Posted on Authorea 13 Oct 2020 | The copyright holder is the author/funder. All rights reserved. No reuse without permission. | https://doi.org/10.22541/au.160262384.42442943/v1 | This a preprint and has not been peer reviewed. Data may be preliminary. liisfrCitnauessi h ulnsa Mountains Hualongshan Gao Yue the in udensis different Clintonia of for pattern ploidies spatial diversity and architectures Clonal ftecoa ln a oebd,i ol aerltvl ihrrtoo lnlgot,a hc stebssof basis impacts the significant is has which growth as clonal growth, Usually, 2018; clonal 2016). of al., al., ratio et et (Wang higher ramets relatively Geremew have of would development 2016; and it al., germination buds, the et more have has (Chen plant al., plants research clonal et clonal the evolution If Drunen of and Van structure ecology 2015; spatial 2018a). in al., and al., interest et characteristics et intense (Kartzinel environ- growth Wang of ecosystems heterogeneous the topic of to Therefore, a maintenance adapting 2018a). been the ramets. in al., in plants clonal resources et role Clonal Wang through utilize critical 2015; 2018a). plasticity to a morphological al., capacity expand play more greater can et and Wang habitats, a exhibit ments, have angiosperms other and 2018; plants of and growth, al., clonal ~80% deserts, clonal et Meanwhile, wetlands, that through Geremew grasslands, estimated space pathway 2010; forests, is living important al., in It their most et positions 2020). asexual (Wang the dominant al., Sand´en growth occupy is with et 2019; general clonal organisms simultaneously al., the in also et of engage Mandel but growth can 2018; clonal reproduction, al., the sexual et reproduction, (Geremew through asexual only In not reproduction. reproduce can Angiosperms INTRODUCTION 1 udensis, Clintonia Mountains. Hualongshan the in diploid ancestral survival the genetic KEYWORDS and from its diversity different maintained clonal that higher and with surroundings species udensis new clonal C. clonal to of Thus, facultative adapted tetraploid and the a index, These diploid. process, responded diversity became udensis. evolutionary diversity the clone growth, the C. of During of as clonal that tetraploid reproduction. such and and and than tetraploid, reproduction stability diploid average higher seed the the phalanxes. and slightly between through of branches, both occurred also cytotypes, indices rhizome were variations two were diversity of genetic ploidies The significant index, ratio two and diversity the differentiation diploid. of knot, genetic reproduction There the architectures rhizome and cytotypes. of each clone uniformity, two of that The distribution the buds than between genetic of models higher tetraploid. number C. Y were or the and of clones knots, V, diploid ploidy tetraploid C, rhizome origination, the different zigzag, of the in had the number udensis study present between the C. the However, to clone populations of analyzed material styles structure dominated initially excellent knot genetic no mainly we rhizome an grows spatial was the genotyping, as tetraploid that and molecular regarded found the growth, and It is while investigations clonal intra-polyploidy udensis. slopes, field characteristics, this south Through spatial Hualongshan So, the polyploidy. bank the on plant bud In slopes. areas of north m (4n=28). adaption the 2450 tetraploid and on in and evolution areas grows (2n=14) primarily m diploid udensis 1900 cytotypes C. in two of possessing diploid herb the perennial Mountains, a is udensis Clintonia Abstract 2020 13, October 3 2 1 ffiito o available not Affiliation University Ankang University Normal Shanxi 1 e Han Wei , nr-oyliy u ak lnlsailsrcue eei iest,adaption diversity, genetic structure, spatial clonal bank, bud intra-polyploidy, 1 i Liu Lin , 2 a Zhang Hao , 1 nZang En , 1 1 eLuSun GenLou , 3 n iigWang Yiling and , 1 Posted on Authorea 13 Oct 2020 | The copyright holder is the author/funder. All rights reserved. No reuse without permission. | https://doi.org/10.22541/au.160262384.42442943/v1 | This a preprint and has not been peer reviewed. Data may be preliminary. liis rvd nihstwr nihn h pta tutrso lnlpat,adetbihafoundation a establish and plants, intra- results clonal different of These of structures characteristics tetraploids. spatial adaptation and the ecological diploids enriching the between toward of insights understanding structures provide our spatial ploidies, enhance and in further ploidies; differences to different likely the of are a) configurations for to: clonal rationales were spatial aims reveal and intra-polyploid main differentiation, b) Our between genetic markers. diversity, pattern molecular tetraploid clonal (SSR) distribution and the Repeat diversity analyze diploid Sequence genetic Simple of and the investigations structures were field verified spatial through these and clonal However, Mountains the 2016). be Hualongshan would explored al., the we pattern et study, Wang similar 2008; this the uncertain. intra-polyploidy, al., In is should the et to still tetraploid For Li polyploid expected of plants. 2000; different level of be al., diversity between inter-polyploidy can et gene occurred the it (Brown the from ancestral chromosomes, diploid Thus, obtained its size. of same mainly that population than four effective than adaptability with larger higher broader autotetraploid a be and the having potential extent Within certain higher 2018). a imply al., of may tetraploid et the (Wan autoploid for diploid of for autotetraploid genome material an doubled natural is of diploid The it ideal adaptability the study, ecological an from previous different and be the are structures, 2019). would According which clonal al., ploidies slopes characteristics, north et different growth the Ma of clonal on 2018a; the pattern m studying al., 1900 distribution at et plants vertical areas Wang clonal The in 2015; of of grows surroundings. envi- al., tetraploid diploid frequency harsher the et and the Under while Drunen occurrence 2020). Mountains, slopes, (Van al., the Hualongshan conditions et i.e. the Wang stressed increased, 2019; In under is al., temperature higher reproduction and et be water, asexual Alonso-Marcos light, might of 2018; as al., ratio such habi- et the factors different Wang ecological ronments, in by 2018; of reproduction influenced al., modification asexual is et the and plants by (Huang reproduction of determined sexual primarily reproduction between hard are ratios asexual tats a the and in have reproduction in Changes grow sexual tetraploid factors. the and many and brown, between seedlings diploid trade-off is produce thus, the the ground; generally diploid However, mossy can both the moist tetraploids and in and and 2009), wood diploids tetraploid scape al., fallen habitats, and the decayed et wild diploid of In (Bai the reproduction. color tetraploid sexual between the the different that in significantly revealed green rhizome. is investigations is herb Field that perennial different 2007). while the this Zhao, between of & found size were (Wang differences seed significant The no however, ploidies. populations; Province, different