Supplemental Fig. S1

A ESCs EBs +ITSF NPCs Neurons media

D4 D8 D11 Oct4+ Nestin+ Tuj1+

Oct4 Nestin Tuj1

B TSS TTS 2 Cbx3 1.5

1

0.5 Average Profile Average

0 -1000 0 1000 2000 3000 4000 Meta-gene (bp)

C Olig1 Lifr

20 20 Cbx3

10 20 Pol II

TSS TSS Supplemental Fig. S2

A C D 100 24 hrs (D6) siControl siCbx3 2.5 75 2 Cbx3 50 1.5

α-Tubulin 25 1 Sox1+ cells cells (%) Sox1+ 0.5

0 Expression Relative B 0 Ndn Olig1 Jag1 Wnt7b Pdgfb Itga5 ESCs EBs siCbx3 NPCs 48 hrs (D7) 2.5 D5 D7 D4 D8 2 IF siControl_D7 siCbx3_D7 1.5

1

0.5 Relative Expression Relative 0 Sox1 Ndn Olig1 Jag1 Wnt7b Pdgfb Itga5

72 hrs (D8) 3 * 2.5 2 *** *** 1.5

DAPI 1 ** * *

Relative Expression Relative 0.5 0 Ndn Olig1 Jag1 Wnt7b Pdgfb Itga5 E Down-regulated G Homophilic cell adhesion Fold induction Nervous system development KD_RPKM/Ctrl_RPKM Sox1 NPC NPC only Neurogenesis Folr1 Car2 Neuron differentiation Thbs1 Ets2 Anxa3 Icam1 1575 Junb Casp8 Neurogenesis Sgpl1 H2-M3 Serpine1 Il23a 261 Nervous system development Qk Tnfsf9 Macromolecule metabolic process Itga5 Tnfaip2 Col5a1 Tgfbr2 Overlap ESC 586 Regulation of cellular metabolic process Hopx Hoxa5 Hoxa5 Hbegf Gata3 F3 Stat5a Vasculature development Plcd3 Scin Biomineral tissue development Wnt4 Esam Pdgfb Mecom

ESC only Neuron projection development Tead1 Il7 Casp8 Il15ra Multicellular organismal development genes lineage hematopoietic Wnt7b Nfe2 0 10 20 30 Emp2 Il34 Hdac7 Fli1 -log10 (p-value) Stat1 Flt3l Up-regulated Msx2 Runx1 Runx1 Regulation of immune system process Tnfaip2 Hlx Tgfbr2 Hoxb5 Hoxb5

Circulatory system development Derepressed NPC Ctsh Egr3

NPC only Cardiovascular system development Arhgef15 Cbfa2t3 3086 Multicellular organismal process Col3a1 Hoxa5

ardiac lineage genes lineage ardiac Tnnt3 Tnnt3 Response to cytokine stimulus c Reck Cdx2 627 Regulation of immune system process Thbs2 Cellular response to bacterial origin Tnfsf12

Overlap Esx1 ESC 684 RresponseResponse to lipid Rapgef3 Tbx20 Tbx20 Derepressed Gja4 Amino-acid betaine catabolic process Hpse Apoptotic process in heart morphogenesis Gpr4 Tbx3 Circadian sleep/wake cycle Tbx3 ESC only Wnt5a Paraxial mesodermal cell differentiation Tnni3 Nfe2 0 10 20 30 Wnt11 -log (p-value) Apob 10 Tcf7l2 Hand1 Hand1 F Thbs1 Qk Pdgfb Wnt7b Runx1 Plxdc1 Pdgfra Pdgfra 15 15 15 15 Kcnj8 4 Cbx3 Cbx3 Fgf10 Optc 3 Col4a3 20 20 20 20 2 Ceacam1 1 Pol II Egr3 Igf1 0

TSS TSS TSS TSS Supplemental Fig. S3

A B -DOX +DOX

FLAG-Med26

Med19 68 64 FLAG-Cdk8 Med22 62 44 Med8 62 66

Head Med20 49 52 TBP Med17 54 44 Med11 124 171 Med7 62 57 Med21 187 108 Med1 38 31 Med10 169 115

