DOCSLIB.ORG

Complete Androgen Insensitivity in a 47,XXY Patient with Uniparental Disomy for the X Chromosome

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Complete Androgen Insensitivity in a 47,XXY Patient with Uniparental Disomy for the X Chromosome American Journal of Medical Genetics 86:107–111 (1999) Complete Androgen Insensitivity in a 47,XXY Patient With Uniparental Disomy for the X Chromosome Shigeki Uehara,1* Mitsutoshi Tamura,1 Masayuki Nata,2 Jun Kanetake,2 Masaki Hashiyada,2 Yukihiro Terada,1 Nobuo Yaegashi,1 Tadao Funato,3 and Akira Yajima1 1Departments of Obstetrics and Gynecology, Tohoku University School of Medicine, Sendai, Japan 2Forensic Medicine, Tohoku University School of Medicine, Sendai, Japan 3Laboratory Medicine, Tohoku University School of Medicine, Sendai, Japan We describe a unique patient with complete tes, absence of Wolffian and Müllerian derivatives, and androgen insensitivity syndrome and a high serum concentrations of testosterone and gonad- 47,XXY karyotype. Androgen receptor assay otropins. These abnormalities are caused by the ab- using cultured pubic skin fibroblasts sence or malfunction of the androgen receptor (AR) re- showed no androgen-binding capacity. Se- sulting from various types of mutations of the AR gene quence analysis of the androgen receptor located on Xq12 [Graffin and Wilson, 1989; Sinnecker gene demonstrated two nonsense muta- et al., 1997]. The 47,XXY karyotype causes Klinefelter tions, one in exon D and one in exon E. Mi- syndrome, which is characterized by tall stature, a crosatellite marker analysis showed that slender build with long extremities, male external the patient is homozygous for all five Xq loci genitalia with a small penis and small testes, and in- examined. The results suggest that the long- fertility due to azoospermia. The prevalence of arms of the two X chromosomes are identi- Klinefelter syndrome is approximately 1 in 1,000 males cal, i.e., uniparental isodisomy at least for [Levitan, 1988]. Endocrinologic evaluation in adult pa- Xq, and carry the same mutations in the an- tients with 47,XXY typically demonstrates hypergo- drogen receptor gene. This explains how nadotropic hypogonadism, and atrophic changes in the complete androgen insensitivity syndrome testes. occurred in this 47,XXY individual. Am. J. A combination of AIS and 47,XXY was reported in 5 Med. Genet. 86:107–111, 1999. cases [Bartsch-Sandhoff et al., 1976; Gerli et al., 1979; © 1999 Wiley-Liss, Inc. German and Vessell 1966; Müller et al., 1990; Scully et al., 1990]. The rarity of this concurrence is explained by KEY WORDS: androgen insensitivity syn- the random nature of X-inactivation in XXY patients drome; Klinefelter syndrome; [Disteche, 1995; Lyon, 1961], because overall, a defect microsatellite markers; meio- resulting from a mutant AR allele on one X chromo- sis II nondisjunction; double some is masked by the effect of the normal allele on the mutation; uniparental di- other X chromosome. However, AIS can occur in XXY somy patients when a mutant allele is preferentially ex- pressed through non-random X-inactivation, or when both X chromosomes carry mutant alleles, i.e., homo- zygosity. INTRODUCTION Here we describe a Japanese patient with complete Patients with androgen insensitivity syndrome AIS and 47,XXY chromosome constitution, and discuss (AIS), an X-linked disorder with a prevalence of about the mechanism leading to the manifestation of AIS in 1 in 65,000 males [Jagiello and Atwell, 1962], have fe- 47,XXY individuals. male genitalia and breasts (despite a male karyotype) with a very low grade of pubic hair development, a CLINICAL REPORT blindly ending vagina, intra-abdominal or inguinal tes- A 30-year-old woman presented with primary amen- orrhea and sterility for 4 years. Her height was 165 cm *Correspondence to: Shigeki Uehara, MD, Department of Ob- (+1.5 SD for the Japanese women), and weight 61.5 kg. stetrics and Gynecology, Tohoku University School of Medicine, She was muscular for a woman and lacked breast de- 1–1 Seiryo-machi, Aoba-ku, Sendai 980–8574, Japan. E-mail: velopment (Tanner grade I). The vulva appeared im- [email protected] mature with no pubic