University of Connecticut OpenCommons@UConn
Doctoral Dissertations University of Connecticut Graduate School
8-9-2018 ICP8 Self Interactions are Essential for HSV-1 Replication Compartment Formation Anthar Darwish University of Connecticut - Storrs, [email protected]
Follow this and additional works at: https://opencommons.uconn.edu/dissertations
Recommended Citation Darwish, Anthar, "ICP8 Self Interactions are Essential for HSV-1 Replication Compartment Formation" (2018). Doctoral Dissertations. 1940. https://opencommons.uconn.edu/dissertations/1940 ICP8 Self Interactions are Essential for HSV-1 Replication Compartment Formation
Anthar S. Darwish, PhD
University of Connecticut, 2018
ABSTRACT
The objective of this thesis was to understand the ICP8 protein interactions
involved during the formation of HSV-1 replication compartments. We focused
our efforts on mapping the ICP8-ICP8 self-interactions that are involved in the
formation of DNA independent filaments. We report here that the FNF motif
(F1142, N1143 and F1144) and the FW motif (F843 and W844) are essential for
ICP8 filament formation. Furthermore we observed a positive correlation between
ICP8 filamentation and the formation of replication compartments. Mammalian
expression plasmids bearing mutations in these motifs (FNF and FW) were
unable to complement an ICP8 null virus for growth and replication compartment
formation. We propose that filaments or other higher order structures of ICP8
may provide a scaffold onto which other proteins are recruited to form
prereplicative sites and replication compartments. In an attempt to broaden our
understanding of ICP8 self-interactions and its interactions with other essential
viral proteins we searched for potential protein interaction sites on the surface of
ICP8. Using the structural information of ICP8 and sequence comparison with
homologous proteins, we identified conserved residues in the shoulder region
(R262, H266, D270, E271, E274, Q706 and F707) of ICP8 that might function as
protein interaction sites. The Q706A and F707A (QF) mutant protein was able to Anthar S. Darwish, University of Connecticut, 2018
form pre-replicative like sites and bind ssDNA but cannot complement ICP8 null virus for growth and replication compartment formation. Our analysis suggests that (QF) is involved in an important function or interaction that is required for the progression of mature replication compartments. ICP8 Self Interactions are Essential for HSV-1 Replication Compartment Formation
Anthar S. Darwish
B.S., Birzeit University, 2008
M.S., Al-Quds University, 2010
A Dissertation
Submitted in Partial Fulfillment of the
Requirements for the Degree of
Doctor of Philosophy
at the
University of Connecticut
2018
i Copyright by
Anthar S. Darwish
2018
ii APPROVAL PAGE
Doctor of Philosophy Dissertation
ICP8 Self Interactions are Essential for HSV-1 Replication Compartment Formation
Presented by Anthar S. Darwish, B.Sc., M.Sc.
Major Advisor ______Sandra K. Weller
Associate Advisor ______Ann Cowan
Associate Advisor ______John Carson
Associate Advisor ______Christopher Heinen
Associate Advisor ______Gordon Carmichael
University of Connecticut 2018
iii Acknowledgments
This thesis was completed because of the guidance, help and support of many
remarkable people. The process of completing a doctoral degree requires a village of teachers, mentors, classmates, family and friends. I am tremendously grateful for this experience and all of the help and guidance that I received throughout this journey. I would like to thank the University of Connecticut for the opportunity to receive this training.
I would also like to thank my advisor, Sandra Weller, for the opportunity to be a student in her lab. Thank you for all of your guidance, patience, support and help throughout the years. Thanks for always challenging and pushing us to be better scientists and thank you for your thoughtful revisions on my thesis. I would also like to thank my committee members Ann Cowan, John Cason, Chris Heinen, and Gordan Charmical for the helpful discussions, academic support, and guidance. I would like to additionally thank Ann
Cowan for her personal support, revisions and suggestions during my thesis preparation. Furthermore, I am very grateful to have had such a thoughtful and caring
Dean. Thank you Barbara Kream, for always having an open door and for your countless support during my studies.
I would also like to thank all of the past and present members of the Weller lab. I must start by acknowledging Ping Bai and Lorry Grady for their thoughtful collaborations on this study, it was a pleasure to work closely with both of you! We made a good team,
iv
thank you for sharing you expertise with me. I also had the wonderful opportunity of working with Jonathan Helmus, I would like to thank him for his significant contribution in helping to identify predicted protein interaction sites on ICP8. Furthermore, I would like to thank Renata Szczepaniak for her constant help with trouble shooting experiments and the valuable role she played in my lab training. I would also like to acknowledge Savithri Weerasooriya and Katherine DiScipio for their dedicated and fruitful continuation of this research project. Thank you for the great work you have done with ICP8!
I was very lucky to have shared my time in the Weller lab with some amazing graduate students. I would like to start by thanking Mitali Adlakha for being a supportive, caring and wonderful lab mate. I enjoyed our discussions and teatime at Tisane. I would also like to thank Sam Smith for her constant support, encouragement and guidance through out my graduate studies!
I consider myself immensely luck to have always had such a wonderful support system of classmates, friends and family. My parents Ghaziah and Saker are the most remarkable and selfless human beings I’ve ever met. Thank you for everything you have done for me and your endless support and constant belief in me! The greatest gift in life is wonderful siblings and I am very grateful for my brothers, Deya and Enar, and of course my sister and best friend, Esrar. Thank you for everything you have done for me! I love you guys!
v
Table of Contents
Chapter 1. Introduction……………………………………………………………….………1
1.1 Human Herpesviridea Overview…………………………………………………...... 1
1.2 HSV-1 Virion……………………………………………………..……………………...3
HSV-1 Genome………………………………………………………………………….5
HSV-1 capsid……………………………………………………………………………7
Tegument……………………………………………………………………………...…8
Envelope……………………………………………………………………………...….8
1.3 HSV-1 pathogenesis and Life cycle overview………………………………………..9
1.4 HSV-1 DNA replication proteins……………..…………………………….…….12
A. Single strand DNA binding protein, ICP8…………………………………….…..12
Overview…………………………………………………………………………….12
ICP8 structure……………………………………………………………………....13
ssDNA binding and cooperativity…………………………………………………14
ICP8 filaments………………………………………………………………………16
B. UL9, origin-binding protein…………………………………………………………17
ICP8-UL9 interaction……………………………………………………………….18
C. UL5/8/52 Helicase-primase complex……………………………………………..19
ICP8-UL5/8/52 interaction………………………………………………………....20
D. UL30/42 DNA Polymerase Holoenzyme…………………………………………20
ICP8-UL30/42 interaction………………………………...………………………..21
1.5 Model for DNA replication………………….…………………………………………22
Initiation phase of DNA Replication………………………………………………23
vi Elongation phase of DNA replication……………………………………………..24
1.6 Replication Compartment Formation………………………………………………..25
1.7 Thesis Objectives……………………………………………………………………...28
Chapter 2. Material and Methods………………………………………………………….30
2.1 Cell culture and viruses……………………………………………………………….30
2.2 DNA constructs and mutagenesis…………………………………………………...30
2.3 Protein purification…………………………………………………………………….31
2.4 Electron microscopy…………………………………………………………………..32
2.5 Immunofluorescence (IF) analysis…………………………………………………..33
2.6 Transient complementation assays………………………………………………….33
2.7 Plaque reduction assay……………………………………………………………….34
2.8 ssDNA binding assay………………………………………………………………….34
2.9 Transfection assay…………………………………………………………………….35
2.10 Surface plasmon resonance (SPR)………………………………………………..35
2.11 Prediction of protein interaction sites………………………………………………36
Chapter 3. ICP8 Filament Formation is Essential for Replication Compartment Formation During Herpes Simplex Virus Infection…………………………………....37
Abstract…………………………………………………………………………………….38
Introduction…….…...…………………………………………………………………...... 39
vii
Results………………………………………………………….……………………………...42
The FNF and FW motifs of ICP8 are required for filament formation………….42
ICP8 mutants that fail to form filaments are unable to complement the growth of an ICP8-null virus………………………………………………………………..…..44
FW and FNF exhibit a trans-dominant phenotype……………………..…………46
Mutant proteins retain ability to bind ss DNA with reduced cooperativity……...50
ICP8 mutants defective in filament formation are unable to generate replication compartments and PRS-like foci……………………………….…………………..52
HSV-1 helicase primase complex (UL5/8/52) interacts with ICP8 mutants...... 55
Discussion………………………………………………..……………………….……….57
Chapter 4 -ICP8 Mutant Q706A-F707A Can Assemble Pre-replicative Like Site
Although Fails to Form Replication Compartments……………………………….…..61
Abstract…………...………………..………………………………………………………62
Introduction………………………………….....…………………………………………..63
Results…………………………………...…………………………………………………66
Identifying potential protein interaction sites on ICP8………………………….…66
Characterization of ICP8 head region mutants: (R644A-D645A), (N882A-
L883A) and (D905A-Y909A)…………………………….………….……………….69
viii
Characterization of shoulder region mutants: (Y20A-F61A-Y90A), (C116A-
R120A), (R262A-H266A), (D270A, E271A, and E274) and (Q706A-F707A).....75
ICP8 Q706A- F707A mutant can still bind to ssDNA …………………………….77
Discussion…………………………………………………………...……...………….….79
Chapter 5 Summary and Perspectives……………………………………………..…….84
