DOCSLIB.ORG

APL-The Language Debugging Capabilities, Entirely in APL Terms (No Core Symbol Denotes an APL Function Named' 'Compress," Dumps Or Other Machine-Related Details)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
APL-The Language Debugging Capabilities, Entirely in APL Terms (No Core Symbol Denotes an APL Function Named' 'Compress, DANIEL BROCKLEBANK APL - THE LANGUAGE Computer programming languages, once the specialized tools of a few technically trained peo­ p.le, are now fundamental to the education and activities of millions of people in many profes­ SIons, trades, and arts. The most widely known programming languages (Basic, Fortran, Pascal, etc.) have a strong commonality of concepts and symbols; as a collection, they determine our soci­ ety's general understanding of what programming languages are like. There are, however, several ~anguages of g~eat interest and quality that are strikingly different. One such language, which shares ItS acronym WIth the Applied Physics Laboratory, is APL (A Programming Language). A SHORT HISTORY OF APL it struggled through the 1970s. Its international con­ Over 20 years ago, Kenneth E. Iverson published tingent of enthusiasts was continuously hampered by a text with the rather unprepossessing title, A inefficient machine use, poor availability of suitable terminal hardware, and, as always, strong resistance Programming Language. I Dr. Iverson was of the opinion that neither conventional mathematical nota­ to a highly unconventional language. tions nor the emerging Fortran-like programming lan­ At the Applied Physics Laboratory, the APL lan­ guages were conducive to the fluent expression, guage and its practical use have been ongoing concerns publication, and discussion of algorithms-the many of the F. T. McClure Computing Center, whose staff alternative ideas and techniques for carrying out com­ has long been convinced of its value. Addressing the putation. His text presented a solution to this nota­ inefficiency problems, the Computing Center devel­ tion dilemma: a new formal language for writing clear, oped special APL systems software for the IBM concise computer programs. To demonstrate the val­ 360/91 computer. That software provided a dramatic ue of such a language, he used it to present a variety imp.rovement in the speed of APL language programs, of interesting, nontrivial algorithms (such as those for achIeved largely by the thorough use of the high-speed sorting lists of numbers or for "parsing" and analyz­ "vector" processing capabilities of the machine. APL ing statements written in other programming lan­ at APL was the fastest known implementation of the guages). language anywhere in the free world. The APL language, which is used extensively When the Computing Center was upgraded to the IBM 3033 processors, the speed of the 360/91 was par­ throughout the world today, 2 looks only remotely like the notation presented in Iverson's seminal text, tially sacrificed, but a new opportunity arose: to build although it does retain many of the fundamental con­ an APL system to handle very large applications (us­ cepts. The original notation could not be entered into ing virtual memory technology and bulk data handling techniques). Since its introduction in 1978 this a computer to be acted upon; it was confined to black­ 4 ' boards, pencil and paper, and the published literature. system has been used regularly by hundreds of Lab- Only through manual translation into Fortran or some oratory staff members for many purposes. other language could Iverson's notation actually Now, in 1984, APL is available for nearly every "come to life" in the real world of computing. computer in the marketplace. It is also a featured ser­ Through collaboration with others, most notably vice of numerous commercial time-sharing companies including one that specializes in up-to-date (hourly) Adin Falkoff, Dr. Iverson designed another APL 3 in~ that could be used in a practical way on time-shared ternational financial databases. Most significantly, interactive computer systems. By 1970, the APL lan­ APL is now available for personal computers,5 thus guage service was in use by thousands of people, in­ bringing it within reach of everyone. The inexorable cluding the research and design staff of IBM (whose trend toward more powerful, less expensive computers various System 360 computers hosted the APL ser­ is bringing APL out into the world it was designed for: vices), the staff of the NASA Goddard Space Flight the world of learning, intellectual satisfaction, human Center, and the financial planners of a number of ma­ productivity, timely right answers, and smooth integra­ jor corporations. The elegant yet practical APL won tion of computing and education. the praise of many of its users, just as it evoked stern criticism from the established data processing and aca­ A BRIEF LOOK AT THE APL LANGUAGE demic computing communities. APL is international in character. It uses symbols APL received only a modicum of software engineer­ instead of words borrowed from natural language (al­ ing support from the principal computer vendors as though some of the symbols are indeed derived from 280 Johns Hopkins APL Technical Digest the Greek alphabet). In this sense, APL is compara­ ble to traditional notations of mathematics. The sym­ bols require a special keyboard (Fig. 1) and display device for interacting with the computer. (Today, numerous manufacturers offer APL-equipped termi­ nals and personal computers.) Much of APL is familiar and reminds us of our fun­ damentallearnings in arithmetic and algebra. In fact, APL can be used very effectively as a "laboratory" Figure 1-Typical APL keyboard. for learning algebra. 