Conservation and Phylogeography of Taiwan Paradise Fish, Macropodus Opercularis Linnaeus

Acta Zoologica Taiwanica 10(2): 121-134 (1999)

Conservation and Phylogeography of Taiwan Paradise Fish, Macropodus opercularis Linnaeus

Tzi-Yuan Wang1, Chyng-Shyan Tzeng1, and Shih-Chieh Shen2

1Department of Life Science, National Tsing Hua University, Hsinchu, Taiwan 30043, R.O.C. 2Department of Zoology, National Taiwan University, Taipei, Taiwan 10617, R.O.C.

ABSTRACT

The paradise fish (Macropodus opercularis) is naturally distributed in western Taiwan, but is rare now because of such factors as environment pollution and habitat loss. Conservation of this animal in Taiwan is becoming more urgent. Some closely related species, such as Chinese paradise fish (M. chinensis), are difficult to distinguish with morphological characters. We sequenced and compared the control region of mitochondrial DNA (mtDNA) to reveal the genetic distance and molecular phylogeny of paradise fish populations from different geographical regions: Taiwan, Singapore, and mainland China. The interspecific distance between M. opercularis (Taiwan, Singapore) and M. chinensis (Zhejiang, Jilin) is 0.1341 ±0.0124, much more highly divergent than the distance between the Taiwanese and Singaporean populations, or within the Chinese populations. Five haplotypes from 11 specimens of the Taiwanese native population have been identified from a 1034-bp-length of mtDNA. However, the lower haplotypic diversity (H = 0.68) indicates a decreasing population in Taiwan, in contrast with the M. chinensis (H = 0.89). In addition, the unique genotype in Miaoli and Taichung may imply their subdivision because of exotic input of fish from a different geographic region. Thus conservation work should focus on avoiding the random release of paradise fishes into the wild.

Key words: Macropodus opercularis, Paradise fish, Mitochondrial DNA, Taiwan

of the first tropical fishes that 19th century INTRODUCTION Europeans kept as pets (Shen et al., 1991). Tai- Only three species of Anabantoidei fishes wan paradise fish can be further divided into occur in Taiwan: Anabas testudineus, Macropo- four groups, according to their body color: dus opercularis, and Tricogaster trichopterus. A. Nankang (Taipei) type, Sanyi (Miaoli) type, testudineus is close to extirpation on this Shyrshoeike (Taichung) type, and Malaysia island, while the last species is assumed to have peninsula type (Jan et al., 1992). The natural been introduced from other areas. As a result, distribution of paradise fish has been in west- paradise fish, M. opercularis, is the only species ern Taiwan, but is now limited because of envi- of the Subfamily Macropodinae, Perciformes: ronment pollution, habitat loss, etc. Belontiidae (Forselius, 1957; Liem, 1963; Nel- M. opercularis is dispersed extensively in son, 1994) in Taiwan. The so-called colorful plain and lower-elevation hills of western and rabbit sold for aquariumuse is actually an northeastern Taiwan. Natural ponds, minor introduced man-bred paradise fish strain. creeks, and farm drains areas-slow-moving, Some strains of paradise fish interbred with nearly quiescent waters are the preferred habi- other species have also become popular in the tats. However, the broad distribution has aquatic pet market. Paradise fish was also one dwindled to a sporadic occurrence according

121 Tzi-Yuan Wang, Chyng-Shyan Tzeng, and Shih-Chieh Shen

Table 1. Collection data and sample information. Bold letters indicate that the samples are collected from aquarium. The others are all native populations in this investigation. Scientific name Region, Country Colony Specimens number (analyzed number) Macropodus opercularis (Mo) Taipei, Taiwan MN 2 (1) Hsinchu, Taiwan MB 3 (2) Miaoli, Taiwan MS 4 (2) Taichung, Taiwan MK 3 (3) Chiayi, Taiwan MJ 3 (2) Pingtung, Taiwan MP 3 (1) Aquarium, Taiwan MU 3 (1) Duan, Guangxi DA 5 (*) Juhae, Guangdong JH 4 (*) Aquarium, Singapore SG 2 (2) Macropodus chinensis (Mc) Wuyih, Zhejiang WE 5 (3) Jyrlin, Jyrlin GL 2 (2) Trichopsis pumilus (Tp) Aquarium TP 3 (2) Betta splendens (Bs) Aquarium BS 3 (3) * Sample was preserved in formalin without successful mtDNA sequence data. to a 1991 investigation (Shen et al., 1991; Jan Korean peninsula in 1914, and have proven and Wu, 1994), despite the government's capable of reproducing in the wild. Recently, announcement to place the paradise fish in the Wakiyama (1997) employed 12 allozyme mark- list of rare and valuable species on 31 Aug. ers to analyze the relationships among 17 1990. species of Anabantoid fishes. The result con- Kimura (1937) first reported and estab- firmed anatomy-based classification of five lished data of the Anabantidae fishes in China. Macropodinae species: Betta splendens and M. Chen (1969) reported A. scandens and M. oper- opercularis were grouped together with cularis (Synonyms names: M. polyacanthus Parosphromenus deissneri, whereas Trichopsis Linnaeus, M. viridiauratus Oshima) in Taiwan vittatus and Pseduosphromenus dayi constituted thereafter. Chen (1969) stated that M. opercu- a separate group. laris could be found in Taipei, Taichung, and Jan and Wu (1994) investigated M. opercu- Luotung. Fig. 1A illustrates the distribution of laris since 1992, and 12 isolated, native, but the species native to southern China, the small populations are found in this investiga- Malaysia peninsula, Hainan I., Okinawa, and tion. Conservation of M. opercularis remains Taiwan (Oshima, 1934; Nelson, 1994). Both pressing, and conserving the genetic diversity Hong Kong- and Japan-inhabiting paradise between populations will directly influence fishes belong to either M. opercularis or M. chi- their long-term chance of survival. Resolving nensis (Oshima, 1934; Wen, 1981). Some simi- molecular phylogeny between two paradise lar species, such as Chinese paradise fish (M. fishes (M. opercularis and M. chinensis) appears chinensis) and M. opercularis, are difficult to to be the key to these problems, because they distinguish solely with morphological charac- are confused by traditional taxonomic meth- ters. The Chinese paradise fish originally ods. The mitochondrial DNA (mtDNA) con- spread from the western Korean peninsula, trol region has been shown to be a powerful then west of the Luohtung River to mainland marker in the analysis of inter- and intra-spe- China, to the north of the Yangtze River. The cific genetic differentiation owing to the imple- specimens in Japan were introduced from the mentation of rapid evolution rates than