hair development (Tanner grade Received 2 July 1998; Accepted 3 May 1999 I); she had a narrow vagina lacking the cervix. Pelvic © 1999 Wiley-Liss, Inc. 108 Uehara et al. examination, ultrasonography, and magnetic reso- nance imaging showed absence of the uterus. The pa- tient was hypergonadotropic: serum luteinizing hor- mone was 19.2 mIU/ml (normal, 0.8 to 8.3 mIU/ml for males, 1.4 to 15.3 mIU/ml for follicular-phase females); follicle-stimulating hormone, 46.3 mIU/ml (1.2 to 10.2 mIU/ml for males, 3.2 to 12.2 mIU/ml for follicular- phase females); prolactin, 2.8 ng/ml (3.4 to 16.2 ng/ml for males, 3.7 to 24.8 ng/ml for females); 17␤-estradiol, 20.6 pg/ml (<5 to 48 pg/ml for males, 4 to 60 pg/ml for early follicular-phase females); progesterone, 0.99 ng/ ml (<2.4 ng/ml for males, <1.82 ng/ml for follicular- phase females); and testosterone, 1.0 ng/ml (2.86 to 11.48 ng/ml for males, <0.1 to 0.9 ng/ml for females). Laparoscopic examination demonstrated small, whit- ish, testis-like gonads on the walls of the pelvis. No Fig. 1. Saturation curve of specific binding of [3H] R1881 to the andro- gen receptor on cultured fibroblasts derived from the patient (᭹) and a Müllerian or Wolffian derivatives were identified. Bi- control subject (᭺). No androgen binding was detectable in fibroblasts from lateral gonadectomy was performed. Histopathological the patient. examination demonstrated a few degenerating seminif- erous tubles with no spermatogonia and Leydig cell clusters in the stroma with fibrotic replacement; no 15% FBS until sufficient numbers of fibroblasts were tumors were seen. Two maternal aunts also had pri- obtained. Two days before the assay the medium was mary amenorrhea and sterility. Chromosome analysis changed to serum-free MEM. Fibroblasts were har- of lymphocytes and fibroblasts showed a non-mosaic vested in Hanks BSS containing 0.01% trypsin and 47,XXY karyotype. 0.02% EDTA, rinsed with PBS, and suspended in MEM containing 25 mM tricine (Sigma-Aldrich Japan, To- 5 METHODS kyo). Duplicate tubes of fibroblasts (7×10 cells/ml) were incubated for 1 hr at room temperature with vari- Whole-Cell Receptor Assay of ous concentrations (0.16 to 5 nM) of [3H] methyltrieno- Androgen Receptor lone ([3H] R1881; New England Nuclear Research Products, Boston, MA) in the presence or absence of a The method of Nakao et al. [1992] was followed for 1000-fold excess of unlabeled R1881. After incubation, AR radioreceptor assay. Briefly, pubic skin samples cells were washed three times with PBS and then lysed from the patient and from a female control (obtained under informed consent at vaginal hysterectomy per- formed to treat her uterine carcinoma in situ) were minced and cultured in flasks containing 5 ml Eagle’s MEM (GIBCO BRL, Rockville, MD) supplemented with TABLE I. Primer Sequence Used in the Present Study Primer pair Sequences (5Ј–3Ј) AR-Exon B GCCTGCAGGTTAATGCTGAA GTTATTTGATAGGGCCTTGC AR-Exon C GTTTGGTGCCATACTCTGTC ATGGCCACGTTGCCTATGAA AR-Exon D GAGTTTAGAGTCTGTGACCA GATCCCCCTTATCTCATGCT AR-Exon E AACCCGTCAGTACCCAGACT GCTTCACTGTCACCCCATCA AR-Exon F GGGCTTATTGGTAAACTTCC GTCCAGGAGCTGGCTTTTCC AR-Exon G TCAGATCGGATCCAGCTATC TCTATCAGGCTGTTCTCCCT AR-Exon H GAGGCCACCTCCTTGTCAAC AAGGCACTGCAGAGGAGTAG HUMARA [AGC]n TCCAGAATCTGTTCCAGAGCGTGC GCTGTGAAGGTTGCTGTTCCTCAT HUMHPRTB [AGAT]n ATGCCACAGATAATACACATCCCC CTCTCCAGAATAGTTAGATGTAGG DXYS156 [TAAAA]n GTAGTGGTCTTTTGCCTCC Fig. 2. Sequences for the androgen receptor (AR) gene in the patient. CAGATACCAAGGTGAGAATC (a) A partial sequence of AR-exon D with a C-to-T substitution that DXS731 [CA]n CCTGATCATCCCTGAGGCTA changes glutamine (CAG) to a stop codon (TAG) at codon 640. (b) A partial TTAGTCCCAGGGGGGAGAG sequence of AR-exon E with a G-to-A substitution that changes tryptophan DXS738 [CA]n CCAGCAATAACCATAAGTAAAACC (TGG) to a stop codon (TGA) at codon 749. Arrows indicate each substi- AATGTGTTGTTGTATTCACCTTGC tuted nucleotide, bar depicts the substituted termination codon, and nucleotides above the arrows indicate the wild type. Androgen Insensitivity With UPD for X Chromosome 109 Fig. 3. Microsatellite marker analysis of HUMARA (a), HUMHPRTB (b), DXYS156 (c), DXS730 (d), and DXS738 (e). X