Yunnan are between in diversity or of overlap Mountains characteristics which Snow morphological Province, The Shaanxi Dragon areas. in distribution Jade only Mountains diploid has the Hualongshan the tetraploid the encompassing to the and adjacent China, areas, Province, et distributed Northern Hubei Wang these extensively in in 2008; and in Province continuously al., Shennongjia is Heilongjiang et presence diploid (Wang to the 28) limited China Although = South a 2017). (4n of al., tetraploid et Province and He Yunnan 14) 2011; from = al., (2n et 2019). Wang diploid al., 2010; include et al., that Mandel cytotypes two 2018b; has al., Asia, et Wang of herb 2015; mechanisms patches perennial decline al., different The and et of maintenance, (Kartzinel formation, patterns the populations genetic exploring plant the for as clonal significance clarifying such great of and factors of Nevertheless, Sand´en structures be abiotic specific et 2015; 2017). might genetic and al., plants to spatial al., biological clonal et analyzing plants by (Kartzinel et So, affected patterns of Pirog diversity recruitment 2020). be adaptability seedling 2015; may al., genetic and plants the al., strategies, of clonal growth determine et of heterogeneity, level diversity habitat Drunen and the and (van influence structures decrease spatial process spatial and smaller can the evolutionary 2006) even the reproduction Zhang, at during asexual plaques, & environments Meanwhile, diversity (Zhang clonal 2018a). population different plants al., of clonal and the et showed structures researchers (Wang genetic Some scales populations. diverse plant spatially of diversity form of level can and structures spatial the on .udensis C. lnoi udensis Clintonia o nyaeulyrpoue hog xlaybd u lognrtssesthrough seeds generates also but buds axillary through reproduces asexually only not .udensis C. ftegenus the of .udensis C. evs ris noecne,adplespeetdcomplex presented pollens and inflorescences, fruits, leaves, Clintonia .udensis C. 2 rw anyi ra t25 ntesouth the on m 2450 at areas in mainly grows a,wihi ieydsrbtdars Eastern across distributed widely is which Raf, safclaiepat(i ta. 2016). al., et (Liu plant facultative a is .udensis C. .udensis C. Wn ho 2007). Zhao, & (Wang .udensis C. ouain of populations . Posted on Authorea 13 Oct 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160262384.42442943/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. i ( 10 was ddH volume reaction PCR collected primers. Liliaceae screened The all selected were Subsequently, of repeatability the information 1). good using (Table and tag) reactions primers bands sequence PCR of amplification clear by pairs (expressed with SSR EST primers 18 of the from pairs out from eight 2008), markers analyzer. al. molecular concentration acid et the (Yang SSR nucleic The and UV the gel, method. an to agarose CTAB using % According modified detected 0.1 the was a following in DNA DNA electrophoresis extracted genomic using the determined total of was the DNA extract extracted to of used quality were samples leaf Fresh LSD significance. and methods for software, analysis data 20 paired SPSS SSR the using the 2.3 of analyzed compare branches was to data of employed obtained was numbers The all difference) and of (least-significant roots. ages variance) the The of (analysis from ANOVA counted. where One-way removed were laboratory, was rhizome the soil counted. each to also the on were transferred once buds) rhizome was dormant measured, silica sample and color-changing and (active Each a observed buds using were refrigerator. dried 1) scissors, laboratory of with a (Fig. number off in nodes cut -80 rhizome were at the individuals stored sampled the and were all gel, of ploidies leaves two the the ten Then of Within individual analysis respectively. sampled configuration each areas, of Clonal sample individuals positions 2.2 tetraploid visible the spatial and all specific diploid from the collected the recorded. were And, and in individuals northern marked of tetraploid set areas. the and slopes were sample of diploid shady areas 107 plots the 40deg and the in m at 93 on 1 forests of areas total arbor x a the narrow m samples, under and grows 1 long tetraploid Ten the the whereas within slopes. east, grows to west diploid from the gullies, Mountains, Hualongshan broadleaved the Dabashan deciduous In the and of forest, to peak evergreen belong highest subtropical Mountains areas. second Hualongshan north forest the the forest, mixed China, is broadleaved of which evergreen regionalization level, vegetation subtropical the sea Province,the on above Based Shaanxi m in China. 2917 in Reserve is Mountains Nature Mountains National Hualongshan Mountains the Hualongshan of 109 the coordinates at geographic the located with are sites sample The materials and sites Sample 2.1 environments. their METHODS to AND plants MATERIALS clonal 2 of mechanisms adaptation the elucidating for o 0s neln t4 0fr3 ,etnina 2fr2mn 5cce nttl xeso t7 o 5 for 72 at ( extension number 10% genet total, using total in the separated cycles using were estimated 35 was products min, diversity amplified Clone 2 The for analysis 72 staining. diversity -4. silver at Clonal at using extension 2.4 stored visualized s, and finally 30 electrophoresis were for gel products 60 polyacrylamide PCR denaturing - the 45 and at min, annealing s, 30 for . eei iest n tutr analysis structure and diversity Genetic 2.5 and (genets), genotypes of number -1) ( D N N ,adFgridx( index Fager and ), 2 i 1]/[ -1)] 3.4 O / G ( N .udensis C. N μ .Terato rcdr a sflos r-eauaina 4fr5i,dntrto t94 at denaturation 5min, for 94 at pre-denaturation follows: as was procedure reaction The L. 1.Where, -1). ( N -1)] } ; hzm oe ol eadddrn ahgoigsao e er h ubrof number The year. per season growing each during added be could nodes rhizome E E N ( = .Tecluainfrua fteSmsnadFgridcswere: indices Fager and Simpson the of formulas calculation The ). = D Σ - D N min μ i ° N 64"-19e3’9 ,3dg43"-3dg81"N h ihs peak highest The N. 32deg08’13" - 31deg54’39" E, 109deg30’29" - 16’41" ,icuigmx5 mix including L, a h oa ubro ape niiul (ramets), individuals sampled of number total the was ( / ) i a h ubro niiul rmt)wt h genotype. i the with (ramets) individuals of number the was D max - D min 3 μ ); ,DAtmlt 1 template DNA L, D G min ,aeaecoesz ( size clone average ), ( = G .udensis C. 1 (2 -1) N μ - ,SRpies0.6 primers SSR L, G niiul eeamplified were individuals / ) N N / ( G N ,Smsnindex Simpson ), G -1); D a h total the was D 1-[?] = max μ ,and L, ( = { [ G N Posted on Authorea 13 Oct 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160262384.42442943/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. he lnlrmt,wieteohr4 eeshdol igecoa ae.Frtettali,teewas there tetraploid, the For ramet. clonal had genet single one a and only ramets, had clonal genets two 42 had other genets the three while which of ramets, (genets), clonal genotypes three 46 of consisted the diploids in between clones variance dominant no ( of were tetraploid analysis There and The diploid 4). between (Table diversity tetraploid clonal and in than ( diploid diversity index between clonal diversity found higher Simpson was had genotype tetraploid shared the No that indicating respectively, 0.4612 diploid. the and 0.3741 1.109, were ( ( index evenness size clone (Table average diversity clonal The higher relatively presented also it species, 4). this of For respectively. tetraploid diploid, and and tetraploid tetraploid diploid and the diploid of Both structure and between diversity individuals the Clonal Thus, clone 3). 