6 When being taught French, American students often spend hours speaking the lan­ guage in a laboratory. When learning mathematics, APL functions are defined upon rectangular arrays however, there is usually no such laboratory in which of data, not just upon individual scalar values. A rec­ to experience and experiment with the concepts. When tangular array contains data arranged along zero or computers are introduced, ostensibly for that purpose, more axes or dimensions, not necessarily all having the the languages used (almost always Basic) have but a same length. A simple list of values is a rectangular weak relationship to the substance of the material be­ array with only one dimension (a vector); a square ma­ ing taught. APL offers an attractive, substantive al­ trix is a rectangular array with two equal dimensions. ternative. A typical financial report often contains tables of num­ Consider the familiarity of the following APL bers that can easily be recognized as rectangular ar­ symbols: rays. This characteristic results in what may be the + Addition single most important contribution of the language, Subtraction particularly in light of evolving supercomputer tech­ x Multiplication niques: those who "think in APL" 7 naturally think Division in terms of vector and array processing. Factorial APL achieves generality through the simplicity and uniformity of its rules (as contrasted with achieving < ::; = ~ >:;t. Comparisons Logical negation generality through exhaustive enumeration of features, /\ Logical AND (intersection) which is typical of computer paraphernalia). As a V Logical OR (union) strong source of generality, APL uses the concept of an operator, permitting one to build functions that are E Set membership I Absolute value variants of other functions. The I operator, for ex­ ample, can be used to create a summation function The Fortran-like languages use unfamiliar symbols out of the ordinary addition function. The resultant (such as * for multiply, I for divide, and .LT. for less summation function looks like + I and is read as "plus than). Instead of restricting his notation to the sym­ over. " We consider this to be highly general because bols available on the keypunch machines of the 1960s, it is simple and has many latent possibilities for which Iverson chose symbols that were and are used to teach traditional mathematics (and Fortran) has inconsistent arithmetic and that appear today on nearly every hand­ ad hoc notations. Consider these variations: held calculator. APL is rooted in the mathematical concept of func­ + 1 "plus over" Summation tion, and most of its capabilities are implemented as xl "times over" Product functions. The language is rich in interesting identi­ rl "max over" Maximum value ties involving many combinations of its intrinsic func­ LI "min over" Minimum value tions, and it is conducive to formal symbolic manip­ /\ 1 "and over" True for all ulation and proofs. v i "or over" True for any The familiar symbols in the previous list all imply the performance of the corresponding familiar func­ When applied to arrays, these reduction functions may tions. Other functions, familiar and otherwise, are be applied along any axis (i.e., down the columns or denoted by well-chosen, easily learned symbols. The across the rows). following are some examples: APL promotes human productivity by thoughtful­ ly automating most irrelevant aspects of the com­ r L Maximum and minimum puter's inner workings and by nearly eliminating the * Power need for declarative statements (DIMENSION, ® Logarithm DECLARE, etc.). Unless facing extreme limits, APL El Matrix inverse, matrix division users do not need to consider how numbers are o Circular, Pythagorean, trigono- represented internally (as binary, decimal, hexadeci­ metric mal, Boolean, byte, word, floating-point, etc.), nor ~ t Ascending and descending "sort" do they need to announce in advance the sizes, shapes, ~ Transpose about the diagonal or types of arrays. Furthermore, most APL implemen­ <P Reverse tations provide for convenient interactive testing and Volume 5, Number 3, 1984 281 D. Brocklebank - APL-The Language debugging capabilities, entirely in APL terms (no core symbol denotes an APL function named' 'compress," dumps or other machine-related details). which uses a list of 1's and O's (a Boolean vector) as its left argument to indicate which elements of its right APL AND EXPRESSIVE DIRECTNESS argument are to be kept (1) or deleted (0). For a broad class of problems, APL provides a very Now let us test function A, first by itself and then high dgreee of expressive directness. By this we mean in combination with function P: that the language is conducive to the fluent, rapid, and A 'A MAN, A PLAN, A CANAL, clear expression of many algorithms, ideas, and defi­ PANAMA.' nitions.
