Mutations in the VPS45 Gene, a SEC1 Homologue, Result in Vacuolar Protein Sorting Defects and Accumulation of Membrane Vesicles

Journal of Cell Science 107, 3449-3459 (1994) 3449 Printed in Great Britain © The Company of Biologists Limited 1994

Mutations in the VPS45 gene, a SEC1 homologue, result in vacuolar protein sorting defects and accumulation of membrane vesicles

Christopher R. Cowles, Scott D. Emr* and Bruce F. Horazdovsky† Division of Cellular and Molecular Medicine & Howard Hughes Medical Institute, University of California, San Diego, School of Medicine, La Jolla, California 92093-0668, USA *Author for correspondence †Present address: Department of Biochemistry, University of Texas Southwestern Medical Center, Dallas, Texas 75235-9038, USA

SUMMARY

Genetic analyses of vacuolar protein sorting in Saccha- kDa protein in labeled yeast cell extracts. Subcellular frac- romyces cerevisiae have uncovered a large number of tionation studies demonstrate that the majority of Vps45p mutants (vps) that missort and secrete vacuolar hydrolases. is associated with a high-speed membrane pellet fraction A small subset of vps mutants exhibit a temperature-con- that includes Golgi, transport vesicles and, potentially, ditional growth phenotype and show a severe defect in the endosomal membranes. Signiﬁcantly, this fraction lacks localization of soluble vacuolar proteins, yet maintain a ER, vacuole and plasma membranes. Overexpression of near-normal vacuole structure. Here, we report on the Vps45p saturates the sites with which Vps45p associates. A cloning and characterization of the gene affected in one of vps45 null mutant accumulates vesicles, many of which these mutants, VPS45, which has been found to encode a were found to be present in large clusters. This accumula- member of a protein family that includes the yeast proteins tion of potential transport vesicles indicates that Vps45p Sec1p, Sly1p and Vps33p, as well as n-Sec1, UNC18 and may facilitate the targeting and/or fusion of these vesicles Rop from other eukaryotic organisms. These proteins are in the vacuolar protein sorting pathway. thought to participate in vesicle-mediated protein transport events. Polyclonal antiserum raised against a TrpE-Vps45 fusion protein speciﬁcally detects a stable 67 Key words: VPS45, SEC1, vacuole, protein sorting, transport vesicle

INTRODUCTION fragmented, while class C mutants lack any identifiable vacuole structures. Class D vps mutants are morphologically The localization of proteins to the lysosome-like vacuole of similar to class A strains but have a large, single vacuolar Saccharomyces cerevisiae is a complex process and involves structure and exhibit defects in mother-to-daughter cell several distinct targeting and delivery events. Like secreted vacuolar inheritance. Class E mutants contain a novel proteins, vacuolar proteins are first translocated into the endo- endosome-like compartment in addition to normal vacuoles, plasmic reticulum (ER), and subsequently transit to and and class F mutants contain a single large vacuole structure through the compartments of the Golgi complex (Stevens et that is encircled by smaller, fragmented vacuoles. Even though al., 1982). In a late Golgi compartment, vacuolar proteins are some vps mutants exhibit severe defects in vacuolar morphol- then actively sorted away from the secretory protein flow ogy, the vast majority of vps mutants (>75%) contain a normal (Graham and Emr, 1991) and delivered to the vacuole via a or near-normal vacuole structure (classes A, D, E and F). This prevacuolar endosome intermediate (Vida et al., 1993). In suggests that these mutants are competent to construct and order to identify the cellular machinery involved in Golgi-to- maintain a vacuole structure, yet have specific protein targeting vacuole protein sorting and delivery events, several mutant and sorting defects. Some of these defects may involve the dis- selection schemes have been designed that detect mislocaliza- ruption of specific vesicular trafficking events that are respon- tion of soluble vacuolar proenzymes (Bankaitis et al., 1986; sible for the delivery of distinct subsets of vacuolar proteins Rothman and Stevens, 1986; Robinson et al., 1988; Rothman from a late Golgi compartment to the vacuole. et al., 1989). Using these selection schemes, a large number of Analysis of protein movement through various stages of mutants have been identified that missort and secrete vacuolar both the secretory and vacuolar protein localization pathways proteins. Together, these vacuolar protein sorting (vps) mutants has uncovered a number of protein families that direct define greater than 40 complementation groups that have been common events (i.e., transport vesicle targeting and fusion) divided into six distinct morphological classes (Banta et al., at each stage of the transport process. One such family 1988; Raymond et al., 1992). Class A vps mutants display includes the yeast rab proteins Ypt1p, Vps21p and Sec4p. wild-type morphology: one to three large vacuole structures are These small GTP-binding proteins appear to be involved in present in each cell. The vacuoles of class B vps mutants are the targeting and/or fusion of vesicular transport intermedi-

3450 C. R. Cowles, S. D. Emr and B. F. Horazdovsky ates at distinct stages of the transport pathway. Ypt1p is Plasmid constructions involved in ER-to-Golgi vesicle movement (Goud et al., Recombinant DNA manipulations employed in the construction of 1988). Vps21p functions in the vacuolar protein sorting plasmids were performed as described previously (Maniatis et al., pathway (Golgi to vacuole; Horazdovsky et al., 1994), and 1989), with the exception of DNA fragment isolations carried out by Sec4p is required for delivery of secretory vesicles from the the glass bead method of Vogelstein and Gillespie (1979). The CEN- Golgi to the plasma membrane (Bruno et al., 1988). Another based plasmid pVPS45-10 was generated by inserting the SmaI-PvuII group of proteins, the Sec1 family, also appears to function fragment of library plasmid pVPS45-1 (containing VPS45, refer to in vesicle targeting or fusion. In yeast, the Sly1, Sec1 and Fig. 1A) into the SmaI site of pRS414 (Sikorski and Heiter, 1989). The same SmaI-PvuII fragment was also inserted into the SmaI site Vps33 (Slp1) proteins are required for protein delivery from of pRS424 (Sikorski and Heiter, 1989) to create the 2µ-based plasmid ER to Golgi, Golgi to plasma membrane, and Golgi to pVPS45-15. For sequence analysis, plasmid pVPS45-9 was con- vacuole, respectively (Novick et al., 1980; Banta et al., 1990; structed by inserting the ClaI-SacI fragment of pVPS45-10 (contain- Wada et al., 1990; Dascher et al., 1991). Distinct Sec1p ing the SmaI-PvuII fragment of pVPS45-1) into the ClaI and SacI sites family members also have been implicated to function in the of pBluescript KS (Stratagene). Generation of pVPS45-6 was vesicular trafficking events of other eukaryotes. In achieved by ligating the EcoRV-EcoRV fragment of pVPS45-1 into mammalian neuronal cells, n-Sec1 has been shown to interact the SmaI site of pBluescript KS. Plasmid pVPS45-5 was constructed with the plasma membrane protein syntaxin (Hata et al., 1993; by inserting the BglII-BglII segment of pVPS45-1 into the BamHI site Garcia et al., 1994; Pevsner et al., 1994). Syntaxin is thought of pBluescript KS. pVPS45-21 consisted of the EcoRV-HindIII to serve as one of the receptor molecules involved in the segment of pVPS45-1 inserted at the SmaI and HindIII sites of pBlue- docking of synaptic vesicles with the plasmalemma (Söllner script KS. Plasmids pVPS45-4 and pVPS45-7 were generated by introducing the BglII-PvuII or SmaI-BglII fragments of pVPS45-1, et al., 1993a,b). UNC18 has been proposed to serve a similar respectively, into the SmaI and BamHI sites of pRS414. The integra- function in Caenorhabditis elegans (Hosono et al., 1992; tive mapping plasmid, pVPS45-17, was constructed by inserting the Pelham, 1993). Though members of the Sec1 protein family ClaI-SacI fragment of pVPS45-10 into the ClaI and SacI sites of and the rab-like GTP-binding proteins clearly play critical pRS304 (Sikorski and Heiter, 1989). roles in vesicle-mediated protein trafficking, their exact An intermediate plasmid construction was performed in generating functions remain unclear. the vps45 deletion/disruption. Plasmid pVPS45-9 was digested with Here we report the characterization of one of the VPS gene EcoRV and BglII, removing a large portion of VPS45 (see Fig. 1A), products involved in delivery of proteins to the yeast vacuole. and the remainder of the vector sequences were isolated and purified. VPS45 encodes a 67 kDa homolog of Sec1p. Subcellular local- pHIS3 (from E. Phiziaky) was digested by XhoI, blunted by a Klenow ization of Vps45p suggests that it is peripherally associated fill-in reaction, and digested with BamHI. The resulting XhoI(blunt)- with cellular membranes (potentially including Golgi and BamHI fragment containing the HIS3 gene was isolated and ligated into the EcoRV and BglII sites of pVPS45-9 (lacking the VPS45 endosomal membranes, as well as membrane vesicles). vps45 coding sequences) to generate disruption plasmid pVPS45-19. In mutants missort multiple vacuolar hydrolases, are temperature order to construct a TrpE-Vps45 fusion protein, plasmid vector sensitive for growth, and exhibit a class D vacuole morphol- pATH2 (containing the trpE coding sequences; Dieckmann and ogy. Interestingly, vps45 deletion mutants accumulate what Tzagoloff, 1985) was digested with SmaI and HindIII. Plasmid appear to represent aggregates of intermediate transport pVPS45-9 was digested with EcoRV and HindIII, and the 626-base vesicles. No other characterized vps mutants have been shown fragment was purified and ligated into the SmaI and HindIII sites of to exhibit this phenotype. Our findings thus suggest a unique the pATH2 trpE expression vector to generate pVPS45-11. role for Vps45p in vesicle targeting and/or fusion in the vacuolar protein sorting pathway. Genetic and nucleic acid manipulations All standard yeast genetic procedures were adhered to as previously described (Miller, 1972; Sherman et al., 1979). Bacterial DNA transformations were performed using the protocols of Hanahan (1983). MATERIALS AND METHODS Yeast transformations followed a previously described alkali cation treatment protocol (Ito et al., 1983). Yeast strain CCY100 was Materials generated by integrating plasmid pBHY11 (CPY-invertase::LEU2) LB and M9 media supplemented with antibiotics and amino acids as (Horazdovsky et al., 1994) at the leu2-3,122 locus of BHY45-1. Inte- required (Miller, 1972) were used for propagation of Escherichia coli. grative mapping studies of the cloned VPS45 gene were carried out Yeast extract-peptone-dextrose (YPD), yeast extract-peptone-fructose by linearizing pVPS45-17 (VPS45, TRP1) at SphI and using the lin- (YPF) or synthetic dextrose (SD) was employed for growth of S. cere- earized plasmid to transform BHY11. Trp+ transformants (CCY101) visiae and supplemented as needed (Sherman et al., 1979). Boehringer were crossed with CCY100. Diploids were selected, sporulated, and − − Mannheim, New England Biolabs, or Stratagene restriction and 26 of the resulting asci were dissected. Trp+/Trp and Vps+/Vps seg- modifying enzymes were used in this study. Sequenase Version 2.0 regated 2:2. All Trp+ haploid segregants also showed the Vps+ was obtained from US Biochemical Corp. Zymolyase 100-T (Kirin phenotype. In order to generate vps45 chromosomal deletion mutant Brewery Co.) was purchased from Seikagaku Kogyo Co. (Tokyo, CCY120, plasmid pVPS45-19 was digested with ScaI and SphI, and Japan). Glusulase was received from the DuPont Co. 5-Bromo-4- the resultant fragment containing the vps45∆2::HIS3 construct was + chloro-3-indoyl-β-D-galactoside, phenylmethylsulfonyl fluoride, α2- used to transform SEY6210, SEY6211 or BHY10.5. His transfor- macroglobulin, aprotinin, leupeptin, pepstatin and isopropyl-β-D- mants of BHY10.5 were sporulated, and resultant asci were dissected. thiogalactopyranoside were from Boehringer Mannheim. Tran Genomic DNA from representative haploid segregants as well as from 35S-label was obtained from ICN Biochemicals, while [α-35S]dATP His+ SEY6210 and SEY6211 transformants was isolated and was purchased from Amersham Corp. Production of antisera to CPY, subjected to polymerase chain reaction with oligonucleotides CC451 ALP and PrA has been described previously (Klionsky et al., 1988; and CC452 (see below) to confirm the presence of the appropriate Klionsky and Emr, 1989). All other reagents were purchased from deletion/disruption (Herman and Emr, 1990). Sigma. The oligonucleotides CC451, 5′-GGGCGTCCGTAACGAG-3′,