chromosome-specific markers are present in a single peak (arrowhead). Product size is 288 bp for HUMARA, 287 bp for HUMHPRTB, 140 bp for DXYS156, 195 bp for DXS730, and 150 bp for DXS738. For DXYS156, a Y-specific marker also is detected (arrow); X-specific and Y-specific alleles are discriminated by their product size. Remaining peaks represent internal size controls. with 1 ml of absolute ethanol. The aliquot was trans- screen for bacterial colonies containing the correct in- ferred to vials containing 10 ml of ACS-II cocktail (Am- sert. Each PCR product was sequenced with a DSQ- ersham, Buckinghamshire, England) for liquid scintil- 1000L automated DNA sequencer (Shimazu, Tokyo, lation counting. The results were analyzed by the Japan) using the dideoxynucleotide method. To distin- Scatchard method to quantify specific [3H] R1881 bind- guish mutations from randomly misincorporated ing. nucleotides, sequences were examined in six clones ob- tained from each exon. Nucleotide Sequencing Microsatellite Markers Analysis Sequence analysis was carried out for exons B to H of the AR gene, using the method of Nakao et al. [1992] Leukocyte genomic DNA from the patient was ana- and Lubahn et al. [1989] (Exon A was not examined lyzed for polymorphisms of five microsatellite markers because of the rarity of mutations.) Primer sequences on the long-arm of X chromosome. DNA from her par- are shown in the Table I. Polymerase chain reaction ents was not available because both were deceased. (PCR) products were purified and concentrated using a Briefly, DNA sample was amplified by PCR using QIAEX II apparatus (Qiagen, Tokyo), and subcloned primers for HUMARA (AR) on Xq12 [Edwards et al. into pGEM-T (plasmid, Promega, Madison, WI). DH-5␣ 1992], HUMHPRTB (HPRT) on Xq26.1 [Edwards et al., (Escherichia coli) that was transformed by the plasmid 1992; Huang et al., 1991], DXYS156 on Xq and Y [Chen were cultured, thereafter direct colony PCR using both et al., 1994], DXS730 (MS21) on Xq26 [Hudson et al., M13 forward and reverse primers was performed to 1992], and DXS738 (E114) on Xq21.1 [Hudson et al., 110 Uehara et al.
Load more

Recommended publications
  • Clinical and Molecular Relevance of Genetic Variants in the Non-Coding
    Clinical and molecular relevance of genetic variants in the non-coding transcriptome of patients with cytogenetically normal acute myeloid leukemia by Dimitrios Papaioannou, Hatice G. Ozer, Deedra Nicolet, Amog P. Urs, Tobias Herold, Krzysztof Mrózek, Aarif M.N. Batcha, Klaus H. Metzeler, Ayse S. Yilmaz, Stefano Volinia, Marius Bill, Jessica Kohlschmidt, Maciej Pietrzak, Christopher J. Walker, Andrew J. Carroll, Jan Braess, Bayard L. Powell, Ann-Kathrin Eisfeld, Geoffrey L. Uy, Eunice S. Wang, Jonathan E. Kolitz, Richard M. Stone, Wolfgang Hiddemann, John Byrd, Clara D. Bloomfield, and Ramiro Garzon Haematologica 2021 [Epub ahead of print] Citation: Dimitrios Papaioannou, Hatice G. Ozer, Deedra Nicolet, Amog P. Urs, Tobias Herold, Krzysztof Mrózek, Aarif M.N. Batcha, Klaus H. Metzeler, Ayse S. Yilmaz, Stefano Volinia, Marius Bill, Jessica Kohlschmidt, Maciej Pietrzak, Christopher J. Walker, Andrew J. Carroll, Jan Braess, Bayard L. Powell, Ann-Kathrin Eisfeld, Geoffrey L. Uy, Eunice S. Wang, Jonathan E. Kolitz, Richard M. Stone, Wolfgang Hiddemann, John Byrd, Clara D. Bloomfield, and Ramiro Garzon. Clinical and molecular relevance of genetic variants in the non-coding transcriptome of patients with cytogenetically normal acute myeloid leukemia. Haematologica. 2021; 106:xxx doi:10.3324/haematol.2021.266643 Publisher's Disclaimer. E-publishing ahead of print is increasingly important for the rapid dissemination of science. Haematologica is, therefore, E-publishing PDF files of an early version of manuscripts that have completed a regular peer review and have been accepted for publication. E-publishing of this PDF file has been approved by the authors. After having E-published Ahead of Print, manuscripts will then undergo technical and English editing, typesetting, proof correction and be presented for the authors' final approval; the final version of the manuscript will then appear in print on a regular issue of the journal.
