DOCSLIB.ORG

Identification and Characterisation of RNA Targets of the RNA Binding Proteins Tra2α and Tra2β Andrew Best

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Identification and Characterisation of RNA Targets of the RNA Binding Proteins Tra2α and Tra2β Andrew Best Identification and characterisation of RNA targets of the RNA binding proteins Tra2α and Tra2β Andrew Best Institute of Genetic Medicine A thesis submitted for the degree of Doctor of Philosophy September 2014 Declaration Declaration I, Andrew Best, declare that no portion of the work compiled in this thesis has been submitted in support of another degree or qualification at this or any other University or Institute of Learning. This thesis includes nothing which is the work of others, nor the outcomes of work done in collaboration, except where otherwise stated. ……………………………….. Andrew Best I Acknowledgements Acknowledgements First and foremost, I would like to extend my thanks to a fantastic supervisor - Professor David Elliott – for his guidance, patience and support. David has been a kind and enthusiastic mentor. I would also like to thank my second supervisor – Dr Alison Tyson-Capper – for her constant encouragement and support throughout this project. I would like to thank all members of the Elliott lab, both past and present. I would particularly like to thank Mrs Caroline Dalgliesh (Institute of Genetic Medicine, Newcastle University) for her valuable advice and for the countless ‘quick questions’ she has kindly answered over the years. Thanks to Dr Sushma Grellscheid (School of Biological and Biomedical Sciences, Durham University) for sharing her valuable expertise when I first started working in the lab. I would also like to thank Dr Jennifer Munkley, Dr Elaine Hong and Dr Ingrid Ehrmann for their help and advice. You have all made my PhD an enjoyable and rewarding experience. I extend a special thank you to my good friends and fellow PhD students Ms Marina Danilenko, Mr Morten Ritso and Dr Mahsa Kheirollahi-Kouhestani. I wish you all success and happiness in the future. I am indebted to many collaborators for their time and generosity throughout this project. Without them this work would not have been possible. Thank you to the following collaborators: Dr Julian Venables (Institute of Genetic Medicine, Newcastle University), Dr Katherine James (School of Computing Science, Newcastle University), Professor Tomaz Curk (Faculty of Computer and Information Science, University of Ljubljana), Mr Yaobo Xu (Institute of Genetic Medicine, Newcastle University), Dr Mauro Santibanez-Koref (Institute of Genetic Medicine, Newcastle University), Mr Rafiq Hussain (Institute of Genetic Medicine, Newcastle University), Professor Bernard Keavney (Institute of Cardiovascular Sciences, University of Manchester), Dr Roscoe Klinck (Université de Sherbrooke, Québec, Canada), Professor Benoit Chabot (Université de Sherbrooke, Québec, Canada), Dr Ian Cowell (Institute for Cell and Molecular Biosciences, Newcastle University), Mr Ka Cheong Lee (Institute for Cell and Molecular Biosciences, Newcastle University), Professor Caroline Austin (Institute for Cell and Molecular Biosciences, Newcastle University), Dr Irina Neganova (Institute of Genetic Medicine, Newcastle University) and Mr Ian Dimmick (Institute of Genetic Medicine, Newcastle University). I also gratefully acknowledge the Breast Cancer Campaign for funding this project. Thanks also to my external examiner – Dr Emanuele Buratti – for an enjoyable and constructive discussion. I would like to extend a big thank you to all my family and friends. Thank you to my mum – Janet – for the unconditional love, support and kindness you have shown to me throughout my life. Thank you to a wonderful sister – Helen – for your friendship and support. A special thanks to my girlfriend – Rebecca – for her continual love, care and support. I am truly grateful