Middle Med4 100 131 Med9 58 47 Med31 126 68 Med26 296 11 Med14 55 59 Med24 57 58 Med27 40 57

Tail Med15 44 62 Med29 52 78 Med23 48 36 Med16 25 24 Cdk8 26 884 Cyclin C 0 94 Med12 2 51 Kinase Med13 0 28

0 150 300

NSAF value Supplemental Fig. S4

A B C Med26 RNA level Control Cbx3 KD 1.5 5 5 Ctrl Cbx3KD Med26 4 4 Cdk8 1 Med26 3 3 2 2 0.5 α Tubulin - 1 1 Average Profile Average Average Profile Average 0 Relative Expression Relative 0 0 -500 TSS +500bp -500 TSS +500bp Ctrl Cbx3 KD

D Cbx3-activated Cbx3-repressed E Cbx3- Cbx3- F Med26 binding 12 6 8 activated repressed Log2 (FC) Cbx3 Med26 Cdk8 6 5 8 4 4 0 Foxh1 (RPKM)

4 2 2 Jak2 2 Average Profile Average Log -5 0 0 0 -1 TSS +1 -1 TSS +1 -1 TSS +1 (kb)

G H Cbx3-activated Cbx3-repressed NSD genes CSD genes Olig1 Jag1 Itga5 Thbs1 3 3 Ctrl Adam22 20 KD genes (356) development

2 2 Cbx3 Sox4 10 Acsl3 Ctrl 1 1 10 Pax6 ervous system Med26

KD N Average Profile: Cdk8 Profile: Average 0 0 TSS 0.5 TSS 0.5 (kb) 10 -3 Ctrl -2 -1 0

Cdk8 10 KD Cbx3 binding

TSS TSS TSS TSS Supplemental Fig. S5

Med26

α-Tubulin

Med26 protein level 1.2

0.8

0.4

Relative Expression Relative 0 Huang

Supplemental Figure Legends

Supplemental Fig. S1. (A) Procedure and validation of mouse ESC neural differentiation. Oct4-positive (Oct4+) ESCs were differentiated into NPCs that were marked by the NPC marker Nestin (Green). After withdrawing EGF and FGF2 from the media, NPCs can differentiate into neurons with the growth of axons that are marked by the neuronal marker Tuj1 (Red). (B) Meta-gene profile of Cbx3 in NPCs. Biological replicate of Figure 1B. (C) Brower tracks show examples of neural differentiation-related genes co-bound by Cbx3 and Pol II in NPCs.

Supplemental Fig. S2. (A) Validation of knockdown efficiency of Cbx3 protein by Western blotting. Two independent siRNAs targeting mouse Cbx3 were transfected into the cells for 72 hours before total cell protein was blotted with anti-Cbx3. siCbx3-2 was selected for RNA-seq and ChIP-Seq experiments. (B) Early effect of siCbx3 transfection on Sox1-positive NPC generation. On day 5 of differentiation, siControl or siCbx3 were transfected into the cells. Immunostaining of Sox1 protein was performed on Day 7. (C) Quantification of percentage of Sox1-positive cells versus DAPI-positive cells for the immunostaining. (D) Time-course RT-qPCR analysis shows that siCbx3 compared to siControl decreases expression of neural lineage genes and increases expression of mesodermal lineage genes 72 hours post transfection. However, siCbx3 does not significantly change gene expression 24 or 48 hours post transfection. *p<0.05, **p<0.01, ***p<0.005, student's t-test. See Supplemental table for primers. (E) Regulation of gene expression by Cbx3 during ESC neural differentiation. ESCs or differentiated cells were transfected with siRNAs targeting Cbx3 and subjected to RNA-seq analysis. Left panel: Venn diagram shows overlap of up- and down-regulated genes upon Cbx3 KD in NPCs or ESCs. Right panel: GO enrichment analysis for up- and down-regulated genes only in NPCs or only in ESCs or overlapping genes in both NPCs and ESCs. (F) Browser tracks showing Cbx3 and Pol II binding in control NSCs to genes upregulated by Cbx3 siRNA knockdown. (G) Heatmap of Cbx3-bound and up-regulated cardiac or hematopoietic lineage genes upon Cbx3 KD in NPCs. Fold induction was calculated by dividing RPKM value of Cbx3 KD by RPKM value of control for each gene. Genes were ranked by RPKM

