DOCSLIB.ORG

Identification of Differentially Expressed and Developmentally

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Identification of Differentially Expressed and Developmentally Oncogene (2004) 23, 3444–3453 & 2004 Nature Publishing Group All rights reserved 0950-9232/04 $25.00 www.nature.com/onc Identification of differentially expressed and developmentally regulated genes in medulloblastoma using suppression subtraction hybridization Naoki Yokota1,2,3, Todd G Mainprize1,2, Michael D Taylor1,2, Tomohiko Kohata1,2, Michael Loreto1,2, Shigeo Ueda1,2, Wieslaw Dura4, Wiesia Grajkowska4, John S Kuo1,2 and James T Rutka1,2,* 1The Arthur and Sonia Labatt Brain Tumor Research Centre, The University of Toronto, Toronto, Ontario, Canada; 2The Division of Neurosurgery, The University of Toronto, Toronto, Ontario, Canada; 3The Department of Neurosurgery, Hamamatsu University School of Medicine, Hamamatsu, Japan; 4Department of Pathology, University of Warsaw, Warsaw, Poland To increase our understanding of the molecular pathogen- Keywords: medulloblastoma; developmentally regulated esis of medulloblastoma (MB), we utilized the technique of gene; differentially expressed gene; subtractive suppres- suppression subtractive hybridization (SSH) to identify sion hybridization; cerebellum; external granule cell genes that are dysregulated in MB when compared to cerebellum. SSH-enriched cDNA libraries from both human and Ptch þ /À heterozygous murine MBs were generated by subtracting common cDNAs from corre- Introduction sponding non-neoplastic cerebellum. For the human classic MB library, total human cerebellar RNA was Despite the paucity of knowledge regarding the mole- þ /À used as control tissue; for the Ptch heterozygous MB, cular oncogenesis of most human brain tumors, our þ /À non-neoplastic cerebellum from an unaffected Ptch understanding of the molecular pathways causing littermate was used as the control. Through differential medulloblastoma (MB), the most common malignant screening of these libraries, over 100 upregulated tumor brain tumor in children, has advanced considerably. We cDNA fragments were isolated, sequenced and identified now know that MB can occur in the setting of two with the NCBI BLAST program. From these, we selected major inherited genetic syndromes. In these two genes involved in cellular proliferation, antiapoptosis, and hereditary diseases, Turcot and Gorlin syndrome, the cerebellar differentiation for further analysis. Upregulated Wnt and Hedgehog (Hh) signaling pathways respec- genes identified in the human MB library included Unc33- tively, are dysregulated and may lead to MB as well as like protein (ULIP), SOX4, Neuronatin (NNAT), the other developmental malformations and cancers (Taylor mammalian homologue of Drosophila BarH-like et al., 2000; Wechsler-Reya and Scott, 2001; Yokota 1(BARHL1), the nuclear matix protein NRP/B et al., 2002). MB is also found in approximately 20% of (ENC1), and the homeobox OTX2 gene. Genes found to offspring from heterozygous transgenic mice carrying a be upregulated in the murine MB library included cyclin targeted deletion of the Ptch gene that results in D2 (Ccnd2), thymopoietin (Tmpo), Musashi-1 (Msh1), constitutive Hh signaling (Goodrich et al., 1997; protein phosphatase 2A inhibitor-2 (I-2pp2a), and Wetmore et al., 2001). Both Wnt and Hh signaling Unc5h4(D). Using semiquantitative reverse transcrip- pathways play crucial roles in the proliferation and tion–polymerase chain reaction (RT–PCR), the mRNA differentiation of cerebellar granule cells, from which expression levels for these genes were markedly higher in MBs are thought to arise (Yokota et al., 1996; Buhren human MBs than in cerebellum. Western blot analysis was et al., 2000). used to further confirm the overexpression of a subset of Primitive neuroectodermal tumors (PNETs), such as these genes at