to you all. This thesis is dedicated to the memory of my father – John – who I love and miss dearly. I will always remember your kindness and support. Thank you for always believing in me. This thesis is for you. II Table of Contents Table of Contents Declaration……………………………………………………………………………………………………………………I Acknowledgements……………………………………………………………………………………………………..II Table of Contents………………………………………………………………………………………………………..III List of Figures and Tables……………………………………………………………………………………………..X List of Abbreviations ………………………………………………………………………………………………….XV Abstract………………………………………………………………………………………………………………….XVIII Chapter 1 Introduction………………………………………………………………………………………1 1.1 Pre-mRNA splicing…………………………………………………………………1 1.1.1 One gene, multiple mRNAs……………………………………………………….1 1.1.2 General pre-mRNA processing…………………………………………………..2 1.1.3 Splicing and splice site recognition by the spliceosome……………3 1.1.4 The splicing reaction.…………………………………………………………………5 1.1.5 The minor spliceosome…………………………………….………………………7 1.1.6 Alternative splicing……………………………………………………….............8 1.1.7 Regulation of alternative splicing………………………………………………9 1.1.7.1 Cis-regulatory sequences…………………………………………………………10 1.1.7.1.1 Splice site strength…………………………………………………………………10 1.1.7.1.2 Splicing enhancer and silencer sequences………………………………10 1.1.7.2 Trans-regulatory proteins………………………………………………………11 1.1.8 The SR-protein family………………………………………………………………12 1.1.9 Regulation of SR-protein activity……………………………………………12 1.1.10 Models of splicing regulation by SR-proteins…………………………13 1.1.11 Other factors that influence splicing………………………………………15 1.2 The SR-like splicing factors Tra2α and Tra2β………………………...15 1.2.1 Tra2 proteins…………………………………………………………………………15 1.2.2 Human Tra2α and Tra2β proteins……………………………………………16 1.2.3 The TRA2B gene generates multiple mRNA isoforms………………17 1.2.4 Tra2β protein structure and sequence specificity……………………18 1.2.5 Phosphorylation of Tra2β………………………………………………………20 1.2.6 Well characterised RNA targets of vertebrate Tra2 proteins……21 1.2.7 The physiological functions of Tra2β………………………..……………22 1.3 Alternative splicing in cancer………………………………………..........23 1.3.1 Introduction……………………………………………………………………………23 1.3.2 Mutations within cis-elements………………………………………………24 1.3.3 Trans-acting factors in cancer…………………………………………………25 1.3.4 Tra2β expression in cancer………………………………………………………26 1.3.5 Breast cancer and the MDA-MB-231 cell line…………………………27 III Table of Contents 1.3.6 Alternatively spliced isoforms as potential biomarkers and therapeutic targets in cancer……………………………........................28 1.4 Methodologies for dissecting alternative splicing……..............30 1.4.1 Introduction……………………………………………………………………………30 1.4.2 Model systems using minigenes……………………………………………30 1.4.3 Alternative splicing microarrays………………………………………………31 1.4.4 SELEX………………………………………………………………………………………31 1.4.5 UV cross-linking and immunoprecipitation (CLIP)……………………31 1.4.6 RNA-seq…………………………………………………………………………………33 1.5 Research aims and objectives………………………………………………34 Chapter 2 Functional dissection of splicing regulation by the RNA-binding protein Tra2β………………………………………………………………………………………………35 2.1 Introduction…………………………………………………………………………35 2.2 Aims……………………………………………………………………………………36 2.3 Materials and Methods…………………………………………………………37 2.3.1 Cell culture………………………………………………………………………………37 2.3.1.1 Cell lines…………………………………………………………………………………37 2.3.1.2 HEK-293…………………………………………………………………………………37 2.3.1.3 MCF-7……………………………………………………………………………………37 2.3.1.4 MDA-MB-231…………………………………………………………………………37 2.3.1.5 Routine cell passage………………………………………………………………37 2.3.1.6 Cell line maintenance………………………………………………………………38 2.3.1.7 Cryopreservation of cells…………………………………………………………38 2.3.1.8 Cell counting……………………………………………………………………………38 2.3.2 Minigene splicing assays…………………………………………………………39 2.3.2.1 Minigene transfections……………………………………………………………39 2.3.2.2 RNA extraction ………………………………………………………………………39 2.3.2.4 One-step RT-PCR……………………………………………………………………40 2.3.2.5 Capillary gel electrophoresis (QIAxcel)……………………………………40 2.3.2.6 Calculation of percentage splicing inclusion (PSI)……………………41 2.3.3 Western Immunoblotting………………………………..