4

normal is expected to be 1 for disomic samples, greater than 1 if there are allele amplifications, and less than 1 in the presence of allele deletions. After the amplification reaction, melting curves were constructed from 45°C–95°C to confirm the specificity of the PCR products.

Analysis of apoptosis and proliferation rates Apoptosis was evaluated using the Annexin V-FITC Apoptosis Detection kit (BD Biosciences, San Jose, CA, USA) according to the manufacturer's instructions. The test is based on the selective affinity of annexin V for phospholipid phosphatidylserine, which is translocated from the inner to the outer layer of the cell membrane of apoptotic cells [22] . Both primary lymphocyte cultures and Jurkat-eRF3a(GGC)n cell line were tested. After 72h in culture, 10 6 cells were harvested, washed twice with PBS and stained with annexin V-FITC and propidium iodide (PI) for 15 min at room temperature. Stained cells acquisition was performed by quadrant dot plot dual parameter analysis on a FACScan flow cytometer (Becton Dickinson, Mountain View, CA), equipped with a laser emitting excitation light at 488 nm. Fluorescence compensation was adjusted to minimize overlap of FL1 and FL2 signals. Annexin V -/ PI - cells were considered as viable cells; annexin V +/ PI - cells as in early apoptosis, whereas annexin V+/ PI + cells are necrotic or in late apoptosis. "Starving cells" that easily undergo apoptosis were used as positive staining control. Data were analysed using the PAINT-A-GATE software (BD Immunocytometry Systems, San Jose, CA), and expressed as percentage of the total cells evaluated. Cell proliferation studies were performed on 10 6 frozen cells using DNA flow cytometry analysis according to the method of Deitch et al. [23] . After washing twice, the cells nuclei were stained with PI (Sigma) in

Tris-MgCl2 buffer, treated with Ribonuclease (Sigma) and non-ionic detergent Nonidet P40 (Sigma) for 1 hour in the dark at 4ºC, and further acquired on a FACScan instrument (BD Biosciences). Cell cycle analysis of DNA histograms was performed using the ModFit LT software (Verity Software House, Inc., Topsham, ME). As measures of cell proliferation, the S-phase fraction and the Proliferative Index (S+G2M) were determined from the histogram as the percentage of cells in the respective phase of the cycle.

Cytokinesis-block Micronucleus assay The Cytokinesis-block Micronucleus assay (CBMN) was performed in Jurkat-(GGC)n cell lines and in patient’s lymphocyte primary cultures. 6 µg/ml cytochalasin B (Sigma) were added to the culture medium 44 h after transfections or cultures establishment, to Jurkat-(GGC)n cells or lymphocyte cultures, respectively. 28h later, the cells were harvested, and 100 µl of the cell suspension were spun onto microscope slides using a cytocentrifuge (Shandon, Pittsburgh, PA, USA). The slides were dried and double stained May-Grünwald-Giemsa (Sigma) and mounted with Entellan (Merck, Darmstadt, Germany). For each sample, 1000 binucleated cells were scored blindly using a ZEISS light optical microscope following the scoring criteria outlined by HUMN Project [24]. Monitored values included: number of mono-, bi-, and multinucleated cells, incidence of micronuclei, nucleoplasmic bridges, and nuclear buds and

60 CHAPTER III | PAPER 4

cytokinesis block proliferation index (CBPI). Micronucleus incidence was presented as the number of micronuclei per 1000 examined binuclear cells. CBPI was calculated according to formula: CBPI = (M1 + 2M2 + 3(M3+M4)) / N, where M1-M4 represents the number of cells with 1 to 4 nuclei found, respectively, and N is the total number of scored cells. The CBPI is a measure of the average number of cell cycles that a cell population passes through, considering both three-nucleated and tetra-nucleated cells in the same category.

Statistical analysis Allele frequencies and Fisher’s tests were calculated in GENEPOP, version 1.2 [25]. Case-control odds ratios (OR) and 95% CI (confidence intervals) were calculated as estimators of relative risk, according to Sokal & Rohlf [26]. Non-parametric correlations were evaluated by Spearman’s correlations, one-way analysis of variance (ANOVA) was used for comparisons between groups and T-Test between pairs of groups, using SPSS 15.0 statistical package (SSPS Inc., Chicago, IL, USA). A p value <0.05 was defined as significant.

RESULTS

GGC expansion polymorphism of eRF3a/GSPT1 The genotypes of 138 colorectal cancer (CRC) patients, 94 Crohn Disease (CD) patients and 135 healthy blood donors were determined by fluorescent PCR amplification and peak detection in an automatic sequencer. The five known eRF3a/GSPT1 GGC alleles corresponding to 7, 9, 10, 11 and 12 GGC repeat units were identified. The 10-GGC allele was the most frequent in the three samples. The 9-GGC allele was exclusively detected in the control population, while the 12-GGC allele was only detected in CRC patients, as shown in Table 2. Using the Fisher’s test method, we detected significant differences between the CRC and CD populations both in allelic (χ2= 6.513; p=0.03852) and genotypic (χ2= 7.105; p=0.02866) frequencies. To measure the association of the alleles of eRF3a/GSPT1 gene with disease development, case-control odds ratios (OR) and 95% CI (confidence intervals) were calculated as estimators of relative risk. The analysis did not reveal any statistically significant risk or protective effect associated to any particular allele/genotype, except for the 10-11GGC genotype which is marginally significantly protector in CD (Table 2). Although not statistically significant, the 12-GGC allele is associated with a 6-fold increased risk for CRC and the 9-GGC allele presents a 5-fold protective effect for both diseases.

61 CHAPTER III | PAPER 4

Table 2: Allelic and Genotypic Frequencies and Odds Ratio analysis

CRC CD F (%) OR CI F (%) OR CI Alleles 7 5.43 0.67 0.35 - 1.36 11.7 1.5 0.80 - 2.82 9 - 0.19 0.01 - 3.98 - 0.29 0.01 - 6.02 10 70.65 Ref 68.62 Ref 11 22.83 0.96 0.64 - 1.44 19.68 0.86 0.54 - 1.37 12 1.09 6.64 0.34 - 129.47 - 1.43 0.03 - 72.66 Genotypes 7-7 - 0.27 0.01 - 6.76 1.06 1.22 0.12 - 12.13 7-10 9.42 0.99 0.44 - 2.21 15.96 1.15 0.52 - 2.54 7-11 1.45 0.58 0.11 - 3.05 5.32 1.92 0.47 - 7.75 9-10 - 0.16 0.01 - 3.45 - 0.24 0.01 - 5.21 10-10 49.28 Ref 47.87 Ref 10-11 32.61 0.64 0.38 - 1.09 25.53 0.52 0.28 - 0.96 10-12 0.72 2.43 0.10 - 60.85 - 1.22 0.02 - 62.70 11-11 5.07 4.05 0.67 - 24.23 4.26 3.66 0.55 - 24.20 11-12 1.45 4.05 0.19 - 86.14 - 1.22 0.02 - 62.70 (CRC: colorectal cancer; CD; Crohn’s Disease; F: frequency; OR: odds ratio; CI: confidence interval)

Correlation between GGC repeat number and methylation levels The number of GGC repeats in eRF3a/GSPT1 exon 1 is directly proportional to the number of CpG sites inside the expansion. Because epigenetic changes may contribute to gene expression alterations, we used pyrosequencing technology to perform a quantitative analysis of the methylation status of the CpG sites located within the GGC repeat expansion. Twenty five DNA samples were analysed, comprising all the genotypes detected and including DNA isolated from tumor tissue samples, normal tissue adjacent to the tumor, blood samples from cancer patients and blood from control individuals. All CpG sites in every sample showed no methylation. Figure 1 represents a representative pyrogram quantifying methylation levels at CpG sites within the GGC expansion in the first exon of eRF3a/GSPT1 gene. The GGC repeat length variation from 7 to 12 appears to have no effect on the methylation status of the region, regardless of the source of the DNA sample.

62 CHAPTER III | PAPER 4

Figure 1: Representative pyrogram quantifying methylation levels at 12 CpG sites in a 146bp PCR fragment containing 12GGC repeats. The order of nucleotide dispensation (sequence below chart) is chosen by the software on the basis of the sequence context. E and S indicate Enzyme and Substrate control in the reaction, respectively. Values between 1-4% are within the sensitivity and error range of pyrosequencing, eRF3a/GSPT1 mRNA expression in primary lymphocytes cell lines In order to evaluate if the length of the GGC repeat expansion could in some way modulate eRF3a/GSPT1 gene transcription, we obtained primary cultures of lymphocytes isolated from selected individuals. Thirty two primary cell lines were established, including six different genotypes (7-10GGC, 7- 11GGC, 10-10GGC, 10-11GGC, 11-11GGC and 11-12GGC). After 48h in culture, cells were collected and the levels of expression of eRF3a/GSTP1 were determined by a quantitative real time PCR. As shown in Figure 2A, the mRNA levels of eRF3a/GSPT1 show significant variation between the genotypes, as revealed by the one-way variance test ANOVA (p=0,001). When compared to the levels of expression in the 10-10GGC genotype (considered as reference), the cells representing the genotype 11-12GGC present a 7,6-fold increased in the mRNA level. In order to evaluate if the DNA copy number alterations could be responsible for variations in the levels of expression of eRF3a/GSPT1 gene, we used a real-time PCR assay to measure the gene dosage of eRF3a/GSPT1 relative to a disomic gene ( β-actin) in the same primary cell lines. Gene dosage of eRF3a/GSPT1 show no variation between the genotypes (see Fig. 2B), as revealed by the one-way variance test ANOVA (p=0.97). The eRF3a/GSPT1 copy number assessment showed that only 1 out of 30 cell lines presented genetic losses ( eRF3a/GSPT1 / β-actin = 0.29). However, the levels of mRNA expression in this 10-10GGC cell line are within the same range as the other cell lines with the same genotype. For all the remaining cell lines, quantitative results ranged from 0.65 to 1.28, which is in the range of expected values for disomic samples. We did not detect eRF3a/GSPT1 amplifications in any of the cell lines analysed.

63 CHAPTER III | PAPER 4

eRF3a/GSPT1 A 12

10 **

8

6

4

2 Relative gene expression 0 7-10 7-11 10-10 10-11 11-11 11-12 Genotype B 2

1,5

1 Gene dosage Gene 0,5

0 7-10 7-11 10-10 10-11 11-11 11-12 Genotype

Figure 2: Quantitative analysis of eRF3a/GSPT1 mRNA and DNA levels in primary lymphocyte cell lines derived from patients with different genotypes. A) mRNA levels were quantified by reverse-transcription real time PCR using gene specific primers and TaqMan Probes. 18SrRNA was used as endogenous control gene. The cell lines with the 10-10GGC genotype were considered as reference. The level of eRF3a/GSPT1 is standardized to 1 for the reference genotype. The levels of expression of eRF3a/GSPT1 in the other cell lines (with different genotypes) are expressed as n-fold difference, when compared to the reference. Error bars represent the standard error of the mean. T-Test were used to evaluate differences between each group and the reference:**p<0.005 B) DNA levels were quantified by a SYBR Green based real time PCR assay using β-actin as reference disomic gene. Gene dosage is expressed as the ratio between eRF3a/GSPT1 and β-actin. Error bars represent the standard error of the mean.

Translation termination factor’s mRNA expression in immortalized lymphoblastoid cell lines We quantified eRF3a/GSPT1 mRNA levels of expression in Jurkat-eRF3a(GGC)n cell lines, derived from the Jurkat lymphoblastoid cell line, that transiently express eRF3a/GSPT1 alleles encoding proteins with different glycine expansion lengths.

64 CHAPTER III | PAPER 4

As can be observed in Figure 3A, the mRNA levels of eRF3a/GSPT1 show significant variation between the genotypes (p<0.0001). The Jurkat-9GGC cell line mRNA level was 17-fold lower and the Jurkat- 12GGC mRNA level was 12-fold higher, when compared with the reference Jurkat-10GGC cell line. We also quantified eRF3b/GSPT2 mRNA levels to determine whether the changes in eRF3a/GSPT1 levels were adjusted by modifications in eRF3b/GSPT2 gene expression. Significant differences between genotypes were also detected (p<0.05), as shown in Fig 3B. However, when the level of eRF3b/GSPT2 mRNA in each cell line was compared with the level of expression in the reference cell line, only the Jurkat-7GGC level of eRF3b/GSPT2 was significantly different (6-fold lower than in the Jurkat-10GGC cell line). In what concerns eRF1, the key factor in translation termination, there were no variations in the mRNA levels between cell lines with different genotypes (p>0.05), as shown in Fig 3C.

Analysis of apoptosis and proliferation rates To evaluate whether the length of the GGC repeat expansion in the first exon of eRF3a/GSPT1 gene might be related to the protein role as an inhibitor of apoptosis binding protein (IAP-BP) we quantified the levels of apoptosis in cells expressing proteins with 7-12 Gly residues in the N-terminal of eRF3a. We first compared the lymphocyte primary cell lines and, as can be appreciated in Figure 4A, there were no significant statistical differences between different genotypes in what concerns the number of viable cells, number of death cells and total apoptotic cells. Interestingly, there was a positive correlation between the number of viable cells and increased number of GGC repeats (r=0.370, p=0.048) as well as a negative correlation between the number of apoptotic cells and the GGC repeat number increase (r=−0.411, p=0.027). In what concerns the same analysis in Jurkat-eRF3a(GGC)n cell lines (Figure 4B), no statistically significant difference was observed between cell lines with different genotypes in the parameters analysed, and the correlations could not be confirmed. We also analysed the cell cycle status in the same cell lines. With regard to the percentage of cells in S- phase and the proliferation index (S+G2M), no statistically significant difference was found between cell lines with different genotypes (Figure 4C and 4D). Moreover, any correlation between these cell cycle parameters and the number of GGC repeats could be established.