3.2 3). of (Fig. (Table ratio form lower growth the relative phalanx and both were the minimal, tetraploid was was the individuals and tetraploid diploid and the diploid for the older by reproduction for clone produced observed the typically of usually one were analysis from branches bud rhizome Statistical typically Additional the was rhizome branches. Moreover, branches single the genet. of of 2). the number observation, frequency (Fig. by The highest architecture. our plants produced the branch ramet on with special the a four, Based as had to thought 1-2cm. individuals symmetrical was some and about a of node, basically was nodes rhizome were internode the rhizome in rhizome each ”one” occurred the of of 90 2); buds length formed (Fig. the or The Y between buds, and two active positions V, were to C, spatial there buds zigzagged, The when dormant primarily distribution were of rare. tetraploids ratio very and the of was diploids and ratio style the buds, as of of total styles such tetraploid to rhizome indexes, and the The buds above diploid in active among the that of different than that ratio the the significantly showed higher) the were for both were analysis buds, more buds, ANOVA buds 0.522 same; total possessed one-way (dormant was tetraploids to were lower addition, the buds it tetraploids were that In dormant while buds revealed and results active the 1). 0.357, diploids These of (Table for was the number 4. diploids 0.473 diploid for = the and 0.408, value however, the rhizome diploid maximum buds; and for per the the rhizome 2.315 and buds buds for was 1 total 0.627 of = rhizome was value to values per minimum it (Table extrema buds buds 0.277 buds, dormant The of was total of variance buds to tetraploid. ratio the of buds variance The and active the number of and tetraploid. average proportion 2.120, the the was For tetraploids, rhizome the respectively. diploid For each on tetraploid 3). buds and 2, of diploid number of average architectures The using spatial and analyzed characteristics were Clonal variation 3.1 genetic of pattern RESUILTS distribution 3 2010). the Lischer, and & variation (Expoffer software molecular ARLEQUIN of degree re- The were GENEPOP differentiation 1999). disequilibrium al., population using linkage (I), et detected (Francis presented index was package information that software locus phenotype loci each Shannon the of (H), ( index which disequilibrium coefficient diversity linkage after gene The 1995), Nei’s moved. Rousset, obtained. were & (Raymond loci software 51 of total A G ST E ,adtepretg fplmrhcbns( bands polymorphic of percentage the and ), ee049 n .83 epciey orsodnl,teeprmtr o h diploid the for parameters these Correspondingly, respectively. 0.6863, and 0.4695 were ) N D / n ae vnesidx( index evenness Fager and ) G ftettali a .4,teSmsndvriyidx( index diversity Simpson the 1.146, was tetraploid the of ) .udensis C. .udensis C. ilisadttaliso h ulnsa onan.The Mountains. Hualongshan the of tetraploids and diploids .udensis C. eecoa ouain.Teewr 9ad4 eesin genets 46 and 89 were There populations. clonal were P ° 4 < nlswe aig34buds. 3-4 having when angles 0.05). E nta errvae httenme framets of number the that revealed year that in hwdta hr eesgicn differences significant were there that showed ) PPL .udensis C. eecluae sn h POPGENE the using calculated were ) .udensis C. (P < .5 Tbe3). (Table 0.05) ln rwhpattern growth clone D n Fager and ) Posted on Authorea 13 Oct 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160262384.42442943/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. edigsrus hl h omn usrmi nadratsaecniuul Ce ta. 2016). al., et (Chen continuously state dormant al., a et in the (Qian remain for buds architectures equivalent dormant approximately clonal are the the caespitose knots while When rhizome sprouts, form many seedling winter. to on ensuing buds the the aboveground dormant during udensis sprout and before and C. active winter, buds form of the number active and through The the underground 2017). develop of live of portions knot to some aboveground continue rhizome 2019). buds the spring, al., rhizome the winter, et formed and on Ott and autumn 2013; rhizome buds the al., in of et drops (Liu position temperature ramets and positions, multiple spatial of number more comprised newly occupy The plant 90 the to the clonal or Furthermore, nodes of a branches. rhizome symmetrical branching additional form new a original produce of gradually form and the growth to could grow outward of from to knot the style continued direction of rhizome branching in different ”one” characteristics each formed buds a the former on new affected along buds a and sprout extend active that determined to and the so continues Thus, 2) rhizome, branching rhizome. the (Fig. new its former on newly process Each Each on buds growth branching. seedlings. buds active later rosette new of 2-4 basal the generate formed were number could which there indefinite of rhizome all cases, an belowground year, some generated the in through rhizome grow However, sprouted to year. began every which parts knot, rhizome aboveground different develop of Our to rhizomes 2018a). many knot al., on et bud Wang which active 2015; When al., architectures, single et a can clonal (Kartzinel only plants their ramets was clonal in its there environments, changes ploidies. of that heterogeneous pliable properties found the Within the investigations of 2018). through field changes et al., resources in (Kartzinel secure et result conditions to ultimately Huang clonal habitat strategies 2018b; the different their al., Furthermore, under adjust patterns. et changes architecture Wang malleable clonal 2015; represent different al., might possess species to of found architectures been have species Different of greatest architectures namely, Clone analysis, 4.1 AMOVA 5). of (Table tetraploid results within the DISCUSSION variation the and genetic 4 with diploid the the consistent and between was ploidies, occurred different This variation the 38.07%. genetic between diploid. was existed the diversity ploidies of genetic different that total than the higher of slightly 61.93% was coefficient tetraploid differentiation the gene of ( The diversity diploid genetic the the of that that showed than It higher slightly were these tetraploid were All the which 0.6337. of was in the indices I diversity diversity Among index genetic genetic diversity Three found. The of ( information were primers. level Shannon loci the loci high SSR polymorphic and a disequilibrium of of 0.2358, confirmed linkage was pairs percentage results H No eight The index bp. for diversity polymorphic. 