………………………41 2.3.4 Mutation of Tra2β binding sites………………………………………………41 2.3.4.1 Site-directed mutagenesis of the Nasp-T minigenes………………41 2.3.4.2 Molecular cloning……………………………………………………………………45 2.3.4.3 Sequencing………………………………………………………………………………46 2.3.5 In silico prediction of Tra2β targets from a panel of breast cancer associated alternative splicing events……………………………………46 2.3.6 Molecular cloning of the breast cancer associated exons into the pXJ41 minigene………………………………………………………………………46 2.3.7 siRNA transfection…………………………………………………………………47 2.3.8 Splicing analysis of endogenous targets…………………………………48 IV Table of Contents 2.4 Results…………………………………………………………………………………50 2.4.1 Investigating splicing regulation of Tra2β-bound exons identified from the Tra2β HITS-CLIP experiment……………………………………50 2.4.1.1 Investigating splicing regulation of candidate cassette exons using a minigene assay……………………………………………………………50 2.4.1.2 Tra2β activates splicing inclusion of a poison exon from Tra2a………………………………………………………………………………………52 2.4.1.3 Investigating Tra2β mediated splicing regulation of the Nasp-T exon using mutagenesis…………………………………………………………52 2.4.1.4 Tra2β promotes splicing inclusion of the Nasp-T exon through multiple redundant binding sites……………………………………………54 2.4.2 Investigating the functional effect of removing the RS1 domain or RRM of Tra2β in splicing regulation……………………………………60 2.4.2.1 Direct RNA-binding was required for splicing activation of most Tra2β responsive minigenes……………………………………………………60 2.4.2.2 The Tra2β construct lacking the RS1 domain functioned as a splicing repressor……………………………………………………………………62 2.4.3 Investigating regulation of alternative 3' splice sites identified from the Tra2β HITS-CLIP experiment……………………………………62 2.4.4 Investigating splicing regulation of breast cancer-associated
Load more

Recommended publications
  • Accepted By:- Signature Redacted Department of Biology Graduate Co-Chair: Michael T
    EXPLORING THE FUNCTIONAL CONSERVATION OF MUSCLEBLIND (MBL) PROTEINS by MASSACH USETTS INSTITUTE Julia C. Oddo d o ECHNOLOGY B.S. Molecular, Cellular, and Developmental Biology, SE 1 7 2015 Minor Biochemistry 2011 LIB RARIES SUBMITTED TO THE DEPARTMENT OF BIOLOGY IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTERS OF SCIENCE IN BIOLOGY AT THE MASSACHUSETTS INSTITUTE OF TECHNOLOGY SEPTEMBER 2015 C 2015 Massachusetts Institute of Technology. All rights reserved. The author hereby grants to MIT permission to reproduce and to distribute publicly paper and electronic copies of this thesis document in whole or in part in any medium now known or hereafter created. Signature redacted Signature of Auth or:_ Department of Biology May 22, 2015 Certified by: Signature redacte Thesis Supervisor: Chris B. Burge Professor of Biology and Biological Engineering Director Program CSB Certified by: Signature redactec Thesis Co-Supervisor: Eric T. Wang Research Fellow Accepted by:- Signature redacted Department of Biology Graduate Co-Chair: Michael T. Hemann Associate Professor of Biology 1 EXPLORING THE FUNCTIONAL CONSERVATION OF MUSCLEBLIND (MBL) PROTEINS by Julia C. Oddo Submitted to the Department of Biology on September 8th, 2015 in Partial Fulfillment of the Requirements for the Degree of Master of Science in Biology ABSTRACT Muscleblind (Mbl) is an evolutionarily conserved family of proteins involved in many aspects of RNA metabolism, including alternative splicing. Disruption of Muscleblind in several animals lends to a variety of defects and disease, including the multi-systemic disorder Myotonic Dystrophy (DM). Though much is known about the involvement of Muscleblind in DM, there is much basic knowledge of the protein's function to be discovered.