    [Show full text]
  • Role of CREB/CRTC1-Regulated Gene Transcription During Hippocampal-Dependent Memory in Alzheimer’S Disease Mouse Models
    ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda condicionat a lʼacceptació de les condicions dʼús establertes per la següent llicència Creative Commons: http://cat.creativecommons.org/?page_id=184 ADVERTENCIA. El acceso a los contenidos de esta tesis queda condicionado a la aceptación de las condiciones de uso establecidas por la siguiente licencia Creative Commons: http://es.creativecommons.org/blog/licencias/ WARNING. The access to the contents of this doctoral thesis it is limited to the acceptance of the use conditions set by the following Creative Commons license: https://creativecommons.org/licenses/?lang=en Institut de Neurociències Universitat Autònoma de Barcelona Departament de Bioquímica i Biologia Molecular Unitat de Bioquímica, Facultat de Medicina Role of CREB/CRTC1-regulated gene transcription during hippocampal-dependent memory in Alzheimer’s disease mouse models Arnaldo J. Parra Damas TESIS DOCTORAL Bellaterra, 2015 Institut de Neurociències Departament de Bioquímica i Biologia Molecular Universitat Autònoma de Barcelona Role of CREB/CRTC1-regulated gene transcription during hippocampal-dependent memory in Alzheimer’s disease mouse models Papel de la transcripción génica regulada por CRTC1/CREB durante memoria dependiente de hipocampo en modelos murinos de la enfermedad de Alzheimer Memoria de tesis doctoral presentada por Arnaldo J. Parra Damas para optar al grado de Doctor en Neurociencias por la Universitat Autonòma de Barcelona. Trabajo realizado en la Unidad de Bioquímica y Biología Molecular de la Facultad de Medicina del Departamento de Bioquímica y Biología Molecular de la Universitat Autònoma de Barcelona, y en el Instituto de Neurociencias de la Universitat Autònoma de Barcelona, bajo la dirección del Doctor Carlos Saura Antolín.
    [Show full text]
  • The Essential Role of the Crtc2-CREB Pathway in Β Cell Function And
    The Essential Role of the Crtc2-CREB Pathway in β cell Function and Survival by Chandra Eberhard A thesis submitted to the School of Graduate Studies and Research in partial fulfillment of the requirements for the degree of Masters of Science in Cellular and Molecular Medicine Department of Cellular and Molecular Medicine Faculty of Medicine University of Ottawa September 28, 2012 © Chandra Eberhard, Ottawa, Canada, 2013 Abstract: Immunosuppressants that target the serine/threonine phosphatase calcineurin are commonly administered following organ transplantation. Their chronic use is associated with reduced insulin secretion and new onset diabetes in a subset of patients, suggestive of pancreatic β cell dysfunction. Calcineurin plays a critical role in the activation of CREB, a key transcription factor required for β cell function and survival. CREB activity in the islet is activated by glucose and cAMP, in large part due to activation of Crtc2, a critical coactivator for CREB. Previous studies have demonstrated that Crtc2 activation is dependent on dephosphorylation regulated by calcineurin. In this study, we sought to evaluate the impact of calcineurin-inhibiting immunosuppressants on Crtc2-CREB activation in the primary β cell. In addition, we further characterized the role and regulation of Crtc2 in the β cell. We demonstrate that Crtc2 is required for glucose dependent up-regulation of CREB target genes. The phosphatase calcineurin and kinase regulation by LKB1 contribute to the phosphorylation status of Crtc2 in the β cell. CsA and FK506 block glucose-dependent dephosphorylation and nuclear translocation of Crtc2. Overexpression of a constitutively active mutant of Crtc2 that cannot be phosphorylated at Ser171 and Ser275 enables CREB activity under conditions of calcineurin inhibition.