122 Conservation and Phylogeography of Taiwan Paradise Fish, Macropodus opercularis Linnaeus

(A) (B)

Figure 1. Distribution of Macropodinae fishes in Asia (A); and (B) sampling locations of paradise fishes in Sin- gapore (SG), China (DA, JH, WE, GL), and Taiwan (MN, MB, MS, MJ, MP). Detailed information is given in table 1. remainder of the mtDNA genome (Brown et at 45 to 55 °C. Proteins and lipids were al., 1986; Lee et al., 1995; Sbisae et al., 1997). removed by phenol-chloroform extraction. Maternal inheritance of mtDNA genes also DNA was precipitated at -20 °C by adding two provides a sensitive tool for the detection of volumes of 100% ethanol. Pellets were washed population subdivision (Birky et al., 1989). with 70% ethanol, dried and resuspended in 50 In this study, we examine the genetic diver- µl TE (10 mM Tris-HCl, pH8.0; 1 mM EDTA, gence among samples of M. opercularis and M. pH 8.0). chinensis using the entire mtDNA control region to reveal the genetic information of M. PCR amplification and sequencing opercularis. Betta splendens and Trichopsis A segment of mtDNA that encompasses a pumilus are utilized as outgroups to compare part of the cytochrome b gene, tRNAThr gene, the molecular phylogeography among different tRNAPro gene, the control region, and a part of populations of M. opercularis. tRNAPhe gene, was chosen for sequencing analysis. The primers, Ec7, G22A, PE3, and MATERIALS AND METHODS PK3-2A, were modified from Tzeng et al. Sample collection and DNA extraction (1992); the primer PU was modified from Jean A total of 45 fully grown fishes were col- et al. (1995); the primers, PE4-1, PU4-1 and lected from western Taiwan, Zhejiang, Jilin, PU4-2, were used only for sequencing (Fig. 2, Guangdong, Guangxi, and Singapore from Sep. Table 2). 1996 to Dec. 1999 (Fig. 1, Table 1). Specimens PCR amplifications were performed in a 50- from Taiwan were kept alive in the laboratory. µl reaction volume containing 0.2 mM of Total genomic DNA was extracted from muscle dNTP, 0.2 µM of each primers and 10-500 ng or fin tissue, using a protocol modified from of genomic DNA, 1 unit of Taq polymerase Kocher et al. (1989). Approximately 50 mg of (HT Biotechnology Ltd., England), and the muscle tissue was placed in 700 µl of digestion buffer supplied by the manufacturers. The buffer (10 mM Tris-HCl, pH 8.0; 2 mM EDTA, amplification conditions were as follows: 30- 10 mM NaCl, 1% SDS, 10 mg/ml DTT, 0.5 40 cycles at 93 °C for 1 min of denaturation, mg/ml Proteinase K) and incubated overnight annealing at 45 to 55 °C for 1 min, and exten-

123 Tzi-Yuan Wang, Chyng-Shyan Tzeng, and Shih-Chieh Shen

Table 2. List of primers used in this study. Name Primer sequence Location of mtDNA Ec7 5’-ATYCTACGRTCAATYCC-3’ Cytochrome b PE3 5’-AACTTCCATCCTCAACTCCCAAAGC-3’ Pro-tRNA PE4-1 5’-TAATAATTATWCAGGAC-3’ Control region PK3-2A 5’-CTATTACTGGCATCTGG-3’ Control region G22A 5’-TGKWCCTGAAATAGGAACC-3’ Control region PU4-2 5’-TYYTAGGAGTTTAGGGGG-3’ Control region PU4-1 5’-GCTTTAATTAAGCTACG-3’ Phe-tRNA PU 5’-GGGCATTCTCACGGGGATGCG-3’ Phe-tRNA

Figure 2. Schematic diagram of partial mtDNA and the locations of eight primers. The primers, indicated by arrows, were used for amplification and sequencing. For the sequence of each primer see table 2.

Table 3. Specimen number and their haplotypes of mtDNA among different colonies. MN MB MS MK MJ MP MU SG WE GL TP BS Mo1 1 2 1 1 2 Mo2 2 Mo3 2 Mo4 1 Mo5 1 Mo6 1 Mc1 1 Mc2 1 Mc3 1 Mc4 1 Mc5 1 Tp1 2 Bs1 3 sion at 72 °C for 1 min; a final extension reac- stranded PCR product mixtures were used as tion of 10 min at 72 °C was always added. the template for sequencing, which was carried Control reactions contained no template DNA. out by using the Sequenase PCR Product PCR product sizes were visualized by 1.5% Sequencing Kit (United States Biochemical, agarose gel electrophoresis and ethidium bro- USA). At least one specimen from each popu- mide staining; molecular weights were esti- lation was analyzed. Each sample was mated by comparison to the Bio100 DNA Lad- sequenced in both directions to eliminate der (PROtech Technology, Inc., USA). ambiguous positions. To assure accuracy, new For sequencing, the amplification procedure haplotypes were amplified and sequenced was performed three times, and the double- twice.