the protein level. Notch pathway over- MB, are characterized by dysregulation of cellular activity was demonstrated in the TE671 MB cell line proliferation, apoptosis, or differentiation signals that expressing high levels of MSH1 through HES1-Lucifer- normally occur at critical developmental stages in ase transfections. This study has revealed a panel of neurogenesis (Wechsler-Reya and Scott, 2001). By developmentally regulated genes that may be involved in histology, MB is composed mainly of undifferentiated the pathogenesis of MB. small, round blue cells. However, many MBs exhibit Oncogene (2004) 23, 3444–3453. doi:10.1038/sj.onc.1207475 markers of neuronal differentiation including expression Published online 5 April 2004 of neuronal transcriptional factors from the PAX (Kozmik et al., 1995; Vincent et al., 1996), ZIC (Yokota *Correspondence: JT Rutka, The Division of Neurosurgery, Suite et al., 1996; Michiels et al., 1999; Pomeroy et al., 2002), 1502, The Hospital for Sick Children, 555 University Avenue, and NEUROD gene families (Rostomily et al., 1997). Toronto, Ontario, Canada M5G 1X8; E-mail: [email protected] These neuronal transcriptional factors are developmen- Received 7 September 2003; revised 5 January 2004; accepted 5 January tally regulated and govern the expression of several 2004; Published online 5 April 2004 genes that influence cell fate in the cerebellar granule cell Developmentally regulated genes in medulloblastoma N Yokota et al 3445 lineage, and presumably affect the growth and differ- the fragments isolated from the human MB cDNA entiation of MB. In this study, we sought to identify library, most were found to bear homology to known genes that are differentially expressed in a sporadic sequences in the human genome database. Other cDNA human classical MB as compared with normal human fragments could be assigned a genomic location and a cerebellar tissue; and in a murine Ptch þ /À MB as hypothetical protein structure. However, the structure compared with non-neoplastic cerebellar tissue from and function of some human ESTs found through an unaffected littermate. We utilized the technique of homology searches are still largely unknown. Among suppressive subtractive hybridization (SSH), a polymer- the 25 fragments isolated from the murine cDNA ase chain reaction (PCR)-based method of subtractive subtractive library, 17 identified genes were repeat hits cloning, to identify genes overexpressed in the two with Ccnd2 being represented 12 times (almost 50% of different types of MB (Diatchenko et al., 1996). all clones). This may be due to a high native number of Although a number of genes were isolated using this mRNA species, or related to the preamplification step strategy, we concentrated our efforts on those genes that used for generating the murine library. We selected five are known to be developmentally regulated in the of the nine different genes identified in the murine central nervous system (CNS). Confirmation of the cDNA library for verification. results obtained from the SSH screen was performed by In both libraries, we identified many developmentally reverse transcription (RT)–PCR and Western blot regulated genes involved in cellular proliferation, anti- analysis of non-neoplastic cerebellum, MB specimens apoptosis, and differentiation of the cerebellar granule and various cell lines. Our results show that many MBs cells (Table 2a, b). Housekeeping, ribosomal and share certain expression patterns of these developmen- mitochondrial genes were rarely isolated, indicating that tally regulated genes. the subtractive hybridizations were effective. A total of 11 clones of differentially expressed and developmentally regulated genes were selected from both MB libraries and subjected to further analysis by Results RT–PCR (Figure 1). The genes from the human MB Isolation of upregulated clones by