ICP8 filament formation is required for replication compartment formation in HSV..86
Identification of potential protein interaction sites on ICP8…………………………...89
Concluding thoughts and future direction……………………………………………....93
Chapter 6 References……………………………………………………….……………….97
List of Figures
Chapter 1
Figure 1.1. HSV-1 virion……………………………………………………………………….4
Figure 1.2. HSV-1 genome……………………………………………………………………6
Figure 1.3. HSV-1 replication compartment formation………………………………..…..26
Chapter 3
Figure 3.1. ICP8 protein structure…………………………………………………………..41
Figure 3.2. Filament formation for WT and mutant versions of ICP8 as visualized by
electron microscopy……………………………………………………………..45
ix
Figure 3.3. The FNF and FW mutants exhibit a transdominant phenotype…………….48
Figure 3.4. The ICP8 FNF, FW, FW-FNF, and Δ60 mutants retain the ability to interact
with ssDNA, albeit with reduced cooperativity………..……….…………..…51
Figure 3.5. The ICP8 FNF, FW, FW-FNF, and Δ60NLS mutants do not form
prereplicative site-like structures…………………………………………….…53
Figure 3.6. ICP8 mutants are unable to complement HD-2 for replication compartment
formation………………………………………………………………………….54
Figure 3.7. The helicase-primase complex (UL5/8/52) interacts with WT ICP8 and the
FNF, FW, and FW-FNF mutant proteins………………………………………56
Chapter 4
Figure 4.1. Predicted protein interaction sites annotated on ICP8………………………68
Figure 4.2. Transient complementation of ICP8 null virus by mutant expression
plasmids………………………………………………………………………….70
Figure 4.3. ICP8 mutant Y20A-F61A-Y90A failed to localize to the nucleus…………...72
Figure 4.4. ICP8 Q706A-F707A forms pre-replicative like structures although it is
unable to complement viral growth……………………………………………73
Figure 4.5. ICP8 Q706A-F707A was unable to complement replication compartment
formation………………………………………………………………………….74
x
Figure 4.6. Transient complementation of ICP8 null virus by D270A, E271A and E274A
mutant expression plasmids……………………………………………………78
Figure 4.7. ICP8 Q706A-F707A retains the ability to interact with ssDNA…………..…80
List of Tables
Chapter 3
Table 3.1. Mutants that disrupt ICP8 filament formation fail to complement the growth of
the HD-2 virus…………………………………………………...……..…………47
Chapter 4
Table 4.1. Partial list of HSV-1 proteins reported to interact with ICP8……………..…..64
Table 4.2. ICP8 orthologues from the following Herpesviridae viruses were used in a
sequence alignment for identifying conserved residues in ICP8……………67
Table 4.3. Characterization of ICP8 mutants…………………………………………...….82
xi Chapter 1
Introduction
1.1 Human Herpesviridea Overview
Herpesviridae, or more commonly called Herpesviruses, is a family of more than
200 large double stranded DNA (dsDNA) viruses that infect a wide range of hosts
including mammals, birds and reptiles. The family name originates from the Greek word
herpein, “to creep”, due to the latent infections and periodic reactivations that are
characteristic of this group. Herpesviruses first evolved nearly 500 million years ago and since the dawn of human evolution have been infecting and co-evolving with our
species. To date, nine Herpesviruses have been identified that infect humans, they are
further classified into three-subfamilies (Alphaherpesvirus, Betaherpesvirus, and
Gammaherpesvirus) based on tissue tropism of infection and lengths of replicative
cycles (Pellett and Roizman 2013). More than 90% of the human population has been
infected with one or more of these viruses (Looker et al. 2015; Chayavichitsilp et al.
2009).
The human Herpesviruses share several common characteristics. The members of this
family all encode a large number of viral proteins involved in nucleic acid metabolism.
They also use the cellular nucleus as the site of virus gene transcription, synthesis of
viral DNA and nucleocapsid assembly. Furthermore, Herpesviruses use latency as a
mechanism to establish lifelong persistency with their hosts and periodically reactivate
1 to the lytic cycle to produce progeny virions. Lytic infection usually leads to destruction in non-neuronal infected cells. However, the Herpesviruses also differ vastly with regards to tissue tropism of infection, lengths of replicative cycles and the mechanisms they employ for evading host response and disease manifestation (Pellett and Roizman
2013).
The human Alphaherpesviruses have shorter replicative cycles than the Beta and
Gamma viruses and establish latency in neuronal tissue. This family consists of Herpes
Simplex virus type 1 (HSV-1), Herpes Simplex virus type 2 (HSV-2) and Varicella Zoster
Virus (VZV). HSV-1 and HSV-2 are the causative agents for primary and recurrent oral and genital herpetic lesions. These types of lesions are usually non-lethal although they may cause life-threatening ocular and nervous system infections in immunocompromised individuals and newborns. Occasionally, HSV-1 can also cause corneal infections and encephalitis. HSV-1 and HSV-2 infections can increase the infection rates of more serious pathogens such as HIV and HPV (Corey et al. 2004;
Szostek, Zawilinska, and Kopec 2009). VZV is the infectious agent responsible for chicken pox and shingles (Roizman, Knipe, and Whitley 2013).
The Betaherpesvirus establish latency in lymphocytes, secretory glands, kidneys, and other tissues. This subfamily includes Human Cytomegalovirus (HCMV), which is usually non problematic in healthy individuals although it can be life-threatening for immunocompromised patients, particularly organ transplant recipients (Pellett and
Roizman 2013). HCMV also causes a range of congenital abnormalities and is the
2 leading infectious cause of deafness and intellectual disabilities in children (Damato and
Winnen 2002). Other members of the Betaherpesvirus subfamily have not been as extensively studied as HCMV. The HHV-6B and HHV-7 viruses are known to be the causative agents of roseola infection in children. HHV-7 has also been known to cause
Febrile Respiratory disease (Yamanishi and Mori 2009; Yamanishi, Mori, and Pellett
2013). Additionally, HHV-6A and/or HHV-6B may be linked to the pathogenesis of
Multiple Sclerosis (Leibovitch and Jacobson 2014).
The Gammaherpesviruses have a narrow host cell range. They usually infect either T or
B-lymphocytes and establish latency in lymphoid tissue (Pellett and Roizman 2013).
This subfamily of viruses includes Epstein-Barr virus (EBV) and Kaposi’s sarcoma associated Herpesvirus (KSHV). EBV is the causative agent of mononucleosis and also has the ability to transform B-lymphocytes and is linked to several malignant diseases, such as Burkitt’s lymphoma and Hodgkin’s lymphoma (Longnecker, Kieff, and Cohen
2013). KSHV infections are the most widely spread cause of cancer in acquired
immunodeficiency syndrome (AIDS) patients (Damania and Cesarman 2013).
1.2 HSV-1 Virion
The morphological characteristics of an HSV-1 virion are similar among all members of the Herpesviruses family. The key function of the virion is to protect the viral genome and to act as an infection transmission vehicle. A mature virion is approximately 200nm
in diameter and contains a DNA core that is harbored in an icosahedral proteinaceous
3 Adapted from M. K. Kukhanoval et.al, 2014
Figure 1.1 HSV-1 Virion. A mature virion is approximately 200nm in diameter and contains a DNA core that is harbored in an icosahedral proteinaceous capsid. Surrounding the nucleocapsid is a layer of viral proteins called the tegument; all of these components are enclosed in a lipid bilayer envelope.
4 capsid. Surrounding the nucleocapsid is a layer of viral proteins called the tegument; all
of these components are enclosed in a lipid bilayer envelope (Figure 1.1).
HSV-1 Genome
The HSV-1 genome is a linear double stranded 152-kbp DNA molecule with nicks and
gaps (Kieff, Bachenheimer, and Roizman 1971; McGeoch et al. 1988; S. Smith et al.
2014). The genome consists of two linked components, designated as UL (unique long)
and US (unique short). The UL and US segments are each bracketed by inverted repeat
sequences arranged as ab-UL-b’a’c’-US-ca (Figure 1.2) (Wadsworth, Jacob, and
Roizman 1975; Hayward et al. 1975). Genomic isomerization occurs by recombination between the inverted repeats, leading to the formation of four isomers during DNA replication (Sheldrick and Berthelot 1975). The genome has a total of three origins of replication designated as OriS and OriL. Two copies of OriS are found in the c repeat region and OriL is located in the UL region of the genome (Weller et al. 1985; Stow
1985). The significance of having multiple origins of replication is not fully understood.
Mutants that have only one origin are capable of replicating in cell culture although they
undergo frequent recombination events to create origin duplicates, indicating that there
is significance for having multiple origins (Polvino-Bodnar, Orberg, and Schaffer 1987;
Igarashi et al. 1993).
The HSV-1 genome has at least 90 open reading frames and viral proteins are
generally classified into three temporal kinetic classes; immediate early (IE, or α), early
(E, or β), and late (L, or γ) (Honess and Roizman 1974; Pellett and Roizman 2013).
5 UL US a b b’ a’ c’ c a
OriL OriS OriS
Figure 1.2 HSV-1 Genome. The HSV-1 genome is 152Kb and contains two unique seguments (UL and US). These segments are anked by repeat regions (a, b and c). The genome also has three orgins of replication, one copy of OriL and two copies of OriS. This schemtic is not drawn to scale.
6 These proteins have been named by referring to their relative protein size to one
another or their position along the viral genome. The two earlier naming approaches
were based on the protein band size in an SDS-PAGE gel; Virion Polypeptide (VP) or
Infected Cell protein (ICP) followed by a number corresponding to their size. Proteins
were later named based on the position of the transcript in the genome, starting with the
segment location (either UL or US) and then numbered from left to right.