124 Conservation and Phylogeography of Taiwan Paradise Fish, Macropodus opercularis Linnaeus

Table 4. genetic divergence of paradise fishes constructed by the Kimura two-parameter model. The upper tri- angle matrix represents genetic distance, the lower standard error. Number indicates in bold indicate intraspecific divergence. OTUs Mo1 Mo2 Mo3 Mo4 Mo5 Mo6 Mc1 Mc2 Mc3 Mc4 Mc5 Mo1 0.0010 0.0020 0.0039 0.0010 0.0029 0.1315 0.1382 0.1347 0.1312 0.1313 Mo2 0.0010 0.0010 0.0029 0.0020 0.0039 0.1315 0.1382 0.1347 0.1312 0.1313 Mo3 0.0014 0.0010 0.0039 0.0029 0.0049 0.1327 0.1394 0.1359 0.1324 0.1325 Mo4 0.0020 0.0017 0.0020 0.0049 0.0069 0.1350 0.1417 0.1382 0.1347 0.1347 Mo5 0.0010 0.0014 0.0017 0.0022 0.0039 0.1327 0.1394 0.1359 0.1324 0.1325 Mo6 0.0017 0.0020 0.0022 0.0026 0.0020 0.1292 0.1359 0.1324 0.1289 0.1290 Mc1 0.0122 0.0122 0.0123 0.0124 0.0123 0.0121 0.0079 0.0049 0.0059 0.0059 Mc2 0.0125 0.0125 0.0126 0.0127 0.0126 0.0124 0.0028 0.0029 0.0098 0.0108 Mc3 0.0124 0.0124 0.0124 0.0125 0.0124 0.0122 0.0022 0.0017 0.0069 0.0078 Mc4 0.0122 0.0122 0.0122 0.0123 0.0122 0.0121 0.0024 0.0031 0.0026 0.0069 Mc5 0.0122 0.0122 0.0123 0.0124 0.0123 0.0121 0.0024 0.0033 0.0028 0.0026 The average divergence of Macropodus opercularis is 0.0036 ± 0.0018; the average divergence of Macropodus chinensis is 0.0081 ± 0.0026; and the average divergence between these two species is 0.1341 ± 0.0124.

Data analysis lation for this research, because of the limita- mtDNA sequences including a part of the tion of government permission. Including the cytochrome b gene, two tRNA genes ( tRNAThr outgroups, 24 sequences from the cytochrome and tRNAPro), and the control region (D-loop), b gene to a part of the control region were were aligned using the Pileup program of the aligned with Crossostoma lacustre (Cyprini- GCG software package (Genetic Computer formes: Balitoridae, Tzeng et al., 1992). The Group, version 9.1; Devereux et al., 1997), and entire control region of 14 sequences from the then compared with published mtDNA M. opercularis and five from the M. chinensis sequences of other fishes to verify the bound- colonies were also sequenced and aligned. Fig. aries of the genes. The haplotypic diversity was 3 illustrates each haplotype and demonstrates estimated in a randomly chosen individual the consensus box: termination associated (Nei, 1987). The genetic distance was com- sequence (TAS) and conserved-sequence puted by the Kimura two-parameter method blocks (CSB-II, CSB-III), which are usually without gaps or missing data (Kimura, 1983). found in vertebrate mtDNA (Lee et al., 1995; The phylogenetic analysis was done using the Sbisae et al., 1997). Neighbor-Joining (NJ) method (Saitou and Nei, 1987), as implemented in the MEGA soft- Length variations and haplotypic diversity ware package (Molecular Evolutionary Genet- In the 1034-bp length of mtDNA sequences, ics Analysis, version 1.02; Kumar et al., 1993). five haplotypes (Mo1-Mo5) of Taiwan native A total of 1000 bootstrap replicates (Felsen- paradise fishes were discovered from 11 speci- stein, 1985) were analyzed using the NJ mens in six different colonies (Table 3). Mo1 method. was the common haplotype among different populations of M. opercularis, but was not pre- RESULTS sent in those of Miaoli (MS) or Taichung The original source of specimens from (MK). One variable site in the cytochrome b aquarium are doubtful that we can only count gene, and eight variable sites appearing in the for the outgroup when comparing among the control region were discovered (Fig. 3). Table Taiwan populations (Table 1). Besides, we can 4 shows that the D-loop divergence of M. oper- only take several samples of each native popu- cularis was lower than 1%. Their haplotypic

125 Tzi-Yuan Wang, Chyng-Shyan Tzeng, and Shih-Chieh Shen

1 Cytochrome b::Thr 70 71 Thr-tRNA:: Pro140 Mo1 CCCACTCGCGGGAATCGTAGAAGATAAAATTCTTTTAAAAAATACAAACGACGAATAGCCCTAGTAGCTC Mo1 AGCGACCAGAGCGCCGGTCTTGTAAACCGGACGTCGGAGGTTAAATTCCCCCCTAGCGCTCATCAAAGAA Mo2 ------A------Mo2 ------Mo3 ------A------Mo3 ------Mo4 ------A------Mo4 ------Mo5 ------Mo5 ------Mo6 ------Mo6 ------Mc1 A--T--T--C--G--TA-C--G------C--C------G-A-AT--TA--C------Mc1 ---CCT------C---T------Mc2 A--T--T--C--G--TA-C--G------C--C------G-A-AT--TA--C------Mc2 ---CCT------C---T------Mc3 A--T--T--C--G--TA-C--G------C--C------G-A-AT--TA--C------Mc3 ---CCT------C---T------Mc4 A--T--T--C--G--TA-C--G------C--C------G-A-AT--TA--C------Mc4 ----CT------C---T------Mc5 A--T--T--C--G--TA-C--G------C--C------G-A-AT--TA--C------Mc5 ----C------C---T------

141 Pro-tRNA::D-loop210 211 TAS 280 Mo1 GAAAGATTTTAACTTCCACCCCTAACTCCCAAAGCTAGGATTCTAAACTAAACTATTCTTTGCGCAATTA Mo1 CATATATGTATTTACACCATATATTTATGTTAAACTAATCAATAATTATTCAGGACTAACATTTATAT.T Mo2 ------Mo2 ------Mo3 ------Mo3 ------Mo4 ------Mo4 ------Mo5 ------Mo5 ------Mo6 ------Mo6 ------Mc1 ------G------G--T------AAA----- Mc1 ------C------A------T-?------AC------A-TA-A-- Mc2 ------G------G--T------AAA----- Mc2 ------C------A------T-A------AC------A-TA-A-- Mc3 ------G------G--T------AAA----- Mc3 ------C------A------T-A------AC------A-TA-A-- Mc4 ------G------G--T------AAA----- Mc4 ------C------A------T-A------AC------A-TA-A-- Mc5 ------G------G--T------.AA----- Mc5 ------C------A------T-T------AC------A-TA-AA-