vps45 mutants accumulate membrane vesicles 3451

Table 1. Strains used in this study Strain Genotype Reference or source S. cerevisiae SEY6210 MATα leu2-3,112 ura3-52 his3-∆200 trp1-∆901 lys2-801 suc2-∆9 Robinson et al. (1988) SEY6211 MATa leu2-3,112 ura3-52 his3-∆200 trp1-∆90 ade2-101 suc2-∆9 Robinson et al. (1988) BHY10.5 MATα/MATa leu2-3,112::pBHY11(CPY-Inv LEU2)/leu2-3,112::pBHY11(CPY-Inv Horazdovsky et al. (1994) LEU2) his3-∆200/his3-∆200ura3-52/ura3-52 trp1-∆901/trp1-∆901 suc2-∆9/suc2-∆9 ADE2/ade2-101 lys2-801/LYS2 BHY10 SEY6210; leu2-3,112::pBHY11(CPY-Inv LEU2) Horazdovsky et al. (1994) BHY11 SEY6211; leu2-3,112::pBHY11(CPY-Inv LEU2) Horazdovsky et al. (1994) BHY45-1 SEY6210; vps45-1 This study CCY100 BHY45-1; leu2-3,112::pBHY11(CPY-Inv LEU2) This study CCY101 BHY11; VPS45/VPS45-TRP1 This study CCY120 SEY6210; vps45∆2::HIS3 This study CCY123 SEY6211; vps45∆2::HIS3 This study CCY124 BHY10.5; vps45∆2::HIS3 This study E. coli JM101 ∆(lac-pro) supE thi-1 [F′ traD36 lacIq Z∆M15 proAB] Yanish-Perron et al. (1985) XL1-Blue supE44 thi-1 lac endA1 gyrA96 hsdR17 relA1 [F′ proAB lacIq Z∆M15 Tn10] Bullock et al. (1987)

and CC452, 5′-CGACTCCCCGTATCGG-3′, served as PCR primers plasmid, pVPS45-11. Fusion protein production was induced, and the in analyzing genomic DNA for the presence or absence of the vps45 hybrid protein was purified by the method of Kleid et al. (1981), as disruption construct. Oligonucleotides CC45ST, 5′-CCTTTTTGAT- modified by Herman and Emr (1990). Purified fusion protein was used GTGGC-3′, CCE5, 5′-CGTTTGATTTGCAACC-3′, CC2H, 5′- to immunize New Zealand White rabbits as previously described ATAGGCATTAAGCGG-3′, and Stratagene T3 and T7 primers were (Horazdovsky and Emr, 1993). Collected antiserum was screened and used for sequence analysis (see below). titrated by immunoprecipitation of labeled yeast cell extracts. Cloning and sequence analysis of VPS45 Cell labeling and immunoprecipitations BHY45-1 (vps45-1 leu2-3,112) cells carrying a plasmid encoding a Yeast cells were grown in SD supplemented with appropriate amino CPY-invertase fusion protein (pCYI50, URA3, CEN; Johnson et al., and Casamino acids (2%) to an A600 of 0.8; 5 A600 units of cells were 1987) were transformed with a plasmid-based yeast genomic DNA collected by centrifugation (2,000 g for 5 minutes) and suspended in library (LEU2, CEN; kindly provided by Philip Hieter). Ura+/Leu+ 1 ml of SD medium containing 1 mg/ml bovine serum albumin. Cells transformants were selected, replica-plated onto YPF medium, and were preincubated for 10 minutes at 30¡C, 50 µCi of Tran 35S-label incubated at 30¡C overnight. Vps+ colonies were identified using an was then added, and incubation was continued at 30¡C for 10 to 30 overlay assay designed to detect extracellular invertase activity minutes. When employed, a chase period (for the indicated duration) (Horazdovsky et al., 1994). Plasmids conferring the Vps+ phenotype was initiated by addition of methionine and cysteine to final concen- were isolated (pBHY45-1) and used to transform BHY45-1 to confirm trations of 5 mM and 1 mM, respectively, as well as yeast extract to complementing activity. Various portions of the genomic sequences 0.2%; 60 minute chases were further supplemented by addition of 650 contained in pBHY45-1 were subcloned into the plasmid shuttle µl of SD medium containing appropriate amino acids and glucose at vector pRS414 (Sikorski and Heiter, 1989) and tested for the ability a final concentration of 5%. The label-chase reactions were terminated to complement the vps45 mutant phenotype in order to determine the by addition of trichloroacetic acid (TCA) to a final concentration of minimum complementing DNA fragment shown in Fig. 1A. 10%, and the precipitated proteins were analyzed by immunoprecip- Exonuclease-mung bean nuclease deletions using pVPS45-9 were itation as described previously (Klionsky et al., 1988). performed according to the pBluescript manual supplied by Stratagene, except that nuclease digestion products were size-fractionated and CPY and PrA fractionations isolated from a 1% agarose preparative gel. Resultant nested deletion CPY and PrA fractionation experiments involved growth of yeast products and plasmids pVPS45-4, pVPS45-5, pVPS45-6, pVPS45-7, cells to an A600 of 0.8; 5 A600 units of cells were harvested by cen- pVPS45-9 and pVPS45-21 were denatured and purified over 2 ml trifugation (2,000 g for 5 minutes) and resuspended in 0.5 ml of YNB Sephacryl S-400 spun columns using the procedure described in the containing 1 mg/ml of bovine serum albumin, 100 µg/ml of α2- Pharmacia MinprepKit Plus manual. The resultant denatured single- macroglobulin. Cells were preincubated at 30¡C for 10 minutes; 100 stranded templates were hybridized to T3, T7, CC45ST, CCE5 or µCi of Tran 35S-label was added, and the cells were labeled for 10 CC2H primers and subjected to dideoxy chain termination sequence minutes at 30¡C. Chase was initiated by the addition of methionine, analysis (Sanger et al., 1977) using the Sequenase sequencing protocol cysteine and yeast extract to final concentrations of 5 mM, 1 mM and (US Biochemical Corp.). Protein sequences were aligned progres- 0.2%, respectively. Following a 30 minute chase period, an equal sively, employing the method of Feng and Doolittle (1990). volume of ice-cold spheroplast buffer (50 mM Tris-HCl, pH 7.5, 2 M sorbitol, 40 mM NaN3, 40 mM NaF, 20 mM dithiothreitol) was added, Electron microscopy analysis and the cultures were incubated on ice for 10 minutes. Then 9 µg of SEY6210 (VPS45) and CCY120 (vps45∆2) were grown in YPD zymolyase was added, and the cultures were incubated at 30¡C for 30 medium at 30¡C to an absorbance at 600 nm (A600) of 0.5; 50 A600 minutes. The cultures were then centrifuged at 13,000 g for 1 minute units of cells were harvested by centrifugation and fixed for 1 hour at to generate an intracellular (I) pellet fraction and an extracellular (E) 30¡C in 2 ml of 0.1 M sodium cacodylate, pH 6.8, 5 mM CaCl2, con- media fraction. The presence of CPY and PrA proteins in each taining 3% glutaraldehyde. Cells were embedded, stained and viewed fraction was determined by immunoprecipitation (Klionsky et al., as previously described (Banta et al., 1988). 1988; Robinson et al., 1988). Preparation of antiserum Subcellular fractionations Bacterial cells JM101 were transformed with a trpE-VPS45 gene fusion SEY6210 cells or CCY120 cells harboring plasmid pVPS45-15 were 3452 C. R. Cowles, S. D. Emr and B. F. Horazdovsky