screening subtracted library encode for the nuclear matrix protein NRP/B cDNA libraries (ENC1), the homeobox protein OTX2, SRY (sex determination region Y)-box 4 protein SOX4, Neuro- Over 300 clones were screened in each library, from natin (NNAT), human homologue of Drosophila which 57 differentially regulated clones were selected. BARHL1, and Unc-33-like protein (ULIP). The genes Their plasmids were then purified and cDNAs se- selected from the murine cDNA library are cyclin D2 quenced. The percentage of upregulated clones was (CCND2), thymopoietin (TMPO), Musashi-1 therefore approximately 20%. Of the 32 clones identified (MSH1), protein phosphatase 2A inhibitor-2 from the human MB library, 12 were multiple hits and (I-2PP2A), which is a murine homolog of the human we selected six for further evaluation (Table 1). Among SET gene, and the candidate netrin receptor UNC5H4. Table 1 Primer sequences of genes of interest Primer name Sequence Ann. temperature (1C) Length (bp) BARHL1 forward GGAAGGGACTGTTTGGAGAC 58 318 BARHL1 reverse GCCCTCCTCCTTCACTTTAT ULIP forward GGCAGAAGCAAGAAGAGATT 49 196 ULIP reverse CAAACAAATCAAGGCTATGC SOX4 forward ATTGATGTTGTTGTTGATGG 53 196 SOX4 reverse AAGCAAAATAAAACAAAACC OTX2 forward AGTCACCAGCCATCTCAATC 51 156 OTX2 reverse ATAATCCAAGCAGTCAGCAT Neuronatin forward CGACAATGACGAAGATACCA 53 131 Neuronatin reverse ATCAGAATGCGGTGCCTATG ENC1 forward TGGCCATGGAGGAACTCATC 57 635 ENC1 reverse TGGGGAGCTTGTCATGACTG CCND2 forward ATTGGCATGTCTGGTTCACA 58 195 CCND2 reverse GAACGCCAGATACCAGAAGC TMPO forward CAGGTTCCTTTGTGGCATTT 58 202 TMPO reverse TTGCTGCCATTCTTCTTCAA MSH-1 forward ATGGTGGAATGTAAGAAAGC 58 205 MSH-1 reverse TCGGGGAACTGGTAGGTGTA SET forward CAGCAAGAAGCGATTGAACA 58 203 SET reverse TGCAGACACTTGTGGATGGT Unc5H4 forward GGTGCTCCTGAGTCCTGAAG 58 203 Unc5H4 reverse GGGTCCAAAAGGCAGTAACA b-Actin forward CAACCGCGAGAAGATGACC 58 326 b-Actin reverse TCCAGGGCGACATAGCACA Oncogene Developmentally regulated genes in medulloblastoma N Yokota et al 3446 Table 2 (a) Gene identification
Load more

Recommended publications
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Transcriptional Control of Tissue-Resident Memory T Cell Generation
    Transcriptional control of tissue-resident memory T cell generation Filip Cvetkovski Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2019 © 2019 Filip Cvetkovski All rights reserved ABSTRACT Transcriptional control of tissue-resident memory T cell generation Filip Cvetkovski Tissue-resident memory T cells (TRM) are a non-circulating subset of memory that are maintained at sites of pathogen entry and mediate optimal protection against reinfection. Lung TRM can be generated in response to respiratory infection or vaccination, however, the molecular pathways involved in CD4+TRM establishment have not been defined. Here, we performed transcriptional profiling of influenza-specific lung CD4+TRM following influenza infection to identify pathways implicated in CD4+TRM generation and homeostasis. Lung CD4+TRM displayed a unique transcriptional profile distinct from spleen memory, including up-regulation of a gene network induced by the transcription factor IRF4, a known regulator of effector T cell differentiation. In addition, the gene expression profile of lung CD4+TRM was enriched in gene sets previously described in tissue-resident regulatory T cells. Up-regulation of immunomodulatory molecules such as CTLA-4, PD-1, and ICOS, suggested a potential regulatory role for CD4+TRM in tissues. Using loss-of-function genetic experiments in mice, we demonstrate that IRF4 is required for the generation of lung-localized pathogen-specific effector CD4+T cells during acute influenza infection. Influenza-specific IRF4−/− T cells failed to fully express CD44, and maintained high levels of CD62L compared to wild type, suggesting a defect in complete differentiation into lung-tropic effector T cells.