281 350 351 420 Mo1 TTAGCTAAAATTTATCTAAAACATACAAGTAAACATAATACTAAGAAATACATAAACCATATATATATAT Mo1 ATATATACATAATTTTAAATAAATACCGGGCGAAATTTAAGACCGAACTAATTTAACCCACTGGTTAAGT Mo2 ------Mo2 ------Mo3 ------Mo3 ------Mo4 ------Mo4 ------G----- Mo5 ------Mo5 ------Mo6 ------AC----- Mo6 ------Mc1 -C--T--T-T-----A-T------T----A------T-A------GT-G---A------ATAG--- Mc1 -CC----T.---GA-C..----GA--TAAA---G------T------Mc2 -C--T--T-T-----A-T------T----A------T-A------GT-G---A--C------ATAG--- Mc2 CCC----T.---GA-C..----GA--TAA.---G------C------T------Mc3 -C--T--T-T-----A-T------T----A------T-A------GT-G---A--C------ATAG--- Mc3 CCC----T.---GA-C..----GA--TAA.---G------C-.------T------Mc4 -C--T--T-T-----A-T------T----A------T-A------GT-G---A------ATAG--- Mc4 -CC----T.---GA-C..----GA--TAAA---G------T------Mc5 -C--T--T-T-----A-T------T----A------T-A------GT-G---A------ATAG--- Mc5 -CC----T.---GA-C..----GA--TAAA---G------T------

421 : 490 491 Central conserved region 560 Mo1 TATACCAGGACTCAAAATCTCGCCAAGAAAAACCATTTTAGCCCAATAAGAACCGACCATCAGTTGATAC Mo1 CTCTACGCATTCGTTTAATGATAGTCAGGTCCATTAATTGTGGGGGTTTCACGATATGATTTATTCCTGG Mo2 ------Mo2 ------Mo3 ------Mo3 ------Mo4 ------Mo4 ------A------Mo5 ------Mo5 ------G------Mo6 ------Mo6 ------Mc1 ------G------T Mc1 ------T------C------A------A-----T---- Mc2 ------G------T Mc2 ------T------C------A------A-----T---- Mc3 ------G------T Mc3 ------T------C------A------A-----T---- Mc4 ------G------C-C------T Mc4 ------T------C------A------A-----T---- Mc5 ------G------T Mc5 ------T------C------A------A-----T----

561 Central conserved region: 630 631 700 Mo1 CATTTGGTTCCTATTTCAGGTCCATTAATTGGTTCATTCCTCATTCTTTCATCGTAAATTACATAAGTTA Mo1 ATGGTGGAGTACATACTCCTCTTTAACTTCACATGCCGGGCGTTCTCTCCACAGGCGCATGGGGTTTTTA Mo2 ------Mo2 ------Mo3 ------Mo3 ------A------Mo4 ------C------Mo4 ------Mo5 ------Mo5 ------Mo6 ------Mo6 ------Mc1 ------C------Mc1 ------.------Mc2 ------C------Mc2 ------.------Mc3 ------C------Mc3 ------.------Mc4 ------C------Mc4 ------.------Mc5 ------G------C------Mc5 ------.------

701 poly T region 770 771 840 Mo1 TTTTTTTTTTTTTCCTTTCAATAGGCTTTTCAGAGTGCATAAAACAGTGCACTAAA.CAAGGTAGTAC.C Mo1 CCTCCTTGGCATAAATAATATGTATGAGTGATGAAAAGACATTACATAAGAATTGCATATTAAAATATCA Mo2 ------Mo2 ------Mo3 ------Mo3 ------Mo4 ------Mo4 ------Mo5 ------Mo5 ------Mo6 ------G------Mo6 ------Mc1 ------C-C---.------T---A------G---TG-A---T-----GT-AG-AT Mc1 TT-T----TA--T-T--?---T-G----C-G------T------ACTT-----A- Mc2 ------C-C---.------T---A------G---TG-A---T-----GT-AG-AT Mc2 TT-T----TA--T-T--T---T-G---TC-G------T------ACTT------Mc3 ------C-C---.------T---A------G---TG-A---T-----GT-AG-AT Mc3 TT-T----TA--T-T--T---T-G----C-G------T------ACTT------Mc4 ------C-C---.------T---A------G---TG-A---T-----GT-AG-AT Mc4 TT-T----TA--T-T--T---T-G----C-G------T------ACTT------Mc5 ------C-C---.------T---A------G---TG-A---T-----GT-AG-AT Mc5 TT-T----TA--T-T--T---T-G----C-G------T------ACTT------

841 910 911 CSB-II CSB-III 980 Mo1 AGAGCATAAAGTATCAAGTATTTCTCCTAATTTATCTAATATATCCCCCTTCGTTTGTTCGCGTTAAACC Mo1 CCCCTACCCCCCTAAACTCCTAAAAAGCATAACACTCCTGCAAACCCCCCGGAAACAGGAAACTCTCTAG Mo2 ------Mo2 ------Mo3 ------Mo3 ------Mo4 ------Mo4 ------Mo5 ------Mo5 ------Mo6 ------Mo6 ------Mc1 C------AA---A-----A------G---.------GA------Mc1 ------G-T------C-C---- Mc2 ------AA---A-----A------G-G-.------GA------Mc2 ----A------G-T------C-C---- Mc3 ------AA---A-----A------G---.------GA------Mc3 ------G-T------C-C---- Mc4 ------AA---A-----A------G---.------GA------Mc4 ------G-T------C-C---- Mc5 ------AA---A-----A------G---.------GA------Mc5 ------G-T------C-C----

981 1037 Mo1 AAATCTAAAATCAGCCCATAATTGTGTTCATTTACACTATTATAATATTGCAAATGC Mo2 ------Mo3 ------Mo4 ------Mo5 ------Mo6 ------Mc1 ----T------T------T------T------G---- Mc2 ----T------T------T------T------G---- Mc3 ----T------T------T------T------G---- Mc4 ----T------T------T------T------Mc5 ----TC-----T------T------T------G----

Figure 3. mtDNA haplotypes of the genus Macropodus from the partial cytochrome b gene to the control region. Bold letters indicate the consensus box, TAS, CSB-II, CSB-III; dots denote gaps, and dashes indicate identical sites.

