Oncogene (2004) 23, 3444–3453 & 2004 Nature Publishing Group All rights reserved 0950-9232/04 $25.00 www.nature.com/onc Identification of differentially expressed and developmentally regulated genes in medulloblastoma using suppression subtraction hybridization Naoki Yokota1,2,3, Todd G Mainprize1,2, Michael D Taylor1,2, Tomohiko Kohata1,2, Michael Loreto1,2, Shigeo Ueda1,2, Wieslaw Dura4, Wiesia Grajkowska4, John S Kuo1,2 and James T Rutka1,2,* 1The Arthur and Sonia Labatt Brain Tumor Research Centre, The University of Toronto, Toronto, Ontario, Canada; 2The Division of Neurosurgery, The University of Toronto, Toronto, Ontario, Canada; 3The Department of Neurosurgery, Hamamatsu University School of Medicine, Hamamatsu, Japan; 4Department of Pathology, University of Warsaw, Warsaw, Poland To increase our understanding of the molecular pathogen- Keywords: medulloblastoma; developmentally regulated esis of medulloblastoma (MB), we utilized the technique of gene; differentially expressed gene; subtractive suppres- suppression subtractive hybridization (SSH) to identify sion hybridization; cerebellum; external granule cell genes that are dysregulated in MB when compared to cerebellum. SSH-enriched cDNA libraries from both human and Ptch þ /À heterozygous murine MBs were generated by subtracting common cDNAs from corre- Introduction sponding non-neoplastic cerebellum. For the human classic MB library, total human cerebellar RNA was Despite the paucity of knowledge regarding the mole- þ /À used as control tissue; for the Ptch heterozygous MB, cular oncogenesis of most human brain tumors, our þ /À non-neoplastic cerebellum from an unaffected Ptch understanding of the molecular pathways causing littermate was used as the control. Through differential medulloblastoma (MB), the most common malignant screening of these libraries, over 100 upregulated tumor brain tumor in children, has advanced considerably. We cDNA fragments were isolated, sequenced and identified now know that MB can occur in the setting of two with the NCBI BLAST program. From these, we selected major inherited genetic syndromes. In these two genes involved in cellular proliferation, antiapoptosis, and hereditary diseases, Turcot and Gorlin syndrome, the cerebellar differentiation for further analysis. Upregulated Wnt and Hedgehog (Hh) signaling pathways respec- genes identified in the human MB library included Unc33- tively, are dysregulated and may lead to MB as well as like protein (ULIP), SOX4, Neuronatin (NNAT), the other developmental malformations and cancers (Taylor mammalian homologue of Drosophila BarH-like et al., 2000; Wechsler-Reya and Scott, 2001; Yokota 1(BARHL1), the nuclear matix protein NRP/B et al., 2002). MB is also found in approximately 20% of (ENC1), and the homeobox OTX2 gene. Genes found to offspring from heterozygous transgenic mice carrying a be upregulated in the murine MB library included cyclin targeted deletion of the Ptch gene that results in D2 (Ccnd2), thymopoietin (Tmpo), Musashi-1 (Msh1), constitutive Hh signaling (Goodrich et al., 1997; protein phosphatase 2A inhibitor-2 (I-2pp2a), and Wetmore et al., 2001). Both Wnt and Hh signaling Unc5h4(D). Using semiquantitative reverse transcrip- pathways play crucial roles in the proliferation and tion–polymerase chain reaction (RT–PCR), the mRNA differentiation of cerebellar granule cells, from which expression levels for these genes were markedly higher in MBs are thought to arise (Yokota et al., 1996; Buhren human MBs than in cerebellum. Western blot analysis was et al., 2000). used to further confirm the overexpression of a subset of Primitive neuroectodermal tumors (PNETs), such as these genes at the protein level. Notch pathway over- MB, are characterized by dysregulation of cellular activity was demonstrated in the TE671 MB cell line proliferation, apoptosis, or differentiation signals that expressing high levels of MSH1 through HES1-Lucifer- normally occur at critical developmental stages in ase transfections. This study has revealed a panel of neurogenesis (Wechsler-Reya and Scott, 2001). By developmentally regulated genes that may be involved in histology, MB is composed mainly of undifferentiated the pathogenesis of MB. small, round blue cells. However, many MBs exhibit Oncogene (2004) 23, 3444–3453. doi:10.1038/sj.onc.1207475 markers of neuronal differentiation including expression Published online 5 April 2004 of neuronal transcriptional factors from the PAX (Kozmik et al., 1995; Vincent et al., 1996), ZIC (Yokota *Correspondence: JT Rutka, The Division of Neurosurgery, Suite et al., 1996; Michiels et al., 1999; Pomeroy et al., 2002), 1502, The Hospital for Sick Children, 555 University Avenue, and NEUROD gene families (Rostomily et al., 1997). Toronto, Ontario, Canada M5G 