DOCSLIB.ORG

Tbn, a Novel Gene Essential for the ICM 5451

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Tbn, a Novel Gene Essential for the ICM 5451 Development 127, 5449-5461 (2000) 5449 Printed in Great Britain © The Company of Biologists Limited 2000 DEV2556 Taube nuss is a novel gene essential for the survival of pluripotent cells of early mouse embryos Anne K. Voss*,‡,§, Tim Thomas*,‡, Petros Petrou, Konstantinos Anastassiadis1, Hans Schöler2 and Peter Gruss Max-Planck-Institute of Biophysical Chemistry, Department of Molecular Cell Biology, Am Fassberg 11, 37077 Goettingen, Germany 1European Molecular Biology Laboratory, Gene Expression, Meyerhofstr. 1, 69117 Heidelberg, Germany 2University of Pennsylvania, New Bolton Center, Center for Animal Transgenesis and Germ Cell Research, 382 W. Street Rd, Kennett Square, PA 19348, USA *These contributed equally to this work ‡Present address: Development and Neurobiology, The Walter and Eliza Hall Institute of Medical Research, Royal Parade, Parkville, Victoria 3050, Australia §Author for correspondence (e-mail: [email protected]) Accepted 19 September; published on WWW 14 November 2000 SUMMARY The cells of the inner cell mass constitute the pluripotent the zonae pellucidae, implanted and induced decidual cell population of the early embryo. They have the potential reactions, but failed to develop beyond E4.0. At this time to form all of the tissues of the embryo proper and the trophoblast cells were viable, but inner cell masses were some extra-embryonic tissues. They can be considered a not detectable. At E3.75, massive TUNEL-positive DNA transient stem cell population for the whole of the embryo, degradation and chromatin condensation were visible and stem cells maintaining the same capacity can be within the inner cell masses, whereas the cell membranes isolated from these cells. We have isolated, characterised where intact. Caspase 3 was expressed in these cells. In and mutated a novel gene, taube nuss (Tbn), that is essential vitro, the inner cell mass of mutant embryos failed to for the survival of this important cell population. The proliferate and died after a short period in culture. These taube nuss protein sequence (TBN) was highly conserved results indicate that the novel protein, taube nuss, is between human, mouse, Xenopus laevis, Drosophila necessary for the survival of the inner cell mass cells and melanogaster, Caenorhabditis elegans and Arabidopsis that inner cell mass cells died of apoptosis in the absence thaliana, particularly in a domain that is not present in any of the taube nuss protein. As cell pruning by apoptosis published proteins, showing that TBN is the founding is a recognised developmental process at this stage of member of a completely new class of proteins with an development, the taube nuss protein may be one of the important function in development. The Tbn gene was factors regulating the extent of programmed cell death at expressed ubiquitously as early as E2.5 and throughout this time point. embryonic development. It was also expressed in adult brain with slightly higher levels in the hippocampus. The Tbn mutant embryos developed normally to the blastocyst Key words: Inner cell mass, Stem cells, Apoptosis, Programmed cell stage and contained inner cell masses. They hatched from death, Embryoblast, Blastocyst, Mouse, TBN INTRODUCTION pruned from this population by programmed cell death (Smith and Wilson, 1971). This presumably occurs as a The first cell-lineage specification and restriction in counterbalance to excessive cell proliferation or to remove mammalian development occurs in preimplantation embryos, cells that started to differentiate into an undesirable direction when blastocysts form from compacted morulae. They consist (Pierce et al., 1989). In wild-type E3.5 embryos up to 10% of of an outer cell population, the trophectoderm, from which the inner cell mass cells have been observed to undergo apoptosis, trophoblast compartment of the extra-embryonic tissues but cell death is not observed in the trophectoderm lineage at develops and an inner cell population, the inner cell mass or this point (reviewed by Sanders and Wride, 1995, and by embryoblast, from which all tissues of the embryo proper, the Pampfer and Donnay, 1999). Electron microscopy, vital dye yolk sac, the amnion and the allantois, develop. The cells of exclusion and in situ end-labelling studies have shown that the the inner cell mass are, therefore, a transient pluripotent stem cells dying in the inner cell masses exhibit the typical signs of cell population of the embryo proper and some extra- apoptosis (Copp, 1978; Handyside and Hunter, 1986; Brison embryonic tissues (reviewed by Hogan et al., 1994). Cells are and Schultz, 1997). 