Fig. 2. Nucleotide sequence of VPS45 and amino acid sequence A comparison of Vps45p with Sec1p homologues. (A) The nucleotide sequence and the deduced amino acid sequence of VPS45 are shown. SEHPEBXB Sp The sequence accession number for VPS45 is U11049. (B) Vps45p and the S. cerevisiae Sec1p homologues Sec1p (Aalto et al., 1991), Sly1p (Dascher et al., 1991) and Vps33p (Banta et al., 1990) were 0.5 kb aligned progressively (Feng and Doolittle, 1990). Regions of amino VPS45 acid identity are shown in black boxes. The putative leucine zipper motif of Vps45p is indicated by asterisks and a region of high SE E H B B Sp homology corresponding to residues 226 to 248 of Vps45p is boxed. SE B Sp minutes at 30¡C and chased for 30 minutes as described above. Spher- oplasts were harvested at 500 g and resuspended in ice-cold lysis buffer (50 mM Tris-HCl, 200 mM Sorbitol, 1 mM EDTA; Horaz- dovsky and Emr, 1993). The resultant cell suspension was Dounced HIS3 six times in an ice-cold tissue homogenizer, and then subjected to sequential centrifugation at 500 g (10 minutes), 13,000 g (10 minutes) and 100,000 g (60 minutes) as described previously (Horazdovsky and Emr, 1993). To determine the nature of Vps45p-P100 association, B WT equal samples of the cleared lysate (500 g supernatant) were adjusted to 2 M urea, 1% Triton X-100, 1 M NaCl, or were left untreated. All vps45∆2 samples were incubated on ice for 10 minutes, then subjected to a vps45∆2 100,000 g centrifugation for 1 hour. The level of Vps45p, ALP, VPS45 glucose-6-phosphate dehydrogenase, Kex2p or PM ATPase in each fraction was determined by immunoprecipitation as previously described (Horazdovsky and Emr, 1993).

RESULTS

25ûC Cloning and sequencing of the VPS45 gene vps45 mutants were isolated using a hybrid-protein-based WT selection scheme (Bankaitis et al., 1986; Robinson et al., 1988). The hybrid protein consisted of a N-terminal portion of vps45∆2 vacuolar proteinase A (PrA) fused to the normally secreted vps45∆2 enzyme invertase. In wild-type cells, the vacuolar protein VPS45 sorting signal in the PrA portion of the fusion protein directed it to the vacuole (PrA-Inv 137) (Klionsky et al., 1988). Using a yeast strain deleted for the SUC2 gene encoding endogenous invertase (SEY6210), vps mutants that missort and secrete the PrA-invertase hybrid were selected on the basis of their ability to utilize sucrose, an invertase substrate, as their sole carbon 38ûC source. This approach identified many spontaneous vps mutant strains, including vps45. One vps45 mutant allele, vps45-1, Fig. 1. Characterization and disruption of the VPS45 locus. (A) A exhibited a temperature-conditional (ts) growth phenotype, restriction map of the genomic DNA fragment containing the 3.5 kb which was employed to clone the wild-type gene affected in SmaI-PvuII complementing fragment. The VPS45 coding sequence is this mutant. BHY45-1 (vps45-1) cells were transformed with represented by the black arrow; S, SmaI; E, EcoRV; H, HindIII; B, a YEp24 (URA3, 2µ)-based genomic library (Carlson and BglII; Sp, SphI; X, XhoI and P, PvuII. The 1.6 kb EcoRV-BglII + fragment containing VPS45 sequence was replaced by the HIS3 gene Botstein, 1982). Approximately 16,000 of the resultant Ura (open arrow) to generate the deletion/disruption strain CCY120 transformants were replica-plated and grown at 38¡C. Seven + (vps45∆2). (B) Growth phenotypes of wild-type cells (SEY6210, of the Ura transformants grew at the elevated temperature. WT), cells carrying the vps45 null mutation (vps45∆2, CCY120), or The genomic library plasmid from one of these transformants vps45∆2 cells containing the complementing plasmid pVPS45-10 was isolated, amplified in E. coli, and used to retransform (VPS45) on YPD plates are shown following three days of BHY45-1. The plasmid was found to confer temperature resis- incubation at either 25 or 38°C. No significant difference in growth tance to the transformants, and restriction enzyme mapping rates was observed between 25 and 30ûC for all strains shown. revealed that the complementing library plasmid contained an approximately 7 kb genomic DNA insert. The complementing activity was further refined and found to be contained on a 3.5 grown at 30¡C to an A600 of 0.8 in SD supplemented with appropriate amino acids and Casamino acids (2%). Cells were collected by kb genomic DNA fragment (Fig. 1A) that was capable of com- centrifugation (2,000 g for 5 minutes), and spheroplasts were plementing both the vps45-1 ts growth phenotype as well as generated as previously described (Vida et al., 1990). Spheroplasts the vacuolar protein sorting defect when present on the low were incubated for 10 minutes at 30¡C prior to addition of 30 µCi of copy plasmid pVPS45-10 (see below). Integrative mapping 35 Tran S-label per A600 unit of cells. Spheroplasts were labeled for 30 studies were used to demonstrate that the cloned genomic