65 CHAPTER III | PAPER 4

A eRF3a/GSPT1

12 * 10

8

6

4

2

Relative Expression Gene 0 * NT P 7GGC 9GGC 10GGC 11GGC 12GGC

B eRF3b/GSPT2

5

4

3

2

1

RelativeExpression Gene 0 * NT P 7GGC 9GGC 10GGC 11GGC 12GGC

C eRF1

5

4

3

2

1

0

RelativeExpression Gene NT P 7GGC 9GGC 10GGC 11GGC 12GGC

Figure 3: Relative gene expression levels in Jurkat-eRF3a(GGC)n cell lines. mRNA levels of eRF3a/GSPT1 (A), eRF3b/GSPT2 (B) and eRF1 ( C) were quantified by reverse-transcription real time PCR. The cell line transfected with the 10GGC allele was considered as reference. The level of mRNA of the target gene is standardized to 1 in the reference cell line. The levels of expression of the target genes in the other cell lines are expressed as n-fold difference, when compared to the reference. Results presented are the mean of 3 experiences. Error bars represent the standard error of the mean. T-Test were used to evaluate differences between each cell line and the reference:*p<0.05. NT: Non-transfected cell line; P: cell line transfected with an empty vector.

66 CHAPTER III | PAPER 4

A viable B viable Apoptosis Apoptosis dead dead apoptotic apoptotic 80 100

80 60

60 40 40

20 20

0 0 7-10 7-11 10-10 10-11 11-11 11-12 NT P 7 9 10 11 12

C D S-Phase Proliferation S-Phase Proliferation S+G2M S+G2M

60 50

50 40

40 30 30 20 20

10 10

0 0 7-10 7-11 10-10 10-11 11-11 11-12 NT P 7 9 10 11 12

Figure 4: Flow cytometric analysis of apoptotic and proliferation parameters in cells expressing proteins with 7-12 Gly in the N-terminal of eRF3a. Percentage of viable cells, dead cells and total apoptotic cells were determined for lymphocyte primary cultures of patients with different genotypes (A) and in Jurkat- (GGC)n cell lines (B). The percentage of cells in S-Phase and the Proliferation Index S+G2M were calculated for the same lymphocyte primary cultures (C) and for Jurkat-(GGC)n cell lines (D).

Cytokinesis-block micronucleus assay The cytokinesis-block MN (CBMN) assay was performed in Jurkat-(GGC)n cell lines and patient’s lymphocyte primary cultures, analyzing a minimum of 1000 binucleated cells per each cell line. The CBMN assay showed that formation of micronucleus is more frequent in cell lines with longer GGC expansions (Table 3). The cell line Jurkat-12GGC showed the highest number of MN frequencies in binucleated cells (20.87). This cell line also presented the highest number of Tri- and Tetranucleated cells. In what concerns the lymphocyte cultures, the same pattern was observed: the cells with the 12-GGC allele showed the highest incidence of MN in bi-nucleated cells (21.98), being the increase roughly of the same order of magnitude when compared to the reference 10-10GGC genotype (3.33 MN / 1000 binucleated cells). Regarding cytokinesis block proliferation index (CBPI) values, the results showed that the variation in the GGC expansion length did not affect this proliferation index.

67 CHAPTER III | PAPER 4

Table 3: Cytogenetic analysis of cytokinesis-blocked cultured (Jurkat-GGC)n cells. Frequencies of all parameters are calculated relative to 1000 binucleated cells observed. Mono Tri Tetra MN_Mono MN_Bi MN_Tri MN_Tetra CBPI Jurkat-NT 229.3 5.46 4.55 0.91 3.64 0.00 0.00 1.8 Jurkat-P 314.96 7.87 8.86 1.97 2.95 0.00 0.98 1.83 Jurjat-7GGC 435.47 7.86 8.98 3.37 7.86 2.24 0.00 1.92 Jurkat-9GGC 372.02 6.94 10.91 1.98 3.97 0.00 0.99 1.86 Jurkat-10GGC 341.06 8.34 12.97 1.85 4.63 0.93 0.00 1.88 Jurkat-11GGC 255.42 5.92 12.82 5.92 18.74 0.00 2.96 1.89 Jurkat-12GGC 330.02 10.93 20.87 3.98 20.87 1.99 0.99 1.96 Mono: mononucleated cells; Tri: trinucleated cells; Tetra: tetranucleated cells; MN_Mono: mononucleated cells with micronucleus; MN_Bi: binucleated cells with micronucleus; MN_Tri: trinucleated cells with micronucleus; MN_Tetra: tetranucleated cells with micronucleus; CBPI: cytokinesis block proliferation index; NT: non-transfected; P: empty plasmid

DISCUSSION eRF3a plays a pivotal role in human cells, taking part in different major processes for cell survival. The eRF3a/GSPT1 gene harbours a (GGC)n stable expansion in exon 1, which codes for a Gly stretch in the N-terminal domain of the protein. The amino-terminal region of eRF3a was shown to be involved in its interaction with other proteins, which is necessary to accomplish different eRF3a functions. In this study we showed that the longer known allele (12-GGC), which has been associated with cancer development, is present in 2.2% of the colorectal cancer (CRC) patients. When we combine the results obtained in this study with previously published reports in other cancer models [4,5], the 12GGC allele is present in 5.1% of the patients (N=411) with an allele frequency of 3%, corresponding to a 12-fold increased risk for cancer development (OR= 11.8; SE=1.43; C.I.=0.71-195.46). Epidemiological evidence points to a connection between inflammation and a predisposition for the development of cancer, i.e. long-term inflammation leads to the development of dysplasia [27]. As many of the genetic and epigenetic alterations involved in IBD-associated CRC are common to sporadic colorectal tumors, we postulated that the 12GGC allele could be used as a predictive marker in CD patients. However, we failed to find the 12-GGC allele in CD patients so, this hypothesis could not be supported. Therefore, the 12GGC allele is not likely associated with inflammation. eRF3a/GSPT1 mRNA levels have been reported to be up-regulated both in intestinal type gastric tumors [15] and in breast tumors [5] when compared to normal adjacent tissues. Also, patients with the 12-GGC allele revealed increased levels of mRNA expression when compared with the shorter alleles. However, the mechanism involved in eRF3a/GSPT1 over-expression was not understood. In good agreement with our previous study [5], here we show that the mRNA levels of eRF3a/GSPT1 expressing the 12-GGC allele were significantly up-regulated both in primary lymphocyte cultures of patients with different genotypes and in Jurkat modified cell lines expressing the 5 alleles (Jurkat-(GGC)n), when compared with the 10GGC allele. In the Jurkat-(GGC)n cell lines the levels of eRF3b/GSPT2 and eRF1 were also quantified, but no correlation between eRF3a/GSPT1 expression and the levels of mRNA of the other

68 CHAPTER III | PAPER 4

translation termination factors could be established. This results also corroborate previously publish data [5,15,28] and support the idea that elevated eRF3a/GSPT1 mRNA levels are not the result of a coordinate up-regulation of the translation termination machinery necessary to support increased translation rates. It is now widely recognised that epigenetic modifications are a common mechanism of gene expression regulation via gene transcription, and that methylation of CpG dinucleotides is an important mechanism in the carcinogenesis process [29]. In eRF3a/GSPT1 exon 1 (GGC)n polymorphism, the number of CpG sites is directly proportional to the number of GGC repeats present. However, our data show that the GGC repeat length variation from 7 to 12 have no effect on the methylation status of this region. Regardless of the source of the DNA sample (tumors, normal tissues or blood, cancer patients or controls), all CpG sites inside the GGC expansion showed no methylation. Therefore, the methylation level inside the GGC expansion cannot explain differences in the levels of transcription between alleles. CpG islands often occur as clusters of CpG residues found in the 5’ regions of about 50% of the human genes. These areas are usually unmethylated in normal somatic cells, which is believed to be a prerequisite for active transcription [29,30]. Using the CpG Island Searcher software (http://cpgislands.usc.edu/), we found that the GGC expansion is localized inside a 1195bp CpG island (64.5%GC; ObsCpG/ExpCpG=0.898) that spans part of the 5’UTR, the entire exon 1 and part of intron 1 in eRF3a/GSPT1 gene (data not shown). The remaining CpG sites in this island should therefore be analysed and correlated with the expression of the gene. DNA copy number gains and losses are often responsible for aberrant gene expression patterns associated with malignancy. An example of this is HER2 gene amplification, a common event in breast cancer, leading to overexpression of the protein in about 20% of the patients [31,32]. eRF3a/GSPT1 gene copy dosage was determined in DNA samples from tumors and normal tissues of individuals with all possible genotypes, but no correlations were found between gene copy dosage and mRNA levels of expression. No amplifications of eRF3a/GSPT1 were detected in any of the samples analysed, namely in the samples with the 12-GGC allele. These results reveal that other mechanisms must be responsible for the elevated levels of eRF3a/GSPT1 mRNA found in a significant proportion of both gastric and breast tumors. Although the signalling pathways and the proteins involved are still not identified, it was shown that eRF3a depletion inhibits not only translation but also the cell cycle progression in HCT116 cell line, via mTOR pathway inhibition [10]. The mTORC1 controls the level of cap-dependent mRNA translation by modulating the activity of key translational components. It is known that eIF4E and S6K activity is enhanced in several cancer cell lines and human tumors due to the increase of mTOR activity [33]. The efficiency of eRF3a as a translation termination factor was already shown not to be affected by the length of the glycine expansion in the N-terminal domain of the protein [5]. In this study, we showed that the length variation of the glycine expansion from 7 to 12 in eRF3a N-terminal also has no effect on the cell cycle progression, as reflected by the Proliferation Index (S+G2M) and the percentage of cells in the S- Phase of the cell cycle, neither in lymphocyte cultures nor in Jurkat-(GGC)n cell lines. eRF3a also acts as a regulator of apoptosis being proteolytically processed into an isoform that contains a conserved N-terminal IAP-binding motif [11,34]. Disturbance of the correct interaction/ balance between

69 CHAPTER III | PAPER 4

eRF3a and IAPs can release these proteins and consequently repress or even block the apoptosis pathways in which they are involved. Although the polymorphic glycine stretch is not present in the processed isoform of eRF3a, since it is part of the 69 N-terminal residues excluded by proteolytic cleavage, we raised the hypothesis that the number of glycine residues might interfere in the cleavage process. To test for this possibility, we quantified the levels of apoptosis in cells expressing proteins with 7-12 Gly in the N-terminal domain. Our observation that the percentage of viable cells, dead cells and total apoptotic cells was not significantly different over the range of 7-12 Gly residues suggests that this range of repeat lengths is optimal for eRF3a activity as a IAP-binding protein. Using different organisms as study models, eRF3 was shown to affect cytoskeleton assembly. eRF3 was shown to affect the tubulin cytoskeleton, suggesting a role in the control of chromosome segregation at the anaphase [13]. Its involvement in the assembly of the actin cytoskeleton in yeast was also demonstrated [14], affecting the impairment of the mitotic spindle structure and segregation. Deregulation of eRF3 expression also resulted in abnormal meiotic chromosome segregation and defects in the cytoskeleton assembly in spermatids of Drosophila melanogaster [12]. Regulation of microtubules dynamics, the key components of the cytoskeleton, is crucial for mitosis, cell migration, cell signalling and trafficking. The formation of micronuclei (MN) in dividing cells is the result of chromosome breakage due to unrepaired or mis-repaired DNA lesions, or chromosome malsegregation due to mitotic malfunction. MN frequency is therefore considered a predictive biomarker of cancer risk [35]. We used the frequency of MN as a biomarker of chromosomal damage and genome stability. Our results show that the formation of MN is more frequent in cell lines with longer GGC expansions, with a maximum value in cells expressing the 12GGC allele, both in the Jurkat-(GGC)n cell lines and in the primary lymphocyte cultures. These results may be indicative that the encoded proteins could induce malsegregation of chromatids/chromosomes by interfering with the accurate functioning of the mitotic spindle. It is known that in cancer cells, centrosomes are often found amplified to greater than two per cell, resulting in an increased frequency of chromosome segregation errors (chromosome instability). Destabilization of chromosomes by centrosome amplification aids acquisition of further malignant phenotypes, hence promoting tumor progression [36]. In accordance, several studies have reported increased MN frequencies in peripheral lymphocytes from cancer patients when compared with matched control populations [37,38]. In summary, we have investigated the gene expression profiles induced by different alleles of eRF3a/GSPT1 gene. Our results show that the significant up-regulation in gene expression associated with the 12-GGC allele may be the primary effect of eRF3a-mediated oncogenesis. Further, our data suggests a greater chromosomal damage resulting from mitotic spindle defects in cells expressing eRF3a-12GGC . These patterns highlight the distinct functions of the individual alleles of eRF3a/GSPT1 and may contribute to the developmental and oncogenic roles of eRF3a/GSPT1 . The translation of the present results to clinical practice remains a challenge but carries the promise of more effective diagnostic, prognostic and medical treatment strategies for cancer.

70 CHAPTER III | PAPER 4

ACKNOWLEDGMENTS

The authors thank Doutora Lisete Fernandes for the Jurkat cells donated and for her help in plasmid amplification. We also thank Dra. Marília Cravo and Dr. António Pinto from Instituto Português de Oncologia Francisco Gentil. WE are also grateful to Doutor Olivier Jean-Jean for His help in plasmid constructions. This work was supported by Fundação para a Ciência e Tecnologia from Ministério da Ciência e Ensino Superior (project PTDC/SAU-GMG/67031/2006 and grant SFRH/BD/21468/2005 to JMV).

REFERENCES

[1] Ozawa K, Murakami Y, Eki T, Yokoyama K, Soeda E, Hoshino S, Ui M, Hanaoka F. Mapping of the human GSPT1 gene, a human homolog of the yeast GST1 gene, to chromosomal band 16p13.1. Somat Cell Mol Genet 1992;18:189-94.

[2] Hansen LL, Jakobsen CG, Justesen J. Assignment of the human peptide chain release factor 3 (GSPT2) to Xp11.23-->p11.21 and of the distal marker DXS1039 by radiation hybrid mapping. Cytogenet Cell Genet 1999;86:250-1.

[3] Hoshino S, Imai M, Mizutani M, Kikuchi Y, Hanaoka F, Ui M, Katada T. Molecular cloning of a novel member of the eukaryotic polypeptide releasing factors (eRF). Its identification as eRF3 interacting with eRF1. J Biol Chem 1998;273:22254-9.