    [Show full text]
  • Mapping of Diabetes Susceptibility Loci in a Domestic Cat Breed with an Unusually High Incidence of Diabetes Mellitus
    G C A T T A C G G C A T genes Article Mapping of Diabetes Susceptibility Loci in a Domestic Cat Breed with an Unusually High Incidence of Diabetes Mellitus 1,2, 3, 4 5 Lois Balmer y , Caroline Ann O’Leary y, Marilyn Menotti-Raymond , Victor David , Stephen O’Brien 6,7, Belinda Penglis 8, Sher Hendrickson 9, Mia Reeves-Johnson 3, 3 10 3 3,11, Susan Gottlieb , Linda Fleeman , Dianne Vankan , Jacquie Rand z and 1, , Grant Morahan * z 1 Centre for Diabetes Research, Harry Perkins Institute for Medical Research, University of Western Australia, Nedlands 6009, Australia; [email protected] 2 School of Medical and Health Sciences, Edith Cowan University, Joondalup, Perth 6027, Australia 3 School of Veterinary Science, the University of Queensland, Gottan 4343, Australia; [email protected] (C.A.O.); [email protected] (M.R.-J.); [email protected] (S.G.); [email protected] (D.V.); [email protected] (J.R.) 4 Laboratory of Genomic Diversity, Center for Cancer Research (FNLCR), Frederick, MD 21702, USA; [email protected] 5 Laboratory of Basic Research, Center for Cancer Research (FNLCR), National Cancer Institute, Frederick, MD 21702, USA; [email protected] 6 Laboratory of Genomics Diversity, Center for Computer Technologies, ITMO University, 197101 St. Petersburg, Russia; [email protected] 7 Guy Harvey Oceanographic Center, Halmos College of Arts and Sciences, Nova Southeastern University, Ft Lauderdale, FL 33004, USA 8 IDEXX Laboratories, East Brisbane 4169, Australia; [email protected] 9 Department of Biology, Shepherd University, Shepherdstown, WV 25443, USA; [email protected] 10 Animal Diabetes Australia, Melbourne 3155, Australia; l.fl[email protected] 11 American College of Veterinary Internal Medicine, University of Zurich, 8006 Zurich, Switzerland * Correspondence: [email protected] These authors contributed equally to this work.
    [Show full text]
  • Supplementary Materials
    Supplementary materials Supplementary Table S1: MGNC compound library Ingredien Molecule Caco- Mol ID MW AlogP OB (%) BBB DL FASA- HL t Name Name 2 shengdi MOL012254 campesterol 400.8 7.63 37.58 1.34 0.98 0.7 0.21 20.2 shengdi MOL000519 coniferin 314.4 3.16 31.11 0.42 -0.2 0.3 0.27 74.6 beta- shengdi MOL000359 414.8 8.08 36.91 1.32 0.99 0.8 0.23 20.2 sitosterol pachymic shengdi MOL000289 528.9 6.54 33.63 0.1 -0.6 0.8 0 9.27 acid Poricoic acid shengdi MOL000291 484.7 5.64 30.52 -0.08 -0.9 0.8 0 8.67 B Chrysanthem shengdi MOL004492 585 8.24 38.72 0.51 -1 0.6 0.3 17.5 axanthin 20- shengdi MOL011455 Hexadecano 418.6 1.91 32.7 -0.24 -0.4 0.7 0.29 104 ylingenol huanglian MOL001454 berberine 336.4 3.45 36.86 1.24 0.57 0.8 0.19 6.57 huanglian MOL013352 Obacunone 454.6 2.68 43.29 0.01 -0.4 0.8 0.31 -13 huanglian MOL002894 berberrubine 322.4 3.2 35.74 1.07 0.17 0.7 0.24 6.46 huanglian MOL002897 epiberberine 336.4 3.45 43.09 1.17 0.4 0.8 0.19 6.1 huanglian MOL002903 (R)-Canadine 339.4 3.4 55.37 1.04 0.57 0.8 0.2 6.41 huanglian MOL002904 Berlambine 351.4 2.49 36.68 0.97 0.17 0.8 0.28 7.33 Corchorosid huanglian MOL002907 404.6 1.34 105 -0.91 -1.3 0.8 0.29 6.68 e A_qt Magnogrand huanglian MOL000622 266.4 1.18 63.71 0.02 -0.2 0.2 0.3 3.17 iolide huanglian MOL000762 Palmidin A 510.5 4.52 35.36 -0.38 -1.5 0.7 0.39 33.2 huanglian MOL000785 palmatine 352.4 3.65 64.6 1.33 0.37 0.7 0.13 2.25 huanglian MOL000098 quercetin 302.3 1.5 46.43 0.05 -0.8 0.3 0.38 14.4 huanglian MOL001458 coptisine 320.3 3.25 30.67 1.21 0.32 0.9 0.26 9.33 huanglian MOL002668 Worenine
    [Show full text]
  • Nuclear PTEN Safeguards Pre-Mrna Splicing to Link Golgi Apparatus for Its Tumor Suppressive Role