5450 A. K. Voss and others During hatching and implantation the inner cell mass MATERIALS AND METHODS proliferates. Then the proamniotic cavity is formed, and the cells that formerly formed the inner cell mass are organised Generation of the mutant Tbngt allele into an epithelial structure, the primitive ectoderm or epiblast, The promoter-less reporter construct pGT1.8geo (kindly provided by which lines the proamniotic cavity. The process of proamniotic W. Skarnes; Skarnes et al., 1995) was electroporated into the parental cavity formation involves the programmed cells death of inner murine embryonic stem (ES) cell line MPI-II (Voss et al., 1997) as cell mass cells in the centre of the inner cell mass and selective described previously (Voss et al., 1998b). survival of cells in the periphery of the inner cell mass Cloning and sequencing of the Tbn cDNA and the 5′ (Coucouvanis and Martin, 1995). The surviving cells are junction of pGT1.8geo and the Tbn locus thought to receive a survival signal from the basement Total RNA was isolated from ES cells heterozygous for the insertion membrane surrounding the inner cell mass, while the cells in of pGT1.8geo into the murine genome (clone F5). 5′ rapid the centre die, because they received and executed a death amplification of cDNA ends was performed as previously described signal. Both processes involving cell death, the pruning of (Voss et al., 1998a) using oligonucleotides complementary to the lacZ inner cell mass cells and the formation of the proamniotic gene of pGT1.8geo as gene-specific primers. RACE products were cavity, require careful regulation of the death process, as some isolated and sequenced. The sequences specific for the endogenous cells are entailed to die, while immediate neighbours are gene were amplified by PCR, cloned into pGemT (probe 1, Fig. 1A) required to survive. and used as a probe to screen an ES cell cDNA library. The ES cell + Programmed cell death occurs as a regular mechanism cDNA library was generated for this purpose. PolyA RNA from wild- during embryonic development in order to prune proliferating type ES cells (MPI-II) was reverse transcribed with random hexamere oligonucleotides and second-strand synthesis was carried out using a cell population of excess or aberrant cells or to shape tissues. cDNA synthesis kit (Pharmacia). After filling-in reaction, ligation to Well-known examples of developmental cell death during EcoRI/NotI adapters (Pharmacia), size selection on a Sephacryl mammalian development are the involution of the interdigital S400HR column, the cDNA was cloned into the EcoRI site of webs and of epithelial structures in areas where tissues fuse, λpExcell (Pharmacia) and packaged into Gigapack III Gold e.g. the fusion of the palate (reviewed by Sanders and Wride, (Stratagene). E. coli NM522 were transfected with the phages and 1995; Vaux and Korsmeyer, 1999). Initially, programmed cell plated. The cDNA library of 1,000,000 plaques was harvested without death during development was always thought to involve further amplification. The average insert size was 2 kb±0.8. 0.17% of apoptosis. More recently, it has become clear that other forms the clones contained β-actin cDNA as an insert. Five cDNA clones isolated from this library were sequenced. One clone contained the of programmed cell death that have features in common with ′ necrosis may also occur during development (Chautan et al., entire open reading frame, but not the 5 UTR, which was obtained by 5′ RACE, and only part of the 3′ UTR. The remaining 3′ 1999). untranslated sequences were obtained by 3′ RACE using cDNA Apoptosis is characterised by the internal disassembly of the generated from E12.5 embryos. Three independent PCRs were cell, particularly the DNA, while the cell membrane remains performed using oligonucleotide primers derived from the coding intact. Consequently, chromatin and other cellular material is sequence. Each reaction produced a band of the same size which was fragmented into cell membrane-enclosed portions that can cloned into pGemT and sequenced. easily be cleared by neighbouring cells. In this way adverse DNA was isolated from a tail biopsy of an animal heterozygous for effects of cell death on neighbouring cells and an inflammatory the pGT1.8geo insertion in the Tbn locus. The 5′ junction was reaction are avoided. Developmental cell death is thought to be amplified by PCR using and a lacZ specific primer (5′ GGCGATCGGTGCGGGCCTCTTCGC 3′) and an Tbn-specific regulated by extracellular death-inducing factors and survival ′ ′ factors. There is some evidence that tumour necrosis factor α primer (5 GGAGACACTGACAGAGATGCTGCAGAGC 3 ). The PCR product was cloned into pGemT (Promega) and sequenced. and transforming growth factor α may be, respectively, cell death-inducing and survival factor for the inner cell mass cells Sequence comparison of blastocysts (Brison and Schultz, 1997; Pampfer et al., 1997). The deduced protein sequence was encoded by the longest open Internally, apoptosis involves an antagonism of pro- and anti- reading frame, started with the first ATG, and was in frame with the apoptotic factors. Once apoptosis is induced, the activation of lacZ ORF. The cDNA and the protein sequence were compared with a cascade of proteolytic enzymes including caspases (cysteine entries into the EMBL data bases, SWISS-PROT, and GenBank by proteases that cleave their substrate after an aspartic acid blast and fasta analysis (Wisconsin Package, Genetics Computer residue) ultimately results in the disassembly of the cell Group).