[4] Brito M, Malta-Vacas J, Carmona B, Aires C, Costa P, Martins AP, Ramos S, Conde AR, Monteiro C. Polyglycine expansions in eRF3/GSPT1 are associated with gastric cancer susceptibility. Carcinogenesis 2005;26:2046-9.

[5] Malta-Vacas J, Chauvin C, Gonçalves L, Nazaré A, Carvalho C, Monteiro C, Bagrel D, Jean-Jean O, Brito M. eRF3a/GSPT1 12GGC allele increases the susceptibility for breast cancer development. Oncology Reports 2009;21:1551-8.

[6] Tallheden T, Karlsson C, Brunner A, Van Der Lee J, Hagg R, Tommasini R, Lindahl A. Gene expression during redifferentiation of human articular chondrocytes. Osteoarthritis Cartilage 2004;12:525- 35.

[7] Zhouravleva G, Frolova L, Le Goff X, Le Guellec R, Inge-Vechtomov S, Kisselev L, Philippe M. Termination of translation in eukaryotes in governed by two interacting polypeptide chain release factors, eRF1 and eRF3. EMBO J 1995;14:4065-72.

[8] Kodama H, Ito K, Nakamura Y. The role of N-terminal domain of translational release factor eRF3 for the control of functionality and stability in S. cerevisiae. Genes Cells 2007;12:639-50.

71 CHAPTER III | PAPER 4

[9] Volkov K, Osipov K, Valouev I, Inge-Vechtomov S, Mironova L. N-terminal extension of Saccharomyces cerevisiae translation termination factor eRF3 influences the suppression efficiency of sup35 mutations. FEMS Yeast Res 2007;7:357-65.

[10] Chauvin C, Salhi S, Jean-Jean O. Human eukaryotic release factor 3a depletion causes cell cycle arrest at G1 phase through inhibition of the mTOR pathway. Mol Cell Biol 2007;27:5619-29.

[11] Hegde R, Srinivasula SM, Datta P, Madesh M, Wassell R, Zhang Z, Cheong N, Nejmeh J, Fernandes-Alnemri T, Hoshino S, Alnemri ES. The polypeptide chain releasing factor GSPT1/eRF3 is proteolytically processed into an IAP-binding protein. J Biol Chem 2003;278:38699-706.

[12] Basu J, Williams BC, Li Z, Williams EV, Goldberg ML. Depletion of a Drosophila homolog of yeast Sup35p disrupts spindle assembly, chromosome segregation, and cytokinesis during male meiosis. Cell Motil Cytoskeleton 1998;139:286-302.

[13] Borchsenius AS, Tchourikova AA, Inge-Vechtomov SG. Recessive mutations in SUP35 and SUP45 genes coding for translation release factors affect chromosome stability in Saccharomyces cerevisiae. Curr Genet 2000;37:285-91.

[14] Valouev IA, Kushnirov VV, Ter-Avanesyan MD. Yeast polypeptide chain release factors eRF1 and eRF3 are involved in cytoskeleton organization and cell cycle regulation. Cell Motil Cytoskeleton 2002;52:161-73.

[15] Malta-Vacas J, Aires C, Costa P, Conde AR, Ramos S, Martins AP, Monteiro C, Brito M. Differential expression of the eukaryotic release factor 3 (eRF3/GSPT1) according to gastric cancer histological types. J Clin Pathol 2005;58:621-5.

[16] Mecklin JP. The implications of genetics in colorectal cancer. Ann Oncol 2008;19:v87-90.

[17] Zisman Y, Rubin DT. Colorectal cancer and dysplasia in inflammatory bowel disease. World J Gastroenterol 2008;14:2662-9.

[18] Munkholm P. Review article: the incidence and prevalence of colorectal cancer in inflammatory bowel disease. Aliment Pharmacol Ther 2003;18:1-5.

[19] Sambrook J, Russel DW. Molecular Cloning: A laboratory manual. 3rd ed. New York: Cold Spring Harbor Laboratory Press; 2002.

[20] Chauvin C, Salhi S, Le Goff C, Viranaicken W, Diop D, Jean-Jean O. Involvement of Human Release Factors eRF3a and eRF3b in Translation Termination and Regulation of the Termination Complex Formation. Mol Cell Biol 2005;25:5801–11.

[21] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001;25:402-8.

[22] Vermes I, Haanen C, Steffens-Nakken H, Reutelingsperger C. A novel assay for apoptosis: flow cytometric detection of phosphatidylserine expression on early apoptotic cells using fluorescein labelled annexin V. J Immunol Methods 1995;184:39-51.

72 CHAPTER III | PAPER 4

[23] Deitch AD, Law H, White RD. A stable propidium iodide staining procedure for flow cytometry. J Histochem Cytochem 1982;30:967-72.

[24] Fenech M, Chang WP, Kirsch-Volders M, Holland N, Bonassi S, Zeiger E. HUman MicronNucleus Project. HUMN project: detailed description of the scoring criteria for the cytokinesis-block micronucleus assay using isolated human lymphocyte cultures. Mutat Res 2003;534:65-75.

[25] Raymond M, Rousset F. GENEPOP (version 1.2): population genetics software for exact tests and ecumenicism. J Heredity 1995;86:248-9.

[26] Sokal RR, Rohlf JF. Biometry, the Principle and Practice of Statistics in Biological Research. 3rd ed.: New York: W.H. Freeman and Company; 1995.

[27] Allavena P, Garlanda C, Borrello MG, Sica A, Mantovani A. Pathways connecting inflammation and cancer. Curr Opin Genet Dev 2008;18:3-10.

[28] Malta-Vacas J, Nolasco S, Monteiro C, Soares H, Brito M. Translation termination and protein folding pathways are up-regulated in gastric cancer. Clin Chem Lab Med 2009;47:427-31.

[29] Esteller M. Epigenetic gene silencing in cancer: the DNA hypermethylome. Hum Mol Genet 2007;16:R50-9.

[30] Dunn BK. Hypomethylation: one side of a larger picture. Ann N Y Acad Sci 2003;983:28-42.

[31] Pal SK, Pegram M.. HER2 targeted therapy in breast cancer...beyond Herceptin. Rev Endocr Metab Disord 2007;8:269-77.

[32] Park JW, Neve RM, Szollosi J, Benz CC. Unraveling the biologic and clinical complexities of HER2. Clin Breast Cancer 2008;8:392-401.

[33] Averous J, Proud CG. When translation meets transformation: the mTOR story. Oncogene 2006;25:6423–5.

[34] Verhagen AM, Kratina TK, Hawkins CJ, Silke J, Ekert PG, Vaux DL. Identification of mammalian mitochondrial proteins that interact with IAPs via N-terminal IAP binding motifs. Cell Death Differ 2007;14:348-57.

[35] Eastmond DA, Tucker JD. Identification of aneuploidy-inducing agents using cytokinesis-blocked human lymphocytes, and an antikinetochore antibody. Environ Mol Mutagen 1989;13:34-43.

[36] Gisselsson D. Mitotic instability in cancer: is there method in the madness? Cell Cycle 2005;8:1007- 10.

[37] Bonassi S, Znaor A, Ceppi M, Lando C, Chang WP, Holland N, Kirsch-Volders M, Zeiger E, Ban S, Barale R, Bigatti MP, Bolognesi C, Cebulska-Wasilewska A, Fabianova E, Fucic A, Hagmar L, Joksic G, Martelli A, Migliore L, Mirkova E, Scarfi MR, Zijno A, Norppa H, Fenech M. An increased micronucleus frequency in peripheral blood lymphocytes predicts the risk of cancer in humans. Carcinogenesis 2007;28:625-31.

73 CHAPTER III | PAPER 4

[38] Iarmarcovai G, Ceppi M, Botta A, Orsière T, Bonassi S. Micronuclei frequency in peripheral blood lymphocytes of cancer patients: a meta-analysis. Mutat Res 2008;659:274-83.

74 CHAPTER III | PAPER 5

75 CHAPTER III | PAPER 5

76 CHAPTER III | PAPER 5

77 CHAPTER III | PAPER 5

78 CHAPTER III | PAPER 5

79

80

4. CHAPTER IV

DISCUSSION

This chapter presents an integrative discussion of the results obtained in the 5 papers that compose Chapters II and III of this dissertation (Malta-Vacas et al., 2005; Brito et al., 2005; Malta-Vacas et al., 2009a; Malta-Vacas et al., 2009b; Malta-Vacas et al., submitted).

The concept that genetic variation underlies inter-individual differences in drug response and contributes to the risk of developing common complex disorders is expanding rapidly. Consequently, the interest in genetic translational research has increased. A great proportion of the success observed in Mendelian disease mapping was due to the strong heritability of the traits in families and the fact that mutation of a single gene was, for most diseases, the driving force behind disease pathogenesis; in almost all instances, a strong genotype–phenotype correlation could be drawn. Complex diseases do not necessarily follow traditional patterns of Mendelian inheritance. So, the identification of disease causing genes using conventional linkage- based approaches has been less successful (Iyengar & Elston, 2007; Bodmer & Bonilla, 2008). Recent advances in high-throughput genotyping technology, and a better understanding of the genetic architecture of complex disease has led to the development of genome-wide association studies (GWA), which are providing now novel and important insights into disease processes (Hirschhorn & Daly, 2005; Lango & Weedon, 2008). In the field of oncogenetics, two types of polymorphisms have been extensively studied: single nucleotide polymorphisms (SNPs) and short tandem repeats (STRs), with particular regard to trinucleotide repeats. Microsatellite alterations such as microsatellite instability (MSI) and loss of heterozygosity (LOH) gained a lot of interest (De Schutter et al., 2007; Zhang & Yu, 2007; Imai & Yamamoto, 2008). Furthermore, gene expression profiling using DNA microarrays is likely to become a useful diagnostic tool enabling classification of disease phenotype based on molecular basis of disease pathogenesis, revealing information that cannot be obtained by histological assessment. Moreover, identification of differentially expressed genes in affected versus control tissue or over time in affected tissue will lead to better understanding of the mechanisms underlying disease and ultimately to the development of more effective drug therapies.

81 CHAPTER IV | DISCUSSION

4.1 Translation and cancer

The eukaryotic cells have a variety of means by which they are able to regulate the expression of their genes. Although transcriptional regulation is obviously crucial, the control of gene expression also relies heavily on translational selectivity and the mechanism of protein synthesis provides the cell with a variety of sophisticated and subtle means to modulate the rates of production of key proteins (Clemens, 2004, Gebauer & Hentze, 2004; Kapp & Lorsch, 2004; Mata et al., 2005). This reflects the necessity for rapid adaptations of the gene expression system to alterations of cellular conditions, such as re-entry into cell cycle. As the molecular processes that control mRNA translation in the eukaryotic cells are extremely complex and highly integrated with the cell cycle control, their deregulation can occur at multiple levels, leading to disease and particularly to cancer pathogenesis (Clemens & Bommer, 1999; Dua et al., 2002; Abbott & Proud, 2004; Holland, 2004; Pandolfi, 2004; Bilangues & Stokoe, 2007). Molecular links between tumor-suppressive and oncogenic pathways and the control of protein synthesis machinery have been revealed in the past decades. Until recently, the notion that translational control could be a driving force of the oncogenic process was not generally accepted, being the translation machinery regarded as a passive recipient of aberrant signalling cues (Ruggero & Pandolfi, 2003; Holland et al., 2004). Strong genetic support is now being accumulated for the opposite hypothesis, in which the protein machinery itself would be missfunctional, leading to cancer. This includes (i) the identification of alterations in the expression of several genes encoding proteins known to modulate mRNA translation that are associated with cancer (Nupponen et al., 1999; Joseph et al., 2004; Savinainen et al., 2004; Comtesse et al., 2007; Tomlinson et al., 2007; Rojo et al., 2007), (ii) antisense mRNA-mediated reduction of the expression of certain translation factors that resulted in a reversion of the oncogenic properties of the cancer cells (Li et al., 2006; Graff et al., 2007), (iii) effective anticancer drugs proven to act on key regulators of the protein synthetic machinery (Mita et al., 2003; Easton & Houghton, 2006), and mainly (iii) ectopic expression of certain translation factors that resulted in cell transformation and tumorigenesis (Anand et al., 2002; De Benetti & Graff, 2004). In the past years, much attention has been paid to initiation and elongation translation factors (de)regulation and their role in malignancy (Meric & Hunt, 2002; Stoneley & Willis, 2003; Sonenberg & Dever, 2003; Averous & Proud, 2006; Sun et al., 2008; Tejada et al., 2009). In what concerns translation termination, only a few studies have analyzed their expression profile in cancer tissues. Zondervan et al. (2000) suggested eRF3b/GSPT2 (among other genes) as a candidate gene for hepatocellular carcinoma susceptibility. A few years later Thakur et al. (2005) showed that eRF3b/GSPT2 , as well as other genes related to ribosomal biogenesis and translational control, presented 2-fold or higher expression in transgenic mouse mammary tumors compared to lactating mammary gland. Groene et al. (2006) also identified eRF3b/GSPT2 and the gene encoding the transcription factor HOXA9 as the most relevant elements in a 45

82 CHAPTER V | DISCUSSION

gene signature that allowed discrimination between UICC (international union against cancer) stage II and stage III colorectal cancers, with a rate of correct classification of about 80%. However, there was no differential expression of genes in cancer-related pathways. Only one study analyzed the expression profile of a series of 36 translation factors, including initiation, elongation and termination factors, to assess differences in mRNA levels between tumor and normal cell lines (Joseph et al., 2004). Unfortunately, only one termination factor was represented, eRF1, which revealed no variation between tumor and normal cells. Our own results show that eRF3a/GSPT1 is significantly over-expressed both in intestinal type gastric tumors (Malta-Vacas et al., 2005) and in breast tumors (Malta-Vacas et al., 2009a). However, in both cases, eRF3a/GSPT1 gene expression was shown not to be correlated with the levels of expression of the other translation termination factors, and therefore was not associated with increased translation rates. eRF3a/GSPT1 gene expression will be discussed in Chapter 3.3 of this thesis.