    [Show full text]
  • SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure S1. RBPJ
    Xie et al. SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure S1. RBPJ correlates with BTIC marker expression. A-D. The TCGA GBM dataset was downloaded and correlations analyzed by R. RBPJ mRNA levels were highly correlated with (A) Olig2, (B) Sox2, (C) CD133, and (D) Sox4 levels. E. RBPJ is preferentially expressed in proneural glioblastomas. The glioblastoma TCGA dataset was interrogated for RBPJ mRNA expression segregated by transcriptional profile. The proneural tumors were further divided into G-CIMP (glioma CpG-island methylator phenotype) or non-G-CIMP. **, p < 0.01. ****, p < 0.0001. *****, p < 0.00001. Supplemental Figure S2. Targeting RBPJ induces BTIC apoptosis. A. 3691 BTICs were transduced with shCONT, shRBPJ-1, or shRBPJ-2. Lysates were prepared and immunoblotted with the indicated antibodies. shRNA-mediated knockdown of RBPJ was associated with increased cleaved (activated) PARP. B. 3691 BTICs were transduced with shCONT, shRBPJ-1, or shRBPJ-2. Apoptosis measured by Annexin V staining. Data are presented as mean ± SEM (two- way ANOVA; **, p < 0.01; n = 3). Supplemental Figure S3. Targeting RBPJ does not affect non-BTIC proliferation. Non-BTICs (Top, 3691; Bottom, 4121) were transduced with shCONT, shRBPJ-1, or shRBPJ-2. Cell proliferation was measured by CellTiter-Glo. 42 Xie et al. Supplemental Figure S4. RBPJ induces transcriptional profiles in BTICs distinct from Notch activation. A. In parallel experiments, 3691 BTICs were either treated with DAPT (at either 5 μM or 10 μM) vs. vehicle control (DMSO) or transduced with shRBPJ vs. shCONT. RNA-Seq was performed and the results displayed as a heat map with normalization to the relevant control.
    [Show full text]
  • SOX4 Is Activated by C-MYC in Prostate Cancer
    Medical Oncology (2019) 36:92 https://doi.org/10.1007/s12032-019-1317-6 ORIGINAL PAPER SOX4 is activated by C‑MYC in prostate cancer Hongyan Dong1,2 · Jing Hu1 · Lin Wang3 · Mei Qi1 · Ning Lu1 · Xiao Tan2 · Muyi Yang1 · Xinnuo Bai4 · Xuemei Zhan2 · Bo Han1,5 Received: 26 July 2019 / Accepted: 12 September 2019 / Published online: 27 September 2019 © Springer Science+Business Media, LLC, part of Springer Nature 2019 Abstract Although MYC proto-oncogene (C-MYC) amplifcation has been consistently reported to be a potential marker for prostate cancer (PCa) progression and prognosis, the clinicopathological and prognostic signifcance of C-MYC protein expression remains controversial. Overexpression of SOX4 has been shown to play important roles in multiple cancers including PCa. However, the link between these two critical genetic aberrations is unclear. In the current study, we showed that C-MYC was overexpressed in 16.2% (17/105) of Chinese patients with localized PCa. Overexpression of C-MYC was signifcantly associated with high Gleason scores (P = 0.012) and high Ki67 labeling index (P = 0.005). C-MYC overexpression was cor- related with cancer-related mortality and suggested to be an unfavorable prognostic factor in Chinese PCa patients (P = 0.018). Overexpression of C-MYC is associated with SOX4 overexpression in PCa tissues. Notably, SOX4 is a direct target gene of C-MYC; C-MYC activates SOX4 expression via binding to its promoter. In addition, Co-IP analysis demonstrated a physi- cal interaction between C-MYC and SOX4 protein in PCa cells. Clinically, C-MYC+/SOX4+ characterized poor prognosis in a subset of PCa patients.