1 Huang value of Cbx3 KD. Canonical mesodermal lineage genes are highlighted in red arrow boxes.

Supplemental Fig. S3. (A) Validation of expression of FLAG-Med26 or FLAG-Cdk8. ESCs expressing 3×FLAG tagged Med26 or Cdk8 under control of a Dox-inducible promoter were cultured with or without 1µg/ml doxycycline. After 48 hours total cell protein was subjected to Western blotting with a TBP control to normalize extract amounts. (B) MuDPIT analysis of FLAG-Med26 or FLAG-Cdk8 containing Mediator subunits. The number in each color-coded column represents NSAF (normalized spectral abundance factor) values for each subunit.

Supplemental Fig. S4. (A) RT-PCR analysis of Med26 RNA level upon Cbx3 KD. Control siRNAs or siCbx3 was transfected into the cells for 72 hours before total RNAs of the cells were harvested and subjected to RT-PCR. (B) Western blots of Med26 upon Cbx3 KD. Control siRNAs or siCbx3 was transfected into the cells for 72 hours. Cells were lysed in SDS-PAGE loading buffer for blotting analysis. (C) Average gene profiles of Med26 and Cdk8 around TSSs (±500bp) of Med26 bound genes in control or Cbx3 KD NPCs. ChIP-seq signals for average distributions were plotted by significant peaks. (D) Average profiles of Cbx3, Med26 and Cdk8 at promoters of Cbx3 activated (626 down-regulated genes upon Cbx3 KD) or repressed genes (1057 down-regulated genes upon Cbx3 KD) in NPCs. Average distributions were plotted by significant peaks around TSSs ±1kb. P values were calculated by Wilcoxon rank-sum test (Cbx3: p=0.028, Med26: p=0.017; Cdk8: p=1.04e-06). (E) Box plot of gene expression level of Cbx3 target genes in NPCs prior to but affected upon Cbx3 KD, i.e., Log2 expression levels of RPKM of control NPCs. (F) Heatmap of nervous system development genes with decreased Med26 promoter binding levels in fold change (FC) upon Cbx3 KD. Genes are ranked by Cbx3 promoter binding levels. (G) Average gene profiles of Cdk8 at promoters of Cbx3 target genes including nervous system development genes (NSD) and circulatory system development genes (CSD) in control or Cbx3 KD NPCs (P values from Wilcoxon rank- sum test, p=3.62e-12 for Cdk8 in NSD genes; p<2.2e-16 for Cdk8 in CSD genes). (H)

2 Huang

Brower tracks show changes of Med26 and Cdk8 binding around TSSs of representative Cbx3 target genes upon Cbx3 KD in NPCs.

Supplemental Fig. S5. Validation of knockdown efficiency of Med26 protein by Western blotting. Total protein was harvested on day 3 post siRNA transfection. Intensity of blot bands from three replicates were quantified and graphed in lower panel. siMed26-2 was used for RNA-seq experiments.

3 Supplemental Table

Name Primer Sequence

Ndn-F ACTAGGGCTGTGTAAGGGTGG

Ndn-R TGCGTTGCTGTTAAGTCCTGC

Olig1-F AGCTGCTCCCCAACAGTGTC

Olig1-R GCCCATCCGTAACACCCTTG

Jag1-F GCTGCCGCCATAGGTAGAGT

Jag1-R TACCAGTGCCAGTGGAAGCC

Wnt7b-F TCCACCTGTGTGCATGTAAGC

Wnt7b-R CCACAAGTGCTCAGGCATACA

Pdgfb-F TCCATTGCCTCCACTTCCTGG

Pdgfb-R AGATCAGAGGGACACCTGTGC

Itga5-F CACTAACCGTGGATGGTGCT

Itga5-R TGGGCTCCAGATCAACCCTA