HSV-1 also encodes a number of noncoding transcripts that are mostly involved in establishing latency; most notable is the long-noncoding RNA Latency Associated
Transcript (LATs) and at least 17 microRNAs predominately found in the OriS and OriL
regions (Stevens et al. 1987; Spivack and Fraser 1987; Umbach et al. 2009) (Roizman,
Knipe, and Whitley 2013).
HSV-1 capsid
The HSV-1 capsid is a 125 nm icosahedron with 162 capsomers, including 140 hexons,
11 pentons and a portal. The major capsid proteins are VP5, VP26, VP23 and VP19C;
additionally, a number of minor capsid proteins are also required for the processing and
packaging of the viral genome into preformed capsids (Conway and Homa 2011).
Furthermore, the capsid also contains a portal that is involved in taking up and releasing
viral DNA. This portal is a ring composed of twelve UL6 protein monomers. Our group
has identified that the leucine zipper region within UL6 and disulfide bond formation are
both important for inter-subunit interactions and stable portal ring formation (Nellissery
et al. 2007; Szczepaniak et al. 2011; Albright et al. 2011) .
7 Tegument
The tegument is a layer of proteins between the nucleocapsid and the envelope. This
largely unstructured region contains at least 23 viral proteins and some cellular proteins
and transcripts (Loret, Guay, and Lippé 2008; Xu, Che, and Li 2016; Dai and Zhou
2018). The tegument proteins are involved in trafficking viral particles during entry and
egress, viral gene expression and evading host defenses (Kelly et al. 2009). Some
noteworthy proteins in the tegument that are involved in gene expression include: ICP4, the major viral transcription regulator and the transactivator protein VP16 (Yao and
Courtney 1989; Loret, Guay, and Lippé 2008; Naldinho-Souto, Browne, and Minson
2006). Furthermore, a few tegument proteins are involved in establishing a favorable cellular environment for HSV-1 infection; such as, the virion host shutoff (VHS) protein
that cleaves cellular mRNA and the ubiquitin viral ligase, ICP0, which counteracts intrinsic cellular responses to viral infection (Roizman, Knipe, and Whitley 2013; Everett
2000; Strelow and Leib 1995).
Envelope
The outermost layer of the virion is a lipid bilayer envelope, which protects the virion and facilitates entry into the host cell. The envelop is composed of host cell derived lipids and at least 13 distinct virus encoded glycoproteins (Roizman, Knipe, and Whitley
2013; Arii and Kawaguchi 2018). The lipid composition of the envelope is similar to the cytoplasmic membranes of the Golgi apparatus and is acquired during passage of the
capsid from the nucleus to the Golgi complex (van Genderen et al. 1994; Johnson and
Baines 2011).
8 1.3 HSV-1 pathogenesis and Life cycle overview
HSV-1 has a biphasic life cycle that begins with a primary lytic infection in epithelial cells
of the oral mucosa and is followed by a latent phase in the trigeminal ganglion. The
most common clinical manifestation of HSV-1 is the presence of orolabial lesions, which
are visible indicators that the virus is shedding. Direct contact between skin abrasions of
an uninfected individual with these lesions or the saliva of an infected individual results
in viral transmission. Viral shedding is the most robust during symptomatic infection;
however, asymptomatic individuals are also shedding the virus and can transmit to
others (Wilson and Mohr 2012; Basavarajappa et al. 2015).
Entry of HSV-1 into the host cell involves interactions between at least five envelope
glycoproteins and several cell surface targets. The initial step in the entry process
requires attachment of virion glycoproteins gB and gC to heparin sulfate
(glycosaminoglycan). Afterwards, the virion enters the cell by either fusion of the
envelope with the plasma membrane or by endocytosis. The pathway of entry varies
depending on cell type, although both mechanisms involve interaction of gD with one of
the following cell surface targets; nectins, herpesvirus entry mediator (HVEM) or 3-O-
sulfated heparan sulfate (3-OS HS) (Herold et al. 1991; Spear, Eisenberg, and Cohen
2000; Jogger, Montgomery, and Spear 2004; Arii and Kawaguchi 2018; Pellett and
Roizman 2013). The interaction between gD and the aforementioned cell surface
targets facilitate the formation of a fusion proteins complex, gB/gH/gL, which is involved
in the actual fusion event (Eisenberg et al. 2012; Reske et al. 2007). Once the capsid
enters the cytoplasm it is trafficked along microtubules by the dynein-dynactin motor
9 complex until it docks at a nuclear pore and ejects the viral DNA into the nucleoplasm
(Morgan, Rose, and Mednis 1968; Sodeik, Ebersold, and Helenius 1997; Ojala et al.
2000).
The early stages after genome entry are critical for establishing a nuclear environment that promotes successful DNA replication and propagation of progeny. The virus encodes many of its own proteins but also depends on the host’s cellular machinery for many critical functions. For example, all viral gene transcription is dependent on RNA polymerase II and the expression of the five IE proteins (ICP0, ICP4, ICP22, ICP27 and
ICP47) requires cellular transcription factors, Oct1 and HCF, in coordination with the viral transcription factor VP16 (Whitlow and Kristie 2009; Arvin, Campadelli-Fiume,
Mocarski, Moore, Roizman, Whitley, Yamanishi, and Sandri-Goldin 2007; Alwine,
Steinhart, and Hill 1974).
The IE proteins are expressed before the onset of DNA replication and are involved in promoting an environment that is conducive for viral infection. ICP0 is highly involved in counteracting intrinsic cellular resistance to viral infection (reviewed in (Boutell and
Everett 2013; Lanfranca, Mostafa, and Davido 2014)). Furthermore, IE protein ICP4 is the major viral transcription factor that promotes the transcription of most viral genes
(Wagner and DeLuca 2013).
HSV-1 encodes seven replication proteins that are expressed as early genes; a single- stranded DNA (ssDNA) binding protein (ICP8), an origin binding protein (UL9), the
10 helicase-primase complex (UL5-UL8-UL52), and the polymerase and its processivity
factor (UL30/UL42) (reviewed in (Weller and Coen 2012b)). Section 1.4 of this thesis will address the replication proteins in detail, and the mechanism of DNA replication will be covered in section 1.5. After DNA replication is completed L protein expression commences, and the L proteins are mostly involved in capsid assembly and genome packaging. The initial product of HSV-1 replication is a longer than unit length concatemer, which is cleaved into genome length segments while concurrently packaged into viral capsids (reviewed in (Conway and Homa 2011)). The capsid then undergo a series of envelopment and de-envelopment steps through the nuclear membrane and Golgi apparatus until the virion is finally released out of the host cell
(van Genderen et al. 1994; Mettenleiter, Klupp, and Granzow 2009).
Gene expression, DNA replication and viral DNA packaging all occur in large, globular membrane-less structures called replication compartments (Quinlan, Chen, and Knipe
1984; Lamberti and Weller 1996; Phelan et al. 1997; de Bruyn Kops and Knipe 1988).
These compartments are formed in a stepwise assembly process that involves interactions between DNA replication proteins, cellular proteins, the viral genome and the nuclear environment. The details of replication compartment formation will be covered in Section 1.6. The ICP8 protein is essential for the formation of replication compartments (de Bruyn Kops and Knipe 1988; Bush et al. 1991; McNamee, Taylor, and Knipe 2000). This thesis will explore the protein interactions of ICP8 with both itself and other viral replication proteins, to improve our understanding of replication compartment assembly.
11 1.4. HSV-1 DNA replication proteins
HSV-1 is the most extensively studied member of the Herpesviridae family and is used as a model for understanding DNA replication in this family of viruses. This section introduces the seven-replication proteins. ICP8 is the central focus of this thesis; therefore, additional emphasis will be placed on ICP8s’ interactions with the other viral
replication proteins.
A. Single strand DNA binding protein, ICP8
Overview
ICP8 is a 128-kDa globular zinc metalloprotein (Gupte, Olson, and Ruyechan 1991) that
binds ssDNA in a non-sequence specific and cooperative manner (Ruyechan 1983;
Mapelli et al. 2000). It is essential for HSV-1 infection and is involved in viral DNA
synthesis (Conley et al. 1981; Challberg 1986; Weller et al. 1983; C. A. Wu et al. 1988).
ICP8 is required for coupled leading and lagging strand DNA synthesis (Hernandez and
Lehman 1990; Ruyechan and Weir 1984; Falkenberg, Lehman, and Elias 2000). ICP8
also exhibits helix destabilizing activity, strand annealing activity and can promote
strand exchange (Boehmer and Lehman 1993a; Dutch and Lehman 1993; Mapelli et al.
2000; Reuven and Weller 2005; Reuven et al. 2003).
A multifunctional protein, ICP8 has been reported to functionally or physically interact with many viral proteins and at least 50 cellular proteins; its viral interaction partners include UL9, UL30/42, UL5/8/52, alkaline nuclease (UL12) and immediate early proteins
12 ICP4 and ICP27 (T. J. Taylor and Knipe 2004). However, the regions of ICP8
responsible for these different functional interactions have not been identified.
