Genes for Direct Methylation of Glycine Provide High Levels of Glycinebetaine and Abiotic-Stress Tolerance in Synechococcus and Arabidopsis
Total Page：16
File Type：pdf, Size：1020Kb
Genes for direct methylation of glycine provide high levels of glycinebetaine and abiotic-stress tolerance in Synechococcus and Arabidopsis Rungaroon Waditee*†, Md. Nazmul H. Bhuiyan*†, Vandna Rai*, Kenji Aoki‡, Yoshito Tanaka‡, Takashi Hibino‡, Shigetoshi Suzuki§, Jun Takano¶, Andre´ T. Jagendorfʈ, Tetsuko Takabe**, and Teruhiro Takabe*†† *Research Institute, ‡Graduate School of Environmental and Human Sciences, and §School of Agriculture, Meijo University, Nagoya 468-8502, Japan; ¶Shimadzu Company, Nakagyou-ku, Kyoto 604-8511, Japan; ʈDepartment of Plant Biology, Cornell University, Ithaca, NY 14853; and **Graduate School of Agricultural Science, Nagoya University, Nagoya 464-8601, Japan Contributed by Andre´T. Jagendorf, December 8, 2004 Betaine is an important osmoprotectant, synthesized by many methylation (20). Two N-methyltransferase enzymes were involved plants in response to abiotic stresses. Almost all known biosyn- in betaine synthesis. One enzyme [A. halophytica glycine sarcosine thetic pathways of betaine are two-step oxidations of choline. methyltransferase (ApGSMT)] catalyzed the methylation reactions Recently, a biosynthetic pathway of betaine from glycine, cata- of glycine to sarcosine and sarcosine to dimethylglycine, respec- lyzed by two N-methyltransferase enzymes, was found. Here, the tively, and the other enzyme [A. halophytica dimethylglycine meth- potential role of N-methyltransferase genes for betaine synthesis yltransferase (ApDMT)] catalyzed the specific methylation of dim- was examined in a freshwater cyanobacterium, Synechococcus sp. ethylglycine to betaine (20). It was shown that a reaction product, PCC 7942, and in Arabidopsis plants. It was found that the coex- S-adenosyl-L-homocysteine (AdoHcy), a potent inhibitor of many pression of N-methyltransferase genes in Synechococcus caused methyltransferases, was a relatively weak inhibitor for betaine accumulation of a significant amount of betaine and conferred salt synthesis; and the final product, betaine, did not inhibit methylation tolerance to a freshwater cyanobacterium sufficient for it to activities even at a concentration of 1 M. become capable of growth in seawater. Arabidopsis plants ex- Here, we tested the potential role of genes that encode glycine pressing N-methyltransferase genes also accumulated betaine to a N-methyltransferases (ApGSMT and ApDMT) for betaine synthe- high level in roots, stems, leaves, and flowers and improved seed sis in a freshwater cyanobacterium Synechococcus sp. PCC 7942 and yield under stress conditions. Betaine levels were higher than in the higher plant, Arabidopsis. It was found that the coexpression those produced by choline-oxidizing enzymes. These results dem- of ApGSMT and ApDMT led to accumulation of significant onstrate the usefulness of glycine N-methyltransferase genes for amounts of betaine in Synechococcus cells and conferred sufficient the improvement of abiotic stress tolerance in crop plants. salt tolerance that the cells were capable of growth in seawater. Arabidopsis plants expressing ApGSMT and ApDMT accumulated cyanobacteria ͉ methyltransferase ͉ osmoprotectant ͉ stress resistance significant amounts of betaine in roots, stems, leaves, and flowers. Accumulation levels of betaine were higher than those of plants oday, Ϸ20% of the world’s cultivated land and nearly half of all transformed with choline-oxidizing enzymes. These results dem- Tirrigated lands are affected by high salinity (1). High salinity onstrated the usefulness of betaine synthesis from glycine for the causes ion imbalance and hyperosmotic stress in plants. Organisms construction of salt-tolerant crop plants. that thrive in hypersaline environments possess specific mecha- Materials and Methods nisms for the adjustment of their internal osmotic status. One such mechanism is the ability to accumulate low-molecular-weight or- Strains and Culture Conditions. Synechococcus sp. PCC 7942 cells ganic-compatible solutes such as sugars, some amino acids, and were grown at 30°C under continuous fluorescent white light, 40 ⅐ Ϫ2⅐ Ϫ1 ϭ quaternary ammonium compounds (2–4). Glycine betaine (N,N,N- E m s ; E, einstein; 1 einstein 1 mol of photons) in BG11 trimethylglycine, hereafter betaine) is a major osmolyte (2–4). liquid medium and bubbled with 3% CO2. The Synechococcus cells Another mechanism for adaptation to high salinity is the exclusion expressing ApGSMT and ApDMT and Escherichia coli bet-cluster of the Naϩ ion from sodium-sensitive sites (5). Genetic engineering genes were grown in the same conditions as wild-type cells but ⅐ Ϫ1 techniques have been applied to improve the salt tolerance of plants supplemented with 10 g ml