vps45 mutants accumulate membrane vesicles 3453 A CCCGGGCGTCCGTAACG 17 AGTACTGACTGTATGGCGAAAAGTTGCCAGAAATGTTCATTTTTGTTTCTGCCAATTTCAGGAAAGGGTAACGTCATTACAGTTAGTTAACGTTCGAACTTACTTATA 125 GAAGTGCCTTGGCTCATATGCAATGTACCCAGAGTAACATTAAGGAGTGAAGAGGTACAGTGACTTGGTTTTGAGTTAAGGCCATCTTTTACTGTATAGAACAAAGAA 233 ATGAACCTTTTTGATGTGGCTGACTTTTATATAAACAAAATTGTGACTTCCCAATCGAAATTGAGCGTAGCCAATGTCAATGAACACCAAAGGATTAAGGTTTTGCTG 341 1 M N L F D V A D F Y I N K I V T S Q S K L S V A N V N E H Q R I K V L L TTGGATAAGAATACCACACCTACGATATCCTTATGTGCCACTCAAAGTGAGTTGTTGAAGCATGAAATATATCTGGTAGAAAGAATAGAAAATGAGCAACGTGAAGTG 449 37 L D K N T T P T I S L C A T Q S E L L K H E I Y L V E R I E N E Q R E V TCCAGGCATTTAAGGTGCTTAGTTTACGTTAAACCCACAGAGGAAACACTGCAACATCTGCTGCGTGAGTTAAGAAATCCTCGGTACGGCGAGTATCAAATATTCTTT 557 73 S R H L R C L V Y V K P T E E T L Q H L L R E L R N P R Y G E Y Q I F F AGTAATATTGTCTCTAAATCTCAATTAGAACGGCTAGCTGAATCTGACGACTTGGAAGCTGTTACTAAGGTGGAAGAAATATTCCAAGACTTTTTTATATTAAACCAA 665 109 S N I V S K S Q L E R L A E S D D L E A V T K V E E I F Q D F F I L N Q GATTTATTTTCGTTTGATTTGCAACCAAGAGAATTTTTAAGTAATAAATTGGTTTGGAGCGAAGGGGGGCTAACAAAATGTACCAACAGCTTAGTTTCTGTGCTTTTA 773 145 D L F S F D L Q P R E F L S N K L V W S E G G L T K C T N S L V S V L L TCCTTAAAGATAAAACCAGATATCAGGTATGAAGGAGCAAGTAAAATTTGTGAAAGATTGGCTAAAGAAGTTTCCTATGAGATTGGTAAAAACGAAAGAACTTTTTTT 881 181 S L K I K P D I R Y E G A S K I C E R L A K E V S Y E I G K N E R T F F GATTTTCCTGTGATGGATTCGACACCTGTGTTACTAATTTTAGATCGTAATACTGATCCTATAACACCTTTACTTCAACCTTGGACCTACCAATCAATGATCAATGAG 989 217 D F P V M D S T P V L L I L D R N T D P I T P L L Q P W T Y Q S M I N E TATATAGGCATTAAGCGGAATATAGTTGATTTATCGAAAGTGCCTAGAATTGATAAAGACCTGGAGAAGGTCACCTTATCATCAAAGCAAGATGCTTTCTTCAGGGAT 1097 253 Y I G I K R N I V D L S K V P R I D K D L E K V T L S S K Q D A F F R D ACCATGTATTTGAATTTTGGTGAATTGGGTGATAAAGTAAAACAATATGTGACTACATACAAAGACAAGACACAAACCAACAGCCAAATAAATTCCATTGAGGATATT 1205 289 T M Y L N F G E L G D K V K Q Y V T T Y K D K T Q T N S Q I N S I E D I AAAAACTTTATTGAGAAGTATCCAGAGTTTAGAAAATTATCTGGAAATGTTGCAAAGCATATGGCTATAGTGGGGGAATTAGACAGACAGTTGAAGATAAAAAATATA 1313 325 K N F I E K Y P E F R K L S G N V A K H M A I V G E L D R Q L K I K N I TGGGAAATTAGTGAAATAGAACAAAATCTATCAGCACACGATGCCAATGAAGAAGATTTCTCCGATTTGATTAAATTGCTACAAAATGAAGCAGTTGATAAGTATTAC 1421 361 W E I S E I E Q N L S A H D A N E E D F S D L I K L L Q N E A V D K Y Y AAGTTAAAGCTTGCATGTATTTATTCTTTAAACAATCAAACCAGCTCAGACAAAATCCGTCAACTAGTTGAGATTCTGTCTCAACAACTTCCTCCAGAGGACGTCAAC 1529 397 K L K L A C I Y S L N N Q T S S D K I R Q L V E I L S Q Q L P P E D V N TTTTTCCATAAATTTAAATCGCTTTTTAGCCGCCAGGATAAAATGACTCAAAGTAACCATGACAAGGACGATATATTAACCGAACTAGCAAGAAGATTTAATAGTAGA 1637 433 F F H K F K S L F S R Q D K M T Q S N H D K D D I L T E L A R R F N S R ATGAATTCTAAGAGCAACACCGCTGAAAACGTCTATATGCAACATATTCCGGAAATTTCGTCATTACTAACAGATCTCTCTAAAAATGCGTTATTCAGGGATCGTTTC 1745 469 M N S K S N T A E N V Y M Q H I P E I S S L L T D L S K N A L F R D R F AAAGAAATAGATACTCAAGGCCATAGAGTGATCGGAAACCAGCAGAGCAAAGATATTCCTCAGGATGTAATATTGTTTGTTATTGGCGGTGTAACTTATGAGGAGGCA 1853 505 K E I D T Q G H R V I G N Q Q S K D I P Q D V I L F V I G G V T Y E E A AGGCTAGTCCATGATTTCAATGGAACGATGAATAACAGAATGAGGGTGGTTTTAGGAGGCACCTCTATACTTTCAACTAAAGAATATATGGATTCTATTAGATCTGCA 1961 541 R L V H D F N G T M N N R M R V V L G G T S I L S T K E Y M D S I R S A AAATAAATAAGGATTATCTTATTCTAAAATTCTATTTTATATATGAGGCATAAATCTATATAACTTTTTCGATGCAGATAAAACATTTTACTATTGCCAAGCGAAATT 2069 577 K * (577) AGGTTCTCATTTTCTTCATTCGGTGCCTAATAATTGCAACTTTGTTCGGTGATCCTTCTATGTGCATGCGTCATAATAACTTAACTGGAAAAAACTTTCTCAACTTAC 2177 GACAAAAAACTCCGATACGGGGAGTCGAACCCCGGTCTCCACGGTGAAAGCGTGATGTGATAGCCGTTACACTATATCGGACAATAATTGTTGGAAATTCATTACAAA 2285 GGTAAATTACTATATGGAAACTTTAC 2311 B 3454 C. R. Cowles, S. D. Emr and B. F. Horazdovsky fragment corresponded to the VPS45 locus (see Materials and vps45∆2 Methods). A VPS45 vps45∆2 Within the 3.5 kb VPS45 complementing fragment, a single VPS45 large open reading frame was identified and predicted to code IE I E I E for a protein of 67,012 Da (Fig. 2A). Hydropathy analysis (Kyte and Doolittle, 1982) predicted the gene product to be p2CPY largely hydrophilic and to lack hydrophobic N-terminal signal mCPY sequences and potential transmembrane domains. One predicted structure found within the open reading frame was a putative leucine zipper motif, composed of four leucine 1 2 3 4 5 6 residues spaced at seven-residue intervals (Fig. 2B). Compar- ison of the deduced Vps45p amino acid sequence with known VPS45 vps45∆2 proteins currently available in the EMBL and GenBank data B bases also revealed a similarity between Vps45p and the Sec1 IE I E protein family; members of this family are thought to be involved in vesicle targeting and/or fusion events (Novick et proPrA al., 1980; Ossig et al., 1991; Gengyo-Ando et al., 1993; Hata mPrA et al., 1993; Pelham, 1993; Garcia et al., 1994; Pevsner et al., 1994). Progressive alignments (Feng and Doolittle, 1990) of the Vps45p sequence with several members of the Sec1 protein 1 2 3 4 family were performed, and Vps45p was found to share the Fig. 3. Intracellular sorting of vacuolar hydrolases. Wild-type cells greatest sequence identity with the S. cerevisiae Sly1, Sec1 and ∆ Vps33 proteins of the Sec1 family (Fig. 2B) (Banta et al., 1990; (VPS45, SEY6210), cells containing the vps45 null allele (vps45 2, CCY120) and CCY120 transformed with the complementing Wada et al., 1990; Aalto et al., 1991; Dascher et al., 1991). All plasmid pVPS45-10 (vps45∆2/VPS45) were labeled for 10 minutes members of this group share low but significant levels of at 30¡C with Tran 35S-label, chased for 30 minutes at 30¡C, then sequence identity. Notably, a region of 50% or greater identity converted to spheroplasts. The labeled cultures were separated into among these four gene products is observed within the span of spheroplast (internal, I) and media (external, E) fractions. The Vps45p amino acid residues 226-248 (Fig. 2B, boxed region). presence of (A) CPY and (B) PrA in these fractions was determined The role this sequence plays in Vps45p function is not yet by immunoprecipitation. The migration positions of Golgi-modified known. A portion of the previously identified SOE1 coding precursors (p2CPY, proPrA) and mature (mCPY, mPrA) proteins are sequence (Su et al., 1990) was also discovered adjacent to the shown. VPS45 open reading frame, localizing the VPS45 gene to chromosome VII. These core oligosaccharides are then extended by the addition Disruption of the VPS45 gene of mannose residues in subsequent Golgi compartments. This To determine the phenotypic consequences resulting from loss leads to an easily identifiable Golgi-modified protein precursor. of VPS45 gene product function, a vps45 deletion/disruption In the case of carboxypeptidase Y (CPY), this precursor is allele was constructed. The EcoRV-BglII fragment of VPS45 referred to as p2CPY (69 kDa); and in the case of PrA, proPrA was replaced with a DNA fragment containing the HIS3 gene (48 kDa). In wild-type cells, when these proteins reach the (Fig. 1A). The DNA segment containing the deletion/disrup- vacuole, the pro segments of p2CPY and proPrA are removed, tion construct was then used to transform a wild-type diploid resulting in the mature vacuolar forms of the enzymes, mCPY strain (BHY10.5). His+ diploid transformants were selected and mPrA (61 kDa and 42 kDa, respectively). We examined and sporulated. All spores were viable, indicating that VPS45 the vacuolar protein sorting capacity of wild-type (SEY6210), was not essential for growth. In addition, analysis of the vps45∆2 and vps45∆2 cells carrying the cloned VPS45 gene. resultant tetrads showed that His+/His− and Vps+/Vps− pheno- Cells were labeled for 10 minutes with Tran 35S-label types segregated 2:2, with all His+ segregants being Vps−. ([35S]methionine and [35S]cysteine) and then chased for 30 However, strains carrying the vps45 null mutation did exhibit minutes by the addition of unlabeled methionine and cysteine. a temperature-conditional growth defect. Unlike wild-type The pulse-labeled cells were treated with zymolyase to remove cells, ∆vps45 cells were unable to grow at 38¡C (Fig. 1B). This their cell walls, and the resultant spheroplasts were separated temperature-conditional phenotype was completely comple- from the culture medium by centrifugation. The presence of mented by the presence of the cloned VPS45 gene on a low CPY and PrA in the spheroplast pellet (I, internal) and media copy plasmid vector (Fig. 1B). These results indicated that (E, external) fractions was determined by immunoprecipita- while Vps45p was not required for vegetative growth at per- tion. As expected, wild-type (VPS45) cells properly delivered missive temperatures (25¡C), Vps45p was required for growth CPY and PrA to the vacuole as evidenced by the presence of at elevated temperatures. Presumably vacuole functions com- these proteins in the internal cell fractions as their mature promised in the vps45 mutant were essential for growth at vacuolar forms (mCPY and mPrA; Fig. 3A,B, lane 1). vps45∆2 38ûC. cells transformed with pVPS45-10 (VPS45) also completely Vacuolar proteins undergo compartmental-specific modifi- matured CPY (Fig. 3A, lane 5). In contrast, the vast majority cation as they transit through the secretory pathway en route of CPY and PrA were found as their Golgi-modified precursor to the vacuole (Stevens et al., 1982). Many vacuolar proteins forms (p2CPY, proPrA) in vps45∆2 cells. Approximately 85% are modified by core oligosaccharides when they enter the ER. of the p2CPY was secreted from these cells (Fig. 3A, lane 4). vps45 mutants accumulate membrane vesicles 3455