126 Conservation and Phylogeography of Taiwan Paradise Fish, Macropodus opercularis Linnaeus

1 Cytochrome b::Thr 70 71 Thr-tRNA::Pro 140 #Mo1 CCCACTCGCGGGAATCGTAGAAGATAAAATTCTTTTAAAAAATACAAACGACGAATAGCCCTAGTAGCTC #Mo1 AGCGACCAGAGCGCCGGTCTTGTAAACCGGACGTCGGAGGTTAAATTCCCCCCTAGCGCTCATCAAAGAA #Mc1 A--T--T--C--G--TA-C--G------C--C------G-A-AT--TA--C------#Mc1 ---CCT------C---T------#Tp1 A---G-A--A--C--TC------C-----T---T-ACAT...... ------#Tp1 ---.-T------A------A---T------..------#Bs1 A--TA-A--A---C-TC------G-----G----C--GC-C-TT-C-T...... ------#Bs1 ----C------AC------CA------#Cro ---CT-G--A---TGGC-----A-----GCC--AGA-TG-GTCT...... ------T #Cro --T.-TG-A---AT------T---A-GA-T------AC--A------C....-G-A--

141 Pro-tRNA:: 210 211 TAS 280 #Mo1 GAAAGATTTTAACTTCCACCCCTAACTCCCAAAGCTAGGATTCTAAACTAAACTATTCTTTG...... #Mo1 ...... CGCAATTACATATATGTATTTACACCATATATTTATGTTAAACT #Mc1 ------G------G--T------#Mc1 ------AAA------C------A------#Tp1 --G-----C-----C------#Tp1 ------TTT--..------C------A----C-A #Bs1 AG------C------G------C--A------#Bs1 ------TTA--A.------A------A---A-AC---A #Cro A-G-----C-----CT------GG------C--A------T-C--AATGCTGC #Cro AGGTATGGTATAGTACATATTATGCATAAT------A-AT------TA-A----T-......

281 350 351 420 #Mo1 AATCAATAATTATTCAGGACTAACATTTATAT.TTTAGCTAAAATTTATCTAAAACATACAAGTAAACAT #Mo1 AATACTAAGAAATACATAAACCATATATATATATATATATACATAAT...... #Mc1 -T-?------AC------A-TA-A---C--T--T-T-----A-T------T----A------#Mc1 T-A------GT-G---A------ATAG----CC----T.---G------#Tp1 TT-AT---T-AG--A-AT-----T--...... -...... #Tp1 ...... -GA-G--G-...... ------GA------#Bs1 T--AT------T-----AT-A----TA-ATA-GCATA-TT---ATATAT--C-C-CAT-TATC-T-- #Bs1 ----ATGAAGAATATATAATCTATATGTATTAACACCATATATATATATACAACATATATATAATTATTT #Cro ...... -...... #Cro ...... -GAC------G--GG--C--TAC---G---GT-G------

491 560 #Mo1 ...... TTTAAATAAATACCGGGCGAAATTTAAGACCGAACTAATT #Mc1 ------A-C..----GA--TAAA---G------421 repeated sequence 490 #Tp1 ------AC-C--C-TGC-TAT-TAT-T---AC-T-GAC-TTAGCA- #Bs1 AGGACATAAATTTTAAATATGCATAATTATTATATATAACCCTCATATATCATATAATAGCTAATATATA #Bs1 CATAAACCATATAAAGCTTAATTTAAAATAA-ATGT-TT-CCAATA------AC-A- #Cro ------GAGCATAAA--TG-G--C-C--ATATATTT---T-----TGGG----C

561 630 631 :Central conserved region 700 #Mo1 TAACCCACTGGTTAAGTTATACCAGGACTCAAAATCTCGCCAAGAAAAACCATTTTAGCCCAATAA.... #Mo1 ...... GAACCGACCATCAGTTGATACCTCTACGCATTCGTTTAATGATAGTCAGGTCCATTAA #Mc1 ----T------G------#Mc1 ------T------T------#Tp1 A--AA--AACA-ATTT-----TT-AA-TATTCCC-A-T...----TC--AAG-C-GTC-GG..------#Tp1 ------G------T---GA-T-TTA------C----C------#Bs1 ---AT--T-A------T------TAA-T----.-T-----A-A--ATT--G------#Bs1 ------T-----T-TTA------G------#Cro G--TAAT-CCCA---AGCCC-T--TA--ATTTTC-T-GAAT--ATTTGC---CA-CTT-TG-G---TAAA #Cro TAATGTAGTAAGA----AC-A-C-----T---TAAAGGTTA----TGCATGAT-GT----A-GA--AA--

701 702 #Mo1 TT #Mc1 -C #Tp1 -- #Bs1 -A #Cro --

Figure 4. mtDNA sequences among different species amplified by primer Ec7 to G22. Bold letters indicate the consensus box, TAS, CSB-II, CSB-III; dots denote gaps, and dashes indicate identical sites. Underlined letters denote repeated sequences of Betta splendens.

diversities (H) are 0.68. Interspecific variations In contrast, similar results of D-loop diver- 142 variable sites were found when compar- gence were found in M. chinensis. The length ing the M. opercularis (Mo) and M. chinensis of the amplified fragment was only 1031 bp, (Mc). The interspecies difference was 13 times and three deletions were observed in the con- greater than intraspecific variation within M. trol region. Fig. 3 also illustrates five haplo- opercularis and M. chinensis. Moreover, we types (Mc1-Mc5) of five specimens from Zhe- revealed the outgroups differences by sequenc- jiang (WE) and Jilin (GL). Two variable sites ing only about a 500-bp-long fragment were discovered in the Thr-tRNA region, and between primer Ec7 and G22A (Fig. 2, Fig. 4). 14 variable sites were located in the control Table 5 demonstrates the length variations region. Surprisingly, the genetic variation is between different species and different mtDNA only about 1% from the long geographic dis- fragments. M. opercularis and M. chinensis tance between Zhejiang and Jilin. This may were more similar than were the others, with imply the recent division, or their slow evolu- only a little difference in the D-loop region as tion rates of mtDNA. The haplotypic diversi- we have mentioned. The entire length of these ties (H) are 0.89 for M. chinensis. two D-loops was slightly shorter than that of C.

127 Tzi-Yuan Wang, Chyng-Shyan Tzeng, and Shih-Chieh Shen

Table 5. Lengths of sequences from the cytochrome b gene to the control region in mtDNA between species. Species Cytochrome b Thr-tRNA Pro-tRNA D-loop Repeat Total length Entire D-loop Mo 57 74 70 327 - 528 833 Mc 57 74 70 324 - 525 830 Bs 50 74 70 449 + 643 Tp 46 72 69 264 - 451 Cro 44 72 68 300 - 484 896 + A 126-bp sequence was repeated seven times in Betta splendens.