Load more

Recommended publications
  • 3 Embryology and Development
    BIOL 6505 − INTRODUCTION TO FETAL MEDICINE 3. EMBRYOLOGY AND DEVELOPMENT Arlet G. Kurkchubasche, M.D. INTRODUCTION Embryology – the field of study that pertains to the developing organism/human Basic embryology –usually taught in the chronologic sequence of events. These events are the basis for understanding the congenital anomalies that we encounter in the fetus, and help explain the relationships to other organ system concerns. Below is a synopsis of some of the critical steps in embryogenesis from the anatomic rather than molecular basis. These concepts will be more intuitive and evident in conjunction with diagrams and animated sequences. This text is a synopsis of material provided in Langman’s Medical Embryology, 9th ed. First week – ovulation to fertilization to implantation Fertilization restores 1) the diploid number of chromosomes, 2) determines the chromosomal sex and 3) initiates cleavage. Cleavage of the fertilized ovum results in mitotic divisions generating blastomeres that form a 16-cell morula. The dense morula develops a central cavity and now forms the blastocyst, which restructures into 2 components. The inner cell mass forms the embryoblast and outer cell mass the trophoblast. Consequences for fetal management: Variances in cleavage, i.e. splitting of the zygote at various stages/locations - leads to monozygotic twinning with various relationships of the fetal membranes. Cleavage at later weeks will lead to conjoined twinning. Second week: the week of twos – marked by bilaminar germ disc formation. Commences with blastocyst partially embedded in endometrial stroma Trophoblast forms – 1) cytotrophoblast – mitotic cells that coalesce to form 2) syncytiotrophoblast – erodes into maternal tissues, forms lacunae which are critical to development of the uteroplacental circulation.
    [Show full text]
  • Cell Fate in the Early Mouse Embryo: Sorting out the Influence of Developmental History on Lineage Choice
    Reproductive BioMedicine Online (2011) 22, 521– 524 www.sciencedirect.com www.rbmonline.com COMMENTARY Cell fate in the early mouse embryo: sorting out the influence of developmental history on lineage choice Samantha A Morris Wellcome Trust/Cancer Research UK Gurdon Institute, University of Cambridge, Tennis Court Road, Cambridge CB2 1QR, UK; University of Cambridge, Department of Physiology, Development and Neurobiology, Downing Street, Cambridge CB2 3DY, UK E-mail address: [email protected]. Abstract In early mouse embryos the first cell-fate decision segregates two cell populations: the outer trophectoderm (TE) and inner cell mass (ICM). Cells are primarily directed to the ICM in two waves of asymmetric division at the 8–16-cell and 16–32-cell stage transition – the first and second waves, respectively. The ICM then diverges to become epiblast (EPI) which will generate the embryo/fetus and extra-embryonic primitive endoderm (PE). Two recent studies have aimed to address the developmental origins of these lineages. Morris et al. (2010) found that first-wave-internalized cells mainly generate EPI, whereas later internalized cells pro- vide PE. This trend was not reflected in an independent study (Yamanaka et al., 2010). From direct comparison of both datasets, it becomes clear that the key difference lies in the proportions of cells internalized in the two waves, impacting greatly upon fate. When the majority of ICM is derived from only the first wave, both EPI and PE must differentiate from the available cells and no pattern is observed. Frequently though, closer parity exists between cells dividing asymmetrically in the first and second waves, revealing the influence of developmental history upon fate.