    [Show full text]
  • Transcription Factor Gene Expression Profiling and Analysis of SOX Gene Family Transcription Factors in Human Limbal Epithelial
    Transcription factor gene expression profiling and analysis of SOX gene family transcription factors in human limbal epithelial progenitor cells Der Naturwissenschaftlichen Fakultät der Friedrich-Alexander-Universität Erlangen-Nürnberg zur Erlangung des Doktorgrades Dr. rer. nat. vorgelegt von Dr. med. Johannes Menzel-Severing aus Bonn Als Dissertation genehmigt von der Naturwissenschaftlichen Fakultät der Friedrich-Alexander-Universität Erlangen-Nürnberg Tag der mündlichen Prüfung: 7. Februar 2018 Vorsitzender des Promotionsorgans: Prof. Dr. Georg Kreimer Gutachter: Prof. Dr. Andreas Feigenspan Prof. Dr. Ursula Schlötzer-Schrehardt 1 INDEX 1. ABSTRACTS Page 1.1. Abstract in English 4 1.2. Zusammenfassung auf Deutsch 7 2. INTRODUCTION 2.1. Anatomy and histology of the cornea and the corneal surface 11 2.2. Homeostasis of corneal epithelium and the limbal stem cell paradigm 13 2.3. The limbal stem cell niche 15 2.4. Cell therapeutic strategies in ocular surface disease 17 2.5. Alternative cell sources for transplantation to the corneal surface 18 2.6. Transcription factors in cell differentiation and reprogramming 21 2.7. Transcription factors in limbal epithelial cells 22 2.8. Research question 25 3. MATERIALS AND METHODS 3.1. Human donor corneas 27 3.2. Laser Capture Microdissection (LCM) 28 3.3. RNA amplification and RT2 profiler PCR arrays 29 3.4. Real-time PCR analysis 33 3.5. Immunohistochemistry 34 3.6. Limbal epithelial cell culture 38 3.7. Transcription-factor knockdown/overexpression in vitro 39 3.8. Proliferation assay 40 3.9. Western blot 40 3.10. Statistical analysis 41 2 4. RESULTS 4.1. Quality control of LCM-isolated and amplified RNA 42 4.2.
    [Show full text]
  • SOX4 Expression in Bladder Carcinoma: Clinical Aspects and in Vitro Functional Characterization
    Research Article SOX4 Expression in Bladder Carcinoma: Clinical Aspects and In vitro Functional Characterization Mads Aaboe,1 Karin Birkenkamp-Demtroder,1 Carsten Wiuf,1,3 Flemming Brandt Sørensen,4 Thomas Thykjaer,1 Guido Sauter,5 Klaus Møller-Ernst Jensen,2 Lars Dyrskjøt,1 and Torben Ørntoft1 1Molecular Diagnostic Laboratory, Department of Clinical Biochemistry, and 2Department of Urology, Aarhus University Hospital/Skejby Sygehus, Aarhus N, Denmark; 3Bioinformatics Research Center, University of Aarhus; 4Institute of Pathology, Aarhus University Hospital, Aarhus Sygehus, Aarhus C, Denmark; and 5Department of Pathology, University Medical Center Hamburg-Eppendorf, Hamburg, Germany Abstract shown to be involved in a range of developmental processes. The SOX4À/À phenotype in mouse results in death during embryo- The human transcription factor SOX4 was 5-fold up-regulated in bladder tumors compared with normal tissue based on genesis due to lack of normal heart development, which results in whole-genome expression profiling of 166 clinical bladder circulatory failure (6, 7). Furthermore, other studies have shown tumor samples and 27 normal urothelium samples.Using a that SOX4 is expressed in hormone-responsive tissues of the SOX4-specific antibody, we found that the cancer cells reproductive system in mouse, as well as in brain and T- and B-cell expressed the SOX4 protein and, thus, did an evaluation of lymphocytes (8, 9), and may play a role in osteoblastic differenti- SOX4 protein expression in 2,360 bladder tumors using a ation (10). tissue microarray with clinical annotation.We found a SOX4 binds to the 7-bp DNA-motif AACAAAG through its high mobility group domain and thereby transcriptionally activates correlation (P < 0.05) between strong SOX4 expression and target genes (9, 11).