Fig. 4. Morphology of the vps45∆2 mutant strain. Wild-type cells (A, SEY6210) or cells containing the vps45 null allele (B and C, CCY120) were prepared for electron microscopic analysis. In A, n identiﬁes the nucleus; v, vacuole. Bars in A and B, 0.5 µm. The broken line box region in B is enlarged in C to show a cluster of 40- 50 nm membrane vesicles. Bar in C, 0.1 µm.

shown). These results indicated that Vps45p function is required for the delivery of soluble vacuolar proteins (CPY and PrA). Vesicular structures are accumulated in vps45∆2 cells The effect of deleting VPS45 on vacuole morphology and other cellular structures was analyzed using both light and electron microscopy. Vacuole morphology was first analyzed in cells grown at 30¡C using the fluorescent vacuole-specific vital stain 5(6)-carboxy-2′,7′-dichlorofluorescein diacetate (CDCFDA). In contrast to wild-type cells, that contained two to five vacuole structures per cell, the vast majority of vps45∆2 cells contained a single large vacuole structure (data not shown). Many of the vps45∆2 cells also accumulated CDCFDA in much smaller structures (~10 per cell) found throughout the cytoplasm (data not shown). Approximately 60% of newly formed buds in vps45∆2 cells contained a vacuole compartment. This was in contrast with budded wild-type cells, where greater than 90% of the buds contained a vacuole compartment. These observa- tions are consistent with the previous assignment of vps45 mutants to the class D mutant class (Raymond et al., 1992). Examination of vps45∆2 mutant cells by electron microscopy uncovered a number of alterations in subcellular structure. Most noticeably, in 5 to 10% of random vps45∆2 cell sections, large clusters of 40-50 nm vesicles were observed (Fig. 4B,C; if vesicle clusters are assumed to be spherical and of uniform size, we would anticipate that 40-60% of cells in the vps45∆2 population possessed a vesicle cluster). The vesicles contained within these clusters were evenly spaced at approximately 20 nm and the majority of the clusters themselves were found adjacent to the vacuole. Such vesicle clusters were not observed in wild-type cells (Fig. 4A) nor in other class D vps mutants (e.g. vps21, data not shown). In addition, vps45∆2 cells were seen to accumulate 40-50 nm membrane vesicles in cell sections lacking observable clusters. These single vesicles were quantitated and found to be present at levels approximately four-fold higher than those observed in wild-type cells (based on comparison of the number of vesicles/µm2 of cytosol in greater than 100 cell sections for both mutant and wild-type cells).

Identiﬁcation and subcellular localization of Vps45p A TrpE-Vps45 fusion protein (containing Vps45p residues 187 to 398, see Fig. 2A) was used to raise polyclonal antiserum that recognized Vps45p. Using this antiserum in immunoprecipitation experiments, a single protein migrating with an apparent molecular mass of 67 kDa was detected in labeled wild-type yeast cell extracts (SEY6210; WT, Fig. 5, lane 2). The mass of this protein species was in good agreement with the ProPrA was also secreted from vps45∆2 cells, although a sig- predicted mass of Vps45p, based on the sequence analysis. niﬁcant portion (65%) was retained inside the cells as well This protein was not detected in cells lacking the VPS45 coding (Fig. 3B, lanes 3 and 4). This retained proPrA did not mature sequence (vps45∆2; ∆, Fig. 5, lane 1) nor was Vps45p detected when chase times were extended to 90 minutes (data not in labeled wild-type cell extracts when preimmune serum was 3456 C. R. Cowles, S. D. Emr and B. F. Horazdovsky

∆ WT 2µ45 Table 2. Subcellular distribution of Vps45p and marker proteins

Chase: 0' 0' 60' 0' 60' Protein P13 S100 P100 Vps45p 10* 25 65 (single copy) Vps45p 5 90 5 (multi-copy) Alkaline phosphatase 80 15 5 (vacuole membrane) PM ATPase 80 10 10 (plasma membrane) Vps45p 67 kDa Kex2p 5 15 80 (Golgi membrane) Glucose-6-P dehydrogenase 0 100 0 (cytosol)

*Values are percentages.