Load more

Recommended publications
  • Super Family
    Super Family (Chaim Freedman, Petah Tikvah, Israel, September 2008) Yehoash (Heibish/Gevush) Super, born c.1760, died before 1831 in Latvia. He married unknown. I. Shmuel Super, born 1781,1 died by 1855 in Lutzin (now Ludza), Latvia,2 occupation alcohol trader. Appears in a list from 1837 of tax litigants who were alcohol traders in Lutzin. (1) He married Brokha ?, born 1781 in Lutzin (now Ludza), Latvia,3 died before 1831 in Lutzin (now Ludza), Latvia.3 (2) He married Elka ?, born 1794.4 A. Payka Super, (daughter of Shmuel Super and Brokha ?) born 1796/1798 in Lutzin (now Ludza), Latvia,3 died 1859 in Lutzin (now Ludza), Latvia.5 She married Yaakov-Keifman (Kivka) Super, born 1798,6,3 (son of Sholom "Super" ?) died 1874 in Lutzin (now Ludza), Latvia.7 Yaakov-Keifman: Oral tradition related by his descendants claims that Koppel's surname was actually Weinstock and that he married into the Super family. The name change was claimed to have taken place to evade military service. But this story seems to be invalid as all census records for him and his sons use the name Super. 1. Moshe Super, born 1828 in Lutzin (now Ludza), Latvia.8 He married Sara Goda ?, born 1828.8 a. Bentsion Super, born 1851 in Lutzin (now Ludza), Latvia.9 He married Khana ?, born 1851.9 b. Payka Super, born 1854 in Lutzin (now Ludza), Latvia.10 c. Rassa Super, born 1857 in Lutzin (now Ludza), Latvia.11 d. Riva Super, born 1860 in Lutzin (now Ludza), Latvia.12 e. Mushke Super, born 1865 in Lutzin (now Ludza), Latvia.13 f.
    [Show full text]
  • An Array-Oriented Language with Static Rank Polymorphism
    An array-oriented language with static rank polymorphism Justin Slepak, Olin Shivers, and Panagiotis Manolios Northeastern University fjrslepak,shivers,[email protected] Abstract. The array-computational model pioneered by Iverson's lan- guages APL and J offers a simple and expressive solution to the \von Neumann bottleneck." It includes a form of rank, or dimensional, poly- morphism, which renders much of a program's control structure im- plicit by lifting base operators to higher-dimensional array structures. We present the first formal semantics for this model, along with the first static type system that captures the full power of the core language. The formal dynamic semantics of our core language, Remora, illuminates several of the murkier corners of the model. This allows us to resolve some of the model's ad hoc elements in more general, regular ways. Among these, we can generalise the model from SIMD to MIMD computations, by extending the semantics to permit functions to be lifted to higher- dimensional arrays in the same way as their arguments. Our static semantics, a dependent type system of carefully restricted power, is capable of describing array computations whose dimensions cannot be determined statically. The type-checking problem is decidable and the type system is accompanied by the usual soundness theorems. Our type system's principal contribution is that it serves to extract the implicit control structure that provides so much of the language's expres- sive power, making this structure explicitly apparent at compile time. 1 The Promise of Rank Polymorphism Behind every interesting programming language is an interesting model of com- putation.