Table 6. Mean and standard error of the number of nucleotide substitutions per 100 sites. (A) The upper trian- gle matrix is Pro-tRNA (70 bp), the lower is Thr-tRNA (70 bp); (B) The upper is the control region (221 bp), the lower is cytochrome b (46 bp); (C) The upper is weighted distance, the lower is average distance. (A) Mo1 Mc1 Tp1 Bs1 Cro Mo1 4.8±2.8 4.8±2.8 10.0±4.3 25.0±8.1 Mc1 5.1±2.9 10.0±4.3 15.9±5.8 33.2±10.3 Tp1 5.9±3.0 5.1±2.8 11.9±4.8 18.0±6.3 Bs1 5.9±3.0 6.7±3.2 9.1±3.9 15.9±5.8 Cro 25.5±7.2 26.3±7.3 23.6±6.9 21.3±6.3 (B) Mo1 Mc1 Tp1 Bs1 Cro Mo1 14.0±2.7 46.9±6.0 30.2±4.4 78.2±9.5 Mc1 36.6±11.6 54.9±6.8 31.6±4.5 81.8±10.0 Tp1 30.6±9.7 32.4±10.2 57.8±7.1 100.0±12.7 Bs1 37.3±11.1 46.8±13.1 32.4±10.2 102.5±13.5 Cro 68.3±18.6 82.4±22.2 70.6±19.0 84.0±23.7 (C) Mo1 Mc1 Tp1 Bs1 Cro Mo1 13.4±3.8 30.8±5.4 23.3±4.9 58.9±9.9 Mc1 13.1±1.9 36.1±6.1 26.3±5.5 64.0±11.0 Tp1 30.7±3.1 35.6±3.5 38.6±6.5 69.4±11.3 Bs1 24.4±2.7 27.7±2.9 37.8±3.6 71.5±12.1 Cro 67.3±5.9 71.8±6.2 69.3±6.0 71.6±6.2 Mean and standard error of Macropodus opercularis: 0.6 ± 0.5. Mean and standard error of Macropodus chinesis: 1.0 ± 0.7. lacustre (Cro). The outgroup, B. splendens Pro-tRNA, and the D-loop fragment) in these (Bs), and T. pumilus (Tp), showed significant species (Table 6). The length-weighted substi- length variations with each other. Interest- tution is similar to the unweighted substitution ingly, a repeated sequence of 126 bp in length between different species. In other words, we was only found in B. splendens, and repeats may consider that these gene segments have a seven times in its control region (Fig. 4). coincident substitution tendency. According to the present results in tables 4 and 6, the inter- Genetic distance and phylogenetic tree specific and intraspecific phylogenetic trees We examined the nucleotide substitutions were established as shown in Fig. 5. Each tree of each segment (cytochrome b, Thr-tRNA, is highly convergent, confirmed by different

128 Conservation and Phylogeography of Taiwan Paradise Fish, Macropodus opercularis Linnaeus

Figure 5. Neighbor-joining tree of paradise fishes in Taiwan and adjacent regions. (A) partial sequences from cytochrome b gene to 5' end of the control region were used to construct the phylogenetic tree; (B) Total length (1034 bp) of paradise fish sequences was used to construct an unrooted tree. distance estimated methods as usually exam- predicament of native populations (Jan and ined. Fig. 5A reveals that over 10% divergence Wu, 1994). The Taiwanese population is appeared in the 500 bp between Mo and Mc, regarded as tributary to southern Chinese pop- and these two revealed about 30% subdiver- ulation (Kawanbe and Mizuno, 1989). Fur- gence with Tp or Bs. thermore, local populations around Taiwan do To resolve the subdivision of different par- not demonstrate apparent reproduction isola- adise fish populations, we compared the entire tion judging from laboratory breeding experi- sequence (1034 bp) between Mo and Mc, and ences. constructed the phylogeny tree (Fig. 5B). Both Mo and Mc were shown to diverge into differ- Phylogeography in paradise fishes ent clades. Meanwhile, three haplotypes (Mo2, Fig. 5A illustrates the molecular phylogeny Mo3, and Mo4) formed a distinct clade, which between each species (Table 1). This result is showed a high bootstrap value in comparing similar to that obtained with allozyme data with the Mo1 and Mo5 clade. A similar result (Wakiyama et al., 1997). Divergent distances can be illustrated when including addition among species of the genus Macropodus are populations, MI and ED in Fig. 1B, from half-way between those of T. pumilus or B. northeastern Taiwan and southern China (data splendens (Table 6). not shown). In M. opercularis, we selected samples from adjacent but geographically separate areas as DISCUSSION outgroups to analyze the relationships among Distribution of Macropodus opercularis in the populations in Taiwan (Table 1). At least Taiwan one specimen from each native population was According to recent reports (Shen et al., chosen for analysis of mtDNA sequence varia- 1991; Jan and Wu, 1994) and personal investi- tion, since morphological characters cannot gations, scattered populations of M. opercularis help us figure out the differences among these still exist in western Taiwan (Fig. 1). Wild pop- populations. As indicated in table 3, the Mo1 ulations fluctuate frequently and are laborious haplotype appears naturally in each popula- to find. The bottleneck effect resulting from tion, but not in the Miaoli or Taichung popula- drastic environmental changes may severely tions. Two specimens (SG) from Singaporean reduce genetic diversity and survival rates of aquarium carry the same haplotype (Mo1), these populations. Inappropriate artificial and another (MU) from Taiwan aquarium is breeding and releases further aggravate the Mo6 haplotype. The result may imply that M.