ing a supernatant (S13) and pellet (P13) fraction. The S13 was then centrifuged at 100,000 g to generate a second set of supernatant (S100) and pellet (P100) fractions. The presence of Vps45p as well as organelle marker proteins in each of these fractions was determined by immunoprecipitation. The 1 2 3 4 5 majority of Vps45p (65%) was found in the high-speed pellet (P100) and thus cofractionated with the Golgi membrane Fig. 5. Immunoprecipitation of the VPS45 gene product. Wild-type marker Kex2p (Table 2). While this result suggested that cells (WT; SEY6210, lanes 2 and 3), cells containing the vps45 null Vps45p may directly associate with Golgi membranes, we allele (∆; CCY120, lane 1), or CCY120 carrying the 2µ expression plasmid pVPS45-15 (2µ45; lanes 4 and 5) were labeled for 10 cannot rule out the possibility that Vps45p may also associate minutes with Tran 35S-label at 30¡C. Labeling was terminated by with an endosomal compartment or intermediate vacuolar addition of TCA (10%; lanes 1, 2 and 4) or a 60 minute chase period transport vesicles, as no markers for these structures are yet at 30¡C was included prior to TCA precipitation (lanes 3 and 5). The available. In addition, a portion of Vps45p was found in a S100 TCA-precipitated proteins were processed for immunoprecipitation (Fig. 6A, lane 3; Table 2) fraction; and a small amount of using Vps45p antiserum, and the antigen-antibody complexes were Vps45p was associated with the dense membrane fraction, P13 resolved by SDS-PAGE and fluorography. The size of Vps45p was (Fig. 6A, lane 2; Table 2). Markers for the vacuole, ER, plasma determined by comparison to molecular mass standards. The amount membrane, and mitochondria are enriched in this P13 fraction of material loaded in lanes 4 and 5 represents one-fifth of that of the (Table 2) (Marcusson et al., 1994). Twentyfold overexpression material loaded in lanes 1-3; additionally, the exposure time for lanes of Vps45p resulted in a markedly different subcellular frac- 4 and 5 was approximately one-half of that for lanes 1-3. tionation pattern of Vps45p: the vast majority of overexpressed Vps45p was found in a S100 fraction (Table 2). This result was in contrast to the predominant localization of wild-type levels used (data not shown). Vps45p also appeared to be stable for of Vps45p in a P100 fraction and suggested that overexpres- at least 60 minutes, as no loss of Vps45p signal was detected sion of Vps45p saturates an interaction site located in the P100 after a 60 minute chase period in wild-type cells (Fig. 5, lane fraction. 3). In addition, when present on a multicopy plasmid To determine the nature of the association of Vps45p with (2µVPS45), Vps45p was stably expressed at levels approxi- these particulate cell fractions, cleared labeled cell lysates were mately 20-fold higher than those seen in cells containing a treated with a number of reagents prior to centrifugation at single copy of VPS45 (2µ45; Fig. 5, lanes 4 and 5; the amount 100,000 g. When the lysate was pretreated with detergent (1% of material and exposure time of the panel containing lanes 4 Triton) or 2 M urea, Vps45p was released into a soluble cell and 5 are one-fifth and one-half those of the panel containing fraction (Fig. 6B, lanes 3-6). In contrast, when cell lysates were lanes 1-3, respectively). In wild-type cells, the expression level treated with 1 M NaCl, the fractionation pattern of Vps45p was of Vps45p was approximately one-tenth that observed for unchanged, with 70% of Vps45p pelleting in a P100 fraction CPY, suggesting a Vps45p abundance of ~0.01% of total cell (Fig. 6B, lanes 7 and 8). This result suggested that Vps45p is protein. peripherally associated with a membrane, possibly via Subcellular fractionation was performed to help determine hydrophobic (salt-stable) protein-protein interactions. the intracellular location of Vps45p. Spheroplasts generated from wild-type cells were labeled with Tran 35S-label for 30 minutes, chased for 30 minutes, lysed, and the spheroplast DISCUSSION lysate was subjected to a set of sequential centrifugations. Following a 500 g centrifugation to remove unlysed sphero- Vps45p is required for the efficient sorting of proteins to the plasts, the cleared lysate was centrifuged at 13,000 g, generat- yeast vacuole. Cells that lack the VPS45 gene product missort vps45 mutants accumulate membrane vesicles 3457