ICP8 structure
The crystal structure of ICP8 was solved using a mutant of ICP8, ICP8Δ60Ccc, that has
a C-terminal 60 residue deletion and two point mutations at C254S and C455S (Mapelli,
Panjikar, and Tucker 2005). This mutant was selected because full length ICP8 is prone
to aggregation and produces poor quality crystals (Mapelli and Tucker 1999). The
ICP8Δ60Ccc mutant binds to ssDNA with similar affinity as wild type ICP8 but exhibits a
complete loss of cooperativity (Mapelli et al. 2000). The crystals of ICP8Δ60Ccc
diffracted to at least 3Å resolution, and Multi-wavelength Anomalous Dispersion (MAD)
was used to solve the protein structure. ICP8 consists of a large N-terminal domain (9 –
1038) and a smaller helical C-terminal domain (1049–1129). The N-terminal domain is
divided into several regions called the head, neck and shoulder. However, these regions
cannot be separated because non-contiguous polypeptide chains form the protein’s
tertiary structure. The C-terminal domain (1049 –1129) is mostly helical and is
connected to the N-terminal domain by an 11 residue disordered linker (Mapelli,
Panjikar, and Tucker 2005). The structure of the 60 C-terminal residues of ICP8 has not
been solved; a bioinformatics analysis of this region has reveled a mostly disordered
structure (Hoch and Schuyler, unpublished).
The zinc-binding region of ICP8 contains four highly conserved residues (C499, C502,
C510 and H512) that coordinate one zinc molecule per protein (Gupte, Olson, and
13 Ruyechan 1991). Mutations in residues C499 and C502 produce a non-functional
protein that is incapable of complementation (Gao et al. 1988). However, a zinc
depleted ICP8 molecule still retains DNA binding activity, which suggests a structural
role for the zinc binding region (Gupte, Olson, and Ruyechan 1991).
ssDNA binding and cooperativity
The DNA binding activity of ICP8 was first identified during a DNA-cellulose chromatography experiment of HSV-1 and HSV-2 infected cell extracts; these early experiments demonstrated a tighter binding affinity of ICP8 to single stranded DNA than to double stranded DNA (Bayliss, Marsden, and Hay 1975; Purifoy and Powell 1976;
Powell and Purifoy 1976; C. K. Lee and Knipe 1985). Additional in vitro binding studies and electron microscopy analysis of ICP8 revealed that it binds cooperatively to DNA and can hold it in an extend configuration (Ruyechan 1983; Ruyechan and Weir 1984).
The DNA binding footprint of ICP8 on ssDNA was estimated to be 10 -14 nucleotides
(White and Boehmer 1999; Mapelli, Panjikar, and Tucker 2005; Mapelli and Tucker
1999).
Numerous attempts have been made to map the ssDNA-binding domain in ICP8. Initial studies based on mapping temperature sensitive mutants (ts13, ts18, and tsHA1)
defective in DNA binding suggested the involvement of amino acid residues 348-450
(Gao et al. 1988). Gao and Knipe later proposed a ssDNA binding region between
amino acid residues 564-1110, based on characterization of several ICP8 mutant
viruses with internal deletions or C-terminal truncations in the ICP8 gene (Gao and
Knipe 1989). A subsequent proteolytic analysis of ICP8 by Wang and Hall suggested a
14 DNA binding region exists between residues 300-849 (Y. S. Wang and Hall 1990).
Furthermore, photoaffinity labeling of ICP8 with BrdU-oligonucleodies followed by proteolysis suggested an approximately similar ssDNA binding region between residues
386-902 (White and Boehmer 1999).
The studies mentioned above identified large regions in ICP8 that are potentially involved in DNA binding, although no specific residues in the protein have been assigned DNA binding function. However, after the crystal structure of ICP8 was solved, a modeling analysis of ssDNA in the neck region of ICP8 revealed several surface exposed aromatic and positively charged conserved residues (Tyr 543, Asn 551, Arg
772, Lys 774, Arg 776, Tyr 988, Phe 998, and Asn1002) that were suggested to be involved in ssDNA binding (Mapelli, Panjikar, and Tucker 2005).
The significance of the C-terminal region of ICP8 for cooperative binding was not initially evident; it was originally presumed to be involved in ssDNA binding directly (Gao and
Knipe 1989; Leinbach and Heath 1988). However, Mapelli et al. demonstrated by a
series of electrophoretic mobility shift assay (EMSA) experiments that the 60 C-terminal residues in ICP8 are responsible for cooperative binding, and that removal of these residues did not affect the intrinsic DNA binding ability of ICP8 (Mapelli et al. 2000).
Furthermore, a prior study by Dudas at el. identified two cysteines at residues 254 and
455 by fluorescein-5-maleimide modification that also seemed to affect cooperative binding of ICP8 (Dudas and Ruyechan 1998). However, these cysteine residues were later proven to have a minor impact on cooperativity (Mapelli et al. 2000).
15 ICP8 filaments
ICP8 assembles into several different types of filaments: it forms long magnesium-
dependent left-handed helical protein filaments in the absence of DNA (O'Donnell et al.
1987) and single helical protein filaments when it assembles on ssDNA (Bortner et al.
1993; Makhov, Boehmer, and Lehman 1996; Makhov and Griffith 2006). Furthermore,
ICP8 can form oligomeric rings when it binds to short ssDNA fragments (Makhov,
Boehmer, and Lehman 1996). ICP8 also form thicker helical nucleoprotein filaments
during the intermediate steps of an annealing reaction between two complementary
strands of ssDNA, these type of filaments are distinct from the protein only or ssDNA
bound filaments (Makhov and Griffith 2006).
ICP8’s filament forming properties are not typical to classic single strand DNA binding
proteins such as E. coli SSB or bacteriophage T4 gene 32 proteins. Those DNA binding
proteins form smooth bead-like coatings along ssDNA and do not assemble into protein
filaments in the absence of ssDNA. Whereas, ICP8 assembles on ssDNA as single
helical filaments, similar to recombinase proteins such as RecA, UvsX and Rad51 (Flory
and Radding 1982; Yu and Egelman 1993; Benson, Stasiak, and West 1994). The
resemblance of ICP8 behavior on ssDNA to known recombinases suggests that it might
share similarities in function. ICP8 has been reported to have annealing activity and can
catalyze strand transfer reactions with the HSV-1 alkaline nuclease, UL12, these two proteins are thought to form a two-subunit recombinase (Bortner et al. 1993; Reuven et al. 2003). Visualizing the steps of an ICP8 mediated annealing reaction with electron microscopy revealed that ICP8 first forms thin nucleoprotein filaments on each of the
16 complementary ssDNA. These strands then intertwine with each other in a double-helix arrangement to form thicker nucleoprotein filaments. These super-helices promote the annealing of the two complementary ssDNA and are resolved upon the completion of the reaction (Makhov and Griffith 2006).
The nucleoprotein filaments of ICP8 described above are different from the protein only filaments that ICP8 can form in the absence of DNA. An analysis based on negative- staining electron microscopy and 3D helical reconstruction concluded that DNA independent filaments are double protein helices that have an anti-parallel orientation to each other (Makhov et al. 2009). Furthermore, it was found that the pitch of these bipolar filaments is 250 Å, with approximately 6.2 dimers per turn (Makhov et al. 2009).
ICP8 homologs BALF2 and ORF6, Epstein-Barr virus (EBV) and Kaposi’s sarcoma- associated herpesvirus (KSHV) ssDNA binding proteins, respectively, also form DNA- free helical protein filaments (Ozgur, Damania, and Griffith 2011; Mumtsidu, Makhov, and Konarev 2008). The biological relevance of DNA independent filaments of ICP8 is not understood.
B. UL9, origin-binding protein
The origin binding protein UL9 is 851 amino acids long and is essential for HSV-1 DNA replication but is not required after DNA synthesis has initiated (Carmichael, Kosovsky, and Weller 1988; Blümel and Matz 1995). UL9 forms a dimer in solution and demonstrates several biochemical activities including helicase unwinding, nucleoside
17 triphosphatase (NTPase), non-specific ssDNA binding and sequence specific cooperative DNA binding at an origin of replication (Bruckner et al. 1991; Dodson and
Lehman 1993; Elias, Gustafsson, and Hammarsten 1990; Fierer and Challberg 1992;
Hazuda, Perry, and McClements 1992; H. M. Weir, Calder, and Stow 1989; Elias et al.
1992). The helicase activity in UL9 resides in a domain defined by seven conserved helicase motifs in the N-terminus of the protein (between residues 1-534); additionally, a
C-terminus truncation of UL9 has been reported to retain helicase activity (Abbotts and
Stow 1995; Martinez, Shao, and Weller 1992). The N-terminus of UL9 binds ssDNA non-specifically whereas the C-terminus contains a conserved sequence element between residues 756-760 that is responsible for origin specific binding (Murata and
Dodson 1999; Olsson et al. 2009).
UL9 is a complex protein that appears to be unique to Alpha herpesviruses without any known homologues in Beta and Gamma herpesviruses. Further details of how UL9 functions to unwind the origin of replication will be discussed further below, in the section that addresses a model for DNA replication.
ICP8-UL9 interaction
UL9 interacts directly with ICP8, forming a specific co-complex that functions in opening and activating the origin of replication (Boehmer and Lehman 1993b; He and Lehman
2000; Makhov et al. 2003; Aslani, Olsson, and Elias 2002). The helicase and ATPase activities of UL9 are stimulated through its interaction with ICP8 via a 13-amino acid sequence (WPMMQGAVNFSTL) in the extreme carboxyl terminus of UL9 (Olsson et al.
2009; Boehmer 1998; Fierer and Challberg 1992; Boehmer, Craigie, and Stow 1994).