    [Show full text]
  • BUGS Code for Item Response Theory
    JSS Journal of Statistical Software August 2010, Volume 36, Code Snippet 1. http://www.jstatsoft.org/ BUGS Code for Item Response Theory S. McKay Curtis University of Washington Abstract I present BUGS code to fit common models from item response theory (IRT), such as the two parameter logistic model, three parameter logisitic model, graded response model, generalized partial credit model, testlet model, and generalized testlet models. I demonstrate how the code in this article can easily be extended to fit more complicated IRT models, when the data at hand require a more sophisticated approach. Specifically, I describe modifications to the BUGS code that accommodate longitudinal item response data. Keywords: education, psychometrics, latent variable model, measurement model, Bayesian inference, Markov chain Monte Carlo, longitudinal data. 1. Introduction In this paper, I present BUGS (Gilks, Thomas, and Spiegelhalter 1994) code to fit several models from item response theory (IRT). Several different software packages are available for fitting IRT models. These programs include packages from Scientific Software International (du Toit 2003), such as PARSCALE (Muraki and Bock 2005), BILOG-MG (Zimowski, Mu- raki, Mislevy, and Bock 2005), MULTILOG (Thissen, Chen, and Bock 2003), and TESTFACT (Wood, Wilson, Gibbons, Schilling, Muraki, and Bock 2003). The Comprehensive R Archive Network (CRAN) task view \Psychometric Models and Methods" (Mair and Hatzinger 2010) contains a description of many different R packages that can be used to fit IRT models in the R computing environment (R Development Core Team 2010). Among these R packages are ltm (Rizopoulos 2006) and gpcm (Johnson 2007), which contain several functions to fit IRT models using marginal maximum likelihood methods, and eRm (Mair and Hatzinger 2007), which contains functions to fit several variations of the Rasch model (Fischer and Molenaar 1995).
    [Show full text]
  • Compendium of Technical White Papers
    COMPENDIUM OF TECHNICAL WHITE PAPERS Compendium of Technical White Papers from Kx Technical Whitepaper Contents Machine Learning 1. Machine Learning in kdb+: kNN classification and pattern recognition with q ................................ 2 2. An Introduction to Neural Networks with kdb+ .......................................................................... 16 Development Insight 3. Compression in kdb+ ................................................................................................................. 36 4. Kdb+ and Websockets ............................................................................................................... 52 5. C API for kdb+ ............................................................................................................................ 76 6. Efficient Use of Adverbs ........................................................................................................... 112 Optimization Techniques 7. Multi-threading in kdb+: Performance Optimizations and Use Cases ......................................... 134 8. Kdb+ tick Profiling for Throughput Optimization ....................................................................... 152 9. Columnar Database and Query Optimization ............................................................................ 166 Solutions 10. Multi-Partitioned kdb+ Databases: An Equity Options Case Study ............................................. 192 11. Surveillance Technologies to Effectively Monitor Algo and High Frequency Trading ..................
    [Show full text]
  • A Quick Reference to C Programming Language
    A Quick Reference to C Programming Language Structure of a C Program #include(stdio.h) /* include IO library */ #include... /* include other files */ #define.. /* define constants */ /* Declare global variables*/) (variable type)(variable list); /* Define program functions */ (type returned)(function name)(parameter list) (declaration of parameter types) { (declaration of local variables); (body of function code); } /* Define main function*/ main ((optional argc and argv arguments)) (optional declaration parameters) { (declaration of local variables); (body of main function code); } Comments Format: /*(body of comment) */ Example: /*This is a comment in C*/ Constant Declarations Format: #define(constant name)(constant value) Example: #define MAXIMUM 1000 Type Definitions Format: typedef(datatype)(symbolic name); Example: typedef int KILOGRAMS; Variables Declarations: Format: (variable type)(name 1)(name 2),...; Example: int firstnum, secondnum; char alpha; int firstarray[10]; int doublearray[2][5]; char firststring[1O]; Initializing: Format: (variable type)(name)=(value); Example: int firstnum=5; Assignments: Format: (name)=(value); Example: firstnum=5; Alpha='a'; Unions Declarations: Format: union(tag) {(type)(member name); (type)(member name); ... }(variable name); Example: union demotagname {int a; float b; }demovarname; Assignment: Format: (tag).(member name)=(value); demovarname.a=1; demovarname.b=4.6; Structures Declarations: Format: struct(tag) {(type)(variable); (type)(variable); ... }(variable list); Example: struct student {int
    [Show full text]
  • Lecture 2: Introduction to C Programming Language [email protected]
    CSCI-UA 201 Joanna Klukowska Lecture 2: Introduction to C Programming Language [email protected] Lecture 2: Introduction to C Programming Language Notes include some materials provided by Andrew Case, Jinyang Li, Mohamed Zahran, and the textbooks. Reading materials Chapters 1-6 in The C Programming Language, by B.W. Kernighan and Dennis M. Ritchie Section 1.2 and Aside on page 4 in Computer Systems, A Programmer’s Perspective by R.E. Bryant and D.R. O’Hallaron Contents 1 Intro to C and Unix/Linux 3 1.1 Why C?............................................................3 1.2 C vs. Java...........................................................3 1.3 Code Development Process (Not Only in C).........................................4 1.4 Basic Unix Commands....................................................4 2 First C Program and Stages of Compilation 6 2.1 Writing and running hello world in C.............................................6 2.2 Hello world line by line....................................................7 2.3 What really happens when we compile a program?.....................................8 3 Basics of C 9 3.1 Data types (primitive types)..................................................9 3.2 Using printf to print different data types.........................................9 3.3 Control flow.......................................................... 10 3.4 Functions........................................................... 11 3.5 Variable scope........................................................ 12 3.6 Header files.........................................................