    [Show full text]
  • Trim24 Targets Endogenous P53 for Degradation
    Trim24 targets endogenous p53 for degradation Kendra Alltona,b,1, Abhinav K. Jaina,b,1, Hans-Martin Herza, Wen-Wei Tsaia,b, Sung Yun Jungc, Jun Qinc, Andreas Bergmanna, Randy L. Johnsona,b, and Michelle Craig Bartona,b,2 aDepartment of Biochemistry and Molecular Biology, Program in Genes and Development, Graduate School of Biomedical Sciences and bCenter for Stem Cell and Developmental Biology, University of Texas M.D. Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, TX 77030; and cDepartment of Molecular and Cellular Biology, Baylor College of Medicine, 1 Baylor Plaza, Houston, TX 77030 Edited by Carol L. Prives, Columbia University, New York, NY, and approved May 15, 2009 (received for review December 23, 2008) Numerous studies focus on the tumor suppressor p53 as a protector regulator of p53 suggests that potential therapeutic targets to of genomic stability, mediator of cell cycle arrest and apoptosis, restore p53 functions remain to be identified. and target of mutation in 50% of all human cancers. The vast majority of information on p53, its protein-interaction partners and Results and Discussion regulation, comes from studies of tumor-derived, cultured cells Creation of a Mouse and Stem Cell Model for p53 Analysis. To where p53 and its regulatory controls may be mutated or dysfunc- facilitate analysis of endogenous p53 in normal cells, we per- tional. To address regulation of endogenous p53 in normal cells, formed gene targeting to create mouse embryonic stem (ES) we created a mouse and stem cell model by knock-in (KI) of a cells and mice (12), which express endogenously regulated p53 tandem-affinity-purification (TAP) epitope at the endogenous protein fused with a C-terminal TAP tag (p53-TAPKI, Fig.
    [Show full text]
  • Histone Acetyltransferase Activity of CREB-Binding Protein Is Essential
    bioRxiv preprint doi: https://doi.org/10.1101/2021.05.26.445902; this version posted July 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Histone acetyltransferase activity of CREB-binding protein is 2 essential for synaptic plasticity in Lymnaea 3 4 Dai Hatakeyama1,2,*, Hiroshi Sunada3, Yuki Totani4, Takayuki Watanabe5,6, Ildikó Felletár1, 5 Adam Fitchett1, Murat Eravci1, Aikaterini Anagnostopoulou1, Ryosuke Miki2, Takashi 6 Kuzuhara2, Ildikó Kemenes1, Etsuro Ito3,4, György Kemenes1,* 7 8 1Sussex Neuroscience, School of Life Sciences, University of Sussex, Brighton BN1 9QG, 9 UK. 2Faculty of Pharmaceutical Sciences, Tokushima Bunri University, Tokushima 770-8514, 10 Japan. 3Kagawa School of Pharmaceutical Sciences, Tokushima Bunri University, Sanuki 11 769-2193, Japan. 4Department of Biology, Waseda University, Tokyo 162-8480, Japan. 12 5Graduate School of Life Science, Hokkaido University, Sapporo 060-0810, Japan. 13 6Laboratory of Neuroethology, Sokendai-Hayama, Hayama 240-0193, Japan. 14 15 Keywords: Long-term memory; Lymnaea; CREB-binding protein (CBP); Histone Acetyl 16 Transferase (HAT); Cerebral Giant Cell (CGC); synaptic plasticity 17 18 *Correspondence should be addressed to Dr. Dai Hatakeyama, Tokushima Bunri University, 19 180 Nishihama-Houji, Yamashiro-cho, Tokushima City, Tokushima 770-8514, Japan, 20 [email protected]; and Prof. György Kemenes, University of Sussex, Brighton, 21 BN1 9QG, United Kingdom, [email protected]. 22 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.05.26.445902; this version posted July 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder.