4.2 eRF3a/GSPT1 DNA polymorphisms

The gene eRF3a/GSPT1 contains a (GGC)n stable expansion in exon 1, which encodes a polyglycine stretch in the N-terminal domain of eRF3a protein. Four alleles, containing 7, 9, 10 and 11 GGC repeat units, were detected in our control population composed of healthy individuals with no known familiar history of cancer. The same four alleles were detected in a Crohn’s Disease sample population. An extra allele with 12GGC repeat units was exclusively detected in cancer patients, with an allele frequency of 5% in gastric (Brito et al., 2005), 2,55% in breast (Malta-Vacas et al., 2009a) and 1,09% in colorectal cancer (Malta-Vacas, submitted). When the results obtained in all the cancer patients samples analysed are combined, the 12GGC allele is present in 5,1% of the patients (N=411) with an allele frequency of 3%, corresponding to a 12-fold increased risk for cancer development (OR= 11,8; SE=1,43; C.I.=0,71-195,46). Although the odds are not statistically significant, the considerable increased risk associated with this allele should not be, in our view, considered as insignificant. Given the rarity of the allele, the statistical results need to be strengthened by replication in larger populations.

4.2.1. eRF3a/GSPT1 polymorphisms in cancer

Microsatellite alterations such as microsatellite instability (MSI) and loss of heterozygosity (LOH) gained a lot of interest as possible tumor markers. Microsatellite regions are at high risk for variations in the number of repeats caused by slippage of the DNA polymerase during DNA replication. In normal cells, these errors are repaired by the mismatch repair system (MMR). In tumors, defects in the MMR system may be present, so that variations in microsatellite regions are not repaired correctly, leading to somatic changes with gain or loss of repeat units. Thus,

83 CHAPTER IV | DISCUSSION

MSI is generally associated with the presence of a defect MMR system, although environmental factors might also have a role in generating it (De Schutter et al., 2007). Interestingly, Alvarado et al., (2005) showed some genetic heterogeneity (somatic mosaicism) for the androgen receptor (AR) gene CAG repeat length in laser capture microdissected prostate cancer samples, which was not present in normal prostate tissues. The same pattern was observed by Di Fabio et al., (2008) in colorectal carcinoma epithelial cells from men. However, there was no significant difference in the allele lengths between MSI carcinomas and microsatellite stable carcinomas, revealing that multiple unique somatic mutations of the AR CAG repeats occur. A significant shortening of the CAG repeat lengths was observed in cancerous tissues, which may be responsible for the generation of highly proliferating clones of cancer cells characterized by increased responsiveness to androgens. Thus, we have considered the possibility that eRF3a/GSPT1 genetic heterogeneity could also exist. To evaluate this, we compared the GGC repeat lengths of eRF3a/GSPT1 microsatellite alleles between normal and tumor tissues in gastric cancer samples but no evidence for MSI or somatic mosaicism was detected (Brito et al., 2005). LOH marks a suppressor phenotype that is characterized by extensive losses of genetic material. Accordingly, LOH can be recognized by loss of a genomic fragment, SNP or microsatellite allele in a tumor when compared with normal tissue. LOH in eRF3a/GSPT1 microsatellite was investigated but not detected in gastric cancer tissues (Brito et al., 2005). Furthermore, we determined eRF3a/GSPT1 gene copy dosage in normal and tumor gastric and CCR samples. Only looses of genetic material were found in gastric cancer tissues from three patients (Malta-Vacas et al., 2005), but were not associated to LOH, since they were homozygous in this locus. Accordingly, looses in chromosome 16p have been reported in gastric (Sarlomo-Rikala et al., 1998; Takeno et al., 2009) and other types of cancer (dos Santos Aguiar et al., 2007; Ross et al., 2007; Rydzanicz et al., 2008). Gains on chromosome 16p have also been reported in some types of cancer, including gastric cancer cell lines (Takada et al., 2005). However, we did not detect amplifications of eRF3a/GSPT1 gene in gastric tumors or CCR tissues (Malta-Vacas et al., 2005; Malta-Vacas et al., submitted). Several exonic trinucleotide repeats have been associated with oncological pathologies, either conferring a protective effect or associated with elevated risk for disease (see Table 4 in Chapter 1.5 of this thesis). The most investigated STR in cancer is the CAG repeat expansion in the AR gene. Laboratory experiments show that the length of this repeat expansion affects the activity of gene transcription (i.e., the longer the repeats the lower the transactivation). Based on this finding, it is speculated that prostate cancer risk may vary with the length of CAG repeats due to the role of androgen receptor in the disease (Tran et al., 2004; Zhang & Yu, 2007). This speculation has been supported by some epidemiologic studies in which longer CAG repeats are found to be associated with lower risk of prostate cancer in populations of different geographical origins (Hsing et al., 2002; Nelson & Witte, 2002; Krishnaswamy et al., 2006). However, inconclusive and even conflicting results have been achieved in other studies, so there is not a consensual opinion about the role of this CAG expansion in cancer (Li et al., 2003; Zeegers et al.,

84 CHAPTER V | DISCUSSION

2004; Lange et al., 2008). The exon 1 of AR gene also contains a GGC expansion, the length of which has been shown to be inversely associated with breast (Suter et al., 2003) and prostate cancer risk (Chang et al., 2002; Ding et al., 2005). However, the functional significance of this GGC trinucleotide polymorphism has not been extensively examined. A few other studies also reveal that microsatellites may have functional roles in transcription. A tetranucleotide polymorphic microsatellite located in the first intron of the tyrosine hydroxylase (TH) gene is implicated in the regulation of TH gene expression (Meloni et al., 1998). The Pig3 gene harbors a pentanucleotide microsatellite (TGYCC)n in its promoter that functions as a p53 binding site. This microsatellite is polymorphic, and the expression level of Pig3 by p53 correlates with the length of the microsatellite (Contente et al., 2002). This polymorphism was shown to be associated with an increased risk for bladder cancer (Ito et al., 2006) but not for breast and lung cancer susceptibility (Gorgoulis et al., 2004). Recently, the EWS/FLI oncogenic transcription factor involved in Ewing’s sarcoma was shown to interact with (GGAA)n microsatellites to regulate some of its target genes (Gangwal et al., 2008). An association between the number of GGAA repeats and EWS/FLI binding and transcriptional activity was confirmed for different genes. For that reason, the authors raised the hypothesis that those microsatellite polymorphisms may be responsible for differences in susceptibility to Ewing’s sarcoma, both between individuals and between populations (Gangwal & Lessnick, 2008). Unfortunately, the promoter and 5‘UTR regions of eRF3a/GSPT1 gene are still not well characterized. Also, the cis-acting elements and transcription factors involved in the induction of human eRF3a/GSPT1 transcription remain to be identified. However, based on the results described above, it is tempting to speculate that the same phenomena might occur and that the microsatellite polymorphism in eRF3a/GSPT1 exon 1 is associated with the individual susceptibility for cancer development by affecting the binding efficiency of transcription factors. If the length of the GGC expansion in eRF3a/GSPT1 affects the binding of putative transcription factors or other cis-acting proteins, the level of transcription will be proportional to the number of GGC repeats present. Therefore, individuals with longer (or shorter) alleles might present a greater (or lower) susceptibility to cancer. In this case, differences in allele frequencies between different populations would also reflect different population susceptibilities to cancer. DNA methylation, especially in promoter regions, is a possible mechanism of regulation of gene expression, either directly interfering with the binding of transcription factors, or indirectly, causing changes in chromatin conformation (Esteller, 2007). The number of GGC repeats in eRF3a/GSPT1 microsatellite is proportional to the number of CpG sites present. CpG islands, generally defined as a 200-bp minimum stretch of DNA with a C+G content greater than 50% and an observed CpG/expected CpG in excess of 0.6. (Takai & Jones, 2002) often occur as clusters of CpG residues found in the 5’ regions of about 50% of the human genes. These areas are usually unmethylated in normal somatic cells, which is believed to be a prerequisite for active transcription (Dunn, 2003; Esteller, 2007). It is now widely recognised that epigenetic modifications are a common mechanism of gene expression regulation via gene transcription,

85 CHAPTER IV | DISCUSSION

and that methylation of CpG dinucleotides is an important mechanism in the carcinogenesis process (Esteller, 2007). In eRF3a/GSPT1 exon 1 (GGC)n polymorphism, the number of CpG sites is directly proportional to the number of GGC repeats present. However, our data show that the GGC repeat length variation from 7 to 12 have no effect on the methylation status of this region. Regardless of the source of the DNA sample (tumors, normal tissues or blood; cancer patients or control individuals), all CpG sites inside the GGC expansion are unmethylated (Malta- Vacas, submitted). Therefore, the methylation level inside the GGC expansion cannot explain differences in the levels of transcription between alleles. Using the CpG Island Searcher software (http://cpgislands.usc.edu/), we found that the GGC expansion is localized inside a 1195bp CpG island (64,5%GC; ObsCpG/ExpCpG=0.898) that spans part of the 5’UTR, the entire exon 1 and part of intron 1 in eRF3a/GSPT1 gene. The remaining CpG sites inside this CpG island should therefore be analysed in each microsatellite allele and correlated with the expression of the gene. We further investigated the presence of additional genetic variability in eRF3a/GSPT1 gene that could be linked with the polyglycine expansion polymorphism. Only two synonymous SNPs are described within the coding sequence of eRF3a/GSPT1 in the NCBI database: T1128C located in exon 7 (rs33657) and G1986C located in exon 14 (rs3752426). We additionally detected a nucleotide substitution G274T in exon 1, resulting in an amino acid change from Gly to Cys at codon 92. Although genetic databases revealed that Gly is a conserved amino acid at this position among different species, our results provided evidence to support that this is a polymorphism rather than a new mutation (Brito et al., 2005). Therefore, this polymorphism was screened in cancer patients and control individuals, but no differences in the frequencies between both groups were detected ( χ2=0.04; P>0.05). Odds ratio (OR) analysis failed to reveal any risk/protective effect associated with either allele. Moreover, after a linkage analysis we concluded that the polymorphisms analysed did not segregate with any of the alleles of the polyglycine expansion. Most of the studies done so far on the role of STR alleles contribution to cancer highlighted individual variations in cancer risk, associated with specific alleles of different polymorphic genes that are present in a significant proportion of the normal population. Conversely, we report the presence of a specific allele (12GGC) directly associated with cancer development. Therefore, we purpose that the presence of the 12GGC allele, by itself, may provide a new useful marker for cancer susceptibility.

4.2.2. eRF3a/GSPT1 microssatelite polymorphism in inflammation

Epidemiological evidence points to a connection between inflammation and a predisposition for the development of cancer, i.e. chronic and persistent inflammation leads to the development of neoplasia (Allavena et al., 2007). Crohn’s disease (CD) is a chronic inflammatory disease that can affect the entire gastrointestinal tract from the mouth to the anus. Nowadays, the association between CD and the increased risk for CRC is widely accepted (Zisman & Rubin,

86 CHAPTER V | DISCUSSION

2008). CRC is the most common type of cancer in inflammatory bowel disease (IBD), although cancer in other organs can occur. Although CRC associated to IBD accounts only for 1%-2% of all cases of CRC in the general population, it is considered a serious complication of these diseases and accounts for approximately 10%-15% of all deaths in IBD patients (Munkholm, 2003). CD is a complex disease in which multiple genetic and environmental factors are likely to contribute to pathogenesis, and the search for CD susceptibility genes therefore poses similar problems to those in other complex disorders. As several of the molecular alterations that are involved in IBD-associated CRC are common to sporadic colorectal tumors (Zisman & Rubin, 2008), we postulated that the 12GGC allele could be used as a predictive marker in CD patients. However, we failed to find the 12GGC allele in CD patients so this hypothesis could not be supported. Therefore, the 12GGC allele is not likely associated with inflammation. Moreover, there were no significant differences in the frequencies of the alleles between CD patients and control healthy individuals.

4.3. eRF3a/GSPT1 gene expression eRF3a/GSPT1 gene is ubiquitously expressed in mammalian cells. The expression of the gene is proliferation dependent, being the mRNA levels up-regulated in the G1 to S phase transition of the cell cycle (Hoshino et al., 1989; Hoshino et al ., 1998). Low levels of mRNA were detected in liver cells (Hoshino et al., 1989) and a strong decrease during human chondrocytes differentiation has been reported (Tallheden et al., 2004). Chauvin et al. (2005) showed that the level of eRF3a protein controls the formation of the translation termination complex. In this study they show that eRF1 intracellular levels are adjusted to that of the eRF3a available for the formation of translation termination complexes. The opposite situation was not verified, suggesting that, due to its involvement in other cellular processes and association with other factors, the intracellular amount of eRF3a is controlled by mechanisms other than the termination complex formation. When investigating the patterns of eRF3a/GSPT1 gene expression in cancer, comparing the levels of mRNA in tumors with the normal adjacent tissues, we found that the gene is frequently over-expressed in tumor tissues, regardless of the type of cancer analyzed (Malta-Vacas et al., 2005; Malta Vacas et al., 2009a). In what concerns gastric cancer, we have shown that eRF3a/GSPT1 is over-expressed in 67% of the intestinal gastric tumors and only in 10% of the diffuse type tumors. The difference in the pattern of expression of eRF3a/GSPT1 supports the hypothesis of genetically independent pathways in the origin of intestinal and diffuse type gastric tumors (Werner et al., 2001; Zheng et al., 2004; Cervantes et al., 2007). Lower proliferating rates have been assigned to intestinal tumours using different labeling indexes (Shinohara et al., 1996; Seno et al., 2002; Cervantes et al., 2007). Therefore, it seems unlikely that the higher amounts of eRF3a/GSPT1 mRNA seen in