    [Show full text]
  • APL Literature Review
    APL Literature Review Roy E. Lowrance February 22, 2009 Contents 1 Falkoff and Iverson-1968: APL1 3 2 IBM-1994: APL2 8 2.1 APL2 Highlights . 8 2.2 APL2 Primitive Functions . 12 2.3 APL2 Operators . 18 2.4 APL2 Concurrency Features . 19 3 Dyalog-2008: Dyalog APL 20 4 Iverson-1987: Iverson's Dictionary for APL 21 5 APL Implementations 21 5.1 Saal and Weiss-1975: Static Analysis of APL1 Programs . 21 5.2 Breed and Lathwell-1968: Implementation of the Original APLn360 25 5.3 Falkoff and Orth-1979: A BNF Grammar for APL1 . 26 5.4 Girardo and Rollin-1987: Parsing APL with Yacc . 27 5.5 Tavera and other-1987, 1998: IL . 27 5.6 Brown-1995: Rationale for APL2 Syntax . 29 5.7 Abrams-1970: An APL Machine . 30 5.8 Guibas and Wyatt-1978: Optimizing Interpretation . 31 5.9 Weiss and Saal-1981: APL Syntax Analysis . 32 5.10 Weigang-1985: STSC's APL Compiler . 33 5.11 Ching-1986: APL/370 Compiler . 33 5.12 Ching and other-1989: APL370 Prototype Compiler . 34 5.13 Driscoll and Orth-1986: Compile APL2 to FORTRAN . 35 5.14 Grelck-1999: Compile APL to Single Assignment C . 36 6 Imbed APL in Other Languages 36 6.1 Burchfield and Lipovaca-2002: APL Arrays in Java . 36 7 Extensions to APL 37 7.1 Brown and Others-2000: Object-Oriented APL . 37 1 8 APL on Parallel Computers 38 8.1 Willhoft-1991: Most APL2 Primitives Can Be Parallelized . 38 8.2 Bernecky-1993: APL Can Be Parallelized .
    [Show full text]
  • A Tutorial Introduction to the Language B
    A TUTORIAL INTRODUCTION TO THE LANGUAGE B B. W. Kernighan Bell Laboratories Murray Hill, New Jersey 1. Introduction B is a new computer language designed and implemented at Murray Hill. It runs and is actively supported and documented on the H6070 TSS system at Murray Hill. B is particularly suited for non-numeric computations, typified by system programming. These usually involve many complex logical decisions, computations on integers and fields of words, especially charac- ters and bit strings, and no floating point. B programs for such operations are substantially easier to write and understand than GMAP programs. The generated code is quite good. Implementation of simple TSS subsystems is an especially good use for B. B is reminiscent of BCPL [2] , for those who can remember. The original design and implementation are the work of K. L. Thompson and D. M. Ritchie; their original 6070 version has been substantially improved by S. C. Johnson, who also wrote the runtime library. This memo is a tutorial to make learning B as painless as possible. Most of the features of the language are mentioned in passing, but only the most important are stressed. Users who would like the full story should consult A User’s Reference to B on MH-TSS, by S. C. Johnson [1], which should be read for details any- way. We will assume that the user is familiar with the mysteries of TSS, such as creating files, text editing, and the like, and has programmed in some language before. Throughout, the symbolism (->n) implies that a topic will be expanded upon in section n of this manual.