    [Show full text]
  • Development Development
    DEVELOPMENT DEVELOPMENT • Prenatal –Before birth • Postnatal development- After birth • PRENATAL DEVELOPMENT – 1. Embryonic development – Up to 8 weeks after fertilization. Devided into 23 arbitrarory stages called as Carnegie Stages Pre implantation development Post implantation development 2.Foetal development 8 weeks onwards after fertilization Cleavage ( post fertilization) • process of subdivision of ovum into smaller cells called cleavage. • process of repeated mitotic divisions of zygote occur with in zonapellucida, • these cells are known as blastomeres, • first cleavage division occur around 24 hrs after fertilization, • during 8 cell stage compaction of cells occur within the cells flatten & increase their intercellular contact , • Cleavage proceed to 16 celled stage --- MORULA, • All cells of approximately same size, • At 16 cells stage cells polarity is determuned to form outer trophoectoderm & inner cell mass, • inner cell mass give rise to embryo in future, while outer cell mass is destined to form the fetal membranes including placenta • the inner cell mass also called embryoblast , • cells of trophoblast help to provide nutrition to embryo, blastocyst • some fluid now passes into morula from uterine cavity , & partially separate the cells of inner cell mass from trophoblast. • as quantity of fluid increases the morula acquires shape of a cyst,the cells of trophoblast flattens out & inner cell mass gets attach to one side only, • the morula now is called blastocyst ,cavity is called blastocoele. • site where blastocyst is attach to inner cell mass is calld embryonic or animal pole , while opposite site is aembryonic pole. Zona pellucida( function) • trophoblast has property of being able to stick to uterine ( or other) epithelium & its cells have capacity to eat up other cells( property of invading) • thus as embryo is travelling down the uterine tube & uppermost part of uterine cavity , it is prevented from sticking to epithelium by a zona pellucida.
    [Show full text]
  • Early Embryonic Development Till Gastrulation (Humans)
    Gargi College Subject: Comparative Anatomy and Developmental Biology Class: Life Sciences 2 SEM Teacher: Dr Swati Bajaj Date: 17/3/2020 Time: 2:00 pm to 3:00 pm EARLY EMBRYONIC DEVELOPMENT TILL GASTRULATION (HUMANS) CLEAVAGE: Cleavage in mammalian eggs are among the slowest in the animal kingdom, taking place some 12-24 hours apart. The first cleavage occurs along the journey of the embryo from oviduct toward the uterus. Several features distinguish mammalian cleavage: 1. Rotational cleavage: the first cleavage is normal meridional division; however, in the second cleavage, one of the two blastomeres divides meridionally and the other divides equatorially. 2. Mammalian blastomeres do not all divide at the same time. Thus the embryo frequently contains odd numbers of cells. 3. The mammalian genome is activated during early cleavage and zygotically transcribed proteins are necessary for cleavage and development. (In humans, the zygotic genes are activated around 8 cell stage) 4. Compaction: Until the eight-cell stage, they form a loosely arranged clump. Following the third cleavage, cell adhesion proteins such as E-cadherin become expressed, and the blastomeres huddle together and form a compact ball of cells. Blatocyst: The descendents of the large group of external cells of Morula become trophoblast (trophoblast produce no embryonic structure but rather form tissues of chorion, extraembryonic membrane and portion of placenta) whereas the small group internal cells give rise to Inner Cell mass (ICM), (which will give rise to embryo proper). During the process of cavitation, the trophoblast cells secrete fluid into the Morula to create blastocoel. As the blastocoel expands, the inner cell mass become positioned on one side of the ring of trophoblast cells, resulting in the distinctive mammalian blastocyst.