87 CHAPTER IV | DISCUSSION

intestinal type tumours are necessary for increased translation rates, which could be expected in cancer cells to support higher proliferation activity. Accordingly, the transcript levels of eRF3a/GSPT1 were not correlated with those of eRF1 and eRF3b/GSPT2 and therefore were not associated with increased translation rates (Malta-Vacas et al., 2005). Regarding breast cancer, we found eRF3a/GSPT1 overexpressed in 44% of the tumors. We further compared the patterns of expression between invasive ductal carcinomas (IDC), which is the most common type of breast cancers, and other types of tumors, but no differences between different types of tumors were detected. Once again, the mRNA levels of eRF3a/GSPT1 were not correlated with the levels of the other translation termination factors. In this study, analyzing breast cancer patients, we had the first indication that the level of mRNA expression of eRF3a/GSPT1 gene could be correlated with the length of the GGC expansion in exon 1. The longer allele (12GGC) was only found in patients with eRF3a/GSPT1 overexpression in tumor samples. In contrast, the shorter allele (7GGC) was mostly associated to tumors with eRF3a/GSPT1 underexpression (Malta-Vacas et al., 2009a). Allelic specific gene expression is a widespread mechanism in the human genome whose regulation seems to be far more complex than expected. It appears to be an important factor in human phenotypic variability and as a consequence, for the development of complex traits and diseases (Palacios et al., 2009). In order to test the hypothesis that the allele length in the microsatellite polymorphism in eRF3a/GSPT1 exon 1 has a role in transcription regulation, we obtained different cell lines with all the known alleles, in order to quantify the levels of gene expression induced by each allele. We have measured the transcript levels of eRF3a/GSPT1 in primary lymphocyte cultures from patients with different genotypes and in Jurkat lymphoblastoid cell lines modified to express each different allele. Significant allelic expression imbalance (AEI) was detected in both. The mRNA levels of eRF3a/GSPT1 expressing the 12GGC allele were significantly up-regulated both in primary lymphocyte cultures (7.6-fold higher) and in Jurkat modified cell lines (12-fold higher), when compared with the respective reference 10GGC allele. In the Jurkat cell line expressing the 9GGC allele, the mRNA level was significantly lower, when compared with the reference Jurkat- 10GGC cell line (Malta-Vacas et al., submitted). Overall, we detected a direct relation between the level of eRF3a/GSPT1 gene expression and increased number of GGC repeats. These results could not corroborate those of other published studies, in which "long" GGC alleles within stable expansions significantly decrease gene expression, either affecting transcription (Persico et al., 2006) or translation (Ding et al ., 2005) of the genes harboring them. It is possible, as discussed before, that cis-acting regulatory factors might be affected by the length of the GGC expansion, increasing the level of transcription of longer alleles. Consequently the transcripts reach levels of oncogenecity, through a mechanism not yet identified. Furthermore, there is also the possibility that the longer 12GGC allele encodes a mutant protein with transforming proprieties itself.

88 CHAPTER V | DISCUSSION

4.4. eRF3a/GSPT1 as a proto-oncogene

The mechanism of eRF3a/GSPT1 overexpression in cancer tissues is still not elucidated. However, in the view that eRF3a is closely regulated by conditions that affect cellular proliferation (Hoshino et al., 1989; Hoshino et al., 1998; Chauvin et al., 2007), it is not surprising that aberrant expression of eRF3a/GSPT1 gene induce malignant transformation of cells. Although the mechanism by which transformation occurs has not been established, it is consensually assumed that elevated expression of key regulatory proteins is involved in carcinogenesis.

4.4.1 eRF3a roles in translation

Whether the oncogenic event happens upstream the ribosome or it is eRF3a/GSPT1 intrinsic/specific, overexpression of the gene may theoretically lead to: i) a global impairment of mRNA translation (overall increase in the rate of protein synthesis), (ii) selective quantitative defects in mRNA translation (increase in the synthesis of specific mRNA targets) or iii) qualitative defects in protein translation (mistranslation). The three possibilities are discussed below, regarding the roles of eRF3a in translation. The protein synthesis is coupled with cell cycle progression and is regulated in response to nutrient availability and mitogenic stimulation. However, the transduction pathways activated do not stimulate the translation of all the mRNAs equally. The expression of the components of the translation machinery might be selectively regulated, increasing the translation rate of specific oncogenic transcripts (Dua et al., 2001; Holland, 2004; Holland et al., 2004; Rajasekhar & Holland, 2004; Mamane et al., 2007). Although the signalling pathways and the proteins involved are still not identified, it was recently demonstrated that eRF3a depletion in HCT116 cells induces an arrest of the cell cycle in late G1 phase, via mTORC1 inhibition (Chauvin et al., 2007). The mTORC1 controls the level of cap-dependent mRNA translation by modulating the activity of key translational components. After activation by mTOR, S6K phosphorylates the ribosomal protein S6, leading to an increase in translation of a subset of mRNAs (Corradetti & Guan, 2006). It is known that eIF4E and S6K activity is enhanced in several cancer cell lines and human tumours due to the increase of mTOR activity (Averous & Proud, 2006). Therefore, it is tempting to speculate that eRF3a/GSPT1 overexpression detected in different kinds of tumors might be responsible for excessive mTOR activation, leading to differential expression of specific targets and consequent malignant transformation. The mTOR pathway has been extensively studied in the past decades because rapamycin, a specific inhibitor of mTOR activity, was shown to have a potent anti-cancer activity. However, it is known that not all effects of mTOR are sensitive to the classical anti-mTOR drug rapamycin, and this compound also interferes with other processes besides eIF4E function (Averous & Proud, 2006). Signaling by the PI3K/Akt/mTOR pathway profoundly affects mRNA translation through

89 CHAPTER IV | DISCUSSION

phosphorylation of downstream targets such as 4E-BP and S6K. Inhibitors of this pathway and thus cap-dependent translation are emerging as promising therapeutic targets for cancer therapy (Averous & Proud, 2006; Mamane et al., 2006). Such molecules are likely to come from further work to understand the regulation of mTOR targets such as components of the translational apparatus. In this context, eRF3a/GSPT1 comes out as a potential candidate target molecule for cancer treatment. eRF3 interacts with poly(A)-binding protein (PABP1) and the surveillance factor UPF1, acting as a key mediator that transduces termination signal to mediate normal and nonsense-mediated mRNA decay (Hoshino et al., 1999a; Hoshino et al., 1999b; Hosoda et al., 2003; Kobayashi et al., 2004). Interaction between eRF3a and PABP results in the inability of the latter to multimerize and consequently inhibits it to perform the typical regularly spaced complexes on the poli(A) tail of mRNAs that regulate mRNA degradation. This may facilitate shortening of the poly(A) tail of mRNAs by an RNase (Hoshino et al., 1999a; Hoshino et al., 1999b; Hosoda et al., 2003). Therefore, enhanced amounts of eRF3a in the cells, as a consequence of eRF3a/GSPT1 overexpression, might result in the recruitment of high amounts of PABP, which consequently becomes scarce to generate the multimeric complexes that regulate mRNA stability and mRNA turnover. Although we do not have own results/ data to support this hypothesis, it is tempting to speculate that this process could lead to a global increase in mRNA instability. Furthermore, it is reasonable to assume that the termination signal triggers mRNA degradation. If mRNA degradation starts while translation is still in progress, deleterious truncated proteins may be synthesized. By interacting with PABP, eRF3a was also reported to have a role in the circularization of the mRNA, allowing the recycling of ribosomes for successive translation cycles. The terminating ribosome could be passed to the 5’ cap structure through a protein bridge consisting of eRF1- eRF3-PABP-eIF4F (Uchida et al., 2003; Hosoda et al., 2003). The inhibition of the interaction between eRF3a and PABP was shown to significantly attenuate translation of capped/poly(A)- tailed mRNA (Hoshino et al ., 1999a). Therefore, one can foresee that alterations in the levels of expression of eRF3a/GSPT1 can modulate translation of capped/poly(A)-tailed mRNAs, resulting in an impairment of mRNA translation. The protein eRF3a also takes part on the “surveillance complex” that triggers nonsense mediated mRNA decay (NMD), a mechanism that recognizes mRNAs containing premature termination codons (PTCs) and induces their degradation. These transcripts are generally derived from genes in which a mutation has given rise to a premature nonsense codon, but the PTC can also be attributable to errors in transcription, pre-mRNA splicing or RNA editing (Amrani et al., 2006). PTCs are known to cause at least some of the diseases that involve protein insufficiency, namely oncological pathologies. The biological and medical significance of NMD is highlighted by an increasing number of known genetic diseases that are caused by C-terminally truncated proteins, such as the Hurler syndrome, muscular dystrophy and cystic fibrosis (Boikos & Stratakis, 2006;

90 CHAPTER V | DISCUSSION

Brooks et al., 2006; Khajavi et al., 2006; Linde & Kerem, 2008). The NMD represents a translation-dependent process that selectively recognizes and degrades mRNAs whose open reading frame (ORF) is truncated by a PTC and consequently encodes incomplete polypeptides. The truncated proteins encoded by these mutant mRNAs are potentially toxic to the cell, either trough dominant-negative or gain-of-function effects. The core NMD “surveillance complex” consists of UPF1, UPF2, UPF3, the release factors eRF1 and eRF3 and is also affected by the termination codons context and exon–exon junctions’ proximity. Thus, enhanced expression of eRF3a/GSPT1 and consequent excess of eRF3a protein might disturb the formation of the surveillance complex and therefore contribute to a reduction of its efficiency, leading to the accumulation of truncated proteins in the cell. The potential oncogenic properties of eRF3a/GSPT1 discussed above arrive from a disruption in the normal balance between eRF3a and its interaction proteins. This results in the disturbance of the formation of the complexes in which eRF3a takes part, and consequently compromise their efficiency. Instead of quantity issues, the transforming capacities of eRF3a might also arrive from a protein quality basis, caused by non-functional or toxic eRF3a proteins. We consider this possibility specifically for the 12-Gly eRF3a protein, and its consequences will be discussed bellow. The canonical role of eRF3a is to stimulate eRF1 activity in translation termination. eRF3a depleted cells reveal a high level of stop codon readthrough, which is alleviated by restoring eRF3 expression, proving that eRF3a has a key role in translation termination efficiency (Chauvin et al., 2005). Although the interaction between eRF3a and eRF1 is mediated through the C- domain of both proteins, Chauvin et al. (2005) demonstrated that the N-terminal domain could have an effect in the binding efficiency, possibly by blocking the site of interaction. In order to investigate the efficiency of eRF3a proteins with different N-terminal sizes (determined by the number of Gly residues) we compared the readthrough level between HEK293 cells expressing 5 different alleles of eRF3a/GSPT1 with 7, 9, 10, 11 and 12 GGC repeat units in the first exon microsatellite. Our results show no significant differences in the readthrough efficiencies whatever the eRF3a variant expressed. This suggests that the length of the glycine stretch encoded by the GGC repeat has no detectable effect on eRF3a activity in what concerns its role in translation termination (Malta-Vacas et al., 2009a). Non-translational roles of eRF3 have been reported. Investigations into those functions of eRF3a protein shed new light on the mechanisms of its oncogenicity.

4.4.2. eRF3a role in cytoskeleton dynamics eRF3a proteins, in addition to their role in translation, are thought to be involved in cytoskeletal regulation. The cytoskeleton of a eukaryotic cell is composed of long polymers of actin proteins called microfilaments, tubulin polymers termed microtubules and a heterogeneous group of intermediate filament proteins. These structures provide structural integrity to a eukaryotic cell

91 CHAPTER IV | DISCUSSION

and regulate mitosis, cell migration, cell signaling and trafficking (Honore et al, 2005). eRF3 proteins from several species associate with the cellular actin network and can bind tubulin microtubules (Basu et al., 1998; Bailleul PA, 1999; Borchsenius et al., 2000; Valouev et al., 2002 ). The ability of eRF3a protein to interact with and/or bind to actins and tubulins raises the possibility that cytoskeleton alterations may facilitate tumorigenesis. Using different organisms as study models, eRF3 has been shown to affect both tubulin and actin elements of the cytoskeleton. Mutations in eRF3 have been reported to induce disruption of chromosome behaviour during the meiotic divisions, problems in aster formation, aberrations in spindle organization and disappearance of the ana/telophase central spindle, which in turn disrupts cytokinesis (see Chapter 1.3.3 of this thesis). The CCT complex is an important pathway that regulates microtubules stability and, consequently, cytoskeleton organization. An interaction between eRF3 and CCT (chaperonin containing TCP-1) subunits was first predicted using a theoretical model (Marcotte et al., 1999), and latter experimentally confirmed by immunoprecipitation (King et al., 2000). Regulation of microtubules dynamics, the key components of the cytoskeleton, is crucial for mitosis. During mitosis, two centrosomes form spindle poles and direct the formation of bipolar mitotic spindles, which is an essential event for accurate chromosome segregation into daughter cells (Walczak & Heald, 2008). Deregulation of centrosome structure is an integral aspect of the origin of chromosomal instability in many cancers (Honore et al., 2005; Godinho et al., 2009). Disturbance of the correct interaction between eRF3 and CCT subunits may affect microtubules stability and consequently perturb the correct chromosome segregation leading to genome aberrations. The mRNA levels of the genes encoding the CCT2 and CCT4 subunits of the CCT complex were reported to be up-regulated in hepatocelular carcinomas and in 83% of the colonic tumors (Yokota et al., 2001). Our own results also revealed that eRF3a/GSPT1 is overexpressed in 70% of the intestinal type gastric tumors (Malta-Vacas et al., 2005). Interestingly both eRF3a/GSPT1 (Hoshino et al., 1998; Chauvin et al., 2007) and CCT subunits (Yokota et al., 1999; Nolasco et al., 2005) expression levels correlate with growth rates in mammalian cells, being up-regulated in the early S phase of the cell cycle. To investigate if the expression of eRF3a/GSPT1 and the genes encoding the components of the tubulin folding pathway are correlated, and collectively contribute to tumorigenesis, we quantified the expression of a number of genes belonging to both pathways (eRF1, eRF3a/GSPT1 , PFDN4, CCT2, CCT4 and TBCA) in normal and tumoral gastric tissues. However, eRF3a/GSPT1 mRNA levels of expression did not correlate with any of the other genes analysed in gastric tissue samples. Although eRF3a/GSPT1 expression is likely to be independent from both cell translation rates and protein folding pathways, our results revealed up-regulated levels of expression of components of the translation termination and protein folding pathway in gastric cancer tissues, mostly in the intestinal type tumors (Malta- Vacas et al., 2009b). Corroborating previous results (Malta-Vacas et al., 2005), the differences in

92 CHAPTER V | DISCUSSION

the patterns of expression of the genes studied support the hypothesis of genetic independent pathways in the origin of intestinal and diffuse type gastric tumors. The formation of micronuclei (MN) in dividing cells is the result of chromosome breakage due to unrepaired or mis-repaired DNA lesions, or chromosome malsegregation due to mitotic malfunction (Bonassi et al., 2007). Therefore, the MN frequency is since long considered a predictive biomarker of cancer risk (Eastmond & Tucker, 1989; Fenech et al., 1999; Fenech, 2006; Mateuca et al., 2006). We used the frequency of MN as a measure of chromosomal damage and genome stability to evaluate if eRF3a proteins with different N-terminal lengths are equally competent in their putative role in microtubules stability. The frequency of MN in Jurkat- (GGC)n cell lines revealed that the formation of MN is more frequent in cells with longer GGC expansions, which may be indicative that the encoded proteins allow malsegregation of chromatids/chromosomes by interfering with the accurate functioning of the mitotic spindle (Malta-Vacas et al., submitted). It is known that in cancer cells centrosomes are often found amplified to greater than two per cell, resulting in an increased frequency of chromosome segregation errors. Destabilization of chromosomes by centrosome amplification aids acquisition of further malignant phenotypes, hence promoting tumor progression (Gisselsson, 2005; Godinho et al., 2009). In accordance, several studies have reported increased MN frequencies in peripheral lymphocytes from cancer patients when compared with matched control populations (El-Zein et al., 2006; Bonassi et al., 2007, Iarmarcovai et al., 2008; Saran et al., 2008).