350-750 gene were obtained Nei’s from bands were were 40 fragments fragments bands, DNA 51 DNA stable the and was of clear genets sizes 51 of Finally, distribution 1). the the (Table sample between tetraploids, diversity. the the characteristics clonal and of for higher lower, reproduction All While relatively indicated were scattered. clonal which genets) was dense, the of and genets (number in close or clones relatively of clones differentiation numbers of the was distribution diploids, there the the In that which tetraploids. and noting ploidies, diploids different worth tetraploids. tetraploids the is and and between diploids diploids It found the the both ramets, was between Therefore, clonal genotype occurred 3). three differentiation individual (Fig. had ramet that identical genets clonal verified two no single and Further, a ramets, only polyclonal. clonal had were two genets had 78 genets other three the which while of (genets), genotypes 89 .udensis C. ilisadttalis ahsrn,teatv usbgnt emnt n omcaespitose form and germinate to begin buds active the spring, Each tetraploids. and diploids niiul omlygo n eeo,te eur nyoeatv u nec rhizome each on bud active one only require they develop, and grow normally individuals .udensis C. ili n erpodidvdaswr mlfidb C sn S markers SSR using PCR by amplified were individuals tetraploid and diploid .udensis C. G ST ewe h ili n erpodws069,wihidctdthat indicated which 0.6193, was tetraploid and diploid the between ilisadttalisi h ulnsa Mountains Hualongshan the in tetraploids and diploids .udensis C. PPL PPL 5 85,H=023,adI=031,respectively, 0.3416, = I and 0.2332, = H 68.5%, = 35,H=022,adI=031)(al 2). (Table 0.3012) = I and 0.2127, = H 63.5%, = Tbe4). (Table .udensis C. PPL a 84,i addition, in 78.4%, was ) niiul i.The die. individuals ° nl,which angle, .udensis C. Posted on Authorea 13 Oct 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160262384.42442943/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. eprtr,si osue n h hcns ftehmslyr ncnucinwt h oe liue of altitudes lower the with conjunction environmental In layer. communities, humus tetraploids. forest the of the of density did thickness canopy the than the and reproduction in moisture, changes sexual soil by of temperature, main limited rate the was higher as distribution seeds a population through sustained system diploids reproduction both ancestral Furthermore, sexual Thus, environment. the the subalpine preserved and the populations in forms, tetraploid factors environmental Mountains. and other Hualongshan diploid and the the climate, territories, in heat, spatial diploids diploids. water, of the ancestral maintain ancestral instability of its the and that than from growth than occupy clonal different altitudes To of lower completely level relatively higher are at through that environment grow new surroundings and this diploids new to adapt explore might of they and tetraploids from tetraploids long-term byThe 1996), seedlings the a germinated al., establishing When under of are et 2016). grow difficulty al., that the (Li they et to plants when related (Chen to reproduction be reproduction contrast clone might seed This adopt in pressures. to grow selection likely environmental and more stable survive other. are each easily plants with more Therefore, state competitive seeds. ramets strong clonal a in generated consistently Smith are Newly 2018; plants individual al., environments, when et undisturbed Geremew higher In 2015; was al., input et resource Drunen survival the (Van 2020). and although reproduction al., probability seeds, clonal et growth by through the produced produced plants, was seedlings of ramet those each reproduction than sexual higher much the were with rate Compared 4). Alonso- (Table 2017; depends environ- diploid al., For primarily et the by 2019). system (Pirog impacted two-breeding organisms al., between are this et interactions between plants Marcos and balance demands, in The resource reproduction light. 2006). changes, environmental and sexual al., on water et and as (Zhang reproduction such environment conditions clonal diverse mental between the of relationship to high proportion trade-off adaptability relative a a a is maintain The is This can and 2009). reproduction round al., sexual flight et and a (Bai growth outcrossing in 2009). clonal and pollinators al., self-compatibility by et partial visited (Bai is plants system ramets clonal clonal pollination for pollen of Long-distance of rate inbreeding. number limitation outcrossing to the The outcrossing growth. and from clonal plants pollinators guerrilla of with by system plants mating of the that tetraploids. change than would or lower resources is diploids pollen its However, heterologous in of 2011). source spacers of al., long-wandering growth et no clonal Wang are The 2010; there growth, the as al., clonal populations, of et environmental for clonal Wang survival utilize nutrition larger 2008; and and and for al., occupy development space reasonably et sustainable for (Wang more the to demands population maintain populations growing tetraploid to the and meet resources diploid would expansion the continuous change enabling the This while to of flocks. Due through pattern in 2015). ramets growth al., of ramet rates et the survival Drunen the rhizomes, (Van optimize behavior of to utilizing foraging reproduction and clonal for of integration capacity efficacy physiological 2008). the the improve al., can structure et to plants Wang clonal Clonal rise 2007; this Zhao, give Although & (Wang to plants. sites clonal thought localized the was diploid for population the resources) of clonal quite various by was (e.g., the generated ramets heterogenicity having of these ramets of environmental of individuals architecture architecture of pattern clonal the of and number distribution the to spatial ratio The pattern Thus, the According the ploidies. 2). where adjacent formed. limited, (Fig. both reproduction, grow also was repetitive for clone was would microspace individuals low tetraploid ramets the tetraploid relatively the and and in was Generally, diploid patchiness reproduction knot. for clone clone rhizome collective analysis the more statistical at whereas annual occurred other, in typically each genet rhizome the to the of internodes of rhizome buds the between distance The .udensis C. a iie xaso blt,i aiiae h ayuiiaino niomna eore at resources environmental of utilization easy the facilitated it ability, expansion limited a had .udensis C. .udensis C. saprnilrstehraeu pce htgosudrtesaeo oet.Its forests. of shade the under grows that species herbaceous rosette perennial a is .udensis C. eog otepaaxmd.I lnswt hln lnlgot,the growth, clonal phalanx with plants If mode. phalanx the to belongs .udensis C. h ln erdcinlvlo h erpodwshge hnta of that than higher was tetraploid the of level reproduction clone the , .udensis C. rdal omdfo hln oarltvl scattered relatively a to phalanx a from formed gradually .udensis C. .udensis C. 6 a omiti eulrpouto u othe to due reproduction sexual maintain to had .udensis C. setmpiospliain n t breeding its and pollination, entomophilous is .udensis C. a hln atr