streptomycin. The growth of cya- (6–13). Considerable success has been demonstrated by manipu- nobacterial cells was monitored by measuring absorbance at 730 nm lating the Naϩ͞Hϩ antiporter genes (6–8). By contrast, the genetic with a Shimadzu UV-160A spectrophotometer. engineering of betaine synthesis has been hampered by low accu- mulation levels of betaine (9–13). Most known biosynthetic path- Construction of the Expression Vectors for ApGSMT and ApDMT in ways of betaine include a two-step oxidation of choline: choline 3 Cyanobacteria. The plasmids pUC303-Bm (21, 22) and pUC303-Bet betaine aldehyde 3 betaine. The first step is catalyzed by choline (13, 23) were used to transform control cells and for the expression monooxygenase (CMO) in plants (14), choline dehydrogenase of E. coli bet-cluster genes coding for the choline oxidation enzymes CDH and betaine aldehyde dehydrogenase, respectively. The plas- (CDH) in animals and bacteria (15, 16), and choline oxidase in ϩ͞ ϩ some bacteria (11, 17). The second step is catalyzed by NADϩ- mid pUC303-ApNhaP was used for the expression of the Na H dependent betaine aldehyde dehydrogenase in all organisms (15, antiporter gene from A. halophytica (ApNhaP1) (23). For the 18, 19), although in some bacteria, CDH and choline oxidase also construction of a coexpression vector, the region containing both catalyze the second step (15–17). Hitherto, all attempts at betaine synthesis have been carried out by using choline-oxidizing enzymes Abbreviations: ApNhaP1, Naϩ͞Hϩ antiporter from A. halophytica; ApDMT, A. halophytica (9–13). The supply and transport of betaine precursors such as dimethylglycine methyltransferase; ApGSMT, A. halophytica glycine sarcosine methyl- choline, ethanolamine, and serine to plastids may be of importance, transferase; CDH, choline dehydrogenase; CMO, choline monooxygenase; MS, Murashige because these precursors have been suggested to be limiting and Skoog; SAM, S-adenosylmethionine. (12, 13). †R.W. and M.N.H.B. contributed equally to this work. Recently, we showed that a halotolerant cyanobacterium, Aph- ††To whom correspondence should be addressed. E-mail: [email protected]. anothece halophytica, synthesizes betaine from glycine by three-step © 2005 by The National Academy of Sciences of the USA 1318–1323 ͉ PNAS ͉ February 1, 2005 ͉ vol. 102 ͉ no. 5 www.pnas.org͞cgi͞doi͞10.1073͞pnas.0409017102 Downloaded by guest on October 1, 2021 the promoter and the coding region of ApGSMT was amplified through a 0.22-m membrane filter. The filtrate was dried in a from genomic DNA of A. halophytica by PCR by using the primer vacuum and stored at Ϫ20°C until use. At the time of analysis, set, GSMTbamF, 5Ј-ATGGATCCTTCAATGTAAGGGGTT- samples were dissolved in mobile-phase solution (pH 2.6) contain- GCT-3Ј and GSMTbamR, 5Ј-CGGGATCC TTAATCTTTTTT- ing 14.1 g of trilithium citrate tetrahydrate, 70 ml of 2-methoxyetha- CGCAAC-3Ј. The corresponding region for ApDMT was ampli- nol, and 13.3 ml of 60% HClO4 per liter and injected into an amino fied by using the primer set, DMTsalF, 5Ј-GCGTCGAC- acid analyzer with a shim-pack Li column (Shimadzu). CTAGGGT TTGTGGAAC TT-3Ј and DMTsalR, 5Ј-ACGTC- GACACCAAGAATCTGCTTAGT T-3Ј. PCR products were Other Methods. SDS͞PAGE and Western blotting analysis were subcloned into pBSKϩ at the EcoRV restriction site and then carried out according to the standard protocol, as described (20). sequenced. DNA fragments covering the promoter and the coding Antibodies raised against the ApGSMT and ApDMT proteins were region of ApGSMT and ApDMT were prepared by digestion with prepared as described (20). Protein contents were determined by BamHI and SalI, respectively. Each fragment was ligated into the the modified Lowry method (25). Betaine was extracted and corresponding site of the shuttle vector, pUC303. The generated analyzed by time-of-flight mass spectroscopy, as described (13). plasmid pUC303-ApGSMT͞DMT was transferred to Synechococ- Methyltransferase activities were carried out as described (20). cus cells, as described (23). The transformants were selected on BG11 agar containing 10 g⅐mlϪ1 streptomycin. Results Coexpression of N-Methyltransferases ApGSMT and ApDMT in a Construction of Transgenic Arabidopsis Expressing ApGSMT and Ap- Freshwater Cyanobacterium Synechococcus sp. PCC7942 Conferred DMT. The plasmids pApGSMT-SKϩ and pApDMT-SKϩ, which the Salt Tolerance of Cells Capable of Growth in Seawater. It has been contain the coding regions of ApGSMT and ApDMT in pBSKϩ, demonstrated that Synechococcus sp. PCC 7942 cells could grow in respectively (20), were digested with NcoI and BamHI. The result- BG11 medium containing 0.35 M NaCl but not at 0.375 M NaCl, ing fragments were ligated into the NcoI and BglII sites of whereas cells expressing choline-oxidizing genes, such as bet-cluster pCAMBIA1301, generating pApGSMT-CAMBIA and