    [Show full text]
  • ID1 Mediates Escape from TGF-Β Tumor Suppression in Pancreatic Cancer
    Author Manuscript Published OnlineFirst on October 3, 2019; DOI: 10.1158/2159-8290.CD-19-0529 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. ID1 mediates escape from TGF-β tumor suppression in pancreatic cancer Yun-Han Huang1,2,3, Jing Hu1, Fei Chen1, Nicolas Lecomte4, Harihar Basnet1, Charles J. David1,10, Matthew D. Witkin5, Peter J. Allen6, Steven D. Leach4,6,7,9, Travis J. Hollmann7,8, Christine A. Iacobuzio-Donahue4,7,8, and Joan Massagué1* 1Cancer Biology and Genetics Program, Sloan Kettering Institute, Memorial Sloan Kettering Cancer Center, New York, NY 10065 2Weill Cornell/Sloan Kettering/Rockefeller Tri-Institutional MD-PhD Program, New York, NY 10065 3Gerstner Sloan Kettering Graduate School of Biomedical Sciences, New York, NY 10065 4The David M. Rubinstein Center for Pancreatic Cancer Research, Memorial Sloan Kettering Cancer Center, New York, NY 10065 5Center for Epigenetics Research, Memorial Sloan Kettering Cancer Center, New York, NY 10065 6Department of Surgery, Memorial Sloan Kettering Cancer Center, New York, NY 10065 7Department of Pathology, Memorial Sloan Kettering Cancer Center, New York, NY 10065 8Human Oncology and Pathogenesis Program, Memorial Sloan Kettering Cancer Center, New York, NY 10065 9Present address: Department of Molecular and Systems Biology, Dartmouth Geisel School of Medicine, 1 Rope Ferry Road, Hanover, NH 03755-1404 10Present address: Tsinghua University School of Medicine, Department of Basic Sciences, Medical Sciences Building D106, Haidian District, Beijing, China, 100084 Running title: ID1 mediates escape from TGF-β tumor suppression in PDA Keywords: TGF-β, pancreatic cancer, ID1, tumor suppression, EMT Financial support: National Cancer Institute grants R01-CA34610 (JM) and P30-CA008748 (MSKCC), and Predoctoral Fellowship F30-CA203238 (YH).
    [Show full text]
  • The Tumor Suppressor HHEX Inhibits Axon Growth When Prematurely Expressed in Developing Central Nervous System Neurons
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by epublications@Marquette Marquette University e-Publications@Marquette Biological Sciences Faculty Research and Biological Sciences, Department of Publications 9-1-2015 The umorT Suppressor HHEX Inhibits Axon Growth when Prematurely Expressed in Developing Central Nervous System Neurons Matthew .T Simpson Marquette University Ishwariya Venkatesh Marquette University Ben L. Callif Marquette University Laura K. Thiel Marquette University Denise M. Coley Marquette University See next page for additional authors Accepted version. Molecular and Cellular Neuroscience, Vol 68 )September 2015): 272-283. DOI. © 2015 Elsevier Inc. Used with permission. NOTICE: this is the author’s version of a work that was accepted for publication in Molecular and Cellular Neuroscience. Changes resulting from the publishing process, such as peer review, editing, corrections, structural formatting, and other quality control mechanisms may not be reflected in this document. Changes may have been made to this work since it was submitted for publication. A definitive version was subsequently published in Molecular and Cellular Neuroscience, Vol 68 )September 2015): 272-283. DOI. Authors Matthew T. Simpson, Ishwariya Venkatesh, Ben L. Callif, Laura K. Thiel, Denise M. Coley, Kristen N. Winsor, Zimei Wang, Audra A. Kramer, Jessica K. Lerch, and Murray G. Blackmore This article is available at e-Publications@Marquette: https://epublications.marquette.edu/bio_fac/515 NOT THE PUBLISHED VERSION; this is the author’s final, peer-reviewed manuscript. The published version may be accessed by following the link in the citation at the bottom of the page. The Tumor Suppressor HHEX Inhibits Axon Growth When Prematurely Expressed in Developing Central Nervous System Neurons Matthew T.