    [Show full text]
  • Application and Interpretation
    Programming Languages: Application and Interpretation Shriram Krishnamurthi Brown University Copyright c 2003, Shriram Krishnamurthi This work is licensed under the Creative Commons Attribution-NonCommercial-ShareAlike 3.0 United States License. If you create a derivative work, please include the version information below in your attribution. This book is available free-of-cost from the author’s Web site. This version was generated on 2007-04-26. ii Preface The book is the textbook for the programming languages course at Brown University, which is taken pri- marily by third and fourth year undergraduates and beginning graduate (both MS and PhD) students. It seems very accessible to smart second year students too, and indeed those are some of my most successful students. The book has been used at over a dozen other universities as a primary or secondary text. The book’s material is worth one undergraduate course worth of credit. This book is the fruit of a vision for teaching programming languages by integrating the “two cultures” that have evolved in its pedagogy. One culture is based on interpreters, while the other emphasizes a survey of languages. Each approach has significant advantages but also huge drawbacks. The interpreter method writes programs to learn concepts, and has its heart the fundamental belief that by teaching the computer to execute a concept we more thoroughly learn it ourselves. While this reasoning is internally consistent, it fails to recognize that understanding definitions does not imply we understand consequences of those definitions. For instance, the difference between strict and lazy evaluation, or between static and dynamic scope, is only a few lines of interpreter code, but the consequences of these choices is enormous.
    [Show full text]
  • Command $Line; Done
    http://xkcd.com/208/ >0 TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG >1 TGCAGGTTGTTGTTACTCAGGTCCAGTTCTCTGAGACTGGAGGACTGGGAGCTGAGAACTGAGGACAGAGCTTCA >2 TGCAGGGCCGGTCCAAGGCTGCATGAGGCCTGGGGCAGAATCTGACCTAGGGGCCCCTCTTGCTGCTAAAACCAT >3 TGCAGGATCTGCTGCACCATTAACCAGACAGAAATGGCAGTTTTATACAAGTTATTATTCTAATTCAATAGCTGA >4 TGCAGGGGTCAAATACAGCTGTCAAAGCCAGACTTTGAGCACTGCTAGCTGGCTGCAACACCTGCACTTAACCTC cat seqs.fa PIPE grep ACGT TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG >1 TGCAGGTTGTTGTTACTCAGGTCCAGTTCTCTGAGACTGGAGGACTGGGAGCTGAGAACTGAGGACAGAGCTTCA >2 TGCAGGGCCGGTCCAAGGCTGCATGAGGCCTGGGGCAGAATCTGACCTAGGGGCCCCTCTTGCTGCTAAAACCAT >3 TGCAGGATCTGCTGCACCATTAACCAGACAGAAATGGCAGTTTTATACAAGTTATTATTCTAATTCAATAGCTGA >4 TGCAGGGGTCAAATACAGCTGTCAAAGCCAGACTTTGAGCACTGCTAGCTGGCTGCAACACCTGCACTTAACCTC cat seqs.fa Does PIPE “>0” grep ACGT contain “ACGT”? Yes? No? Output NULL >1 TGCAGGTTGTTGTTACTCAGGTCCAGTTCTCTGAGACTGGAGGACTGGGAGCTGAGAACTGAGGACAGAGCTTCA >2 TGCAGGGCCGGTCCAAGGCTGCATGAGGCCTGGGGCAGAATCTGACCTAGGGGCCCCTCTTGCTGCTAAAACCAT >3 TGCAGGATCTGCTGCACCATTAACCAGACAGAAATGGCAGTTTTATACAAGTTATTATTCTAATTCAATAGCTGA >4 TGCAGGGGTCAAATACAGCTGTCAAAGCCAGACTTTGAGCACTGCTAGCTGGCTGCAACACCTGCACTTAACCTC cat seqs.fa Does PIPE “TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTG...G” grep ACGT contain “ACGT”? Yes? No? Output NULL TGCAGGTTGTTGTTACTCAGGTCCAGTTCTCTGAGACTGGAGGACTGGGAGCTGAGAACTGAGGACAGAGCTTCA >2 TGCAGGGCCGGTCCAAGGCTGCATGAGGCCTGGGGCAGAATCTGACCTAGGGGCCCCTCTTGCTGCTAAAACCAT >3 TGCAGGATCTGCTGCACCATTAACCAGACAGAAATGGCAGTTTTATACAAGTTATTATTCTAATTCAATAGCTGA
    [Show full text]
  • The C Programming Language