    [Show full text]
  • Formation of Germ Layers (Second & Third Week of Development)
    8.12.2014 Formation of Germ Layers (Second & Third week of Development) Dr. Archana Rani Associate Professor Department of Anatomy KGMU UP, Lucknow Day 8 • Blastocyst is partially embedded in the endometrial stroma. • Trophoblast differentiates into 2 layers: (i) Cytotrophoblast (ii) Syncytiotrophoblast • Cytotrophoblast shows mitotic division. Day 8 • Cells of inner cell mass (embryoblast) also differentiate into 2 layers: (i) Hypoblast layer (ii) Epiblast layer • Formation of amniotic cavity and embryonic disc. Day 9 • The blastocyst is more deeply embedded in the endometrium. • The penetration defect in the surface epithelium is closed by a fibrin coagulum. Day 9 • Large no. of vacuoles appear in syncytiotrophoblast which fuse to form lacunae which contains embryotroph. Day 9 • Hypoblast forms the roof of the exocoelomic cavity (primary yolk sac). • Heuser’s (exocoelomic membrane) • Extraembryonic mesoderm Day 11 & 12 • Formation of lacunar networks • Extraembryonic coelom (chorionic cavity) • Extraembryonic somatic mesoderm • Extraembryonic splanchnic mesoderm • Chorion Day 13 • Implantation bleeding • Villous structure of trophoblast. • Formation of Primary villi • Secondary (definitive) yolk sac • Chorionic plate (extraembronic mesoderm with cytotrophoblast) Third week of Development • Gastrulation (formation of all 3 germ layers) • Formation of primitive streak • Formation of notochord • Differentiation of 3 germ layers from Bilaminar to Trilaminar germ disc Formation of Primitive Streak (PS) • First sign of gastrulation • On 15th day • Primitive node • Primitive pit • Formation of mesenchyme on 16th day • Formation of embryonic endoderm • Intraembryonic mesoderm • Ectoderm • Epiblast is the source of all 3 germ layers Fate of Primitive Streak • Continues to form mesodermal cells upto early part of 4th week • Normally, the PS degenerates & diminishes in size.
    [Show full text]
  • The Implications of a Unified Theory of Programmed Cell Death, Polyamines, Oxyradicals and Histogenesis in the Embryo
    lilt. J. Dn. Bioi. J7: 75-S3 (191)3) 75 The implications of a unified theory of programmed cell death, polyamines, oxyradicals and histogenesis in the embryo RALPH E. PARCHMENT- Division of Pharmacology and Toxicology, Hipple Cancer Research Center, Dayton, Ohio, USA ABSTRACT Programmed cell death lapoptosis) is the ubiquitous biological phenomenon of intentional cell death that eliminates redundant cells, changes phenotypic composition during histogenesis, provides form during morphogenesis and balances mitosis in renewing tissues. This form of cell death is controlled by a genetic program(s) that kills the targeted cell without causing subsequent inflammation. Malignant cells implanted into the appropriate regulatory field in the embryo will lose their malignant phenotype yet retain the capacity for proliferation and differentiation. This embryonic regulation of cancer requires simultaneous contact with specific structures on the surfaces of normal cells and exposure to soluble, extracellular signals. During studies to identify such soluble factors in the blastocyst, extracellular hydrogen peroxide was discovered in the blastocele fluid. Current evidence indicates that this hydrogen peroxide causes apoptosis of inner cell mass cells destined to develop into trophectoderm - the first apoptotic event during mammalian development which likely prevents the formation of ectopic trophectoderm in the soon-to.appear germ layers (histogenesis). The evidence also suggests that the hydrogen peroxide is generated during the oxidation of extracellular polyamines by a family of enzymes called amine oxidases. The components of this mechanism are also present in the mammalian epidermis, where they are proposed to control the survival of basal cell progeny and hence epidermal homeostasis (essentially controlling the production of tissue mass).
    [Show full text]
  • New Insights Into Human Early Embryo Development: a Particular Theoretical Study
    14 International Journal of Modern Anthropology Int. J. Mod. Anthrop. (2018) Vol: 2, Issue No: 11, pp: 14 - 46 Available online at: www.ata.org.tn ; DOI: http://dx.doi.org/10.4314/ijma.v2i11.1 Original Synthesis Article New insights into human early embryo development: a particular theoretical study Hassen Chaabani Laboratory of Human Genetics and Anthropology, Faculty of Pharmacy, University of Monastir, 5000 Monastir, Tunisia. E.mail: [email protected] (Received 18 January 2018; Accepted 5 Mars 2018; Published 5 May 2018) Abstract – The experimental research on the subject of human early embryo development has been remained insufficient because of ethical norms and legal constraints. In this context, the carrying out of theoretical studies could speed up the slow knowledge progression on this subject. Thus, I present here a particular model of theoretical study based on a synthesis of selected published experimental results combined with what has been provided from my interpretation of scientific signs masked in some Qur‟an verses. In the obtained detailed scenario, I consider that the third cleavage, resulting in 8 blastomeres, is coupled to a particular rearrangement in which 2 daughter cells seem move down and 2 others move up; while the 4 remaining cells seem stay at their initial position (I called them “4 HI cells”). Nevertheless, I consider that the fourth cleavage, resulting in 16 blastomeres, is coupled to a rearrangement that gives the impression of a harmonious descent: in fact, one of each two daughter cells seems pushed down. This descent materializes a morula top–bottom axis, which will go to coincide with the embryo-abembryo axis of the blastocyst.