4.4.3. eRF3a role in proliferation and apoptosis rates

The regulation of protein synthesis is known to be coupled with cell cycle progression and regulated in response to nutrient availability and mitogenic stimulation. There is presently a growing body of evidence that supports the involvement of translation in cell proliferation and cancer development (Clemens & Bommer, 1999; Rajasekhar & Holland, 2004). The first eRF3 coding gene described, named gst1 (G1 to S Transition), was identified in a temperature-sensitive mutant of Sacharomyces cerevisae because it was required for the G1 to S phase transition of the cell cycle (Kikuchi et al., 1988). The mammalian eRF3a/GSPT1 gene is also regulated in a cell cycle-dependent manner, being up-regulated in the G1-S phase transition of the cell cycle (Hoshino et al., 1989; Hoshino et al., 1998; Chauvin et al., 2007). To evaluate whether the length of the Gly expansion in N-terminal region of eRF3a have an effect on the protein involvement in cell cycle regulation, we analyzed the cell cycle status of cells expressing different alleles, encoding proteins with 7-12 Gly residues in the N-terminal of eRF3a. Both in the Jurkat-(GGC)n cell lines and in primary cultured lymphocytes we found any significant difference in the percentage of cells in S-phase and in the proliferation index (S+G2M) between the (GGC)n alleles. Using the Jurkat-(GGC)n cell lines, the CBPI (cytokinesis block proliferation index) was also calculated as a measure of the average number of cell cycles that a

93 CHAPTER IV | DISCUSSION

cell population pass through. These results also showed that the variation in the GGC expansion length did not affect the proliferative kinetics of the cells (Malta-Vacas et al., submitted). It is known that some cell cycle regulators can influence both cell division and programmed cell death. This means that there is an inter-connection between the molecular mechanisms that control the decision between proliferation and cell death. A linkage of cell cycle and apoptosis has been recognized for c-Myc , p53 , pRb , Ras , and other cancer-related proteins (Alenzi, 2004). It may seem contradictory at first glance, but it is known that a number of dominant oncogenes, such as c-Myc , induce apoptosis under certain circumstances (Hoffman & Liebermann, 2008). Interestingly, a proteolytically processed isoform of the eRF3a protein was reported to function as an IAP (inhibitor of apoptosis protein) binding protein. The processed protein harbours a conserved N-terminal IAP-binding motif (AKPF), which is exposed after proteolytic cleavage of a 69-residue leader sequence (Hegde et al., 2003). As eRF3 directly interacts with IAPs such as cIAP1, cIAP2 and XIAP, disturbance of the correct interaction between eRF3a and IAPs can release these proteins and consequently repress or even block the apoptosis pathways in which they are involved. The polymorphic Gly stretch is not present in the processed isoform of eRF3a, since it is part of the 69 N-terminal residues excluded by proteolytic cleavage. However, we raised the hypothesis that the number of Gly residues might interfere in the cleavage process. If this is the case, the amount of the processed eRF3a isoform could be influenced by the length of the Gly expansion. As a consequence, reduced amounts of eRF3a could repress the apoptotic pathways or, by contrast, an excess of eRF3a isoform could sequester higher amounts of IAPs and potentiate apoptosis by liberating caspases from IAP inhibition. Moreover, eRF3a was also reported to interact with ASK1, which plays a critical role in inducing apoptosis signals initiated by a variety of death stimuli. eRF3a interacts with ASK1 and enhances ASK1-induced apoptotic activity through the activation of caspase-3 (Lee et al., 2008). As the site of interaction between eRF3a and the C-terminal domain of ASK1 is not identified, it is possible that the length of the Gly stretch might interfere with this interaction, (des)regulating the apoptotic pathways activated downstream. To evaluate this possibility, we analyzed the apoptosis rates in cell lines expressing the 5 known alleles of eRF3a/GSPT1 . Both in Jurkat-(GGC)n cell lines and in lymphocytes primary cultures, there were no significant differences between different alleles, in what concerns the number of viable cells, number of dead cells and total apoptotic cells (Malta-Vacas et al., submitted). Our results suggest that this range of repeat lengths (7 to 12 GGC) does not affect the cleavage of eRF3a protein into the N-truncated isoform and therefore does not have an impact in its activity as an IAP-binding protein. These results also suggest that the interaction between eRF3a and ASK1 is not likely to be affected by the number of glycine residues in eRF3a N-terminal domain. Although the length of the Gly expansion does not affect proliferation and apoptosis rates, eRF3a appears to be a key component in a cell cycle checkpoint that determines whether cells progress through S phase. Although the precise pathways in which it is involved are not still identified, it is clear that eRF3a/GSPT1 expression controls the transition from G1 to S phase. Also, eRF3a

94 CHAPTER V | DISCUSSION

regulates apoptosis by interacting both with IAPs and with the ASK1. Therefore, eRF3a is certainly a critical protein, implicated in mechanisms that control the decision between proliferation and cell death.

4.5. References

Abbott CM, Proud CG. (2004) Translation factors: in sickness and in health. Trends Biochem Sci 29(1):25-31.

Alvarado C, Beitel LK, Sircar K, Aprikian A, Trifiro M, Gottlieb B. (2005) Somatic mosaicism and cancer: a micro-genetic examination into the role of the androgen receptor gene in prostate cancer. Cancer Res 65(18):8514-8.

Alenzi FQ. (2004) Links between apoptosis, proliferation and the cell cycle. Br J Biomed Sci 61(2):99- 102.

Allavena P, Garlanda C, Borrello MG, Sica A, Mantovani A. (2008) Pathways connecting inflammation and cancer. Curr Opin Genet Dev 18(1):3-10.

Amrani N, Sachs MS, Jacobson A. (2006) Early nonsense: mRNA decay solves a translational problem. Nat Rev Mol Cell Biol 7(6):415-25.

Anand N, Murthy S, Amann G, Wernick M, Porter LA, Cukier IH, Collins C, Gray JW, Diebold J, Demetrick DJ, Lee JM. (2002) Protein elongation factor EEF1A2 is a putative oncogene in ovarian cancer. Nat Genet 31(3):301-5.

Averous J, Proud CG. (2006) When translation meets transformation: the mTOR story. Oncogene 25(48):6423-35.

Bailleul PA, Newnam GP, Steenbergen JN, Chernoff YO. (1999) Genetic study of interactions between the cytoskeletal assembly protein sla1 and prion-forming domain of the release factor Sup35 (eRF3) in Saccharomyces cerevisiae. Genetics 153(1):81-94.

Basu J, Williams BC, Li Z, Williams EV, Goldberg ML. (1998) Depletion of a Drosophila homolog of yeast Sup35p disrupts spindle assembly, chromosome segregation, and cytokinesis during male meiosis. Cell Motil Cytoskeleton 39(4):286-302.

Bilanges B, Stokoe D. (2007) Mechanisms of translational deregulation in human tumors and therapeutic intervention strategies. Oncogene 26(41):5973-90.

Bodmer W, Bonilla C. (2008) Common and rare variants in multifactorial susceptibility to common diseases. Nat Genet 40(6):695-701.

Boikos SA, Stratakis CA. (2006) Carney complex: pathology and molecular genetics. Neuroendocrinology 83(3-4):189-99.

Bonassi S, Znaor A, Ceppi M, Lando C, Chang WP, Holland N, Kirsch-Volders M, Zeiger E, Ban S, Barale R, Bigatti MP, Bolognesi C, Cebulska-Wasilewska A, Fabianova E, Fucic A, Hagmar L, Joksic G, Martelli A, Migliore L, Mirkova E, Scarfi MR, Zijno A, Norppa H, Fenech M. (2007) An increased micronucleus frequency in peripheral blood lymphocytes predicts the risk of cancer in humans. Carcinogenesis 28(3):625-31.

Borchsenius AS, Tchourikova AA, Inge-Vechtomov SG. (2000) Recessive mutations in SUP35 and SUP45 genes coding for translation release factors affect chromosome stability in Saccharomyces cerevisiae. Curr Genet 37(5):285-91.

95 CHAPTER IV | DISCUSSION

Brito M, Malta-Vacas J, Carmona B, Aires C, Costa P, Martins AP, Ramos S, Conde AR, Monteiro C. (2005) Polyglycine expansions in eRF3/GSPT1 are associated with gastric cancer susceptibility. Carcinogenesis 26(12):2046-9.

Brooks DA, Muller VJ, Hopwood JJ. (2006) Stop-codon read-through for patients affected by a lysosomal storage disorder. Trends Mol Med 12(8):367-73.

Cervantes A, Rodríguez Braun E, Pérez Fidalgo A, Chirivella González I. (2007) Molecular biology of gastric cancer. Clin Transl Oncol. 2007 Apr;9(4):208-15.

Chang BL, Zheng SL, Hawkins GA, Isaacs SD, Wiley KE, Turner A, Carpten JD, Bleecker ER, Walsh PC, Trent JM, Meyers DA, Isaacs WB, Xu J. (2002) Polymorphic GGC repeats in the androgen receptor gene are associated with hereditary and sporadic prostate cancer risk. Hum Genet 110(2):122-9.

Chauvin C, Salhi S, Le Goff C, Viranaicken W, Diop D, Jean-Jean O. (2005). Involvement of Human Release Factors eRF3a and eRF3b in Translation Termination and Regulation of the Termination Complex Formation. Mol Cell Biol 25: 5801–5811.

Chauvin C, Salhi S, Jean-Jean O. (2007) Human eukaryotic release factor 3a depletion causes cell cycle arrest at G1 phase through inhibition of the mTOR pathway. Mol Cell Biol 27(16):5619-29.

Clemens MJ, Bommer UA. (1999) Translational control: the cancer connection. Int J Biochem Cell Biol 31(1):1-23.

Clemens MJ. (2004) Targets and mechanisms for the regulation of translation in malignant transformation. Oncogene 23(18):3180-8.

Comtesse N, Keller A, Diesinger I, Bauer C, Kayser K, Huwer H, Lenhof HP, Meese E. (2007) Frequent overexpression of the genes FXR1, CLAPM1 and EIF4G located on amplicon 3q26-27 in squamous cell carcinoma of the lung. Int J Cancer 120(12):2538-44.

Contente A, Dittmer A, Koch MC, Roth J, Dobbelstein M. (2002) A polymorphic microsatellite that mediates induction of PIG3 by p53. Nat Genet 30(3):315-20.

Corradetti MN, Guan KL. (2006) Upstream of the mammalian target of rapamycin: do all roads pass through mTOR? Oncogene 25: 6347-6360, 2006.

De Benedetti A, Graff JR. (2004) eIF-4E expression and its role in malignancies and metastases. Oncogene 23(18):3189-99.

De Schutter H, Spaepen M, Mc Bride WH, Nuyts S. (2007) The clinical relevance of microsatellite alterations in head and neck squamous cell carcinoma: a critical review. Eur J Hum Genet 15(7):734- 41.

Di Fabio F, Alvarado C, Gologan A, Youssef E, Voda L, Mitmaker E, Beitel LK, Gordon PH, Trifiro M. (2009) Somatic Mosaicism of Androgen Receptor CAG Repeats in Colorectal Carcinoma Epithelial Cells From Men. J Surg Res 154(1):38-44.

Ding D, Xu L, Menon M, Reddy GP, Barrack ER. (2005) Effect of GGC (glycine) repeat length polymorphism in the human androgen receptor on androgen action. Prostate 62(2):133-9.

Dos Santos Aguiar S, de Jesus Girotto Zambaldi L, dos Santos AM, Pinto W Jr, Brandalise SR. (2007) Comparative genomic hybridization analysis of abnormalities in chromosome 21 in childhood osteosarcoma. Cancer Genet Cytogenet 175(1):35-40.

Dua K, Williams TM, Beretta L. (2001) Translational control of the proteome: relevance to cancer. Proteomics 1(10):1191-9.

Dunn BK. (2003) Hypomethylation: one side of a larger picture. Ann N Y Acad Sci 983:28-42.

Eastmond DA, Tucker JD. (1989) Identification of aneuploidy-inducing agents using cytokinesis- blocked human lymphocytes and an antikinetochore antibody. Environ Mol Mutagen 13(1):34-43.

96 CHAPTER V | DISCUSSION

Easton JB, Houghton PJ. (2006) mTOR and cancer therapy. Oncogene 25(48):6436-46.

El-Zein RA, Schabath MB, Etzel CJ, Lopez MS, Franklin JD, Spitz MR. (2006) Cytokinesis-blocked micronucleus assay as a novel biomarker for lung cancer risk. Cancer Res 66(12):6449-56.