    [Show full text]
  • Plasma Autoantibodies Associated with Basal-Like Breast Cancers
    Published OnlineFirst June 12, 2015; DOI: 10.1158/1055-9965.EPI-15-0047 Research Article Cancer Epidemiology, Biomarkers Plasma Autoantibodies Associated with Basal-like & Prevention Breast Cancers Jie Wang1, Jonine D. Figueroa2, Garrick Wallstrom1, Kristi Barker1, Jin G. Park1, Gokhan Demirkan1, Jolanta Lissowska3, Karen S. Anderson1, Ji Qiu1, and Joshua LaBaer1 Abstract Background: Basal-like breast cancer (BLBC) is a rare aggressive PSRC1, MN1, TRIM21) that distinguished BLBC from controls subtype that is less likely to be detected through mammographic with 33% sensitivity and 98% specificity. We also discovered a screening. Identification of circulating markers associated with strong association of TP53 AAb with its protein expression (P ¼ BLBC could have promise in detecting and managing this deadly 0.009) in BLBC patients. In addition, MN1 and TP53 AAbs were disease. associated with worse survival [MN1 AAb marker HR ¼ 2.25, 95% Methods: Using samples from the Polish Breast Cancer study, a confidence interval (CI), 1.03–4.91; P ¼ 0.04; TP53, HR ¼ 2.02, high-quality population-based case–control study of breast can- 95% CI, 1.06–3.85; P ¼ 0.03]. We found limited evidence that cer, we screened 10,000 antigens on protein arrays using 45 BLBC AAb levels differed by demographic characteristics. patients and 45 controls, and identified 748 promising plasma Conclusions: These AAbs warrant further investigation in autoantibodies (AAbs) associated with BLBC. ELISA assays of clinical studies to determine their value for further understanding promising markers were performed on a total of 145 BLBC cases the biology of BLBC and possible detection. and 145 age-matched controls.
    [Show full text]
  • Trim24-Regulated Estrogen Response Is Dependent on Specific Histone Modifications in Breast Cancer Cells
    The Texas Medical Center Library DigitalCommons@TMC The University of Texas MD Anderson Cancer Center UTHealth Graduate School of The University of Texas MD Anderson Cancer Biomedical Sciences Dissertations and Theses Center UTHealth Graduate School of (Open Access) Biomedical Sciences 12-2012 TRIM24-REGULATED ESTROGEN RESPONSE IS DEPENDENT ON SPECIFIC HISTONE MODIFICATIONS IN BREAST CANCER CELLS Teresa T. Yiu Follow this and additional works at: https://digitalcommons.library.tmc.edu/utgsbs_dissertations Part of the Biochemistry Commons, Cancer Biology Commons, Medicine and Health Sciences Commons, and the Molecular Biology Commons Recommended Citation Yiu, Teresa T., "TRIM24-REGULATED ESTROGEN RESPONSE IS DEPENDENT ON SPECIFIC HISTONE MODIFICATIONS IN BREAST CANCER CELLS" (2012). The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences Dissertations and Theses (Open Access). 313. https://digitalcommons.library.tmc.edu/utgsbs_dissertations/313 This Dissertation (PhD) is brought to you for free and open access by the The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences at DigitalCommons@TMC. It has been accepted for inclusion in The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences Dissertations and Theses (Open Access) by an authorized administrator of DigitalCommons@TMC. For more information, please contact [email protected]. TRIM24-REGULATED ESTROGEN RESPONSE IS DEPENDENT ON SPECIFIC HISTONE
    [Show full text]
  • The Product of a Thyroid Hormone-Responsive Gene Interacts with Thyroid Hormone Receptors
    Proc. Natl. Acad. Sci. USA Vol. 94, pp. 8527–8532, August 1997 Biochemistry The product of a thyroid hormone-responsive gene interacts with thyroid hormone receptors CATHERINE C. THOMPSON* AND MARGARET C. BOTTCHER Department of Neuroscience, Johns Hopkins University School of Medicine, Kennedy Krieger Institute, 707 North Broadway, Baltimore, MD 21205 Communicated by Donald D. Brown, Carnegie Institution of Washington, Baltimore, MD, May 23, 1997 (received for review April 14, 1997) ABSTRACT Thyroid hormone is a critical mediator of the function of the hr gene product (Hr), we identified proteins central nervous system (CNS) development, acting through that interact with Hr. Surprisingly, we found that Hr interacts nuclear receptors to modulate the expression of specific genes. with TR. Previously identified proteins that interact with TR Transcription of the rat hairless (hr) gene is highly up- have been shown to interact with multiple nuclear receptors (9, regulated by thyroid hormone in the developing CNS; we show 10, 14–21). In contrast, of the retinoid and steroid receptors here that hr is directly induced by thyroid hormone. By tested here, Hr interacts only with TR. The interaction of Hr identifying proteins that interact with the hr gene product with TR suggests that Hr is part of a novel autoregulatory (Hr), we find that Hr interacts directly and specifically with mechanism by which Hr may influence the expression of thyroid hormone receptor (TR)—the same protein that reg- downstream TH-responsive genes. ulates its expression. Unlike previously described receptor- interacting factors, Hr associates with TR and not with MATERIALS AND METHODS retinoic acid receptors (RAR, RXR).