    [Show full text]
  • Human Development Summary
    Human Development Laboratory Activity Gametogenesis Male The sperm develop within the highly coiled seminiferous tubules of the testes. When the sperm are fully mature they are extremely small, being little more than a bag of genetic material with a tail. The head of the sperm oell contains the nucleus and little else. The tail consists of a flagellum which allows the sperm to swim through the female reproductive tract to the egg. Female The egg is one of the largest cells in the body. As the egg ripens in the ovary it accumulates yolk which will serve as food for the young embryo until the placenta and umbilical cord are fully functional. Egg development is acomplished with the help of special nurse cells called follicle cells. When the egg is fully formed it bursts from the ovary in a process called ovulation. Ovulation is governed by complex nervous and hormonaI controls. After the egg is released from the ovary it enters the oviduct. Embryonic Development Fertilization Fertilization takes place in the fallopian tubes or oviducts. Although thousands of sperm cells may complete the trip to the egg only one will penetrate the cells outermost membrane and fertilize it. From this point on the egg is referred to as a zygote. Cleavage Divisions Almost as soon as the egg is fertilized it begins to divide. First into two cells, then 4, then 8 and so on. These divisions produce a solid clump of 32-64 cells called the morula. Blastocyst The morula continues its trip down the oviduct to the uterus.
    [Show full text]
  • 16. Early Embryo Develop 2008
    EarlyEarly EmbryonicEmbryonic DevelopmentDevelopment ZygoteZygote -- EmbryoEmbryo • two gametes fuse to produce zygote • with first division embryo is produced CleavageCleavage A series of mitotic divisions whereby a multicellular organism is formed – Cells produced are called blastomeres – Controlled by maternal mRNA and protein in most species – Most species = no net gain in volume • allows rapid division • is accomplished by skipping the G1 and G2 growth period between mitotic divisions MitosisMitosis PromotingPromoting FactorFactor • Regulates biphasic cycle of early blastomeres • Made up of two subunits – Cyclin B: accumulates during S phase and degrades following M phase – Cyclin-dependent kinase (cdc2): phosphorylates key proteins involved w/ mitosis CleavageCleavage • Rapid exponential increase in cell # – Frog egg divides into 37,000 cells in 43 hrs • 1 cleavage/hr – Drosophilia-50,000 cells in 12 hrs • 1 division every 10 mins for 2 hrs • Initially synchronous until mid-blastula transition – Growth phases added – Synchronicity lost – New mRNA transcribed Rate of formation of new cells in the frog Rana pipiens MechanismMechanism ofof MitosisMitosis • Result of two coordinated processes – Karyokinesis • Mitotic spindle of tubulin microtubules • Draws chromosomes to centrioles – Cytokinesis • Contractile ring of actin microfilaments • Creates cleavage furrow CleavageCleavage FurrowFurrow AmountAmount ofof YolkYolk inin OocyteOocyte • POLYLECITHAL or MEGALETHICAL - large amount of yolk – found in elasmobranchs, teleost fishes, reptiles,
    [Show full text]
  • High-Yield Embryology 4
    LWBK356-FM_pi-xii.qxd 7/14/09 2:03 AM Page i Aptara Inc High-Yield TM Embryology FOURTH EDITION LWBK356-FM_pi-xii.qxd 7/14/09 2:03 AM Page ii Aptara Inc LWBK356-FM_pi-xii.qxd 7/14/09 2:03 AM Page iii Aptara Inc High-Yield TM Embryology FOURTH EDITION Ronald W. Dudek, PhD Professor Brody School of Medicine East Carolina University Department of Anatomy and Cell Biology Greenville, North Carolina LWBK356-FM_pi-xii.qxd 7/14/09 2:03 AM Page iv Aptara Inc Acquisitions Editor: Crystal Taylor Product Manager: Sirkka E. Howes Marketing Manager: Jennifer Kuklinski Vendor Manager: Bridgett Dougherty Manufacturing Manager: Margie Orzech Design Coordinator: Terry Mallon Compositor: Aptara, Inc. Copyright © 2010, 2007, 2001, 1996 Lippincott Williams & Wilkins, a Wolters Kluwer business. 351 West Camden Street 530 Walnut Street Baltimore, MD 21201 Philadelphia, PA 19106 Printed in China All rights reserved. This book is protected by copyright. No part of this book may be reproduced or transmitted in any form or by any means, including as photocopies or scanned-in or other electronic copies, or utilized by any information storage and retrieval system without written permission from the copyright owner, except for brief quotations embodied in critical articles and reviews. Materials appear- ing in this book prepared by individuals as part of their official duties as U.S. government employees are not covered by the above-mentioned copyright. To request permission, please contact Lippincott Williams & Wilkins at 530 Walnut Street, Philadelphia, PA 19106, via email at [email protected], or via website at lww.com (products and services).