    ARTICLE DOI: 10.1038/s41467-018-04760-1 OPEN Nuclear PTEN safeguards pre-mRNA splicing to link Golgi apparatus for its tumor suppressive role Shao-Ming Shen1, Yan Ji2, Cheng Zhang1, Shuang-Shu Dong2, Shuo Yang1, Zhong Xiong1, Meng-Kai Ge1, Yun Yu1, Li Xia1, Meng Guo1, Jin-Ke Cheng3, Jun-Ling Liu1,3, Jian-Xiu Yu1,3 & Guo-Qiang Chen1 Dysregulation of pre-mRNA alternative splicing (AS) is closely associated with cancers. However, the relationships between the AS and classic oncogenes/tumor suppressors are 1234567890():,; largely unknown. Here we show that the deletion of tumor suppressor PTEN alters pre-mRNA splicing in a phosphatase-independent manner, and identify 262 PTEN-regulated AS events in 293T cells by RNA sequencing, which are associated with significant worse outcome of cancer patients. Based on these findings, we report that nuclear PTEN interacts with the splicing machinery, spliceosome, to regulate its assembly and pre-mRNA splicing. We also identify a new exon 2b in GOLGA2 transcript and the exon exclusion contributes to PTEN knockdown-induced tumorigenesis by promoting dramatic Golgi extension and secretion, and PTEN depletion significantly sensitizes cancer cells to secretion inhibitors brefeldin A and golgicide A. Our results suggest that Golgi secretion inhibitors alone or in combination with PI3K/Akt kinase inhibitors may be therapeutically useful for PTEN-deficient cancers. 1 Department of Pathophysiology, Key Laboratory of Cell Differentiation and Apoptosis of Chinese Ministry of Education, Shanghai Jiao Tong University School of Medicine (SJTU-SM), Shanghai 200025, China. 2 Institute of Health Sciences, Shanghai Institutes for Biological Sciences of Chinese Academy of Sciences and SJTU-SM, Shanghai 200025, China.
    [Show full text]
  • An Ancient Germ Cell-Specific RNA-Binding Protein Protects
    RESEARCH ARTICLE An ancient germ cell-specific RNA-binding protein protects the germline from cryptic splice site poisoning Ingrid Ehrmann1, James H Crichton2, Matthew R Gazzara3,4, Katherine James5, Yilei Liu1,6, Sushma Nagaraja Grellscheid1,7, TomazˇCurk8, Dirk de Rooij9,10, Jannetta S Steyn11, Simon Cockell11, Ian R Adams2, Yoseph Barash3,12*, David J Elliott1* 1Institute of Genetic Medicine, Newcastle University, Newcastle, United Kingdom; 2MRC Human Genetics Unit, MRC Institute of Genetics and Molecular Medicine, University of Edinburgh, Edinburgh, United Kingdom; 3Department of Genetics, Perelman School of Medicine, University of Pennsylvania, Philadelphia, United States; 4Department of Biochemistry and Biophysics, Perelman School of Medicine, University of Pennsylvania, Philadelphia, United States; 5Life Sciences, Natural History Museum, London, United Kingdom; 6Department of Plant and Microbial Biology, University of Zu¨ rich, Zu¨ rich, Switzerland; 7School of Biological and Biomedical Sciences, University of Durham, Durham, United Kingdom; 8Laboratory of Bioinformatics, Faculty of Computer and Information Sciences, University of Ljubljana, Ljubljana, Slovenia; 9Reproductive Biology Group, Division of Developmental Biology, Department of Biology, Faculty of Science, Utrecht University, Utrecht, The Netherlands; 10Center for Reproductive Medicine, Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands; 11Bioinformatics Support Unit, Faculty of Medical Sciences, Newcastle University, Newcastle, United Kingdom; 12Department of Computer and Information Science, University of Pennsylvania, Philadelphia, United States *For correspondence: [email protected] (YB); [email protected] (DJE) Competing interests: The Abstract Male germ cells of all placental mammals express an ancient nuclear RNA binding authors declare that no protein of unknown function called RBMXL2. Here we find that deletion of the retrogene encoding competing interests exist.