synaptic vesicle VAMP/synaptobrevin v-SNAREs (Trimble et A al., 1988; Baumert et al., 1989) and the plasma membrane S13 P13 S100 P100 syntaxin (Bennett et al., 1992) and SNAP-25 (Oyler et al., 1989) t-SNAREs. VAMP has been shown to interact specifically with syntaxin (Calakos et al., 1994), in a complex that Vps45p also includes SNAP-25 (Söllner et al., 1993a). It is thought that this recognition event docks synaptic vesicles at the plasma membrane. Following docking, the vesicles fuse with the plasma membrane, releasing their contents. Synaptic vesicle 1 2 3 4 recognition and fusion appear to be regulated (Bennett and Scheller, 1993), and one candidate regulator of this process is a member of the Sec1 protein family, n-Sec1. Recent studies B have shown that n-Sec1 from mammalian neuronal cells No 1% 2M 1M specifically interacts with syntaxin (Hata et al., 1993; Garcia Wash Triton Urea NaCl et al., 1994; Pevsner et al., 1994), and it has been proposed that S P S P S P S P n-Sec1 might function to regulate formation of the vesicle docking complex (Pevsner et al., 1994). In yeast, sec1 ts mutant cells accumulate 100 nm Golgi-derived secretory vesicles, suggesting a role for Sec1p in targeting and/or fusion Vps45p of secretory vesicles with the plasma membrane (Novick et al., 1980). Interestingly, two multicopy suppressors of a sec1 ts mutant (SSO1 and SSO2) have been identified, and their predicted gene products share significant sequence homology 1 2 3 4 5 6 7 8 with mammalian syntaxin (Aalto et al., 1993). These observa- tions indicate that, like n-Sec1 in mammalian cells, yeast Sec1p may be interacting with Sso1p and Sso2p to facilitate vesicle Fig. 6. Subcellular fractionation of the VPS45 gene product. docking at the plasma membrane. In addition to Vps45p, other (A) Wild-type cells were converted to spheroplasts, labeled with Tran 35S-label for 30 minutes, and chased for 30 minutes. The yeast Sec1p family members include Sly1p and Vps33p. Sly1p spheroplasts were lysed, and the lysate was cleared of unbroken has been implicated in targeting and/or fusion of ER-derived spheroplasts. Initial fractionations were performed by centrifugation vesicles with the Golgi (Dascher et al., 1991; Ossig et al., at 13,000 g, yielding supernatant (S13, lane 1) and pellet (P13, lane 1991). Vps33p is thought to function in protein delivery (via 2) fractions. The S13 fraction was then subjected to a second vesicle transport intermediates) to the vacuole (Banta et al., centrifugation at 100,000 g, resulting in a supernatant (S100, lane 3) 1990; Wada et al., 1990). Although vps33 and vps45 mutants and a pellet fraction (P100, lane 4). Vps45p, as well as various are both defective for delivery of vacuolar hydrolases, their marker proteins (Table 2), was quantitatively immunoprecipitated vacuole morphologies are strikingly different. In contrast to the from each fraction. (B) Cleared cell lysate was pretreated with buffer enlarged vacuoles of vps45 mutants, vps33 mutants lack alone (lanes 1 and 2), 1% Triton X-100 (lanes 3 and 4), 2 M urea vacuoles (and are therefore designated class C). The subcellu- (lanes 5 and 6), or 1 M NaCl (lanes 7 and 8) prior to centrifugation at 100,000 g. The presence of Vps45p in the resultant supernatant (S) lar fractionation profile of Vps33p also markedly differs from and pellet (P) fractions was determined by quantitative the one we observe for Vps45p (Banta et al., 1990; Fig. 6A). immunoprecipitation. These data suggest separate sites of action for Vps33p and Vps45p. It is possible that one of these proteins may function in Golgi-to-endosome protein transport while the other plays a and secrete soluble vacuolar proteins in their Golgi-modified role in an endosome-to-vacuole protein delivery event. Our precursor form. In addition, ∆vps45 mutant cells show a tem- present data suggest that Vps45p functions in a Golgi-to- perature-sensitive growth defect and accumulate clusters of endosome delivery event (see below). small membrane vesicles. Comparison of the predicted Vps45p The accumulation of 40-50 nm vesicles in vps45 deletion amino acid sequence with other known proteins revealed that mutants (Fig. 4B,C) indicates that like other members of the Vps45p is a member of the Sec1 protein family. Members of Sec1 protein family, Vps45p functions at a vesicle docking this family have been implicated in vesicle targeting in a and/or fusion event. These vesicles are likely transport inter- variety of intercompartmental protein transport events. The mediates of the vacuolar protein sorting pathway. Two forms VPS45 gene product seems to serve a similar function in the of vesicles are found in vps45 mutants, those that are appar- vacuolar protein localization pathway. ently free in the cytoplasm and those that are found in clusters. A current model of vesicle targeting and fusion proposes that The functional significance of the vesicle clustering is unclear, the specificity required to accurately target vesicles derived but it may result from a homotypic interaction that occurs prior from a donor organelle to a distinct acceptor organelle is to fusion with the target organelle and is exaggerated in vps45 mediated by a set of membrane proteins generically referred to mutant cells. It should be noted that the clustering of vesicles as SNARE proteins (Söllner et al., 1993a,b). According to this in ∆vps45 cells does not appear to be a fixation artifact, as other model, vesicles fuse with their appropriate target following class D vps mutant cells that accumulate similar vesicles interaction of a vesicle-SNARE (v-SNARE) with its cognate (vps21) (Horazdovsky et al., 1994) do not contain these target-SNARE (t-SNARE) on the acceptor organelle. The clusters. In addition, the vesicles within each cluster are SNARE protein family is typified by the well-characterized regularly spaced at ~20 nm. This spacing may represent the 3458 C. R. Cowles, S. D. Emr and B. F. Horazdovsky area occupied by a vesicle coat (10 nm on each vesicle). Since (Sec1p and Sly1p) and other rab-like GTP-binding proteins the staining procedure used here for electron microscopic (Sec4p and Ypt1p) have been noted in other yeast vesicle- analysis highlights cell membranes, other staining techniques targeting events (Bruno et al., 1988; Segev et al., 1988; will be needed to test for the presence of protein in this 20 nm Dascher et al., 1991). A similar functional interaction between space. Interestingly, most of the vesicle clusters observed in Vps21p and Vps45p may be involved in the vacuolar protein ∆vps45 cells are found in association with the vacuole. It is delivery pathway; however, such an interaction has not been unclear if this association is meaningful, as the vacuole identified. occupies a large portion of cell volume, and there is a reason- Both genetic and biochemical approaches are in progress to ably high probability that clusters would be randomly found test directly for physical interactions between Vps45p and near vacuoles. Furthermore, the fact that vps45 mutant cells other components of the vacuolar protein sorting pathway (i.e. contain a vacuole, suggests that vacuolar membrane con- Vps21p, Pep12p). In addition, the functional significance of the stituents are delivered independently of Vps45p function. leucine zipper motif and those domains of Vps45p most highly Vacuolar proteins move from the Golgi to the vacuole by conserved with other Sec1p family members is being transiting through a prevacuolar endosome-like compartment examined. These studies should help define a more precise role (Vida et al., 1993). The movement of vacuolar proteins from for Vps45p in vacuolar protein sorting as well as provide the Golgi to the endosome is also thought to involve vesicular insights into the general role that Sec1p family members play transport intermediates (Horazdovsky et al., 1994; Marcusson in vesicle trafficking. et al., 1994). Vps45p function may be required for these earlier vesicle docking/fusion events. The fractionation pattern of We thank the members of the Emr laboratory and Marylin Farquhar Vps45p is consistent with this assignment, as both the for helpful input during the course of this work. We also gratefully endosomal compartment and Vps45p are enriched in a high- thank Daniel Szeto for cloning VPS45; Russell Doolittle for his help speed membrane pellet fraction (P100) (Fig. 6A) (Vida et al., in progressive sequence alignment; Michael McCaffery and Tammie McQuistan for their outstanding electron microscopy work; and Bill 1993). Very little Vps45p is found in a lower-speed membrane Wickner and Randy Schekman for generously supplying Kex2p and pellet (P13) that is highly enriched in vacuolar membranes. PM ATPase antisera. This work was supported by a grant from the Further localization studies will be required to determine the National Institutes of Health (GM-32703) and the National Cancer precise subcellular location of Vps45p. Institute (CA58689). C.R.C. is a member of the Biomedical Sciences The peripheral association of Vps45p with cellular Graduate Program and a Lucille P. Markey Charitable Trust predoc- membranes (Fig. 6) and the observation that this association toral fellow. S.D.E. is supported as an investigator of the Howard can be saturated (Table 2) suggest that Vps45p may be inter- Hughes Medical Institute. acting with a specific and limiting membrane component. A reasonable candidate for this membrane component would be a member of the syntaxin protein family. A syntaxin homolog REFERENCES that functions in the vacuolar protein localization pathway has been discovered recently and is encoded by the PEP12 gene Aalto, M. K., Ruohonen, L., Hosono, K. and Keränen, S. (1991). Cloning (K. A. Becherer and E. W. Jones, personal communication). and sequencing of the yeast Saccharomyces cerevisiae SEC1 gene localized Interestingly, pep12 mutants fall into the class D vps mor- on chromosome IV. Yeast 7, 643-650. Aalto, M. K., Ronne, H. and Keränen, S. (1993). Yeast syntaxins Sso1p and phology group and share similar vacuolar protein sorting and Sso2p belong to a family of related membrane proteins that function in conditional growth phenotypes with vps45 mutants (unpub- vesicular transport. EMBO J. 12, 4095-4104. lished results) (Raymond et al., 1992). Like n-Sec1 binding to Bankaitis, V. A., Johnson, L. M. and Emr, S. D. (1986). Isolation of yeast syntaxin in neuronal cells, Vps45p may bind to Pep12p to facil- mutants defective in protein targeting to the vacuole. Proc. Nat. Acad. Sci. USA 83, 9075-9079. itate vesicle-mediated vacuolar protein transport. Banta, L. M., Robinson, J. S., Klionsky, D. J. and Emr, S. D. (1988). Though the exact mechanism by which these proteins facil- Organelle assembly in yeast: characterization of yeast mutants defective in itate vesicle transport is unclear, Vps45p could serve a number vacuolar biogenesis and protein sorting. J. Cell Biol. 107, 1369-1383. of functions in a vesicle docking and/or fusion event. Vps45p Banta, L. M., Vida, T. A., Herman, P. K. and Emr, S. D. (1990). may act to stabilize the interaction of a vacuolar sorting Characterization of yeast Vps33p, a protein required for vacuolar protein sorting and vacuole biogenesis. Mol. Cell. Biol. 10, 4638-4649. pathway t-SNARE, presumably Pep12p, with a corresponding Baumert, M., Maycox, P. R., Navone, F., De Camilli, P. and Jahn, R. v-SNARE, and thereby facilitate the vesicle fusion event. In (1989). Synaptobrevin: an integral membrane protein of 18,000 daltons the absence of Vps45p, the SNARE complex may rapidly dis- present in small synaptic vesicles of rat brain. EMBO J. 8, 379-384. sociate and vesicle fusion may be hindered, resulting in accu- Bennett, M. K., Calakos, N. and Scheller, R. H. (1992). Syntaxin: a synaptic protein implicated in docking of synaptic vesicles at presynaptic active mulation of small vesicles. Alternatively, Vps45p may play a zones. Science 257, 255-259. direct role in vesicle recognition of the appropriate target Bennett, M. K. and Scheller, R. H. (1993). The molecular machinery for membrane, as there appears to be a different Sec1p family secretion is conserved from yeast to neurons. Proc. Nat. Acad. Sci. USA 90, member associated with each type of vesicle-targeting event 2559-2563. that has been described. Finally, Vps45p may functionally Bruno, G., Salminen, A., Walworth, N. C. and Novick, P. (1988). A GTP- binding protein required for secretion rapidly associates with secretory interact with a rab-like GTPase, and together these proteins vesicles and plasma membrane in yeast. Cell 53, 753-768. may facilitate vesicle targeting and/or fusion. VPS21 codes for Bullock, W. O., Fernandez, J. M. and Short, J. M. (1987). XL1-Blue: a high a small GTP-binding protein (Horazdovsky et al., 1994; efficiency plasmid transforming recA Escherichia coli strain with beta- Singer-Krüger et al., 1994), and vps21 mutants share many galactosidase selection. Biotechniques 5, 376-379. Calakos, N., Bennett, M. K., Peterson, K. E. and Scheller, R. H. (1994). phenotypes with vps45 mutants, most notably the accumula- Protein-protein interactions contributing to the specificity of intracellular tion of 40-50 nm vesicles (Horazdovsky et al., 1994). Potential vesicular trafficking. Science 263, 1146-1149. functional associations between Sec1 protein family members Carlson, M. and Botstein, D. (1982). Two differentially regulated mRNAs vps45 mutants accumulate membrane vesicles 3459