18 However, the reciprocal binding site on ICP8 has not been mapped. UL9 also has the
ability to interact with other viral and cellular proteins, including UL42 and UL8 (Trego and Parris 2003; McLean et al. 1994).
C. UL5/8/52 Helicase-primase complex
The HSV-1 helicase-primase consists of the products of three essential genes (UL5,
UL8 and UL52), which form a heterotrimeric complex that is necessary for viral DNA
synthesis (Crute et al. 1989; Carmichael and Weller 1989; Goldstein and Weller 1988;
Zhu and Weller 1992b). The UL5 protein is 882 amino acid residues and contains seven
super-family 1 conserved helicase motifs that are essential for viral growth and helicase
and ATPase activities (Gorbalenya and Koonin 1993; Zhu and Weller 1992a). The UL52
protein is 1058 amino acid residues and contains both a primase characteristic DID
motif that is necessary for catalytic activity and a putative zinc-binding domain
associated with DNA binding (Klinedinst and Challberg 1994; Dracheva, Koonin, and
Crute 1995; Y. Chen et al. 2007). The UL5 and UL52 proteins are intricately
interdependent; a subcomplex of these two proteins demonstrates helicase, NTPase
and primase activities, although neither of these subunits individually exhibits any
helicase or primase activity on their own (Dodson et al. 1989; Dodson and Lehman
1991; Calder and Stow 1990). The UL8 protein is 750 amino acid residues and has
been reported to be involved in the nuclear localization of the helicase-primase complex
and it modulates the enzymatic activity of UL5 and UL52 (Sherman, Gottlieb, and
Challberg 1992; Barnard, Brown, and Stow 1997; Tenney et al. 1994). UL8 was
19 previously assumed to have no catalytic function of its own, until a recent study by
Bermek et al. reported that UL8 can bind to ssDNA and promote annealing between complementary ssDNA to form a highly branched DNA duplex structure. Furthermore,
UL8 was visualized by electron microscopy to form filaments in the absence of DNA.
The UL8 filaments appear to be flat and are very different from the double helical ICP8 filaments (Bermek, Weller, and Griffith 2017).
ICP8-UL5/8/52 interaction
ICP8 stimulates the helicase, primase and ATPase activities of the UL5/8/52 complex; stimulation of this complex by ICP8 is dependent on the presence of the UL8 subunit.
The E. coli ssDNA-binding protein is unable to substitute for ICP8, suggesting that there is a specific interaction between ICP8 and the UL8 protein (Hamatake, Bifano, Hurlburt, and Tenney 1997a; Falkenberg, Elias, and Lehman 1998).
D. UL30/42 DNA Polymerase Holoenzyme
The HSV-1 DNA polymerase holoenzyme is a heterodimer composed of two essential viral replication proteins; a 1235 amino acid catalytic subunit encoded by the UL30 gene and a 488 amino acid processivity subunit encoded by the UL42 gene (Gottlieb et al.
1990; Marchetti, Smith, and Schaffer 1988; Parris et al. 1988). UL30 serves as the polymerase and contains conserved motifs that are shared among members of the α- like DNA polymerase family. The crystal structure of UL30 revealed the typical thumb, palm and fingers domains shared among polymerases (Gibbs et al. 1988; Liu et al.
2006). Additionally, UL30 has been reported to have proofreading ability as a result of
20 its 3’-5’ exonuclease activity and apurinic/apyrimidinic lyase activity (Hwang et al. 1997;
Bogani and Boehmer 2008).
The auxiliary protein UL42 stimulates long DNA chain synthesis by increasing the affinity of UL30 to its substrate (Gottlieb and Challberg 1994). The crystal structure of
UL42 revealed that one surface of UL42 interacts with UL30 while the other surface is lined with positively charged residues and is presumed to bind DNA (Zuccola et al.
2000). UL42 binds DNA as a monomer with high affinity and uses electrostatic interactions to slide along DNA while simultaneously bound to UL30, therefore tethering the polymerase to the DNA template and increasing processivity (Randell and Coen
2001; Randell and Coen 2004; Randell et al. 2005; Jiang et al. 2007).
ICP8-UL30/42 interaction
ICP8 has been reported to stimulate the polymerase activity of UL30; an in vivo assay using M13mp18 primed substrate demonstrated that stimulation by ICP8 occurs over a narrow range in concentration and that amounts of ICP8 in excess of this range were not stimulatory (Hernandez and Lehman 1990; Ruyechan and Weir 1984; O'Donnell et al. 1987). Furthermore, ICP8 has been reported to co-immunoprecipitate with UL42 (T.
J. Taylor and Knipe 2004; Stengel and Kuchta 2011).
21 1.5 Model for DNA replication
Our lab and other research groups have spent the last several decades attempting to
decipher the details of the DNA replication process. Our team has focused on various
pieces of this puzzle, including but not limited to, genetic analysis and biochemical
properties of the replication proteins, the viral DNA structure, capsid formation,
formation of replication compartments, HSV-1 recombination, involvement of cellular
proteins and the host DNA damage response to infection. Progress has been made in
our understanding of HSV-1 DNA replication although a complete picture is still lacking.
The initial product of HSV-1 replication is a longer than unit length concatemer, which is
cleaved into genome length segments while concurrently packaged into viral capsids
(Deiss and Frenkel 1986; Baines and Weller 2005). Earlier models proposed to explain the long concatemeric DNA, suggested that the linear genome circularized in the infected cell and replication proceeded as a rolling circle mechanism (Garber, Beverley, and Coen 1993; Deshmane et al. 1995; Pellett and Roizman 2013; Poffenberger and
Roizman 1985).
The circularization of the genome during lytic infection is still widely debated; moreover, this model may be overly simplified and does not provide an explanation for genomic inversions or the high frequency of recombination that can occur between co-infecting viral genomes (Schaffer, Tevethia, and Benyesh-Melnick 1974; Dutch, Bianchi, and
Lehman 1995; Fu, Wang, and Zhang 2002). The viral genome is presumed to have
22 branched intermediates because extracted viral DNA from infected cells is unable to
enter a pulsed-field gel (Zhang, Efstathiou, and Simmons 1994; Severini et al. 1994).
Furthermore, electron microscopy studies have revealed numerous X- and Y- shaped
intermediate structures in replicating DNA (Jacob and Roizman 1977; Severini, Scraba, and Tyrrell 1996). A conclusive model for HSV-1 DNA replication should incorporate the evidence stated above which points towards a recombination-mediated replication process.
Initiation phase of DNA Replication
Our current understanding of HSV-1 DNA replication broadly consists of two major phases, the initiation step and the elongation step. The initial step in DNA replication involves the recognition of either OriL or one of the two copies of OriS by a complex of
UL9 and ICP8. This UL9- ICP8 complex undergoes a series of conformational changes,
which result in the distortion and unwinding of the origin. The first step of this unwinding
process involves the cooperative binding of two UL9 dimers to the UL9 origin specific
binding sites (box I, II or III) leading to the distortion of the A/T rich region (Elias et al.
1992; Makhov, Boehmer, and Lehman 1996; He and Lehman 2001). Then, in a second step, UL9 along with ICP8 in the presence of ATP promotes the formation of a hairpin in
the origin (oriS*) (Aslani, Olsson, and Elias 2002; Macao, Olsson, and Elias 2004;
Makhov et al. 2003). During this step UL9 undergoes major conformational changes that alters its DNA binding abilities form duplex origin specific to nonspecific ssDNA binding (Macao, Olsson, and Elias 2004; Olsson et al. 2009). ICP8 may also undergo a conformational change triggered by the exposure of ssDNA resulting in its release from
23 UL9 (Gustafsson et al. 1995). The involvement of UL9 in the initiation step is critical for
productive DNA replication, although UL9 is not required during the subsequent DNA
elongation phase(Blümel and Matz 1995; Schildgen et al. 2005). It is important to note,
that the initiation process has mostly been studied with in vitro models using artificial
substrates and may not be representative of what is happening during infection. Other
viral or cellular factors might be involved during the initiation step of origin unwinding.
Elongation phase of DNA replication
After the initial distortion of the origin by UL9 and ICP8, the helicase primase complex
(UL5/8/52) is probably recruited to the origin via protein- protein interactions. UL9 has
been reported to interact with the UL8 subunit of the helicase-primase complex
(McLean et al., 1994). Additionally, ICP8 can also interact with the helicase-primase complex and can stimulate its activities (Hamatake, Bifano, Hurlburt, and Tenney
1997a; Falkenberg, Elias, and Lehman 1998). At least two molecules of the UL5/8/52 complex are required for successful primase activity: whereas, the helicase activity of this complex requires only one molecule of UL5/8/52 (Y. Chen et al. 2011). This
complex may also function as a scaffold to recruit the polymerase complex (UL30/42) to
the replication fork. Furthermore, the UL8 subunit has been reported to interact with the
viral polymerase (Marsden et al. 1996). Moreover, the helicase- primase complex needs to be active in order to recruit the polymerase, suggesting that conformational changes that occur to the active complex or the presence of an RNA primer are important for recruiting the polymerase (Carrington-Lawrence and Weller 2003). Once present at the replication fork, the viral polymerase has the ability to catalyze coupled leading and
24 lagging strand DNA synthesis (Stengel and Kuchta 2011). While much progress has
been made in understanding DNA replication, we have still not been able to reconstitute
origin dependent DNA replication in an in vitro system. This fact suggests that perhaps
important cellular or viral factors could also be involved in this process, or that we do not
yet fully appreciate the stoichiometry of the proteins at the replication fork. Moreover, the highly branched structures observed in HSV-1 replication products and the isomeric nature of the genome strongly suggests that the mode of replication involves recombination events. Work from our laboratory has also demonstrated that the occurrence of single strand annealing is increased in the context of an HSV-1 infection
(Schumacher et al. 2012).