    [Show full text]
  • Review Article Expression of Tra2 in Cancer Cells As a Potential Contributory Factor to Neoplasia and Metastasis
    Hindawi Publishing Corporation International Journal of Cell Biology Volume 2013, Article ID 843781, 9 pages http://dx.doi.org/10.1155/2013/843781 Review Article Expression of Tra2 in Cancer Cells as a Potential Contributory Factor to Neoplasia and Metastasis Andrew Best,1 Caroline Dagliesh,1 Ingrid Ehrmann,1 Mahsa Kheirollahi-Kouhestani,1 Alison Tyson-Capper,2 and David J. Elliott1 1 Institute of Genetic Medicine, Newcastle University, Central Parkway, Newcastle upon Tyne NE1 3BZ, UK 2 Institute of Cellular Medicine, Newcastle University, Framlington Place, Newcastle upon Tyne NE2 4HH, UK Correspondence should be addressed to David J. Elliott; [email protected] Received 2 May 2013; Accepted 9 June 2013 Academic Editor: Claudia Ghigna Copyright © 2013 Andrew Best et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. The splicing regulator proteins SRSF1 (also known as ASF/SF2) and SRSF3 (also known as SRP20) belong to the SR family of proteins and can be upregulated in cancer. The SRSF1 gene itself is amplified in some cancer cells, and cancer-associated changes in the expression of MYC also increase SRSF1 gene expression. Increased concentrations of SRSF1 protein promote prooncogenic splicing patterns of a number of key regulators of cell growth. Here, we review the evidence that upregulation of the SR-related Tra2 protein might have a similar role in cancer cells. The TRA2B gene encoding Tra2 is amplified in particular tumours including those of the lung, ovary, cervix, stomach, head, and neck.
    [Show full text]
  • A High-Throughput Approach to Uncover Novel Roles of APOBEC2, a Functional Orphan of the AID/APOBEC Family
    Rockefeller University Digital Commons @ RU Student Theses and Dissertations 2018 A High-Throughput Approach to Uncover Novel Roles of APOBEC2, a Functional Orphan of the AID/APOBEC Family Linda Molla Follow this and additional works at: https://digitalcommons.rockefeller.edu/ student_theses_and_dissertations Part of the Life Sciences Commons A HIGH-THROUGHPUT APPROACH TO UNCOVER NOVEL ROLES OF APOBEC2, A FUNCTIONAL ORPHAN OF THE AID/APOBEC FAMILY A Thesis Presented to the Faculty of The Rockefeller University in Partial Fulfillment of the Requirements for the degree of Doctor of Philosophy by Linda Molla June 2018 © Copyright by Linda Molla 2018 A HIGH-THROUGHPUT APPROACH TO UNCOVER NOVEL ROLES OF APOBEC2, A FUNCTIONAL ORPHAN OF THE AID/APOBEC FAMILY Linda Molla, Ph.D. The Rockefeller University 2018 APOBEC2 is a member of the AID/APOBEC cytidine deaminase family of proteins. Unlike most of AID/APOBEC, however, APOBEC2’s function remains elusive. Previous research has implicated APOBEC2 in diverse organisms and cellular processes such as muscle biology (in Mus musculus), regeneration (in Danio rerio), and development (in Xenopus laevis). APOBEC2 has also been implicated in cancer. However the enzymatic activity, substrate or physiological target(s) of APOBEC2 are unknown. For this thesis, I have combined Next Generation Sequencing (NGS) techniques with state-of-the-art molecular biology to determine the physiological targets of APOBEC2. Using a cell culture muscle differentiation system, and RNA sequencing (RNA-Seq) by polyA capture, I demonstrated that unlike the AID/APOBEC family member APOBEC1, APOBEC2 is not an RNA editor. Using the same system combined with enhanced Reduced Representation Bisulfite Sequencing (eRRBS) analyses I showed that, unlike the AID/APOBEC family member AID, APOBEC2 does not act as a 5-methyl-C deaminase.