    [Show full text]
  • Stem-Cell-Based Embryo Models for Fundamental Research and Translation
    REVIEW ARTICLE https://doi.org/10.1038/s41563-020-00829-9 Stem-cell-based embryo models for fundamental research and translation Jianping Fu 1,2,3 ✉ , Aryeh Warmflash 4,5 ✉ and Matthias P. Lutolf 6,7 ✉ Despite its importance, understanding the early phases of human development has been limited by availability of human sam- ples. The recent emergence of stem-cell-derived embryo models, a new field aiming to use stem cells to construct in vitro models to recapitulate snapshots of the development of the mammalian conceptus, opens up exciting opportunities to promote fundamental understanding of human development and advance reproductive and regenerative medicine. This Review provides a summary of the current knowledge of early mammalian development, using mouse and human conceptuses as models, and emphasizes their similarities and critical differences. We then highlight existing embryo models that mimic different aspects of mouse and human development. We further discuss bioengineering tools used for controlling multicellular interactions and self-organization critical for the development of these models. We conclude with a discussion of the important next steps and exciting future opportunities of stem-cell-derived embryo models for fundamental discovery and translation. he development of a multicellular organism from a single notable progress in studying non-human primate (NHP) monkey fertilized egg is a brilliant triumph of evolution that has fas- embryos10–12, whose developments are similar to humans. However, Tcinated generations of scientists (Box 1). Understanding our NHP monkey models remain costly, are difficult to modify geneti- own development is of particular fundamental and practical inter- cally, and have their own ethical challenges.
    [Show full text]
  • Morphological Characterization of Pre-And Peri-Implantation in Vitro
    REPRODUCTIONRESEARCH Morphological characterization of pre- and peri-implantation in vitro cultured, somatic cell nuclear transfer and in vivo derived ovine embryos P Tveden-Nyborg, T T Peura1, K M Hartwich2, S K Walker2 and P Maddox-Hyttel Department of Animal and Veterinary Basic Sciences, Royal Veterinary and Agricultural University, Groennegaardsvej 7, DK-1870 Frederiksberg C, Denmark, 1Sydney IVF Ltd, 4 O’Connell Street, Sydney, NSW 2000, Australia and 2South Australian Research and Development Institute, Turretfield Research Centre, Rosedale, SA 5350, Australia Correspondence should be addressed to Pernille Tveden-Nyborg; Email: [email protected] Abstract The processes of cellular differentiation were studied in somatic cell nuclear transfer (SCNT), in vitro cultured (IVC) and in vivo developed (in vivo) ovine embryos on days 7, 9, 11, 13, 17 and 19. SCNT embryos were constructed from in vitro matured oocytes and granulosa cells, and IVC embryos were produced by in vitro culture of in vivo fertilized zygotes. Most SCNT and IVC embryos were transferred to recipients on day 6 while some remained in culture for day 7 processing. In vivo embryos were collected as zygotes, transferred to intermediate recipients and retransferred to final recipients on day 6. All embryos were processed for examination by light and transmission electron microscopy or immunohistochemical labelling for alpha-1-fetoprotein and vimentin. Overall, morphological development of in vivo embryos was superior to IVC and SCNT embryos. Day 7 and particularly day 9 IVC and SCNT embryos had impaired hypoblast development, some lacking identifiable inner cell masses. On day 11, only in vivo and IVC embryos had developed an embryonic disc, and gastrulation was evident in half of in vivo embryos and one IVC embryo.
    [Show full text]