Fg ) h spatial The 3). (Fig. pattern phalanx a was a eaieysot(- m.The cm). (1-2 short relatively was .udensis C. omtruhgnm duplication genome through form .udensis C. ili n tetraploid and diploid sntsuitable not is Posted on Authorea 13 Oct 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160262384.42442943/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. h eaiecnrbto ai fsxa erdcinadaeulrpouto fdpod n tetraploids and diploids of reproduction asexual and reproduction ( sexual plants of Nevertheless, clonal main- ratio 2016). be al., other contribution can et relative of diversity Liu the values of clonal 2008; average al., ploidies of et the degree different (Wang high than of regeneration a seedling diversity where of clonal long, levels the low quite very generally and under are growth even plants clonal tained clonal of of success lifecycles the The ensuring formation, buds, seedling dormant of for of of resources level adaptability survival material long-term the high provide the improving a would and their growth, These in renew ramet could products. result clonal rhizomes photosynthetic the might Moreover, preform behavior. fitness These and plasticity, foraging paper, the buds achieve 2017). morphological to this impacted Through environments al., favorable In reproduction, 2019). et within 2019). ramets sexual al., the (He al., about et increased population et consumption (Ma reproduction of diversity resource Mandel clonal evolution the 2017; shade, occupy the saved forest al., to and and capacity under et the offspring heterogeneity Pirog had populations of habitat clones 2010; plant Different survival to Jiang diversity. al., clonal clonal due 2016; of high et microhabitats al., relatively diversity (Pang different et had genetic anticipated tetraploids (Ma the and as populations that diploids low within shown both variation has as genetic research not that of increasing was However, hypothesized decrease 2018). was a al., it to et leads Therefore, typically 2009). growth al., Clonal et (Bai of flower) low self-pollination single very the and was that population. inflorescence indicated rate which (including setting fruits, the bagging seed udensis these of and setting the in observation seed anther although with of and no-clipping le, seeds rate investigation by were the the produced xenogamy, there During artificial be and by 2009). could however, al., fruit 58%; et was the setting (Bai seed 82% Wang of 2008; was rate al., the et conditions, 2017). (Wang bient al., studies et previous He with 2011; The consistent al., was et facultative also Wang the confirmed 2010; but only al., species not of et This population diversity the 4). genetic within (Table of high The diversity characteristic was 2019). of genetic Mountains clonal al., Hualongshan loss of et the the level in Marcos supply populations Alonso the can ploidy 2018; increase it husband, affect and plants, & and clonal reproduction Drunen parents facultative (Van of sexual For genotype through structure. same variation spatial the population genetic with and descendant diversity the genetic produce the can propagation clonal through Plants of structure growth. Mountains spatial clone diploids and Diversity the reproduction environment, 4.2 seed subalpine avoid both changing through can the reproduction plants hormone to and own density, adapt stability its by to of through Therefore, restricted reproduction tetraploids space. seed is and in limited growth. invest competition a to seedling within intraspecific resources and regulation more fierce creating growing germination by are When Generally, that competition seed canopy. seedlings 2015). intraspecific plants of and for forest disadvantage diversity, al., the sharing helpful overcome the genetic et could risk not under of that (Zhang growth to maintenance are clonal environments through contribute the different shade offspring propagate can as under forest plants well strategies under as of trade-off habitats habitats, reproduction reproductive tetraploids plaque asexual adopt population. the in the and can stabilize process, capacities reproduction to evolutionary acquisition growth sexual the resource clonal the increase During and both population. reproduction As sexual the of sustaining rate for the of decrease factor might seeds limiting the a that became layer soil humus of The areas distribution geographical the .udensis C. auttv reigsse nrae h uvvlfins n mrvdtegntcdvriyo the of diversity genetic the improved and fitness survival the increased system breeding facultative reigsse sprilysl-optbeadotrse hog olntr.Udram- Under pollinators. through outcrossed and self-compatible partially is system breeding .udensis C. .udensis C. vle noafclaiecoeseis hc ol ananpopulation maintain would which species, clone facultative a into evolved .udensis C. .udensis C. .udensis C. sgntdpod n erpod Wn ta. 2008). al., et (Wang tetraploids and diploids genet ’s .udensis C. D h eopsto eido uu rdal shortened. gradually humus of period decomposition the , .2 Krznle l,21) hc a ffce by affected was which 2015), al., et (Kartzinel 0.62) = eeddo o omnyadgriaingradually germination and dormancy for on depended 7 ilisadttalisi h Hualongshan the in tetraploids and diploids nteHaoghnMutis(al )wslower was 4) (Table Mountains Hualongshan the in .udensis C. hzmscudpaeterclonal their place could rhizomes .udensis C. .udensis C. .udensis C. reigsystem, breeding .udensis C. .udensis C. n different and a ferti- was would clone C. Posted on Authorea 13 Oct 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160262384.42442943/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. odffrn niomns sa uoerpod h erpod hog ihcoa erdciertsand rates reproductive clonal high through tetraploids the respond autotetraploid, to an trade-offs reproductive As adopted environments. tetraploids different and diploids to the Both different habitats. different of to pattern adaptations spatial diversity and architectures Clonal the Under manifest. CONCLUSION respectively, gradually habitats. differentiation 5 were clone tetraploids, different the tetraploids and whereafter environments, to and diploids diverse diploids to tetraploids the adapt the to within and between clones He fixed different diploids and of were formation (2008) the different the genotypes al. through various of the et pressures, Wang adaptation of selection of the patterns different results distribution from the genotype with resulted consistent The Mountains was (2017). which al. ploidies, two et ploidies. the two or between the wind observed between limited was differentiation shorter with the the days tetraploids, enhanced phenologi- of and 45 which asynchronous Most diploids extent, the about which the and certain was tetraploids, between ploidies a diploids exchange two the to the the gene pollination of of of block lower insect those cycle weeks, isolation effectively and growth two with would geographical The altitude The about compared period 2009). tetraploids. by cal August higher the al., tetraploids early relatively of et the in that the (Bai of than matured September that to diploids te- early than