    [Show full text]
  • Genetic Determinants and Epigenetic Effects of Pioneer-Factor Occupancy
    ARTICLES https://doi.org/10.1038/s41588-017-0034-3 Genetic determinants and epigenetic effects of pioneer-factor occupancy Julie Donaghey1,2, Sudhir Thakurela 1,2, Jocelyn Charlton2,3, Jennifer S. Chen2, Zachary D. Smith1,2, Hongcang Gu1, Ramona Pop2, Kendell Clement1,2, Elena K. Stamenova1, Rahul Karnik1,2, David R. Kelley 2, Casey A. Gifford1,2,5, Davide Cacchiarelli1,2,6, John L. Rinn1,2,7, Andreas Gnirke1, Michael J. Ziller4 and Alexander Meissner 1,2,3* Transcription factors (TFs) direct developmental transitions by binding to target DNA sequences, influencing gene expres- sion and establishing complex gene-regultory networks. To systematically determine the molecular components that enable or constrain TF activity, we investigated the genomic occupancy of FOXA2, GATA4 and OCT4 in several cell types. Despite their classification as pioneer factors, all three TFs exhibit cell-type-specific binding, even when supraphysiologically and ectopically expressed. However, FOXA2 and GATA4 can be distinguished by low enrichment at loci that are highly occupied by these fac- tors in alternative cell types. We find that expression of additional cofactors increases enrichment at a subset of these sites. Finally, FOXA2 occupancy and changes to DNA accessibility can occur in G1-arrested cells, but subsequent loss of DNA meth- ylation requires DNA replication. rganismal development is orchestrated by the selective use the regulatory capabilities of the presumed pioneer TFs FOXA2, and distinctive interpretation of identical genetic material GATA4 and OCT4, which are frequently studied in development Oin each cell. During this process, TFs coordinate protein and used in cellular reprogramming. complexes at associated promoter and distal enhancer elements to modulate gene expression.
    [Show full text]
  • Oncogenic Potential of the Dual-Function Protein MEX3A
    biology Review Oncogenic Potential of the Dual-Function Protein MEX3A Marcell Lederer 1,*, Simon Müller 1, Markus Glaß 1 , Nadine Bley 1, Christian Ihling 2, Andrea Sinz 2 and Stefan Hüttelmaier 1 1 Charles Tanford Protein Center, Faculty of Medicine, Institute of Molecular Medicine, Section for Molecular Cell Biology, Martin Luther University Halle-Wittenberg, Kurt-Mothes-Str. 3a, 06120 Halle, Germany; [email protected] (S.M.).; [email protected] (M.G.).; [email protected] (N.B.); [email protected] (S.H.) 2 Center for Structural Mass Spectrometry, Department of Pharmaceutical Chemistry & Bioanalytics, Institute of Pharmacy, Martin Luther University Halle-Wittenberg, Kurt-Mothes-Str. 3, 06120 Halle (Saale), Germany; [email protected] (C.I.); [email protected] (A.S.) * Correspondence: [email protected] Simple Summary: RNA-binding proteins (RBPs) are involved in the post-transcriptional control of gene expression, modulating the splicing, turnover, subcellular sorting and translation of (m)RNAs. Dysregulation of RBPs, for instance, by deregulated expression in cancer, disturbs key cellular processes such as proliferation, cell cycle progression or migration. Accordingly, RBPs contribute to tumorigenesis. Members of the human MEX3 protein family harbor RNA-binding capacity and E3 ligase activity. Thus, they presumably combine post-transcriptional and post-translational regulatory mechanisms. In this review, we discuss recent studies to emphasize emerging evidence for a pivotal role of the MEX3 protein family, in particular MEX3A, in human cancer. Citation: Lederer, M.; Müller, S.; Glaß, M.; Bley, N.; Ihling, C.; Sinz, A.; Abstract: MEX3A belongs to the MEX3 (Muscle EXcess) protein family consisting of four members Hüttelmaier, S.