129 Tzi-Yuan Wang, Chyng-Shyan Tzeng, and Shih-Chieh Shen opercularis from the native populations still Guangdong (ED) has been analyzed. Only 1% have its own genetic variation, which is differ- difference in control region is discovered when ent from aquarium strains. Specimens from comparing within the Taiwanese populations Singapore are the Malaysia peninsula type, (data not shown). All these data emphasize which is larger than specimens from Taiwan. that the specimens from Zhejiang and Jilin are They may be interbreeding with Taiwan native M. chinensis, and the Taiwanese populations population (Jan and Wu, 1994). should be M. opercularis. Interestingly, the As to biogeographical evidence (Oshima, geographic distance from Zhejiang to Jilin is 1934; Kawanabe and Mizuno, 1989), the gener- closed to two thousand kilometers, but their ally accepted hypothesis states that northern genetic distance is less than 1%. More affirma- China is occupied by M. chinensis while M. tive conclusions will probably be drawn with opercularis resides in southern China with the the addition of samples from around Taiwan, Yangtze River as the nouth-south boundary Korean M. chinensis and M. opercularis, and (Fig. 1). Zhejiang is localized at this boundary southern Chinese M. opercularis. area while Jilin belongs to the northern Chi- nese range of M. chinensis. We cannot measure Genetic information and conservation significant characters among these specimens, As we discussed above, only nine variation but interestingly, specimens from Zhejiang sites are appeared from mtDNA. Table 4 shows (WE) seem a little bit different from those of that the divergence of M. opercularis was lower Taiwan, Singapore (SG), Duan (DA), and than 1%. The genetic information is not sig- Juhae (JH). nificant. However, five haplotypes of M. oper- Unexpectedly, in genetic inheritance, speci- cularis from Taiwan native populations are mens from Zhejiang differ conspicuously from divided into two clades, Mo1-Mo5 and Mo2- those of Taiwan and Singapore in the D-loop Mo3-Mo4, separated by a high bootstrap value. of mitochondrial DNA, and the average diver- Mo1 haplotype, naturally present in many iso- gence is 0.1341 ± 0.0124 (Table 4). Compared lated specimens, may be the ancestral haplo- to other fishes, the genetic distance between type. In this view, the Miaoli and Taichung the Taiwanese and Chinese populations has populations are subdivided from the ancestral already surpassed the interspecific level as that clade. between different species of loach, ricefish, The haplotypic diversity of the Taiwanese gobby, porgy, and eel (Tzeng, 1992; Lin, 1995; populations is 0.68; by contrast, the haplotypic Lin, 1996; Jean et al., 1995; Sang et al., 1994). diversity in the Chinese populations is 0.89. Unfortunately we were unsuccessful in The mtDNA genetic diversity in China is amplifying the mtDNA of the formalin-pre- higher than that in Taiwan. Although this served samples from Duan and Juhae. We result should be caused by long geographic dis- need more evidence to confirm whether the tance between two Chinese populations, the genetic divergence is an interspecific relation- haplotypes of M. chinensis are different among ship or is caused by geographic divisions. For- each population. This may emphasize the tunately, we received two specimens from Jilin genetic diversity of Taiwan native population is (GL), of which one specimen (Mc5) with its getting lower and lower, because of decreasing circular caudal fin belongs to M. chinensis population size. The conservation of genetic (Table 3). After mtDNA sequencing, the diversity is urgent and imperative. genetic distance between the Zhejiang and Jilin We can carefully distinguish four pheno- populations was found to be less than 1%, types by morphological characters (Jan and while the genetic distance between the Tai- Wu, 1994). But preserving the entire gene wanese and Chinese populations still showed pool, the genetic phylogeny is an important great variation. Recently, one specimen from part for conservation works. In our investiga-

130 Conservation and Phylogeography of Taiwan Paradise Fish, Macropodus opercularis Linnaeus tion, we can understand that M. opercularis of Avise, J. C. (1995) Mitochondrial DNA poly- Taiwan native populations still has genetic morphism and a connection between genet- diversity, though only a few specimens in each ics and demography of relevance to conser- colony have been analyzed. Only two sepa- vation. Conserv. Biol. 9: 686-690. rated groups are discovered, because of the low Birky, C. W., P. Fuerst and T. Maruyama (1989) diversity of mtDNA and the limitation of col- Organelle gene diversity under migration, lecting specimens. mutation, and drift: equilibrium expecta- In the short term, we suggest that remark- tions, approach to equilibrium, effects of ably small wild groups in the same zone could hetroplasmic cells, and comparison to be interbred with each other to elevate survival nuclear genes. Genetics 121: 613-627. rates. Suitable habitats should be obtained for intermittent release of restored groups to Brown, G. G., G. Gadaleta, G. Pepe, C. Saccone increase genetic diversity. Any habitats of sta- and E. Sbisa (1986) Structural conservation ble populations subsequently discovered and variation in the D-loop-containing should be protected to ensure natural propaga- region of vertebrate mitochondrial DNA. J. tion. In the long term, native populations Mol. Biol. 192: 503-511. must be secluded from foreign ones to mini- Chen, C. S. (1969) The vertebrate animals in mize artifacts and to certify the accuracy of Taiwan. Commercial Publication, Taipei, research results. pp. 548. (In Chinese) The low variations in mtDNA of paradise fishes are a limitation to revealing the popula- Degani, G. and M. Veith (1990) Elec- tion structure and gene flow problem. New trophoretic variations of isozyme systems in techniques have been developed in Taiwan, the muscle and liver of Anabantidae fish. such as use of minisatellites, microsatellites, ISR. J. Aquacult./Bamidgeh 42(3): 67-76. SSCP, and DSCP. We hope these new tech- Devereux, J., P. Haeberli and P. Marquess niques will allow the descendents to discovery (1997) Genetic computer group manual, ver- more genetic information for preserving this sion 9.1. Wisconsin Univ. Press, Madison, threatened fish in Taiwan. WI. ACKNOWLEDGMENTS Felsenstein, J. (1985) Confidence limits on This research was financially supported by phylogenies: an approach using the boot- the National Science Council, Republic of strap. Evolution 39: 783-791. China (NSC 87-2311-B-002-015-B17) and had Forselius, S. (1957) Studies of anabantid fishes. permission from the Council of Agriculture, 1,2,3. Zool. Bid. Fraen Uppsala 32: 93-598. Executive Yuan. We are very grateful to Mr. Heok Hui Tan, Biological Sciences Depart- Jan, J. P. and S. L. Wu. (1992) The biogeogra- ment, Natl. Singapore Univ. in Singapore, Mr. phy of Taiwan fishes between northern and Jinn Chyuang Sheu, Life Science Department, southern areas. China Fisheries Monthly Natl. Tsing Hua Univ. in Hsinchu, Dr. T. H. 478: 5-59. (In Chinese) Lee, Zoology Department, Natl. Chung Hsing Jan, J. P. and S. L. Wu. (1994) Ecology and con- Univ. in Taichung, and Mr. J. P. Jan, Taichung, servation of Macropodus opercularis. for providing specimens. Taichung Mountain Environment Protec- tion Association, Taichung. (In Chinese) REFERENCE Jan, J. P., S. L. Wu, and C. R. Chen. (1992) The Avise, J. C. (1994) Molecular markers, natural ecology and conservation evaluation of Tai- history and evolution. Chapman & Hall, wan paradise fishes. Tachia River Environ- New York.