due the in the later shorter was matured of with diploids were fruits Compared the the diploids kilometers. of whereas the 20 the time was flowering while of The populations meters), cycles temperature. ploidy growth 2917 two the of the between traploids, (peak distance meters geographical 40 2400 The the of of altitude forests an arbor diploids the at meters. the under Mountains, slopes Hualongshan distribute field southern the tetraploids Through In shady environment. history. humid life across the and on distribute strategy, dependent highly breeding and distribution, areas, of habitat altitude that tetraploids its found and to we diploids related investigations, the closely between be Pirog differentiation might 2015; which genetic sample al., significant by et b). was influenced Drunen 2018a, (Van There were The al., selection (2017). plants et sample al. Wang clonal individual et 2017; of He and al., layout, of diversity the viewpoints et point genetic the supported sample and strategy, from results different sample structures, These were scale, spatial but process. 2008), clonal evolutionary of diversity, al., the those et clonal (Wang during from Wang environments by different heterogeneous proposed also views to were of adapt Other tetraploids surroundings to the precipitation. tetraploid habitats, sity increased of 2017; different diploids, and nutrients) al., in the temperatures et When and of higher (Alix diploids. habitats light genet with high-altitude (e.g., original the habitats the factors with altitude from Compared environment low progeny 2019). clone occupied al., of tetraploids et popula- progeny Wang the tetraploid 2018; the within Husband, or progeny, individuals & clone current Drunen Van be The Subsequently, to buds. 4). (Table likely rhizome are populations through ge- of tion offspring different 4), establishment propagate with ramet initial of (Table will areas the tetraploid diploid ploidy various the during the of this the genotypes on microhabitats in multiple than myriad diversity not from occupy genets genetic coming might number nets more of tetraploids genet level diploids, has of higher the tetraploid descendants the As the on for study, reason depends this another genetic mainly In be the plants 2006). might Meanwhile, diploid, diversity. was which Zhang, clonal genetic the tetraploid & higher of with of relative (Zhang compared size population the number Thus, population in within diploids. effective resulting the the size that Consequently, of diploid effective smaller. half the was was than tetraploid tetraploids larger the of relative on rate drift of loss genetic tetraploids gene the the The autopolyploid, diploids. an the Being to 4). (Table diploids the of different two the For habitats. different in .udensis C. .udensis C. ili n erpodgntpswr oaie;tu,ovoscoa differentiation clonal obvious thus, localized; were genotypes tetraploid and diploid .udensis C. liis h iest nie ftettaliswr lgtyhge hnthat than higher slightly were tetraploids the of indices diversity the ploidies, a fe itiue ne h ro n hu oet fhigh- of forests shrub and arbor the under distributed often was 8 .udensis C. ° otensoe ta liueo rm1880-2000 from of altitude an at slopes northern .udensis C. rsne ihrcoa n eei diver- genetic and clonal higher presented .udensis C. .udensis C. liiswr h euto long-term of result the were ploidies a obegnm relative genome double a has liisi h Hualongshan the in ploidies .udensis C. .udensis C. Tbe5), (Table . Posted on Authorea 13 Oct 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160262384.42442943/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. u,Z . i,Z . ag .L,L,S . ho .F 20)CoeadSqec nlsso rDNA of Analysis Sequence and Clone (2008) F. G. Zhao, & F., S. Li, L., Y. Wang, L., of Z. and ITS diversity Liu, strategy, G., growth Z. swamps. Clonal Guo, papyrus (2018) Cyperus L. tropical Triest, in & sedimentation to A., e0190810-e0190810. response Kefalew, spatiotemporal T., A Sierens, structure: I., Stiers, population for A., freeware Geremew, Window-based Microsoft POPGENE, (1999) Repeated T. Boyle, of population analysis. & perform Consequences Y., genetic to C. programs (2016) Rong, of series Y., C. new C. Francis, a Wu, Windows. 3.5: and & ver Linux suite Y., Arlequin under (2010) analyses Z. L. E. genetics Hou, H. Lischer, F., & L., Li, Excoffier, H., Y. of Xie, Banks China. M., Bud Belowground Z. on Deng, Rutidosis Defoliation of daisy S., Biology endangered X. Pollination the The of Chen, conservation. (2009) populations its F. tetraploid G. for in Zhao, implications diversity & Genetic and leptorrhynchoides L., (2000) AG Z. Sinica Young Boreali-Occidentalia Liu, AH, Botanica G., Brown Acta Z. Guo, Mey. apomictic H., .et Trautv and Z. udensis Huang, sexual J., Clintonia sympatric Yang, in Q., G. differentiation Bai, niche explains H ploidy A., than of Tribsch, rather populations S., mode Scheffknecht, reproductive D., in F. plants. Nardi, hybri- in H., interspecific evolution and Alonso-Marcos, and Polyploidy speciation (2017) adaptation, S. for J. Heslop-Harrison, partners & dization: T., Schwarzacher, G´erard, PR., K., Alix, holothurian the in stability Evolution H´el`ene, High Clonal and & time: (2017). Ecology F., and M. Patrick, St´ephane, space Gr´egoire, G., B., through B., structure Alexandre, G., Pauline, P., Agathe, REFERENCES https://orcid.org/0000-0002-0358-0851 iD: Wang Yi-ling Dryad. on archived be ORCID will genotypes microsatellite and data Morphological and critically HZ contributed data; publication. authors the for All STATEMENT AVAILABILITY approval analyzed manuscript. DATA final the WH gave edited and and and LL reviewed drafts YG, GLS manuscript; the and the to YLW wrote data; the YG collected ideas; EZ the conceived GLS and YLW CONTRIBUTIONS AUTHOR declared. None (31970358). Foundation better Science INTEREST to Natural OF helpful National CONFLICT be Chinese by and supported intra-polyploid was the study This of evolution the clones. on plant light ACKNOWLEDGMENTS facultative shed of mechanisms will model adaptation study diversity the this The elucidating ancestors. in diploid results their The from habitats different two completely of to adapted diversity genetic lnoi dni.At oaiaBraiOcdnai Sinica Boreali-Occidentalia Botanica Acta udensis. Clintonia .udensis C. rnir nPatScience Plant in Frontiers oetlapuberula Potentilla nvriyo Alberta of University liiswr niiatt ecnitn ihtehptei bu h inter-polyploid. the about hypothesis the with consistent be to anticipant were ploidies :7534-7547. 7: , 7. , . clg n Evolution and Ecology 1-31. , ae brevicuspis Carex oeua clg Resources Ecology Molecular 9 eeiy(Edinb), Heredity :3588-3598. 9: , Cprca)i h ogigLk Wetlands, Lake Dongting the in (Cyperaceae) le,K,&Dbˇ,C 21)Difference (2019) Dobeˇs, C. & K., ulber, ¨ tcou chloronotus Stichopus 914-921. , naso Botany of Annals 5(P 2):122-129. Pt ( 85 0 564-567. 10: , 9 1170-1175. 29: , 2:183-194. 120: , (Echinodermata). lSOne PloS 13: , Posted on Authorea 13 Oct 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160262384.42442943/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. oe .E,Wnrg .M,Wnlr . uke,Y .