    [Show full text]
  • Cyclin D Activates the Rb Tumor Suppressor by Mono-Phosphorylation
    RESEARCH ARTICLE elifesciences.org Cyclin D activates the Rb tumor suppressor by mono-phosphorylation Anil M Narasimha1†, Manuel Kaulich1†, Gary S Shapiro1†‡, Yoon J Choi2,3, Piotr Sicinski2,3, Steven F Dowdy1* 1Department of Cellular and Molecular Medicine, University of California, San Diego School of Medicine, La Jolla, United States; 2Department of Genetics, Harvard Medical School, Boston, United States; 3Department of Cancer Biology, Dana-Farber Cancer Institute, Boston, United States Abstract The widely accepted model of G1 cell cycle progression proposes that cyclin D:Cdk4/6 inactivates the Rb tumor suppressor during early G1 phase by progressive multi-phosphorylation, termed hypo-phosphorylation, to release E2F transcription factors. However, this model remains unproven biochemically and the biologically active form(s) of Rb remains unknown. In this study, we find that Rb is exclusively mono-phosphorylated in early 1G phase by cyclin D:Cdk4/6. Mono- phosphorylated Rb is composed of 14 independent isoforms that are all targeted by the E1a oncoprotein, but show preferential E2F binding patterns. At the late G1 Restriction Point, cyclin E:Cdk2 inactivates Rb by quantum hyper-phosphorylation. Cells undergoing a DNA damage response activate cyclin D:Cdk4/6 to generate mono-phosphorylated Rb that regulates global transcription, whereas cells undergoing differentiation utilize un-phosphorylated Rb. These observations fundamentally change our understanding of G1 cell cycle progression and show that mono- *For correspondence: sdowdy@ phosphorylated
    [Show full text]
  • Two Cases of Androgen Insensitivity Due to Somatic Mosaicism
    Manuscript submitted to: Volume 2, Issue 2, 104-109. AIMS Genetics DOI: 10.3934/genet.2015.2.104 Received date 26 November 2014, Accepted date 26 February 2015, Published date 3 March 2015 Research article Two cases of androgen insensitivity due to somatic mosaicism Natalie J. Nokoff 1, *, Sharon Travers 1 and Naomi Meeks 2 1 Pediatric Endocrinology, Children’s Hospital Colorado, Aurora, CO 80045, USA 2 Genetics, Children’s Hospital Colorado, Aurora, CO 80045, USA * Correspondence: Email: [email protected]; Tel: 720-777-3607. Abstract: Androgen insensitivity syndrome (AIS) is caused by mutations in the gene encoding the androgen receptor (AR). The incidence of AIS is estimated to be 1 in 99,000. Complete androgen insensitivity syndrome (CAIS) is characterized by a 46,XY karyotype with external genitalia that appear typically female and results from mutations that render the androgen receptor non-functional. Partial androgen insensitivity syndrome (PAIS) results from partial loss of function mutations in AR. Rarely, PAIS results from somatic mosaicism for an AR mutation and not from a hypomorphic variant. We present two cases of PAIS due to somatic mosaicism, one caused by a novel nonsense mutation and one caused by a missense mutation previously reported in CAIS. Two patients with atypical genitalia presented to our multidisciplinary clinic for disorders of sex development and sequencing of AR was performed as part of the diagnostic evaluation. In case one, AR sequencing revealed mosaicism for a nonsense mutation, c.1331T > A; p.Leu444Ter. This mutation has not previously been reported, but is presumed to be pathogenic. In case two, AR sequencing revealed a mosaic missense mutation, c.2279 C > A; p.Ser760Tyr, which has previously been reported in CAIS but not in PAIS.