Esteller M. (2007) Epigenetic gene silencing in cancer: the DNA hypermethylome. Hum Mol Genet 16 Spec No 1:R50-9.

Fenech M. (2006) Cytokinesis-block micronucleus assay evolves into a "cytome" assay of chromosomal instability, mitotic dysfunction and cell death. Mutat Res 600(1-2):58-66.

Fenech M, Holland N, Chang WP, Zeiger E, Bonassi S. (1999) The HUman MicroNucleus Project--An international collaborative study on the use of the micronucleus technique for measuring DNA damage in humans. Mutat Res 428(1-2):271-83.

Gangwal K, Lessnick SL. (2008) Microsatellites are EWS/FLI response elements: genomic "junk" is EWS/FLI's treasure. Cell Cycle 7(20):3127-32.

Gangwal K, Sankar S, Hollenhorst PC, Kinsey M, Haroldsen SC, Shah AA, Boucher KM, Watkins WS, Jorde LB, Graves BJ, Lessnick SL. (2008) Microsatellites as EWS/FLI response elements in Ewing's sarcoma. Proc Natl Acad Sci USA 105(29):10149-54.

Gebauer F, Hentze MW. (2004) Molecular mechanisms of translational control. Nat Rev Mol Cell Biol 5(10):827-35.

Gisselsson D. (2005) Mitotic instability in cancer: is there method in the madness? Cell Cycle 4(8):1007-10.

Godinho SA, Kwon M, Pellman D. (2009) Centrosomes and cancer: how cancer cells divide with too many centrosomes. Cancer Metastasis Rev 28(1-2):85-98.

Gorgoulis VG, Liloglou T, Sigala F, Korkolis D, Yannoukakos D, Papalambros E, Asimacopoulos PJ, Papavassiliou AG, Kotsinas A. (2004) Absence of association with cancer risk and low frequency of alterations at a p53 responsive PIG3 gene polymorphism in breast and lung carcinomas. Mutat Res 556(1-2):143-50.

Graff JR, Konicek BW, Vincent TM, Lynch RL, Monteith D, Weir SN, Schwier P, Capen A, Goode RL, Dowless MS, Chen Y, Zhang H, Sissons S, Cox K, McNulty AM, Parsons SH, Wang T, Sams L, Geeganage S, Douglass LE, Neubauer BL, Dean NM, Blanchard K, Shou J, Stancato LF, Carter JH, Marcusson EG. (2007) Therapeutic suppression of translation initiation factor eIF4E expression reduces tumor growth without toxicity. J. Clin. Invest. 117, 2638–2648.

Groene J, Mansmann U, Meister R, Staub E, Roepcke S, Heinze M, Klaman I, Brümmendorf T, Hermann K, Loddenkemper C, Pilarsky C, Mann B, Adams HP, Buhr HJ, Rosenthal A. (2006) Transcriptional census of 36 microdissected colorectal cancers yields a gene signature to distinguish UICC II and III. Int J Cancer 119(8):1829-36.

Hegde R, Srinivasula SM, Datta P, Madesh M, Wassell R, Zhang Z, Cheong N, Nejmeh J, Fernandes- Alnemri T, Hoshino S, Alnemri ES. (2003) The polypeptide chain-releasing factor GSPT1/eRF3 is proteolytically processed into an IAP-binding protein. J Biol Chem. 278(40):38699-706.

Hirschhorn JN, Daly MJ. (2005) Genome-wide association studies for common diseases and complex traits. Nat Rev Genet 6(2):95-108.

Hoffman B, Liebermann DA. (2008) Apoptotic signaling by c-MYC. Oncogene 27(50):6462-72.

Honore S, Pasquier E, Braguer D. (2005) Understanding microtubule dynamics for improved cancer therapy. Cell Mol Life Sci 62(24):3039-56.

Holland EC, Sonenberg N, Pandolfi PP, Thomas G. (2004) Signaling control of mRNA translation in cancer pathogenesis. Oncogene 23(18):3138-44.

97 CHAPTER IV | DISCUSSION

Holland EC. (2004) Regulation of translation and cancer. Cell Cycle 3(4):452-5.

Hoshino S, Miyazawa H, Enomoto T, Hanaoka F, Kikuchi Y, Kikuchi A, Ui M. (1989) A human homologue of the yeast GST1 gene codes for a GTP-binding protein and is expressed in a proliferation- dependent manner in mammalian cells. EMBO J 8(12):3807-14.

Hoshino S, Imai M, Mizutani M, Kikuchi Y, Hanaoka F, Ui M, Katada T. (1998) Molecular cloning of a novel member of the eukaryotic polypeptide chain-releasing factors (eRF). Its identification as eRF3 interacting with eRF1. J Biol Chem 273(35):22254-9.

Hoshino S, Imai M, Kobayashi T, Uchida N, Katada T. (1999a) The eukaryotic polypeptide chain releasing factor (eRF3/GSPT) carrying the translation termination signal to the 3'-Poly(A) tail of mRNA. Direct association of erf3/GSPT with polyadenylate-binding protein. J Biol Chem 274(24):16677-80.

Hoshino S, Hosoda N, Araki Y, Kobayashi T, Uchida N, Funakoshi Y, Katada T. (1999b) Novel function of the eukaryotic polypeptide-chain releasing factor 3 (eRF3/GSPT) in the mRNA degradation pathway. Biochemistry (Mosc) 64(12):1367-72.

Hosoda N, Kobayashi T, Uchida N, Funakoshi Y, Kikuchi Y, Hoshino S, Katada T. (2003) Translation termination factor eRF3 mediates mRNA decay through the regulation of deadenylation. J Biol Chem 278(40):38287-91.

Hsing AW, Gao YT, Wu G, Wang X, Deng J, Chen YL, Sesterhenn IA, Mostofi FK, Benichou J, Chang C. (2000) Polymorphic CAG and GGN repeat lengths in the androgen receptor gene and prostate cancer risk: a population-based case-control study in China. Cancer Res 60(18):5111-6.

Iarmarcovai G, Ceppi M, Botta A, Orsière T, Bonassi S. (2008) Micronuclei frequency in peripheral blood lymphocytes of cancer patients: a meta-analysis. Mutat Res 659(3):274-83.

Imai K, Yamamoto H. (2008) Carcinogenesis and microsatellite instability: the interrelationship between genetics and epigenetics. Carcinogenesis 29(4):673-80.

Ito M, Nishiyama H, Watanabe J, Kawanishi H, Takahashi T, Kamoto T, Habuchi T, Ogawa O. (2006) Association of the PIG3 promoter polymorphism with invasive bladder cancer in a Japanese population. Jpn J Clin Oncol 36(2):116-20.

Iyengar SK, Elston RC. (2007) The genetic basis of complex traits: rare variants or "common gene, common disease"? Methods Mol Biol 376:71-84.

Joseph P, O'Kernick CM, Othumpangat S, Lei YX, Yuan BZ, Ong TM. (2004) Expression profile of eukaryotic translation factors in human cancer tissues and cell lines. Mol Carcinog 40(3):171-9.

Kapp LD, Lorsch JR. (2004) The molecular mechanics of eukaryotic translation. Annu Rev Biochem 73:657-704.

Khajavi M, Inoue K, Lupski JR. (2006) Nonsense-mediated mRNA decay modulates clinical outcome of genetic disease. Eur J Hum Genet 14(10):1074-81.

Kikuchi Y, Shimatake H, Kikuchi A. (1988) A yeast gene required for the G1-to-S transition encodes a protein containing an A-kinase target site and GTPase domain. EMBO J 7(4):1175-82.

King MDA, Roobol A, Carden MJ. (2000) Confirmation of an interaction between eRF3 (Sup35p/GSPT1) and chaperonin CCT. Mol Biol Cell 1S,617.

Kobayashi T, Funakoshi Y, Hoshino S, Katada T. (2004) The GTP-binding release factor eRF3 as a key mediator coupling translation termination to mRNA decay. J Biol Chem 279(44):45693-700.

Krishnaswamy V, Kumarasamy T, Venkatesan V, Shroff S, Jayanth VR, Paul SF. (2006) South Indian men with reduced CAG repeat length in the androgen receptor gene have an increased risk of prostate cancer. J Hum Genet 51(3):254-7.

98 CHAPTER V | DISCUSSION

Lange EM, Sarma AV, Ray A, Wang Y, Ho LA, Anderson SA, Cunningham JM, Cooney KA. (2008) The androgen receptor CAG and GGN repeat polymorphisms and prostate cancer susceptibility in African- American men: results from the Flint Men's Health Study. J Hum Genet 53(3):220-6.

Lango H, Weedon MN. (2008) What will whole genome searches for susceptibility genes for common complex disease offer to clinical practice? J Intern Med. 2008 Jan;263(1):16-27.

Lee JA, Park JE, Lee DH, Park SG, Myung PK, Park BC, Cho S. (2008) G1 to S phase transition protein 1 induces apoptosis signal-regulating kinase 1 activation by dissociating 14-3-3 from ASK1. Oncogene 27(9):1297-305.

Li C, Grönberg H, Matsuyama H, Weber G, Nordenskjöld M, Naito K, Bergh A, Bergerheim U, Damber JE, Larsson C, Ekman P. (2003) Difference between Swedish and Japanese men in the association between AR CAG repeats and prostate cancer suggesting a susceptibility-modifying locus overlapping the androgen receptor gene. Int J Mol Med11(4):529-33.

Li R, Wang H, Bekele BN, Yin Z, Caraway NP, Katz RL, Stass SA, Jiang F. (2006) Identification of putative oncogenes in lung adenocarcinoma by a comprehensive functional genomic approach. Oncogene 25(18):2628-35.

Linde L, Kerem B. (2008) Introducing sense into nonsense in treatments of human genetic diseases. Trends Genet 24(11):552-63.

Malta-Vacas J, Aires C, Costa P, Conde AR, Ramos S, Martins AP, Monteiro C, Brito M. (2005) Differential expression of the eukaryotic release factor 3 (eRF3/GSPT1) according to gastric cancer histological types. J Clin Pathol 58(6):621-5.

Malta-Vacas J, Chauvin C, Gonçalves L, Nazaré A, Carvalho C, Monteiro C, Bagrel D, Jean-Jean O, Brito M (2009a) eRF3a/GSPT1 12GGC allele increases the susceptibility for breast cancer development. Oncol Rep 21(6):1551-8.

Malta-Vacas J, Nolasco S, Monteiro C, Soares H, Brito M. (2009b) Translation termination and protein folding pathway genes are not correlated in gastric cancer. Clin Chem Lab Med 47(4):427-31.

Malta-Vacas J, Ferreira P., Monteiro C, Brito M (submitted) eRF3a/GSPT1 (GGC)n alleles differential expression in cancer. Genes, Chromosomes and Cancer, submitted

Mamane Y, Petroulakis E, LeBacquer O, Sonenberg N. (2006) mTOR, translation initiation and cancer. Oncogene 25(48):6416-22.

Mamane Y, Petroulakis E, Martineau Y, Sato TA, Larsson O, Rajasekhar VK, Sonenberg N. (2007) Epigenetic activation of a subset of mRNAs by eIF4E explains its effects on cell proliferation. PLoS ONE 2(2):e242.

Marcotte EM, Pellegrini M, Thompson MJ, Yeates TO, Eisenberg D. (1999) A combined algorithm for genome-wide prediction of protein function. Nature 402(6757):83-6.

Mata J, Marguerat S, Bähler J. (2005) Post-transcriptional control of gene expression: a genome-wide perspective. Trends Biochem Sci 30(9):506-14.

Mateuca R, Lombaert N, Aka PV, Decordier I, Kirsch-Volders M. (2006) Chromosomal changes: induction, detection methods and applicability in human biomonitoring. Biochimie 88(11):1515-31.

Meloni R, Albanèse V, Ravassard P, Treilhou F, Mallet J. (1998) A tetranucleotide polymorphic microsatellite, located in the first intron of the tyrosine hydroxylase gene, acts as a transcription regulatory element in vitro. Hum Mol Genet 7(3):423-8.

Meric F, Hunt KK. (2002) Translation initiation in cancer: a novel target for therapy. Mol Cancer Ther 1(11):971-9.

Mita MM, Mita A, Rowinsky EK. (2003) The molecular target of rapamycin (mTOR) as a therapeutic target against cancer. Cancer Biol Ther 2(4 Suppl 1):S169-77.

99 CHAPTER IV | DISCUSSION

Munkholm P. (2003) Review article: the incidence and prevalence of colorectal cancer in inflammatory bowel disease. Aliment Pharmacol Ther 18 Suppl 2:1-5.

Nelson KA, Witte JS. (2002) Androgen receptor CAG repeats and prostate cancer. Am J Epidemiol 155(10):883-90.

Nolasco S, Bellido J, Gonçalves J, Zabala JC, Soares H. (2005) Tubulin cofactor A gene silencing in mammalian cells induces changes in microtubule cytoskeleton, cell cycle arrest and cell death. FEBS Lett 579,3515-24.

Nupponen NN, Porkka K, Kakkola L, Tanner M, Persson K, Borg A, Isola J, Visakorpi T. (1999) Amplification and overexpression of p40 subunit of eukaryotic translation initiation factor 3 in breast and prostate cancer. Am J Pathol 154(6):1777-83.

Palacios R, Gazave E, Goñi J, Piedrafita G, Fernando O, Navarro A, Villoslada P. (2009) Allele-specific gene expression is widespread across the genome and biological processes. PLoS ONE 4(1):e4150.

Pandolfi PP. (2004) Aberrant mRNA translation in cancer pathogenesis: an old concept revisited comes finally of age. Oncogene 23(18):3134-7.

Persico AM, Levitt P, Pimenta AF. (2006) Polymorphic GGC repeat differentially regulates human reelin gene expression levels. J Neural Transm 113(10):1373-82.

Rajasekhar VK, Holland EC. (2004) Postgenomic global analysis of translational control induced by oncogenic signaling. Oncogene 23(18):3248-64.

Rojo F, Najera L, Lirola J, Jiménez J, Guzmán M, Sabadell MD, Baselga J, Ramon y Cajal S. (2007) 4E- binding protein 1, a cell signaling hallmark in breast cancer that correlates with pathologic grade and prognosis. Clin Cancer Res 13(1):81-9.