131 Tzi-Yuan Wang, Chyng-Shyan Tzeng, and Shih-Chieh Shen

ment Protection Association, Taichung, pp. land of China based on the mitochondrial 39. (In Chinese) DNA sequence analysis. Bachelor Thesis, National Tsing Hua Univ, Hsinchu. (In Chi- Jean, C. T., C. F. Hui, S. C. Lee and C. T. Chen nese) (1995) Variation in mitochondrial DNA and phylogenetic relationships of fishes of the Moritz, C., T. E. Dowing and W. M. Brown subfamily Sparinae (Perciformes: Sparidae) (1987) Evolution of animal mitochondrial in the coastal waters of Taiwan. Zool. Stud. DNA: relevance for population biology and 34(4): 270-280. systematics. Ann. Rev. Evol. Syst. 18: 269- 292. Kawanabe H. and N. Misuno (1989) Freshwa- ter fishes in Japan. Mountain and Stream Moritz, C. and W. M. Brown (1987) Tandem Valley Lo., Tokyo, pp. 719. (In Japanese) duplications in animal mitochondrial DNA: variation in incidence and gene content Kimura (1937) Study in Chinese Macropo- among lizards. Proc. Natl. Acad. Sci. USA diniae fishes. Bull. Inst. Nat. Sci., Shanghai. 84: 7183-7187. 7(3): 47-70. (In Japanese) Nei, M. (1987) Molecular evolutionary genetics. Kimura, M. (1983) The neutral theory of molec- Columbia Univ. Press, New York. ular evolution. Cambridge Univ. Press, New York. Nelson, J. S. (1994) Fishes of the word. 3rd ed. J. Wiley, New York, pp. 432-434. Kocher, T. D., W. K. Thomas, A. Meyer, S. V. Edwards, S. Paeaebo, F. X. Villablanca and Oshima, M. (1919) Contribution to the study A. C. Wilson (1989) Dynamics of mito- of the freshwater fishes of the island of For- chondrial DNA evolution in animals: mosa. Ann. Carneg. Mus. XII(2-4): 169- amplification and sequencing with con- 328. (in Japanese) served primers. Proc. Natl. Acad. Sci. USA Oshima, M. (1923) Studies on the distribution 86: 6196-6200. of the freshwater fishes of Taiwan and dis- Kumar, S., K. Tamura and M. Nei (1993) cuss the geographical relationship of Taiwan MEGA: molecular evolutionary genetics island and the adjacent area. Zool. Mag. analysis, version 1.02. : Pennsylvania State 35(411): 1-49. (in Japanese) Univ., University Park, PA, pp. 130. Oshima, M. (1934) Japanese Labrynthici fishes, Lee, W. J., J. Conroy, W. H. Howell and T. D. Zool. Mag., 12(4): 11-20. (In Japanese) Kocher (1995) Structure and evolution of Sang, T. K., H. Y. Chang, C. T. Chen, and C. F. Teleost mitochondrial control regions. J. Hui (1994) Population structure of the Mol. Evol. 41: 54-66. Japanese eel, Anguilla japonica. Mol. Biol. Liem, K. F. (1963) The comparative osteology Evol. 11(2): 250-260. and phylogeny of the Anabantoidei Sanger, F., S. Nicklen and A. R. Coulson (1977) (Teleostei, Pisces). IL Biol. Monogr. 30(i- DNA Sequencing with chain-terminating viii): 1-149. inhibitors. Proc. Natl. Acad. Sci. USA 74: Lin, S. M. (1995) Characterization of medaka 5463-5467. fish (Oryzias latipes) mtDNA D-loop. Mas- Saitou, N. and M. Nei (1987) The neighbor- ter thesis, National Tsing Hua Univ, joining method: a new method for recon- Hsinchu. (In Chinese) structing phylogenetic trees. Mol. Biol. Evol. Lin, Y. S. (1996) Phylogenetic relationships of 4: 406-425. Rhinogobius giurinus of Taiwan and main-

132 Conservation and Phylogeography of Taiwan Paradise Fish, Macropodus opercularis Linnaeus

Sbisae, E., F. Tanzariello, A. Reyes, G. Pesole tion of Family Homalopteridae in Taiwan. and C. Saccone (1997) Mammalian mito- Ph. D. thesis, National Taiwan Univ. chondrial D-loop region structure analysis: Tzeng, C. S., C. F. Hui, S. C. Shen and P. C. identification of new conserved sequences Huang (1992) The complete nucleotide and their functional and evolutionary sequence of the Crossostoma lacustre mito- implications. Gene 205: 125-140. chondrial genome: conservation and varia- Shen, S. C., C. S. Tzeng and C. Y. Shoang tions among vertebrates. Nucleic Acids Res (1991) Studies on the mosquito control by 20: 4853-4858. using endogenous fishes. Institute of Zool- Wakiyama, A., H. Kohno and Y. Taki (1997) ogy, Natl. Taiwan Univ., Taipei, pp. 39. (In Genetic relationships of anabantoid fishes. J. Chinese) Tokyo Univ. Fish. 83(2): 93-102. Tamura, K. and M. Nei (1993) Estimation of Ward, R. D., M. Woodwark, and D. O. F. Skib- the number of nucleotide substitutions in inski (1994) A comparison of genetic diver- the control region of mitochondrial DNA in sity levels in marine, freshwater, and humans and chimpanzees. Mol. Biol. Evol. anadromous fishes. J. Fish Biol. 44: 213-232. 10: 512-526. Wen, S. S. (1981) The freshwater fishes in Hong Tzeng, C. S. (1986) Distribution of the fresh- Kong. Hong Kong Municipal Government, water fishes of Taiwan. J. Taiwan Mus. Hong Kong, pp.71. (In Chinese) 39(2): 127-146. (Received Feb. 11, 1999; Accepted Mar. 15, 2000) Tzeng, C. S. (1992) Genomic structure of mitochondrial DNA of Taiwan stream loach, Crossostoma lacustre, and molecular evolu-

133 Tzi-Yuan Wang, Chyng-Shyan Tzeng, and Shih-Chieh Shen

1 1 2

1 2

Macropodus opercularis 1990 M. chinensis DNA mitochondrial DNA; mtDNA) control region sequence

13.4% 11 1034 bp haplotype 5

134