    [Show full text]
  • The LIM Protein Complex Establishes a Retinal Circuitry of Visual Adaptation
    RESEARCH ARTICLE The LIM protein complex establishes a retinal circuitry of visual adaptation by regulating Pax6 a-enhancer activity Yeha Kim1, Soyeon Lim1†, Taejeong Ha1†, You-Hyang Song1, Young-In Sohn1, Dae-Jin Park2, Sun-Sook Paik3, Joo-ri Kim-Kaneyama4, Mi-Ryoung Song5, Amanda Leung6, Edward M Levine6, In-Beom Kim3, Yong Sook Goo2, Seung-Hee Lee1, Kyung Hwa Kang7, Jin Woo Kim1* 1Department of Biological Sciences, Korea Advanced Institute of Science and Technology (KAIST), Daejeon, South Korea; 2Department of Physiology, Chungbuk National University School of Medicine, Cheongju, South Korea; 3Department of Anatomy, College of Medicine, The Catholic University of Korea, Seoul, South Korea; 4Department of Biochemistry, Showa University School of Medicine, Tokyo, Japan; 5Department of Life Sciences, Gwangju Institute of Science and Technology (GIST), Gwangju, South Korea; 6Department of Ophthalmology and Visual Sciences, Vanderbilt University, Nashville, United States; 7KAIST Institute of BioCentury, Daejeon, South Korea Abstract The visual responses of vertebrates are sensitive to the overall composition of retinal interneurons including amacrine cells, which tune the activity of the retinal circuitry. The expression of Paired-homeobox 6 (PAX6) is regulated by multiple cis-DNA elements including the intronic a- *For correspondence: enhancer, which is active in GABAergic amacrine cell subsets. Here, we report that the [email protected] transforming growth factor ß1-induced transcript 1 protein (Tgfb1i1) interacts with the LIM domain transcription factors Lhx3 and Isl1 to inhibit the a-enhancer in the post-natal mouse retina. †These authors contributed Tgfb1i1-/- mice show elevated a-enhancer activity leading to overproduction of Pax6DPD isoform equally to this work that supports the GABAergic amacrine cell fate maintenance.
    [Show full text]
  • RET Inhibition in Novel Patient-Derived Models of RET Fusion
    © 2021. Published by The Company of Biologists Ltd | Disease Models & Mechanisms (2021) 14, dmm047779. doi:10.1242/dmm.047779 RESEARCH ARTICLE RET inhibition in novel patient-derived models of RET fusion- positive lung adenocarcinoma reveals a role for MYC upregulation Takuo Hayashi1,2,*,§§, Igor Odintsov1,2,§§, Roger S. Smith1,2,‡,§§, Kota Ishizawa2,§, Allan J. W. Liu3,4, Lukas Delasos3, Christopher Kurzatkowski1, Huichun Tai1,2, Eric Gladstone1,2, Morana Vojnic1,2, Shinji Kohsaka1,2,¶, Ken Suzawa1,**, Zebing Liu1,2,‡‡, Siddharth Kunte3, Marissa S. Mattar5, Inna Khodos6, Monika A. Davare6, Alexander Drilon3, Emily Cheng2, Elisa de Stanchina5, Marc Ladanyi1,2,¶¶,*** and Romel Somwar1,2,¶¶,*** ABSTRACT suppressed by treatment of cell lines with cabozantinib. MYC protein Multi-kinase RET inhibitors, such as cabozantinib and RXDX-105, are levels were rapidly depleted following cabozantinib treatment. Taken active in lung cancer patients with RET fusions; however, the overall together, our results demonstrate that cabozantinib is an effective response rates to these two drugs are unsatisfactory compared to other agent in preclinical models harboring RET rearrangements with three ′ targeted therapy paradigms. Moreover, these inhibitors may have different 5 fusion partners (CCDC6, KIF5B and TRIM33). Notably, we different efficacies against RET rearrangements depending on the identify MYC as a protein that is upregulated by RET expression and upstream fusion partner. A comprehensive preclinical analysis of downregulated by treatment with cabozantinib, opening up potentially the efficacy of RET inhibitors is lacking due to a paucity of disease new therapeutic avenues for the combinatorial targetin of RET fusion- models harboring RET rearrangements. Here, we generated two new driven lung cancers.
    [Show full text]