(00 lblgn o eessivsv plants T invasive releases M., flow J. gene A. Global Tack, (2020) M. M., Y. Kelly, Saastamoinen, Buckley, A., & C., P Helm, A., Roscher, L., Wingler, N., A., S. M., L. Olsen, A., E. Roeder, Hamre, Wandrag, Bucharova, M., R., R., E., Morales, Q., E. S. G. Groenteman, L., Vose, F. Enri, B., Crone, J. Brearley, U., P., Gooden, Moore, B´odis, P. J., M., S. M., A., Rasmussen, J. Z., Lonati, Blomberg, E. Dwyer, D. L., P., M., M. Childs, Laanisto, R. Cserg˝o, A. M., R., Baudraz, Duncan, G. Munn´e-Bosch, A., S., M., Wardle, A., Salguero-G´omez, J. C. R., A., Finn, Caruso, Catford, D. D., J., Roach, B. A-L., Villellas, shapes Elderd, Laine, R., B., hierarchies T. M. evolutionary Garcia, Hodkinson, E.,Ehrl´en, complex J., L., within A. competition Smith, Clonal (2020) T. time. over Fioretos, AML & H Pe˜na-Martinez, H., P., S., Agerstam, ˚ P. von, H., Tests Exact Lilljebj for Software Sand´en, C., Genetics Population 1.2): temperate (Version the GENEPOP Ecumenicism. in (1995) and F. gradient Rousset, climatic & a M., Raymond, along in composition structure China. and and northern density diversity Klimeˇsov´a, of L bank Clonal steppe bud (2010) W., J., Y. below-ground Z. Yuan, in Wang, & Differences Q., H., T. J. Mo, Qian, B., Y. Zhang, of Q., populations W. in natrual Wang, banks X., bud below-ground Y. of Pang, significance and ecology The structure genetic (2019) spatial plants. D. and Klimeˇsov´a, Biomass Hartnett, diversity P., Clonal & and J. (2019) J., E. Architecture Ott, J. Clone Moore, & herb, (2019) J., long-lived R. Q. Bayer, the Y. K., in C. Zheng, Major, R., & J. B., Mandel, Y. Deng, J., 1495-1500. Zhao, popu- 40: C., qinlingensis Fargesia G. of a Zang, of Characteristics structure N., Reserve. Clonal Nature Y. (2016) National Ma, S. Foping Y. in Ma, fingerprints & repeat W., sequence Liu, Sinica simple G., Yu, using of J., inferred ploidy J. lation different Liu, of Q., Technology configuration Q. Institute Clonal Ma, (2016) Changshu L. of Y. Journal Wang, between of characteristics & Mey. growth L., Evolution et clonal Trautv. Zhao, Genetic of L., Comparison Liu, (2008) (2013) X., P. F. D. Liu, G. Zhang, & Zhao, J., C. & Cai, pervariabilis F., H., Bambusa S. S. Fan, L., Li, G. L., Liu, Y. of Wang, Heterogeneity Mey L., (2015) et Z. P. Trautv. G. Liu, B. X., Quigley, Li, & of W., structure A. 739-750. genetic Bowsher, 116: kudzu, C., and , of Wang, patches diversity L., among Clonal J. patterns clonal Hamrick, (2018) R., Y. T. X. Kartzinel, Chen, China. Island, & clonal Hainan of H., along Response populations (2018) Gao, P. J. K., Tao, & Jiang, M., spatiotemporal Chen, and N., D. differentiation He, Genetic Sinica R., Ecologica (2017) Y. Xiang, Y. of F., Wang, plasticity Qian, morphological & R., Dong, X., M., H. Liu, Huang, of Z., tetraploidy Fan, and J., diploidy Li, of S., history Wang, J., He, 6 6496-6505. 36: , naso Botany of Annals Bsdo pN Sequencing. cpDNA on .Based aueCommunications Nature 8 6835-6845. 38: , yoo dactylon Cynodon ora fHeredity of Journal r,H,OsakPers . ennso,R,Sb,K . adeg . Thorsson, N., Landberg, H., K. Saba, R., Henningsson, C., Pietras, Orsmark H., ¨ orn, × rii rlim lSOne PloS trillium. Prairie lmablaiea Guihaia balsamifera. Blumea edoaaossdi n abs rigida. Bambusa and daii Dendrocalamopsis 2:1099-1118. 123: , agsadecurvata Fargesia naso Botany of Annals ouaini ieetHabitats. Different in Population geg . ise,M,Gseso,D,Lzrvc . uiso,G., Juliusson, V., Lazarevic, D., Gisselsson, M., Rissler, C., ¨ ogberg, lnoi dni.EooyadEvolution and Ecology udensis. Clintonia 6 248-249. 86: , urramnaavr lobata var. montana Pueraria hns ora fApidEcology Applied of Journal Chinese 1 579. 11: , 2:755-764. 120: , odffrn oetcnp tutrsadlgtconditions. light and structures canopy forest different to ,X . un,W . i,Z . a,X .(2017) G. X. Han, & M., Z. Liu, N., W. Kuang, T., X. u, ¨ caBtnc oel-cietlaSinica Boreali-Occidentalia Botanica Acta 4 e0224123-e0224123. 14: , 10 0 209-214. 30: , 0 105-111. 30: , hns ultno Botany of Bulletin Chinese nivsv plant. invasive an , hns ora fToia Crops Tropical of Journal Chinese re,M,Pty .K,Rml,S., Ramula, K., W. Petry, M., ¨ artel, 9 397-402. 29: , :10243-10251. 7: , nau acoroides Enhalus lnoi udensis Clintonia naso Botany of Annals lnoi udensis Clintonia 1112-1117. , caEcologica Acta pe,J P., J. ¨ opper, 8 288-294 48: , Acta , Posted on Authorea 13 Oct 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160262384.42442943/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. hn,Y . hn,D .(06 sxa n eulrpoutv taeisi lnlplants. clonal in strategies reproductive sexual and Marker Asexual Repeats (2006) Sequence Simple Y. for Ecology D. Mining Zhang, Plant Data & (2008) F., Y. L. Y. M. Lilium Zhang, Li, from light & Tags to D., Sequence Mu, responses Expressed C., allocation in Liu, Development biomass J., Ming, and L., Growth S. (2016) Yang, F.H. Yu, 8091-8101. & herb 24): L., rhizomatous 36( H. the , in Li, availability C., nutrient and sexual B. intensity between Dong, shift Z., the drives M. What Wang, (2018b) C. Ma, & G., Han, 91. H., of Guo, reproduction M., clonal C. and Prather, of Genetic L., Structure Xie, and Population Z., Structure Wang, (2007) Population F. (2008) G. F. Zhao, Yunnanica G. Botanica & Zhao, L., & Y. Q., Wang, Z. Qian, F., S. 1238-1247. Li, L., of G. of Diversity diversity Sun, Clonal L., (2008) F. Y. G. Wang, Zhao, & G., phylogeography Z. DNA Guo, Chloroplast J., (2010) Guo, Mey. F. X., Li, G. L., Zhao, Y. Wang, & F., S. Li, G., Z. 721-732. Guo, J., Guo, X., of of Li, diversity facilitates L., microsatellite diversity Y. Wang, Chloroplast and (2011) plasticity Asia. G. Clonal East Zhao, (2018a) in & X. populations J., Chen, Guo, & Y., B., Wang, Ni, J., You, of L., adaptation Li, abies). the W., (Picea Shaped Zhao, Spruce Have X., Norway Selection Wang, Natural Conifer of and Distributed growth Demography Widely clonal (2020) the the Evolution K. P. in on Ingvarsson, Variation Response & Genetic (2018) C., Index L. Bernhardsson, Polyploidy (2019) X., D. Wang, Y. Wang, Cheng, D., X. C. Guo, & Wang, Wei, L., intensity. & K., B., Zhang, light H., F. Q. M., to A. Meng, X. genets Zhao, Paterson, Y., Song, P., T., T. N., X. Polyploids. Lei, W. M. Li, of R., Ge. Wang, S., Evolution S. L., Y. the Sun, Wang, Feng, for X., Y., S., Y. R. Implications Jiang, Li, Xia, Its T., G., J., and S. J. X. of Yu, Bao, Liu, L., H., Y., mechanism X. Guo, J. fertility Ma, Y., C., X. low P. Li, Sun, and D., J., characteristics Qin, P., induction,physiological J. Wang, the on gourd. Studies wax black (2018) fitness: autotetraploid sexual L. for Z. clonality of Wan, Consequences (2015) dispersal. E. restricted on M. spatially Sciences polyploidy Dorken, under of & fitness of M., enhances consequences Kleunen, expansion evolutionary van Clonal vs. E., W. Immediate Drunen, (2018) Van plant. C. autopolyploid B. an Husband, in & reproduction clonal E., W. Drunen, Van diversity. 4218-4227. genetic on constraints environmental from lnoi dni ruv n Mey. and Trautv. udensis Clintonia n t orlto ihhbttfactors. habitat with correlation its and 2 3803-3817. 12: , 1:8929-8936. 