1.6 Replication Compartment Formation
HSV-1 replication causes dramatic reorganization of the nucleus into large globular non membrane bond structures referred to as replication compartments (Quinlan, Chen, and
Knipe 1984). These compartments function to concentrate and compartmentalize viral and cellular molecules that are crucial for viral gene expression, DNA replication and viral capsid formation (de Bruyn Kops and Knipe 1988; Lamberti and Weller 1996;
Phelan et al. 1997). ICP8 is essential for the formation of replication compartments and is considered to be the nucleating factor required for their formation (de Bruyn Kops and
Knipe 1988; Bush et al. 1991; McNamee, Taylor, and Knipe 2000). The formation of replication compartment occurs through a series of protein scaffold intermediate structures called prereplicative sites (PRS), as shown in Figure 1.3. The stages of PRS
25 Stage I Stage II Stage IIIa Stage IIIb Stage V
ND-10 foci ICP4/ICP27 foci ICP8, UL9 ICP8, UL9 Replication (shown in pink) & UL5/8/52 UL5/8/52 Compartments & ICP8 micro-foci UL30/42 ICP4/ICP27 foci containing: (shown in UL9, UL5/8/52 purple) (shown in green)
Figure 1.3 HSV-1 Replication Compartment formation. The stages of prereplicative site formation are described in detail in the accompaning text.
26 formation can be observed naturally during an infection, although this processes
happens rapidly. Hence, to determine the protein content of PRS during the different
stages of formation; the progression of infection is paused by either using mutant
viruses that are null for essential DNA replication proteins or by administrating drugs that prevent viral DNA synthesis.
The first detectable stage of PRS formation is a nucleoprotein complex containing ICP4 and ICP27 that forms on the viral genome (Liptak, Uprichard, and Knipe 1996; Everett et al. 2004). After which Nuclear domain 10 (ND-10) like foci forms adjacent to ICP4 nucleoprotein complexes (Everett et al. 2004; Everett and Murray 2005). The ND-10 foci are thought to be suppressive to viral gene expression and are targeted for disruption by the virally encoded ubiquitin ligase, ICP0 (Everett 2001). The disruption of ND-10
marks the transition from stage I to stage II. Further progression into stage II requires
oligomerization of ICP4 on viral DNA. Moreover, this stage is characterized by the
appearance of ICP8 micro-foci adjacent to ICP4 and these ICP8 micro-foci appear to
merge with the ICP4/ICP27 foci. Furthermore, UL9 and the Helicase-primase complex
are also detected during this early stage(Livingston et al. 2008).
The prereplicative sites will continue to mature into stage IIIa if the helicase-primase
complex is active. Stage IIIa foci contain all of the same viral replication proteins that are present at the end of stage II (ICP8, UL9, UL5/8/52) although the foci in stage IIIa
are larger in size. The following stage IIIb foci contain all seven viral replication proteins
and the polymerase is recruited to these sites only if an active primase is present
27 (Burkham et al., 1998; Carrington-Lawrence and Weller, 2003). These PRS sites will then coalesce to form larger replication compartments (stage IV) that occupy most of the nucleus if the polymerase is active (Chang et al. 2011).
1.7 Thesis Objectives:
HSV-1 is the most widely studied human herpes viruses and is a model for understanding other members of the family. Although DNA replication has been studied extensively in HSV-1 for many decades, the basic mechanisms that mediate HSV-1 replication are still poorly understood. This thesis focuses on understanding some of the protein- protein interactions involving the ssDNA binding protein ICP8, that mediate the assembly of functional replication compartments.
The HSV-1 virus reorganizes the cellular nucleus into replication compartments and
ICP8 is essential for the formation of the earliest detectable replication compartments.
The physical and functional properties of ICP8 that contribute to replication compartment formation are poorly understood. ICP8 has been known to be essential for productive HSV-1 infection since the early 1980s, although not a single protein interaction motif has been identified. ICP8 forms double helical filaments in the absence of DNA; the biological relevance of these types of filaments is not understood. We are interested in understanding ICP8 self-interactions involved in filament formation and its possible connection to replication compartment formation. In this thesis I sought to identify protein interaction motifs in ICP8. I hypothesize that ICP8 interactions with
28 itself and other viral replication proteins are essential for the localization and
assembly of a functional replisome and formation of replication compartments.
Two aims were pursued to test this hypothesis.
Aim 1. ICP8 filament formation is required for replication compartment formation.
Aim 2. Identify potential protein interaction sites on ICP8 that are critical for replication compartment formation.
29 Chapter 2
Materials and Methods
2.1 Cell culture and viruses
African green monkey kidney (Vero) cells were purchased from the American Type
Culture Collection and maintained in Dulbecco’s modified Eagle’s medium (DMEM)
(Invitrogen, Carlsbad, CA) supplemented with 5% fetal bovine serum (FBS) and 0.1%
penicillin-streptomycin. The ICP8 complementing cell line S2 was generously provided
by David Knipe (Harvard University, Boston, MA) (Gao and Knipe 1989). S2 cells were maintained in DMEM with 5% FBS, 0.1% penicillin-streptomycin and kept under G418 selection (400 ug/ml). The HSV-1 strain KOS was used as the WT strain in all experiments. The ICP8 null virus, HD-2, which contains an in-frame lacZ insertion and a deletion in the UL29 gene, was generously provided by David Knipe (Harvard Medical
School, Cambridge MA) (Gao and Knipe 1989).
2.2 DNA constructs and mutagenesis
The ICP8 expression vector, pSAK-ICP8, contains the full length ICP8 gene under control of the CMV promoter (Schumacher et al. 2012). ICP8 mutants were constructed
in pSAK-ICP8 for mammalian expression and pFastBac1 for the construction of
recombinant baculoviruses. The ICP8Δ60NLS mutant was constructed by PCR
amplification of the ICP8 gene in pSAK-ICP8 with primers that resulted in the deletion of
30 the C-terminal 60 aa of ICP8 and the addition of the SV40 NLS. The resulting PCR product was cloned into pSAK that had been digested with HindIII and EcoR1. ICP8Δ60 was introduced into pFastBac1 using a similar strategy, except no NLS was added.
Alanine substitutions in conserved motifs FNF (1142-1144) and FW (843,844) were made in pSAK-ICP8 and pFastBAC1-ICP8 using the QuikChange II XL Site-Directed
Mutagenesis Kit (Agilent Technologies) according to the manufacturer’s suggested protocol. The FNF mutant (pSAK-ICP8 FNF) contains three alanine residues in place of
FNF and the FW mutant (pSAK-ICP8 FW) contains two alanine residues in place of FW.
A double mutant containing both FNF and FW mutants (pSAK-ICP8 FW-FNF) was constructed by adding the FW mutation to pSAK- ICP8 FNF and pFastBac1-ICP8 FNF using the QuikChange II XL Site-Directed Mutagenesis Kit.
2.3 Protein purification
Recombinant baculoviruses bearing WT and mutant versions of ICP8 were generated in the Bac-to Bac system (Invitrogen) as previously described (Grady, Bai, and Weller
2014). Sf9 insect cells were infected with recombinant baculovirus bearing WT or mutant versions of ICP8 and harvested at ~48-50 hours post infection (hpi). Purification was carried out as previously described (Reuven et al. 2003). Briefly, infected insect cell pellets were resuspended in lysis buffer, homogenized and cleared by centrifugation at 30,000 rpm in a Ti70 rotor for 40 min. The supernatant was applied to a Hi-load
16/10 SP-Sepharose anion-exchange column and eluted with a salt gradient. An additional purification step was performed during purification of the FW mutant due to the presence of a contaminating nuclease. After SP-Sepharose chromatography, ICP8
31 protein containing fractions were pooled and further purified on a Superose 6 size
exclusion column. ICP8 mutant Q706A-F707A was purified similarly to ICP8-FW
mutant. Purified proteins were resolved by denaturing 8% SDS-PAGE and visualized
by Coomassie blue staining. Fractions containing the highest purity were dialyzed
against storage buffer (20 mM Hepes pH 7.6, 1 mM DTT, 0.1 mM EDTA, 100 mM NaCl
and 5% glycerol) and stored at -80°C. The UL5-UL8-UL52 complex was expressed in
insect cells co-infected with recombinant baculoviruses bearing UL5, His-tagged UL8,
and UL52. The heterotrimeric complex was purified on a HIS-Select nickel affinity
column (Sigma) as previously described (Y. Chen et al. 2005).
2.4 Electron microscopy
Purified protein samples at a concentration of 0.3 mg/mL were incubated in a buffer
containing 20 mM Tris-HCl pH 7.5, 50 mM NaCl and 5 mM MgCl2 overnight at 4°C.
Samples were diluted 1:10 in water, adsorbed on a formvar/carbon coated 300 mesh copper grids, negatively stained with 2% uranyl acetate and examined using TEM
Hitachi H-7650 at an accelerating voltage of 80 kV. Images were taken at magnifications of 12,000X and 60,000X. For analysis of filament length, 0.15 mg/mL of
WT ICP8 was incubated with an equal concentration of mutant protein or BSA and incubated overnight under filament forming conditions as described above. The lengths of all filaments detected in a randomly selected area of 100 µm2 were measured using
ImageJ analysis.