with different 5′ ends encode secreted and intracellular forms of yeast GTP-binding Ypt1 protein, may act in endoplasmic reticulum-to-Golgi invertase. Cell 28, 145-154. transport. Mol. Cell. Biol. 11, 2980-2993. Dascher, C., Ossig, R., Gallwitz, D. and Schmitt, H. D. (1991). Identification Oyler, G. A., Higgins, G. A., Hart, R. A., Battenberg, E., Billingsley, M., and structure of four yeast genes (SLY) that are able to suppress the functional Bloom, F. E. and Wilson, M. C. (1989). The identification of a novel loss of YPT1, a member of the RAS superfamily. Mol. Cell. Biol. 11, 872-885. synaptosomal-associated protein, SNAP-25, differentially expressed by Dieckmann, C. L. and Tzagoloff, A. (1985). Assembly of the mitochondrial neuronal subpopulations. J. Cell Biol. 109, 3039-3052. membrane system. J. Biol. Chem. 260, 1513-1520. Pelham, H. R. P. (1993). Neurotransmission and secretion. Nature 364, 582. Feng, D.-F. and Doolittle, R. F. (1990). Progressive alignment and Pevsner, J., Shu-Chan, H. and Scheller, R. H. (1994). n-Sec1: a neural- phylogenetic tree construction of protein sequences. Meth. Enzymol. 183, specific syntaxin-binding protein. Proc. Nat. Acad. Sci. USA 91, 1445-1449. 375-387. Raymond, C. K., Howald-Stevendon, I., Vater, C. A. and Stevens, T. H. Garcia, E. P., Gatti, E., Butler, M., Burton, J. and De Camilli, P. (1994). A (1992). Morphological classification of the yeast vacuolar protein sorting rat brain Sec1 homologue related to Rop and UNC18 interacts with syntaxin. mutants: evidence for a prevacuolar compartment in class E vps mutants. Proc. Nat. Acad. Sci. USA 91, 2003-2007. Mol. Biol. Cell 3, 1389-1402. Gengyo-Ando, K., Kamiya, Y., Kodaira, K., Nishiwaki, K., Miwa, J., Hori, Robinson, J. S., Klionsky, D. J., Banta, L. M. and Emr, S. D. (1988). Protein I. and Hosono, R. (1993). The C. elegans unc-18 gene encodes a protein sorting in Saccharomyces cerevisiae: Isolation of mutants defective in the expressed in motor neurons. Neuron 11, 703-711. delivery and processing of multiple vacuolar hydrolases. Mol. Cell. Biol. 8, Goud, B., Salminen, A., Walworth, N. C. and Novick, P. J. (1988). A GTP- 4936-4948. binding protein required for secretion rapidly associates with secretory Rothman, J. H. and Stevens, T. H. (1986). Protein sorting in yeast: mutants vesicles and the plasma membrane in yeast. Cell 53, 753-768. defective in vacuole biogenesis mislocalization vacuolar proteins into the Graham, T. R. and Emr, S. D. (1991). Compartmental organization of Golgi- late secretory pathway. Cell 47, 1041-1051. specific protein modification and vacuolar protein sorting events defined in a Rothman, J. H., Howald, I. and Stevens, T. H. (1989). Characterization of sec18(NSF) mutant. J. Cell Biol. 114, 207-218. genes required for protein sorting and vacuolar function in the yeast Hanahan, D. (1983). Studies on transformation of Escherichia coli with Saccharomyces cerevisiae. EMBO J. 8, 2057-2065. plasmids. J. Mol. Biol. 166, 557-580. Sanger, F., Nicklen, F. and Coulson, A. R. (1977). DNA sequencing with Hata, Y., Slaughter, C. A. and Südhof, T. C. (1993). Synaptic vesicle fusion chain-terminating inhibitors. Proc. Nat. Acad. Sci. USA 74, 5463-5467. complex contains unc-18 homologue bound to syntaxin. Nature 366, 347- Segev, N., Mulholland, J. and Botstein, D. (1988). The yeast GTP-binding 351. Ypt1 protein and a mammalian counterpart are associated with the secretion Herman, P. K. and Emr, S. D. (1990). Characterization of VPS34, a gene machinery. Cell 52, 915-924. required for vacuolar protein sorting and vacuole segregation in Sherman, F., Fink, G. R. and Lawrence, L. W. (1979). Methods in Yeast Saccharomyces cerevisiae. Mol. Cell. Biol. 10, 6742-6754. Genetics: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Horazdovsky, B. F. and Emr, S. D. (1993). The VPS16 gene product Spring Harbor, NY. associates with a sedimentable protein complex and is essential for vacuolar Sikorski, R. S. and Heiter, P. (1989). A system of shuttle vectors and yeast protein sorting in yeast. J. Biol. Chem. 268, 4953-4962. host strains designed for efficient manipulation of DNA in Saccharomyces Horazdovsky, B. F., Busch, G. R. and Emr, S. D. (1994). VPS21 encodes a cerevisiae. Genetics 122, 19-27. rab5-like GTP binding protein that is required for the sorting of yeast Singer-Krüger, B., Stenmark, H., Düsterhöft, A., Philippsen, P., Yoo, J. S., vacuolar proteins. EMBO J. 13, 1297-1309. Gallwitz, D. and Zerial, M. (1994). Role of three rab5-like GTPases, Hosono, R., Hekimi, S., Kamiya, Y., Sassa, T., Murakami, S., Nishiwaki, Ypt51p, Ypt52p, and Ypt53p, in the endocytic and vacuolar protein sorting K., Miwa, J., Taketo, A. and Kodaira, K. I. (1992). The unc-18 gene pathways of yeast. J. Cell Biol. 125, 283-298. encodes a novel protein affecting the kinetics of acetylcholine metabolism in Söllner, T., Whiteheart, S. W., Brunner, M., Erdjument-Bromage, H., the nematode Caenorhabditis elegans. J. Neurochem. 58, 1517-1525. Geromanos, S., Tempst, P. and Rothman, J. E. (1993a). SNAP receptors Ito, H., Fukada, Y., Murata, K. and Kimura, A. (1983). Transformation of implicated in vesicle targeting and fusion. Nature 362, 318-324. intact yeast cells treated with alkali cations. J. Bacteriol. 153, 163-168. Söllner, T., Bennett, M. K., Whiteheart, S. W., Scheller, R. H. and Johnson, L. M., Bankaitis, V. A. and Emr, S. D. (1987). Distinct sequence Rothman, J. E. (1993b). A protein assembly-disassembly pathway in vitro determinants direct intracellular sorting and modification of a yeast vacuolar that may correspond to sequential steps of synaptic vesicle docking, protease. Cell 48, 875-885. activation and fusion. Cell 75, 409-418. Kleid, D. G., Yansura, D., Small, B., Dowbenko, D., Moore, D. M., Stevens, T., Esmon, B. and Schekman, R. (1982). Early stages in the yeast Grubman, M. J., McKercher, P. D., Morgan, D. O., Robertson, B. H. and secretory pathway are required for transport of carboxypeptidase Y to the Bachrach, H. L. (1981). Cloned viral protein vaccine for foot-and-mouth vacuole. Cell 30, 439-448. disease. Science 214, 1125-1129. Su, J. Y., Belmont, L. and Sclafani, R. A. (1990). Genetic and molecular Klionsky, D. J., Banta, L. M. and Emr, S. D. (1988). Intracellular sorting and analysis of the SOE1 gene: a tRNA3Glu missense suppressor of yeast cdc8 processing of a yeast vacuolar hydrolase: Proteinase A propeptide contains mutations. Genetics 124, 523-531. vacuolar targeting information. Mol. Cell. Biol. 8, 2105-2116. Trimble, W. S., Cowan, D. M. and Scheller, R. H. (1988). VAMP-1: a Klionsky, D. J. and Emr, S. D. (1989). Membrane protein sorting: synaptic vesicle-associated integral membrane protein. Proc. Nat. Acad. Sci. biosynthesis, transport and processing of yeast vacuolar alkaline USA 85, 4538-4542. phosphatase. EMBO J. 8, 2241-2250. Vida, T. A., Graham, T. R. and Emr, S. D. (1990). In vitro reconstitution of Kyte, T. and Doolittle, R. F. (1982). A simple method for displaying the intercompartmental protein transport to the yeast vacuole. J. Cell Biol. 111, hydropathic character of a protein. J. Mol. Biol. 157, 105-132. 2871-2884. Maniatis, T., Fritsch, E. F. and Sambrook, J. (1989). Molecular Cloning: A Vida, T. A., Huyer, G. and Emr, S. D. (1993). Yeast vacuolar proenzymes are Laboratory Manual, 2nd edn (ed. N. Irwin). Cold Spring Harbor Laboratory sorted in the late Golgi complex and transported to the vacuole via a Press, Cold Spring Harbor, NY. prevacuolar endosome-like compartment. J. Cell Biol. 121, 1245-1256. Marcusson, E. G., Horazdovsky, B. F., Cereghino, J. L., Gharakhanian, E. Volgelstein, D. and Gillespie, D. (1979). Preparative and analytical and Emr, S. D. (1994). The sorting receptor for yeast carboxypepidase Y is purification of DNA from agarose. Proc. Nat. Acad. Sci. USA 76, 615-619. encoded by the VPS10 gene. Cell 77, 579-586. Wada, Y., Kitamoto, K., Kanbe, T., Tanaka, K. and Anraku, Y. (1990). The Miller, J. (1972). Experiments in Molecular Genetics. Cold Spring Harbor SLP1 gene of Saccharomyces cerevisiae is essential for vacuolar Laboratory Press, Cold Spring Harbor, NY. morphogenesis and function. Mol. Cell. Biol. 10, 2214-2223. Novick, P., Field, C. and Schekman, R. (1980). Identification of 23 Yanisch-Perron, C., Vieira, J. and Messing, J. (1985). Improved M13 phage complementation groups required for post-translational events in the yeast cloning vectors and host strains: nucleotide sequences of the M13mp18 and secretory pathway. Cell 21, 205-215. pUC19 vectors. Gene 33, 103-109. Ossig, R., Dascher, C., Trepte, H.-H., Schmitt, H. D. and Gallwitz, D. (1991). The yeast SLY gene products, suppressors of defects in the essential (Received 24 June 1994 - Accepted 29 July 1994)