1X8; E-mail: [email protected] These neuronal transcriptional factors are developmen- Received 7 September 2003; revised 5 January 2004; accepted 5 January tally regulated and govern the expression of several 2004; Published online 5 April 2004 genes that influence cell fate in the cerebellar granule cell Developmentally regulated genes in medulloblastoma N Yokota et al 3445 lineage, and presumably affect the growth and differ- the fragments isolated from the human MB cDNA entiation of MB. In this study, we sought to identify library, most were found to bear homology to known genes that are differentially expressed in a sporadic sequences in the human genome database. Other cDNA human classical MB as compared with normal human fragments could be assigned a genomic location and a cerebellar tissue; and in a murine Ptch þ /À MB as hypothetical protein structure. However, the structure compared with non-neoplastic cerebellar tissue from and function of some human ESTs found through an unaffected littermate. We utilized the technique of homology searches are still largely unknown. Among suppressive subtractive hybridization (SSH), a polymer- the 25 fragments isolated from the murine cDNA ase chain reaction (PCR)-based method of subtractive subtractive library, 17 identified genes were repeat hits cloning, to identify genes overexpressed in the two with Ccnd2 being represented 12 times (almost 50% of different types of MB (Diatchenko et al., 1996). all clones). This may be due to a high native number of Although a number of genes were isolated using this mRNA species, or related to the preamplification step strategy, we concentrated our efforts on those genes that used for generating the murine library. We selected five are known to be developmentally regulated in the of the nine different genes identified in the murine central nervous system (CNS). Confirmation of the cDNA library for verification. results obtained from the SSH screen was performed by In both libraries, we identified many developmentally reverse transcription (RT)–PCR and Western blot regulated genes involved in cellular proliferation, anti- analysis of non-neoplastic cerebellum, MB specimens apoptosis, and differentiation of the cerebellar granule and various cell lines. Our results show that many MBs cells (Table 2a, b). Housekeeping, ribosomal and share certain expression patterns of these developmen- mitochondrial genes were rarely isolated, indicating that tally regulated genes. the subtractive hybridizations were effective. A total of 11 clones of differentially expressed and developmentally regulated genes were selected from both MB libraries and subjected to further analysis by Results RT–PCR (Figure 1). The genes from the human MB Isolation of upregulated clones by screening subtracted library encode for the nuclear matrix protein NRP/B cDNA libraries (ENC1), the homeobox protein OTX2, SRY (sex determination region Y)-box 4 protein SOX4, Neuro- Over 300 clones were screened in each library, from natin (NNAT), human homologue of Drosophila which 57 differentially regulated clones were selected. BARHL1, and Unc-33-like protein (ULIP). The genes Their plasmids were then purified and cDNAs se- selected from the murine cDNA library are cyclin D2 quenced. The percentage of upregulated clones was (CCND2), thymopoietin (TMPO), Musashi-1 therefore approximately 20%. Of the 32 clones identified (MSH1), protein phosphatase 2A inhibitor-2 from the human MB library, 12 were multiple hits and (I-2PP2A), which is a murine homolog of the human we selected six for further evaluation (Table 1). Among SET gene, and the candidate netrin receptor UNC5H4. Table 1 Primer sequences of genes of interest Primer name Sequence Ann. temperature (1C) Length (bp) BARHL1 forward GGAAGGGACTGTTTGGAGAC 58 318 BARHL1 reverse GCCCTCCTCCTTCACTTTAT ULIP forward GGCAGAAGCAAGAAGAGATT 49 196 ULIP reverse CAAACAAATCAAGGCTATGC SOX4 forward ATTGATGTTGTTGTTGATGG 53 196 SOX4 reverse AAGCAAAATAAAACAAAACC OTX2 forward AGTCACCAGCCATCTCAATC 51 156 OTX2 reverse ATAATCCAAGCAGTCAGCAT Neuronatin forward CGACAATGACGAAGATACCA 53 131 Neuronatin reverse ATCAGAATGCGGTGCCTATG ENC1 forward TGGCCATGGAGGAACTCATC 57 635 ENC1 reverse TGGGGAGCTTGTCATGACTG CCND2 forward ATTGGCATGTCTGGTTCACA 58 195 CCND2 reverse GAACGCCAGATACCAGAAGC TMPO forward CAGGTTCCTTTGTGGCATTT 58 202 TMPO reverse TTGCTGCCATTCTTCTTCAA MSH-1 forward ATGGTGGAATGTAAGAAAGC 58 205 MSH-1 reverse TCGGGGAACTGGTAGGTGTA SET forward CAGCAAGAAGCGATTGAACA 58 203 SET reverse TGCAGACACTTGTGGATGGT Unc5H4 forward GGTGCTCCTGAGTCCTGAAG 58 203 Unc5H4 reverse GGGTCCAAAAGGCAGTAACA b-Actin forward CAACCGCGAGAAGATGACC 58 326 b-Actin reverse TCCAGGGCGACATAGCACA Oncogene Developmentally regulated genes in medulloblastoma N Yokota et al 3446 Table 2 (a) Gene identification