32 2.5 Immunofluorescence (IF) analysis
IF analysis was performed as described previously (Livingston et al. 2008). Briefly, cells
were grown on glass coverslips and washed with phosphate buffered saline (PBS),
fixed with 4% paraformaldehyde, and permeabilized using 1% Triton X-100. Cells were
blocked in 3% normal goat serum and incubated with the indicated antibodies:
monoclonal mouse anti-ICP4 (1:200; US Biological), polyclonal rabbit anti-ICP8 clone
367 [1:400; a gift from William Ruyechan (Shelton et al. 1994)]. Alexa Fluor secondary antibodies (1:200; Molecular Probes) were used with fluorophores excitable at a wavelength of 488 or 594 nm. All images were taken using a Zeiss LSM 510 Meta confocal microscope and a Zeiss 63X objective lens (numerical aperture, 1.4). Images were processed and arranged using Adobe Photoshop CS3 and Illustrator CS3.
2.6 Transient complementation assays
Vero cells were grown in a 35 mm dish to 70% confluence and transfected with 1 µg of plasmid using Lipofectamine Plus reagent (Invitrogen) according to the manufacturer’s suggested protocol. At 24 hours post transfection, cells were infected with HD-2 at an
MOI of 3 pfu/cell for 1 h at 37°C. After an adsorption period of one hour, cells were washed twice with PBS and media was replaced. At 24 hpi cells and growth media were collected and subjected to three cycles of freezing and thawing. Viral yields were determined by titration on S2 complementing cells. To test for replication compartment formation, cells were grown on coverslips to 70% confluence and transfected with 250 ng of the indicated plasmid and 750 ng of empty vector (as carrier DNA). At 16 hours
33 post transfection cells were infected with HD-2 (MOI = 20), and at 6 hpi cells were fixed
and stained for IF analysis.
2.7 Plaque reduction assay
Infectious DNA was prepared as previously described (S. Smith et al. 2014). Vero cells were grown in a 60 mm dish to 70% confluence and transfected with 25 ng of infectious
WT KOS DNA, along with 100 ng of plasmid expressing WT or mutant versions of ICP8
(FNF, FW or FW-FNF); the ICP8 plasmid was in 80-fold molar excess to infectious
DNA. In addition, 1.4 µg of carrier DNA (pUC19 empty vector) was included in the transfection mixture. At 24 hours post transfection, cells were washed with PBS and incubated for 4 days. Plaques were counted, and data was presented as percentage of plaque reduction compared to WT.
2.8 ssDNA binding assay
Fluorescently labeled 50nt ssDNA substrate (F50nt5’cy3):
TGCGGATGGCTTAGAGCTTAATTGCTGAATCTGGTGCTGTAGCTCAACAT) was purchased from Integrated DNA Technologies. Reaction mixtures (10 ul) containing 20 mM Tris-HCl (pH 7.5), 4% glycerol, 0.1 mg/ml bovine serum albumin (BSA), 0.5 mM
DTT, 5 mM MgCl2, and 100 nM fluorescently labeled substrate were incubated with the indicated amount of WT or mutated ICP8 protein for 30 min at room temperature.
Reactions were stopped by addition of 2 ul of 6x loading buffer (40% sucrose) and loaded onto 5% nondenaturing PAGE. Fluorescent signal was visualized using a Bio
Rad Chemi-Doc MP imaging system.
34 2.9 Transfection assay
Vero cells were grown on a glass coverslip in a 35 mm dish to 70% confluence and
transfected with 250 ng of the indicated ICP8 WT or mutant plasmid and 250 ng of each
of the following plasmids UL8 (pCM-UL8), UL5 (pCM-UL5b), UL52 (pCMV-UL52)
(provided as a gift from Regina Heilbronn (Heilbronn and Hausen 1989). Cells were transfected with Lipofectamine PLUS (Invitrogen) according to the manufacturer's suggested protocol. Twenty hours after transfection cells were fixed and stained for IF analysis.
2.10 Surface plasmon resonance (SPR)
Protein-protein interactions were studied in real time using the Biacore T200 optical biosensor (GE Healthcare). Purified WT or mutant ICP8 proteins (FNF, FW, FW-FNF and Δ60) were covalently immobilized by amine coupling through EDC/NHS on a CM5 sensor chip. UL5/8/52 analyte in HSB buffer (10 mM HEPES pH 7.4, 3 mM EDTA, 150 mM NaCl and 0.05% surfactant P20) was injected over the sensor surface at a flow rate of 30 µL/min for 180 sec (on rate) then followed by HSB buffer at the same flow rate for another 180 sec (off rate). The sensor chip was regenerated between injections by passing 10 mM NaOH at a flow rate of 50 µL/min for 120 sec. Purified bovine serum albumin (BSA; Sigma) was used as a negative control. The data was analyzed using the Biacore T200 evaluation software, and was fitted onto the 1:1 Langmuir binding model.
35 2.11 Prediction of protein interaction sites
To identify potential protein interaction sites on ICP8 we first identified conserved ICP8
residues by a sequence alignment of ICP8 orthologues from representatives of three
sub families of Herpesviridae (Alphaherpes, Betaherpes, and Gammaherpes virus) using the t-coffee multiple sequence alignment program (Notredame, Higgins, and
Heringa 2000). Secondly, we determined the distance of a conserved residue from the surface by using Pymol (reference for Pymol). Residues within 10 Ų to the surface and in close proximity to other conserved residues were categorized as potential protein interaction sites. Alanine substitution mutations were then constructed in the ICP8 amino acid residues that were proposed to be protein interaction sites as described in the DNA constructs and mutagenesis section of this chapter.
36 Chapter 3
ICP8 Filament Formation is Essential for Replication Compartment Formation
During Herpes Simplex Virus Infection
Anthar S. Darwish, Lorry M. Grady, Ping Bai and Sandra K. Weller
This chapter was published in the Journal of Virology.
Darwish, A. S., Grady, L. M., Bai, P. and Weller, S.K (2016). “ICP8 Filament Formation is Essential for Replication Compartment Formation During Herpes Simplex Virus
Infection.” J Virol 90(5) 2561-2570.
P.B and L.M.G both contributed to the protein expression and purification of ICP8 wild type and mutants. P.B also contributed Figure 3.4 and L.M.G and S.K.W helped in manuscript preparation. All other experiments and manuscript preparation were done by A.S.D.
37 ABSTRACT
HSV dramatically reorganizes the infected cell nucleus leading to the formation of prereplicative sites (PRS) and replication compartments (RC). This process is driven by the essential viral ssDNA binding protein, ICP8, which can form double helical filaments in the absence of DNA. In this paper we show that two conserved regions FNF (F1142,
N1143, and F1144), and FW (F843 and W844) are essential for ICP8 self-interactions, and we propose that the FNF motif docks into the FW region during filament formation.
Mammalian expression plasmids bearing mutations in these motifs (FNF and FW) were unable to complement an ICP8 null mutant for growth and replication compartment formation. Furthermore, FNF and FW mutants were able to inhibit wild type (WT) virus plaque formation and filament formation; whereas, a double mutant (FNF-FW) was not.
These results suggest that single mutant proteins are incorporated into non-productive
ICP8 filaments, while the double mutant is unable to interact with WT ICP8 and does not interfere with WT growth. Cells transfected with WT ICP8 and helicase/primase
(H/P) complex exhibited punctate nuclear structures that resemble PRS; however, the
FNF and FW mutants failed to do so. Taken together these results suggest that the FNF and FW motifs are required for ICP8 self-interactions and that these interactions may be important for the formation of PRS and RC. We propose that filaments or other higher order structures of ICP8 may provide a scaffold onto which other proteins can be recruited to form PRS and RC.
38 INTRODUCTION:
Herpes Simplex Virus Type 1 (HSV-1) is a double stranded DNA virus that replicates in
the nucleus of an infected cell in large globular domains called replication compartments
(Quinlan, Chen, and Knipe 1984). These compartments are non-membrane bound
structures in the nucleus that serve to concentrate and compartmentalize viral and
cellular molecules that are required for gene expression, DNA replication and
encapsidation (de Bruyn Kops and Knipe 1988; Lamberti and Weller 1996; Phelan et al.
1997). HSV-1 encodes seven essential replication proteins required for origin-
dependent DNA replication: a single strand DNA binding protein (ICP8), an origin
binding protein (UL9), the helicase-primase complex (UL5/8/52) and the polymerase
complex (UL30/42) (reviewed in (Weller and Coen 2012a)). All seven replication
proteins as well as several cellular proteins localize to replication compartments in HSV-
infected cells (Olivo, Nelson, and Challberg 1989; Lukonis and Weller 1996; Quinlan,
Chen, and Knipe 1984; Wilcock and Lane 1991; Wilkinson and Weller 2004; T. J. Taylor and Knipe 2004; Mohni et al. 2010; Mohni et al. 2011).