Ross CW, Ouillette PD, Saddler CM, Shedden KA, Malek SN. (2007) Comprehensive analysis of copy number and allele status identifies multiple chromosome defects underlying follicular lymphoma pathogenesis. Clin Cancer Res 13(16):4777-85.

Ruggero D, Pandolfi PP. (2003) Does the ribosome translate cancer? Nat Rev Cancer 3(3):179-92.

Rydzanicz M, Giefing M, Ziolkowski A, Kasprzyk M, Gabriel A, Dyszkiewicz W, Szyfter K. (2008) Nonrandom DNA copy number changes related to lymph node metastases in squamous cell carcinoma of the lung. Neoplasma 55(6):493-500.

Saran R, Tiwari RK, Reddy PP, Ahuja YR. (2008) Risk assessment of oral cancer in patients with pre- cancerous states of the oral cavity using micronucleus test and challenge assay. Oral Oncol 44(4):354-60.

Sarlomo-Rikala M, El-Rifai W, Lahtinen T, Andersson LC, Miettinen M, Knuutila S. (1998) Different patterns of DNA copy number changes in gastrointestinal stromal tumors, leiomyomas, and schwannomas. Hum Pathol 29(5):476-81.

Savinainen KJ, Linja MJ, Saramäki OR, Tammela TL, Chang GT, Brinkmann AO, Visakorpi T. (2004) Expression and copy number analysis of TRPS1, EIF3S3 and MYC genes in breast and prostate cancer. Br J Cancer 90(5):1041-6.

Seno H, Oshima M, Taniguchi MA, Usami K, Ishikawa TO, Chiba T, Taketo MM. (2002) CDX2 expression in the stomach with intestinal metaplasia and intestinal-type cancer: Prognostic implications. Int J Oncol 21:769-74.

Shinohara T, Ohshima K, Murayama H, Kikuchi M, Yamashita Y, Shirakusa T. (1996) Apoptosis and proliferation in gastric carcinoma: the association with histological type. Histopathology 29:123-9.

Sonenberg N, Dever TE. (2003) Eukaryotic translation initiation factors and regulators. Curr Opin Struct Biol 13(1):56-63.

100 CHAPTER V | DISCUSSION

Stoneley M, Willis AE. (2003) Aberrant regulation of translation initiation in tumorigenesis. Curr Mol Med 3(7):597-603.

Sun Y, Wong N, Guan Y, Salamanca CM, Cheng JC, Lee JM, Gray JW, Auersperg N. (2008) The eukaryotic translation elongation factor eEF1A2 induces neoplastic properties and mediates tumorigenic effects of ZNF217 in precursor cells of human ovarian carcinomas. Int J Cancer 123(8):1761-9.

Suter NM, Malone KE, Daling JR, Doody DR, Ostrander EA. (2003) Androgen receptor (CAG)n and (GGC)n polymorphisms and breast cancer risk in a population-based case-control study of young women. Cancer Epidemiol Biomarkers Prev 12(2):127-35.

Takada H, Imoto I, Tsuda H, Sonoda I, Ichikura T, Mochizuki H, Okanoue T, Inazawa J. (2005) Screening of DNA copy-number aberrations in gastric cancer cell lines by array-based comparative genomic hybridization. Cancer Sci 96(2):100-10.

Takai D, Jones PA. (2002) Comprehensive analysis of CpG islands in human chromosomes 21 and 22. Proc Natl Acad Sci USA 99(6):3740-5.

Takeno SS, Leal MF, Lisboa LC, Lipay MV, Khayat AS, Assumpção PP, Burbano RR, Smith Mde A. (2009) Genomic alterations in diffuse-type gastric cancer as shown by high-resolution comparative genomic hybridization. Cancer Genet Cytogenet 190(1):1-7.

Tallheden T, Karlsson C, Brunner A, Van Der Lee J, Hagg R, Tommasini R, Lindahl A. (2004) Gene expression during redifferentiation of human articular chondrocytes. Osteoarthritis Cartilage 12(7):525-35.

Tejada S, Lobo MV, García-Villanueva M, Sacristán S, Pérez-Morgado MI, Salinas M, Martín ME. (2009) Eukaryotic Initiation Factors (EIF) 2{alpha} and 4e Expression, Localization, and Phosphorylation in Brain Tumors. J Histochem Cytochem 57(5):503-12.

Thakur A, Xu H, Wang Y, Bollig A, Biliran H, Liao JD. (2005) The role of X-linked genes in breast cancer. Breast Cancer Res Treat 93(2):135-43.

Tomlinson VA, Newbery HJ, Bergmann JH, Boyd J, Scott D, Wray NR, Sellar GC, Gabra H, Graham A, Williams AR, Abbott CM. (2007) Expression of eEF1A2 is associated with clear cell histology in ovarian carcinomas: overexpression of the gene is not dependent on modifications at the EEF1A2 locus. Br J Cancer 96(10):1613-20.

Tran N, Bharaj BS, Diamandis EP, Smith M, Li BD, Yu H. (2004) Short tandem repeat polymorphism and cancer risk: influence of laboratory analysis on epidemiologic findings. Cancer Epidemiol Biomarkers Prev 13(12):2133-40.

Uchida N, Hoshino S, Imataka H, Sonenberg N, Katada T. (2002) A novel role of the mammalian GSPT/eRF3 associating with poly(A)-binding protein in Cap/Poly(A)-dependent translation. J Biol Chem 277(52):50286-92.

Valouev IA, Kushnirov VV, Ter-Avanesyan MD. (2002) Yeast polypeptide chain release factors eRF1 and eRF3 are involved in cytoskeleton organization and cell cycle regulation. Cell Motil Cytoskeleton 52(3):161-73.

Walczak CE, Heald R. (2008) Mechanisms of mitotic spindle assembly and function. Int Rev Cytol 265:111-58.

Werner M, Becker KF, Keller G, Höfler H. (2001) Gastric adenocarcinoma: pathomorphology and molecular pathology. J Cancer Res Clin Oncol 127(4):207-16.

Yokota S, Yanagi H, Yura T, Kubota H. (1999) Cytosolic chaperonin is upregulated during cell growth: preferential expression and binding to tubulin at G1/S transition through early S phase. J Biol Chem 274(52):37070–8.

101 CHAPTER IV | DISCUSSION

Yokota S, Yamamoto Y, Shimizu K, Momoi H, Kamikawa T, Yamaoka Y, Yanagi H, Yura T, Kubota H. (2001) Increased expression of cytosolic chaperonin CCT in human hepatocellular and colonic carcinoma. Cell Stress Chaperones 6(4):345-50.

Zeegers MP, Kiemeney LA, Nieder AM, Ostrer H. (2004) How strong is the association between CAG and GGN repeat length polymorphisms in the androgen receptor gene and prostate cancer risk? Cancer Epidemiol Biomarkers Prev 13(11 Pt 1):1765-71.

Zhang W, Yu YY (2007) Polymorphisms of short tandem repeat of genes and breast cancer susceptibility. Eur J Surg Oncol 33(5):529-34.

Zheng L, Wang L, Ajani J, Xie K. (2004) Molecular basis of gastric cancer development and progression. Gastric Cancer 7(2):61-77. Zisman TL, Rubin DT. (2008) Colorectal cancer and dysplasia in inflammatory bowel disease. World J Gastroenterol 14(17):2662-9.

Zondervan PE, Wink J, Alers JC, IJzermans JN, Schalm SW, de Man RA, van Dekken H. (2000) Molecular cytogenetic evaluation of virus-associated and non-viral hepatocellular carcinoma: analysis of 26 carcinomas and 12 concurrent dysplasias. J Pathol 192(2):207-15.

102

5. CHAPTER V

FINAL REMARKS

Both gastric cancer, colorectal cancer and breast cancer, the types of tumors used as cancer models during this research work, are within the main types of cancer leading to overall cancer mortality. All of them are heterogeneous diseases, being the contributions of different oncogenic mutations to this heterogeneity still not entirely understood. A small percentage of all cases are due to highly penetrant mutations in single genes; low penetrance susceptibility genes account for a high proportion of tumors, and most of them are still to be identified. Therefore, the search for additional cancer predisposition genes is a goal towards the improvement of cancer diagnosis and to a better understanding of the mechanisms underlying these diseases.

The use of molecular markers and gene expression profiling provides a promising approach for improving the predictive accuracy of current disease prognostic indices. Molecular tests for diagnosis, disease prognosis and selection of treatment options, particularly in cancer, are gaining increased acceptance by physicians and patients. Oncologists who are aware of the progress in hereditary cancer syndrome diagnosis and, in particular, of how this effort may be effectively facilitated through a comprehensive family history in concert with molecular genetic studies, are in the advantaged position of designing highly targeted screening and management programs for the members of cancer-prone families. This knowledge may have impact upon the progress in the earlier diagnosis of cancer and provide an impetus for better diagnostic methods.

A better understanding of eRF3a/GSPT1 gene regulation and its relation with cellular proliferation may have prognostic value and potential therapeutic applications. eRF3a/GSPT1 gene had never been related to cancer at the beginning of this study. By the end of the project, we believe that we contributed to a better comprehension of the mechanisms involved in eRF3a oncogenecity, and simultaneously identified a new potential molecule for anti- cancer treatment. Our work also contributed to alert the international scientific community for eRF3a involvement in cancer. Therefore, this work represents a starting point for new roads in

103 CHAPTER V | FINAL REMARKS

cancer investigation. At this moment, other international groups are interested in this theme and are starting new projects concerning this issue. The major outcomes from this research may be summarized as follows: eRF3a/GSPT1 as a susceptibility cancer marker Most of the studies found in literature that evaluate the role of microsatellite polymorphisms contribution to cancer report variations in cancer risk that are associated with specific alleles, which are generally present in a significant proportion of the normal population. In our study, we report the presence of a specific allele (12GGC) directly associated with cancer development. This allele has never been detected in the normal population (represented by a control population of individuals without oncological pathologies and without known familiar history of cancer). Moreover, the presence of the 12GGC allele in cancer patients was shown to be a germline mutation. Therefore, we purpose that the presence of the 12GGC allele, by itself, may provide a new useful marker for cancer susceptibility. Gene expression profiles are key parameters used for the molecular characterization of tumours. The quantification of gene expression levels in tumour samples from cancer patients might be of critical importance in prediction of disease progression, drug response and even in identification of tumour margins to be removed by surgery. eRF3a/GSPT1 gene was shown to be over- expressed in a significant proportion of different types of cancer. Moreover, allelic expression imbalance was detected, being the 12GGC allele significantly up-regulated. Although the mechanisms that underlie eRF3a/GSPT1 over-expression still need further elucidation, the expression of the gene might be of potential value for prognostic evaluation and therapeutic decisions. Otherwise, eRF3a/GSPT1 expression may add value if included in a genetic signature along with other genes, improving its predictive accuracy.

eRF3a/GSPT1 as a potential anticancer drug target Many of the steps involved in translation and in ribosome biogenesis are intrinsically potential drug targets, because they rely on enzymatic activities (e.g. mTOR as a kinase; dyskerin as pseudouridine synthase). Therefore, translational alterations in human tumors present good opportunities for therapeutic interventions. Inhibitors of the mTOR pathway, such as rapamicin and analogues, are attractive targets and have been tested since decades as anti-cancer drugs. Gene therapy vectors including “suicide genes” with highly structured 5’UTRs are also being explored to take advantage of the enhanced cap-dependent translation in cancer cells. eRF3a is a small GTPase that modulates mRNA translation at different levels, namely regulating termination efficiency, recycling ribosomes for successive translation cycles, and even controlling initiation by a retro-control mechanism not yet well understood that involves the mTOR pathway. It thus represents an attractive target for cancer therapy.

104 CHAPTER V | FINAL REMARKS

Moreover, eRF3a appears to be a key component in a cell cycle checkpoint that determines whether cells progress through S phase. In addition, it was shown that this protein is also involved in apoptosis regulation. This suggests that cell cycle-dependent eRF3a induction may be critical for determining whether cells undergo appropriate cell cycle progression or, alternatively, undergo apoptosis. Finally, elements that control microtubules dynamics regulation are also known to have critical consequences for cell fate and thus represent potential therapeutic targets in oncology. Although a long way is still to be walked, the pathways in which eRF3a is involved make it a promising target for cancer therapy. To this end, it will be of paramount importance to assess genetically in vivo the relative significance in cancer pathogenesis of eRF3a in the mRNA translation control network, apoptosis and cytoskeleton assembly, in order to evaluate it as a potential target for therapy.

Future investigations

Hopefully this work will facilitate further investigations on the mechanisms involved in eRF3a/GSPT1 oncogenic potential. Suggestions for future investigations regarding the role of eRF3a/GSPT1 in tumorigenesis are:

- to perform more comparative studies between different types of cancer in order to investigate the presence of the 12GGC allele in other cancer types. Hematologic malignancies are of particular interest because they frequently present chromosomal re-arrangements;

- to analyse the genotypes from first degree relatives of patients with the 12GGC over several generations, to confirm the dominant type of heredity;

- to continue the analysis of the role of the N-terminal domain of eRF3a in cytoskeleton organization. Analysis of the mitotic spindle formation in cells expressing different alleles should elucidate about the role of the N-terminal domain of eRF3a in the accurate functioning of the mitotic spindle;

- to investigate if the size of the polyglycine expansion affects the interaction between eRF3a and UPF1, compromising the protein’s role in the nonsense-mediated mRNA decay;

- to investigate if the size of the polyglycine expansion affects the interaction between eRF3a and PABP, altering the downstream pathways involved, namely in recycling of ribosomes and the stability of the transcriptome;

105 CHAPTER V | FINAL REMARKS

- to quantify the levels of expression of eRF3a and eRF3b in cells expressing different (GGC)n alleles at the mRNA level and protein level;

- to investigate if the levels of eRF3a/GSPT1 mRNA expression correlate with eRF3a and/or eRF3a processed isoform levels;

- to investigate if the expression of eRF3a/GSPT1 correlates with the levels of expression of the translation initiation factors and other factors acting in the mTOR pathway.

106