    [Show full text]
  • Microrna Expression and Activity in T-Cell Acute Lymphoblastic Leukemia
    www.impactjournals.com/oncotarget/ Oncotarget, 2018, Vol. 9, (No. 4), pp: 5445-5458 Review MicroRNA expression and activity in T-cell acute lymphoblastic leukemia Fang Ye1 1Department of Hematology, Beijing Chuiyangliu Hospital Affiliated to Tsinghua University, Beijing, China Correspondence to: Fang Ye, email: [email protected] Keywords: MicroRNA; T-ALL; NOTCH1 Received: October 27, 2017 Accepted: December 01, 2017 Published: December 20, 2017 Copyright: Ye. This is an open-access article distributed under the terms of the Creative Commons Attribution License 3.0 (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT T-cell acute lymphoblastic leukemia (T-ALL) is a lymphoid malignancy caused by the oncogenic transformation of immature T-cell progenitors. Many biologically relevant genetic and epigenetic alterations have been identified as driving factors for this transformation. Recently, microRNAs (miRNAs) have been shown to influence various leukemias, including T-ALL. Aberrant expression of miRNAs can function as either oncogenes or tumor suppressors in T-ALL through the regulation of cell migration, invasion, proliferation, apoptosis, and chemoresistance. This occurs by targeting key signaling pathways or transcriptional factors that play a critical role in T-ALL pathology and progression. Different miRNA expression profiles have been linked to specific genetic subtypes of human T-ALL. Furthermore, miRNAs can also act as independent prognostic factors to predict clinical outcomes for T-ALL patients. In the current review, we will focus on the role of miRNAs in the development and progression of T-ALL. INTRODUCTION immunophenotypes that reflect immature thymocytes arresting at different stages of differentiation [7].
    [Show full text]
  • Single Cell Transcriptomic Analysis of Human Pluripotent Stem Cell Chondrogenesis
    ARTICLE https://doi.org/10.1038/s41467-020-20598-y OPEN Single cell transcriptomic analysis of human pluripotent stem cell chondrogenesis Chia-Lung Wu1,2,5,6, Amanda Dicks1,2,3,6, Nancy Steward1,2, Ruhang Tang1,2, Dakota B. Katz1,2,3, ✉ Yun-Rak Choi1,2,4 & Farshid Guilak 1,2,3 The therapeutic application of human induced pluripotent stem cells (hiPSCs) for cartilage regeneration is largely hindered by the low yield of chondrocytes accompanied by unpre- 1234567890():,; dictable and heterogeneous off-target differentiation of cells during chondrogenesis. Here, we combine bulk RNA sequencing, single cell RNA sequencing, and bioinformatic analyses, including weighted gene co-expression analysis (WGCNA), to investigate the gene reg- ulatory networks regulating hiPSC differentiation under chondrogenic conditions. We identify specific WNTs and MITF as hub genes governing the generation of off-target differentiation into neural cells and melanocytes during hiPSC chondrogenesis. With heterocellular signaling models, we further show that WNT signaling produced by off-target cells is responsible for inducing chondrocyte hypertrophy. By targeting WNTs and MITF, we eliminate these cell lineages, significantly enhancing the yield and homogeneity of hiPSC-derived chondrocytes. Collectively, our findings identify the trajectories and molecular mechanisms governing cell fate decision in hiPSC chondrogenesis, as well as dynamic transcriptome profiles orches- trating chondrocyte proliferation and differentiation. 1 Dept. of Orthopaedic Surgery, Washington University in Saint Louis, St. Louis, MO 63110, USA. 2 Shriners Hospitals for Children—St. Louis, St. Louis, MO 63110, USA. 3 Dept. of Biomedical Engineering, Washington University in Saint Louis, St. Louis, MO 63110, USA. 4 Dept. of Orthopaedic Surgery, Yonsei University, Seoul, South Korea.
    [Show full text]