    [Show full text]
  • RBMX Family Proteins Connect the Fields of Nuclear RNA Processing
    International Journal of Biochemistry and Cell Biology 108 (2019) 1–6 Contents lists available at ScienceDirect International Journal of Biochemistry and Cell Biology journal homepage: www.elsevier.com/locate/biocel RBMX family proteins connect the fields of nuclear RNA processing, disease and sex chromosome biology T ⁎ David J. Elliott , Caroline Dalgliesh, Gerald Hysenaj, Ingrid Ehrmann Institute of Genetic Medicine, Newcastle University, Newcastle-upon-Tyne, NE1 3BZ, UK ARTICLE INFO ABSTRACT Keywords: RBMX is a ubiquitously expressed nuclear RNA binding protein that is encoded by a gene on the X chromosome. RNA splicing RBMX belongs to a small protein family with additional members encoded by paralogs on the mammalian Y Gene expression chromosome and other chromosomes. These RNA binding proteins are important for normal development, and Brain development also implicated in cancer and viral infection. At the molecular level RBMX family proteins contribute to splicing Testis control, transcription and genome integrity. Establishing what endogenous genes and pathways are controlled by Cancer RBMX and its paralogs will have important implications for understanding chromosome biology, DNA repair and mammalian development. Here we review what is known about this family of RNA binding proteins, and identify important current questions about their functions. 1. Introduction et al., 1993). While RBMX is expressed ubiquitously through the body, RBMY genes are specifically expressed in germ cells (cells that even- RBMX (an acronym of RNA Binding Motif protein, X-linked) was tually develop into sperm). Multiple RBMY genes are present on the originally identified as one of a functionally diverse group of nuclear long arm of the human Y chromosome, each encoding 496 amino acid proteins that bind to polyadenylated RNA.
    [Show full text]
  • Downloads from UCSC [69]
    Durham Research Online Deposited in DRO: 15 February 2013 Version of attached le: Published Version Peer-review status of attached le: Peer-reviewed Citation for published item: Grellscheid S, S. and Dalgliesh C , C. and Storbeck, M. and Best, A. and Liu, Y. and Jakubik, M. and Mende, Y. and Ehrmann, I. and Curk, T. and Rossbach, K. and Bourgeois, C.F. and St¡evenin, J. and Grellscheid, D. and Jackson, M.S. and Wirth, B. and Elliott, D.J. (2011) 'Identication of evolutionarily conserved exons as regulated targets for the splicing activator tra2 in development.', PLoS genetics., 7 (12). e1002390. Further information on publisher's website: http://dx.doi.org/10.1371/journal.pgen.1002390 Publisher's copyright statement: Copyright: c 2011 Grellscheid et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Additional information: Use policy The full-text may be used and/or reproduced, and given to third parties in any format or medium, without prior permission or charge, for personal research or study, educational, or not-for-prot purposes provided that: • a full bibliographic reference is made to the original source • a link is made to the metadata record in DRO • the full-text is not changed in any way The full-text must not be sold in any format or medium without the formal permission of the copyright holders. Please consult the full DRO policy for further details. Durham University Library, Stockton Road, Durham DH1 3LY, United Kingdom Tel : +44 (0)191 334 3042 | Fax : +44 (0)191 334 2971 https://dro.dur.ac.uk Identification of Evolutionarily Conserved Exons as Regulated Targets for the Splicing Activator Tra2b in Development Sushma Grellscheid1.*, Caroline Dalgliesh1., Markus Storbeck2,3,4., Andrew Best1, Yilei Liu1¤a, Miriam Jakubik2,3,4, Ylva Mende2,3,4, Ingrid Ehrmann1, Tomaz Curk5, Kristina Rossbach2,3,4, Cyril F.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name transformer 2 beta homolog (Drosophila) Gene Symbol TRA2B Organism Human Gene Summary This gene encodes a nuclear protein which functions as sequence-specific serine/arginine splicing factor which plays a role in mRNA processing splicing patterns and gene expression. Alternative splicing results in multiple transcript variants. Gene Aliases DKFZp686F18120, Htra2-beta, SFRS10, SRFS10, TRA2-BETA, TRAN2B RefSeq Accession No. NC_000003.11, NT_005612.16 UniGene ID Hs.533122 Ensembl Gene ID ENSG00000136527 Entrez Gene ID 6434 Assay Information Unique Assay ID qHsaCED0005186 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000453386, ENST00000382191 Amplicon Context Sequence CCGATTCCCAACATGACGCCTGCGAGTAGACATGGGAGAATGGCTGTGGCTGT GCCGTCTACGATAATCTCGACTGTAAGACCTGCTACGTGATCGTCTATGGGAGC GGGAG Amplicon Length (bp) 82 Chromosome Location 3:185643252-185643363 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 100 R2 0.9997 cDNA Cq 18.17 cDNA Tm (Celsius) 83 gDNA Cq 23.5 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report TRA2B, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Human Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online.