    The C programming Language The C programming Language By Brian W. Kernighan and Dennis M. Ritchie. Published by Prentice-Hall in 1988 ISBN 0-13-110362-8 (paperback) ISBN 0-13-110370-9 Contents ● Preface ● Preface to the first edition ● Introduction 1. Chapter 1: A Tutorial Introduction 1. Getting Started 2. Variables and Arithmetic Expressions 3. The for statement 4. Symbolic Constants 5. Character Input and Output 1. File Copying 2. Character Counting 3. Line Counting 4. Word Counting 6. Arrays 7. Functions 8. Arguments - Call by Value 9. Character Arrays 10. External Variables and Scope 2. Chapter 2: Types, Operators and Expressions 1. Variable Names 2. Data Types and Sizes 3. Constants 4. Declarations http://freebooks.by.ru/view/CProgrammingLanguage/kandr.html (1 of 5) [5/15/2002 10:12:59 PM] The C programming Language 5. Arithmetic Operators 6. Relational and Logical Operators 7. Type Conversions 8. Increment and Decrement Operators 9. Bitwise Operators 10. Assignment Operators and Expressions 11. Conditional Expressions 12. Precedence and Order of Evaluation 3. Chapter 3: Control Flow 1. Statements and Blocks 2. If-Else 3. Else-If 4. Switch 5. Loops - While and For 6. Loops - Do-While 7. Break and Continue 8. Goto and labels 4. Chapter 4: Functions and Program Structure 1. Basics of Functions 2. Functions Returning Non-integers 3. External Variables 4. Scope Rules 5. Header Files 6. Static Variables 7. Register Variables 8. Block Structure 9. Initialization 10. Recursion 11. The C Preprocessor 1. File Inclusion 2. Macro Substitution 3. Conditional Inclusion 5. Chapter 5: Pointers and Arrays 1.
    [Show full text]
  • Kenneth E. Iverson
    Kenneth E. Iverson Born December 17, 1920, Camrose, Alberta, Canada; with Adin Falkoff, inventor and implementer of the programming language APL. Education: BA, mathematics, Queen's University at Kingston, Ont., 1950; MA, mathematics, Harvard University, 1951; PhD, applied mathematics, Harvard University, 1954. Professional Experience: assistant professor, Harvard University, 1955-1960; research division, IBM Corp., 1960-1980; I.P. Sharp Associates, 1980-1987. Honors and Awards: IBM Fellow, 1970; AFIPS Harry Goode Award, 1975; ACM Turing Award, 1979; IEEE Computer Pioneer Award, 1982; National Medal of Technology, 1991; member, National Academy of Engineering. Iverson has been one of those lucky individuals who has been able to start his career with a success and for over 35 years build on that success by adding to it, enhancing it, and seeing it develop into a successful commercial property. His book A Programming Language set the stage for a concept whose peculiar character set would have appeared to eliminate it from consideration for implementation on any computer. Adin Falkoff is credited by Iverson for picking the name APL for the programming language implementation, and the introduction of the IBM “golf-ball” typewriter, with the replacement typehead, which provided the character set to represent programs. The programming language became the language of enthusiasts (some would say fanatics) and the challenge of minimalists to contain as much processing as possible within one line of code. APL has outlived many other languages and its enthusiasts range from elementary school students to research scientists. BIBLIOGRAPHY Biographical Falkoff, Adin D., and Kenneth E. Iverson, “The Evolution of APL,” in Wexelblat, Richard L., ed., History of Programming Languages, Academic Press, New York, 1981, Chapter 14.
    [Show full text]