112: , lnoi dni ruv tMey. et Trautv. udensis Clintonia 30(1):174-183. , hddnrnaru Georgi aureum Rhododendron 293-299. , rtclua Science Pratacultural iceia ytmtc n Ecology and Systematics Biochemical aaaastenophylla Caragana unx University Guangxi Llaee nEs Asia. East in (Liliaceae) cec nCiaPes(eisC ieScience) Life C: (Series Press China In Science 5 357-362. 35: , naso Botany of Annals oapn environment. alpine to (Liliaceae). ln lmtcaiiygradient? aridity climatic a along . rceig fteNtoa cdm fSciences of Academy National the of Proceedings 11 rnir nGenetics in Frontiers otclua ln Journal Plant Horticultural obsheu planiculmis Bolboschoenus nentoa ora fPatSciences Plant of Journal International lnoi udensis Clintonia oeua hlgntc n Evolution and Phylogenetics Molecular 9 22-30. 39: , 2:195-205. 122: , rceig fteNtoa Academy National the of Proceedings lSOne PloS 10. , lnoi udensis Clintonia iica)i China. in Liliaceae) ( lnoi dni Trautv.et udensis Clintonia 3 e0197089-e0197089. 13: , M ln Biology Plant BMC . caEooiaSinica Ecologica Acta eoeBooyand Biology Genome (07):1069-1074. , iuai virgaurea Ligularia 550-557. , (Liliaceae) ora of Journal 169: , 117: , Acta 18: , 55: , Posted on Authorea 13 Oct 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160262384.42442943/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. ubr2 43 93 93 93 39 39 10.00 6.000 4.000 39 10.00 2.296 4.000 6.000 0.667 1.862 39 0.238 7.3846 0.429 0.550 0.006 7.9231 0.550 0.000 39 0.5222 0.571 0.042 0.238 0.333 0.3574 39 1.000 0.006 0.550 0.450 0.4733 3.000 0.036 1.200 1.800 39 0.6266 3.200 0.163 1.700 1.500 2.2827 39 4.000 0.222 2.1333 3.000 1.000 4.000 2.3148 0.408 54 3.000 Maximum 1.000 Minimum 2.1200 0.277 Range Variation 25 Mean Number F: 2 Table F:CACCCAGGCGTAAGAAGAAG AACCTACCTC- F: ES23 F:GCTGGAGCAAGAGAAATTGG ES22 F:AGAGGTGGAACACGGACATC ES18 ES16 F: ES13 TGCTTGAGAT- F: ES11 GGCATCGAT- F: ES10 sequence Primer ES07 Locus system Breeding (2015) M. M. Meng, 1 & Table G., D. Zhang, J., J. Zhou, 956. T., of Deng, Architecture L., clonal Xu, and X., G. Chen, J., Zhang, hrceitco hzm usof buds rhizome of Characteristic for microsatellites of Characteristics n4 n4 n4 n4 n4n 2n 4n 2n 4n 2n 4n 2n 4n 2n number Buds GCCACATTGGACCATAAACC R: GCACGAG GCAGGAATTCG- GCACCTGTGTCAACACCCTA R: AGAATCAGAGAGGCGGAAC R: CACCCCTACC ACATTTGTTGGTCCCTCCTG R: GCCCGGATCACTTTCTTCTC R: CCTCGGATTGTTGATCCTGT R: CTTCTGAGTT TGGCTCGAAC- CAAGAGAATGCGACAAAGC R: GTGCGACGAG ACAAGTAGGGCAACGGGTT R: GATGAGGACTT (5’-3’) number Buds ioeei ihuni.At oaiaBraiOcdnai Sinica Boreali-Occidentalia Botanica Acta jishouensis. Sinosenecio mean Buds lnoi udensis Clintonia lnoi udensis Clintonia 8614 25 21 6 14 16 8 16 48 19 22 46.6 20 10 51.1 26 56 15 51.6 17 51.1 12 51.2 50.2 Ta() Temp Anneal mean Buds 12 ili n tetraploid and diploid ’ ratio buds Active n4n alleles of Number 2n alleles of Number ratio buds Active ration buds Dormant 50) 948- 35(05): , ration buds Dormant g Ago Ago Posted on Authorea 13 Oct 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160262384.42442943/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. buds active of Ratio buds mancy dor- and buds active of Rates buds mancy dor- of ratio The rhizome on bution distri- Buds al 3 Table n-a NV for ANOVA One-way oa oa oa oa oa 0112 .081 Total Total 12 Total 0.938 Total Total Total groups Total Within Total 12 Total groups Among 0.070 Total groups Total Within Total Total 14 Total groups 7.733 Among Total Total groups Within Total Total Total groups Among Total groups Within groups Among obntoCmiainobntoCmiain.7 .1 1030.003 11.063 groups Within 0.014 term Linear 5 CombinationCombinationCombinationCombination0.072 0.017 groups Within 6.147 term Linear 0.153 5 0.005 CombinationCombinationCombinationCombination0.764 groups 9.546 Within term 0.012 Linear 5 CombinationCombinationCombinationCombination0.061 groups Within groups Among lnoi udensis Clintonia groups Within term Linear groups Within term Linear groups Within term Linear 0.990 0.098 0.080 term Linear 5 CombinationCombinationCombination0.400

eito eito .5 .1 0960.004 0.012 10.956 11.487 0.014 0.015 0.017 4 0.055 1 6.366 groups 0.057 Within Deviation 5.267 0.015 Deviation 0.158 Weighted Weighted 0.131 4 1 groups 0.633 0.006 Within Deviation 0.131 Deviation 0.014 9.326 Weighted Weighted 10.426 0.012 0.013 4 1 groups 0.048 Within Deviation 0.013 Deviation Weighted Weighted term Linear 13

groups Within groups Within groups 0.972 Within 0.918 0.120 0.011 0.098 0.009 4 1 0.391 Deviation 0.009 Weighted .0 0.001 7 0.009 0.025 7 0.174 0.001 7 0.009 .3 0.815 9 7.333 Sd SFSignificant F MS df SS level Posted on Authorea 13 Oct 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160262384.42442943/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. i.3. on. so Fig. and . . . . . year. second systyle. year. first Notes: 2. Fig. 1. Fig. Φ ored SM s.Vr ainepretg iainindices Fixation 0.5737 % percentage Variance 0.4218 Var. 1.1274 Est. 67.5 76.5 60.87 10.47 MS 0.3552 0 0.2358 1.959 0.337 0 68.5 SS 78.4 51.698 17.472 63.5 501.832 df 78.371 28.66 311 1 0.923 39.803 Φ 378.867 17 populations Within groups within populations 37 40 Among groups 32 Among Source 5 Table genotypes. of Number , G loci. index. polymorphic size. of Sample , percentage The , 51 51 PPL 51 loci polymorphic of Total Number 4n loci of number 2n Total Population 4 Table buds rhizome of number average The ST CT eei ieetainaogpopulations. among differentiation genetic , eei ieetainaoggroups. among differentiation genetic , d systyle. C , lnlsailsrcueo .udensis C. of structure spatial Clonal udensis. Clintonia of ( architecture udensis Clonal Clintonia of seedings rosette and Rhizomes eei aito of variation Genetic of populations tetraploid and diploid of variation Genetic oa oa oa oa oa .5 12 2.058 Total Total Total Total Total groups Within groups Among e systyle. V , obntoCmiainobntoCmiain.9 .3 .2 0.015 groups Within 6.423 term Linear 0.338 5 CombinationCombinationCombinationCombination1.690 lnoi udensis Clintonia f systyle. Y , groups Within term Linear N Φ / H G a SC h diploid. The , e’ eediversity. gene Nei’s , ili n erpodpopulations tetraploid and diploid F vrg ieo eoye ipo ne.E,Fager , E index. Simpson , D genotype. of size Average , eei ieetainaogppltoswti groups. within populations among differentiation genetic , eito eito .4 .3 .7 0.041 0.007 4.478 14.201 0.236 0.747 4 1 groups 0.943 Within Deviation 0.747 Deviation Weighted Weighted flowering. , 14 a groups Within b rhizomes; , a h tetraploid. The , h diploid. The , lnoi udensis Clintonia PPL I hno’ nomto ne.N index. information Shannon’s , .6 0.053 7 0.368 b I H oet seedings). rosette , · · 320 0 2332 2127 b h tetraploid. The , · · 46178 .40049 0.6863 0.4612 0.4695 0.3741 1.1460 1.1087 89 46 107 93 3416 3012 / E D N/G G N c Φ Φ Φ zigzag , SC ST CT .64( 0.001) = (P 0.3654 0.001) = = (P 0.5732 = .09( 0.001) = (P 0.6089 = Posted on Authorea 13 Oct 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160262384.42442943/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. 15 Posted on Authorea 13 Oct 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.160262384.42442943/v1 — This a preprint and has not been peer reviewed. Data may be preliminary. 16