    [Show full text]
  • The Role of Short RNA Loops in Recognition of a Single-Hairpin Exon Derived from a Mammalian- Wide Interspersed Repeat
    RNA Biology ISSN: 1547-6286 (Print) 1555-8584 (Online) Journal homepage: http://www.tandfonline.com/loi/krnb20 The role of short RNA loops in recognition of a single-hairpin exon derived from a mammalian- wide interspersed repeat Jana Kralovicova, Alpa Patel, Mark Searle & Igor Vorechovsky To cite this article: Jana Kralovicova, Alpa Patel, Mark Searle & Igor Vorechovsky (2015) The role of short RNA loops in recognition of a single-hairpin exon derived from a mammalian-wide interspersed repeat, RNA Biology, 12:1, 54-69, DOI: 10.1080/15476286.2015.1017207 To link to this article: http://dx.doi.org/10.1080/15476286.2015.1017207 © 2015 The Author(s). Published by Taylor & View supplementary material Francis Group, LLC© Jana Kralovicova, Alpa Patel, Mark Searle, and Igor Vorechovsky Published online: 31 Mar 2015. Submit your article to this journal Article views: 343 View related articles View Crossmark data Citing articles: 1 View citing articles Full Terms & Conditions of access and use can be found at http://www.tandfonline.com/action/journalInformation?journalCode=krnb20 Download by: [University of Southampton] Date: 12 May 2016, At: 06:23 RESEARCH PAPER RNA Biology 12:1, 54--69; January 2015; Published with license by Taylor & Francis Group, LLC The role of short RNA loops in recognition of a single-hairpin exon derived from a mammalian-wide interspersed repeat Jana Kralovicova1,2, Alpa Patel2, Mark Searle3, and Igor Vorechovsky1,* 1University of Southampton; Faculty of Medicine; Southampton, UK; 2Institute of Neuroimmunology; Slovak Academy of Sciences; Bratislava, Slovak Republic; 3University of Nottingham; Centre for Biomolecular Sciences; School of Chemistry; Nottingham, UK Keywords: bulge, exon, hairpin, mutation, splicing enhancers and silencers, tetraloop, transposable elements, triloop Abbreviations: TE, transposable element; SINE, Short INterspersed Element; MIR, mammalian-wide interspersed repeat; SSO, splice-switching oligonucleotides; FGB, gene for fibrinogen; ESE, exonic splicing enhancer, ESS, exonic splicing silencer.
    [Show full text]
  • Hnrnp A/B Proteins: an Encyclopedic Assessment of Their Roles in Homeostasis and Disease
    biology Review hnRNP A/B Proteins: An Encyclopedic Assessment of Their Roles in Homeostasis and Disease Patricia A. Thibault 1,2 , Aravindhan Ganesan 3, Subha Kalyaanamoorthy 4, Joseph-Patrick W. E. Clarke 1,5,6 , Hannah E. Salapa 1,2 and Michael C. Levin 1,2,5,6,* 1 Office of the Saskatchewan Multiple Sclerosis Clinical Research Chair, University of Saskatchewan, Saskatoon, SK S7K 0M7, Canada; [email protected] (P.A.T.); [email protected] (J.-P.W.E.C.); [email protected] (H.E.S.) 2 Department of Medicine, Neurology Division, University of Saskatchewan, Saskatoon, SK S7N 0X8, Canada 3 ArGan’s Lab, School of Pharmacy, Faculty of Science, University of Waterloo, Waterloo, ON N2L 3G1, Canada; [email protected] 4 Department of Chemistry, Faculty of Science, University of Waterloo, Waterloo, ON N2L 3G1, Canada; [email protected] 5 Department of Health Sciences, College of Medicine, University of Saskatchewan, Saskatoon, SK S7N 5E5, Canada 6 Department of Anatomy, Physiology and Pharmacology, University of Saskatchewan, Saskatoon, SK S7N 5E5, Canada * Correspondence: [email protected] Simple Summary: The hnRNP A/B family of proteins (comprised of A1, A2/B1, A3, and A0) contributes to the regulation of the majority of cellular RNAs. Here, we provide a comprehensive overview of what is known of each protein’s functions, highlighting important differences between them. While there is extensive information about A1 and A2/B1, we found that even the basic Citation: Thibault, P.A.; Ganesan, A.; functions of the A0 and A3 proteins have not been well-studied.
    [Show full text]