Replication compartment formation in HSV-infected cells occurs via an ordered sequence of events starting with the formation of ICP4/27 nucleoprotein complexes on viral genomes (Liptak, Uprichard, and Knipe 1996; Everett et al. 2004). The first ICP8 containing structures are punctate foci called prereplicative sites (PRS) that also contain the helicase/primase complex (UL5/8/52) and the origin binding protein, UL9 (Liptak,
Uprichard, and Knipe 1996; Lukonis, Burkham, and Weller 1997). UL30 and UL42 are recruited to PRS (Carrington-Lawrence and Weller 2003), and when replication is
39 allowed to proceed, they coalesce with each other and with ICP4/27 foci to form mature
replication compartments (T. J. Taylor et al. 2003; Chang et al. 2011). The absence of
PRS in cells infected with an ICP8 null mutant virus has been taken as evidence that
ICP8 is the nucleating factor required for their formation (de Bruyn Kops and Knipe
1988; Bush et al. 1991; McNamee, Taylor, and Knipe 2000). During the formation of
PRS and RC, ICP8 is known to undergo conformational changes (Uprichard and Knipe
2003a); however, it is not clear how these changes contribute to PRS and RC
formation.
ICP8 is a 128-kDa zinc metalloprotein that binds ssDNA cooperatively and forms thin
nucleoprotein filaments on ssDNA (Makhov and Griffith 2006; Tolun et al. 2013) and double helical filaments in the absence of DNA (O'Donnell et al. 1987; Makhov et al.
2009). The 60 C-terminal residues of ICP8 are required for both filament formation and cooperative binding to ssDNA (Mumtsidu, Makhov, and Konarev 2008; Mapelli et al.
2000). In 2005, the crystal structure of ICP8 lacking the C-terminal 60 aa residues was reported, revealing an N-terminal domain (residues 9-1038) that was described as containing head, neck and shoulder regions (Mapelli, Panjikar, and Tucker 2005).
Based on the ICP8 structure, Mapelli et al. predicted putative ssDNA binding residues
as well as residues that may be important for protein-protein interactions. For instance,
they suggested that conserved residues, F827, F843, W844, L857 and I865 within the
head region form a hydrophobic pocket that could interact with another protein (Mapelli,
Panjikar, and Tucker 2005) (Figure 3.1A).
40 A C
60 kDa Ladder WT FNF FW FW-FNF 250 150 100 75
50
37
B F FW LI
827 843 844 857 865
1 1196 ICP8 WT 60
1136
FNF
1142-1144
Figure 3.1. ICP8 protein structure. (A) Ribbon diagram of ICP8 colored according to subdomain: the head, neck and shoulder subdomains are colored red, yellow, and blue, respectively; the C-terminal domain is colored purple. The green spheres show the alpha-carbon of the FW residues within the head subdomain. The 60 C-terminal residues of ICP8 are not represented in the structure. (PDB ID 1URJ) (B) Schematic of ICP8 protein depicting the locations of the FW motif and the FNF motif. A double and a triple alanine substitution in F843 W844 (FW) and F1142 N1143 F1144 (FNF), respectively, were generated as described in Materials and Methods (C) WT and mutant versions (FNF, FW, FW-FNF and Δ60) of ICP8 were expressed and purified from Sf9 insect cells infected with recombinant baculoviruses and purified as described in Materials and Methods. Purified proteins were resolved by 8% SDS-PAGE and stained with coomassie blue.
41 In this study, we identified two conserved motifs involved in filament formation, one
within the C-terminal 60 amino acids (1142-1144 FNF) and the other within the
hydrophobic head region (F843 and W844) that had been predicted to participate in
protein interactions (Mapelli, Panjikar, and Tucker 2005). Mutant proteins containing
alanine substitutions within these motifs failed to form filaments in solution and were
unable to complement an ICP8 null mutant for viral growth and replication compartment
formation. Furthermore, these mutants were unable to form prereplicative site-like foci in
transfection-based assays. We propose that filaments of ICP8 may form a scaffold onto
which other viral and cellular proteins can be recruited to assemble PRS and RCs.
RESULTS
The FNF and FW motifs of ICP8 are required for filament formation
The HSV ssDNA binding protein, ICP8, has been reported to form double helical protein
filaments in vitro in the absence of DNA (O'Donnell et al. 1987; Makhov, Taylor, and
Griffith 2004; Makhov et al. 2009). ICP8 homologs BALF2 from Epstein-Barr virus (EBV) and ORF6 from Kaposi’s sarcoma-associated herpesvirus (KSHV) also form double helical protein filaments (Ozgur, Damania, and Griffith 2011; Mumtsidu, Makhov, and
Konarev 2008), suggesting that filament formation is a common property of herpesvirus
ssDNA binding proteins. Removal of the 60 C-terminal amino acids from ICP8, BALF
and ORF6 has been reported to eliminate filament formation and to reduce cooperative
binding to ssDNA (Mumtsidu, Makhov, and Konarev 2008; Ozgur and Griffith 2014;
42 Mapelli et al. 2000). These observations suggest that the 60 C-terminal residues of
ICP8 and its homologs contain residues important for protein-protein interactions that
mediate filament formation and cooperative binding (Mapelli et al. 2000; Mapelli,
Panjikar, and Tucker 2005; Mumtsidu, Makhov, and Konarev 2008; Ozgur and Griffith
2014). ICP8 has emerged as the nucleating factor for replication compartment formation
(de Bruyn Kops and Knipe 1988; Bush et al. 1991; McNamee, Taylor, and Knipe 2000),
and we are interested in the relationship between filament formation in vitro and replication compartment formation in HSV-infected cells.
Sequence alignments of ICP8 homologs from the alpha Herpesviridae subfamily revealed a conserved region within the C-terminal 60aa that was predicted to be involved in filament formation (Mapelli, Panjikar, and Tucker 2005). Within this region, the FNF motif (F1142, N1443 and F1144) was predicted to play a role in ICP8-ICP8 interactions (Mapelli, Panjikar, and Tucker 2005). Furthermore, a mutation in the FNF region (F1144C) was previously reported to be unable to complement the growth of an
ICP8 null virus or to localize to replication compartments (T. J. Taylor and Knipe 2003).
The FNF motif was predicted to dock into a conserved hydrophobic region (F827, F843,
W844, L857, and I865) in the head region of a neighboring ICP8 molecule (Mapelli,
Panjikar, and Tucker 2005) (Figure 3.1A, B); however, these predictions have never been directly tested nor has the F114C mutation been studied for its ability to form filaments in vitro. In order to test these predictions, we introduced a triple alanine mutation in the FNF motif and a double alanine mutation in the FW motif (residues F843
43 and W844) (figure 3.1 B). We also reconstructed the previously engineered 60aa C-
terminal deletion for comparison with the alanine substitution mutations.
WT and mutant proteins were purified from insect cells infected with recombinant
baculoviruses (Figure 3.1C) and tested for their ability to form filaments in vitro. ICP8 proteins were incubated under conditions previously shown to promote filament formation and subjected to analysis by electron microscopy as described in Materials and Methods. As anticipated, WT ICP8 was able to form a double helical filament
(Figure 3.2A, B), while ICP8Δ60 was unable to do so (Figure 3.2F). Neither the FNF nor
FW mutant proteins were able to form filaments under these conditions; instead, these proteins formed small clusters consistent with monomers or dimers (Figure 3.2C, D, and
E). These observations suggest that intact FNF and FW motifs in ICP8 may be required for self-interactions between ICP8 molecules that lead to filament formation.
ICP8 mutants that fail to form filaments are unable to complement the growth of an ICP8-null virus
In order to test whether mutants that fail to form filaments retain the ability to complement the growth of an ICP8 null mutant virus, we introduced each of the mutant constructs into a mammalian expression vector under the control of the HCMV promoter. For ICP8∆60, which lacks an NLS, an SV40 NLS was added to ensure that
ICP8∆60 localizes to the nucleus (Gao and Knipe 1992b; Gao and Knipe 1993). The ability of WT and mutant versions of ICP8 to complement the growth of an ICP8 null
44 A B C
WTWTWT WTWT FNFFNF
500 nm 100nm 100nm
D E F
FWΔ60 FW-FNFFW-FNF Δ60FW-FNFΔ60
100nm 100nm 100nm Δ60
Figure 3.2. Filament formation for wild type and mutant versions of ICP8 as visualized by electron microscopy. (A) and (B) ICP8 WT formed double helical filaments after overnight incubation at a concentration of 0.15mg/mL at 4oC in a
5 mM MgCl2 containing buffer. Mutant ICP8 FNF (C), FW (D) FW-FNF (E), and ICP8Δ60 (F) were unable to form filaments. All samples were negatively stained with 2% uranyl acetate and visualized by electron microscopy at an accelerating voltage of 80 kV. Scale bar represents 100 nm (60,000 X) and 500 nm (12,000 X).
45 virus (HD-2) (Gao and Knipe 1989) was measured by transfecting Vero cells with WT or mutant versions of the ICP8 expression plasmids followed by infection with HD-2.
Progeny virus was harvested 24 hours post infection, and viral yields were determined by titration on an ICP8 complementing cell line (S2) (Gao and Knipe 1989). None of the mutants were able to complement HD-2, and viral yields were comparable to cells transfected with an empty vector (Table 3.1). We conclude that the ICP8 mutants that fail to form filaments in vitro are also defective for viral growth.
FW and FNF exhibit a trans-dominant phenotype.
If, as we predict, the FNF motif docks into the hydrophobic head region of a neighboring
ICP8 molecule, the FNF and FW motif mutants would be expected to exert a trans- dominant inhibitory effect on ICP8 filament formation when co-expressed with WT ICP8.
We predict that a mixture of mutant and WT ICP8 would generate a heterogeneous population of dimeric or higher order structures that could prevent ICP8 filament extension and inhibit infection. In the experiment shown in Figure 3.3A, Vero cells were transfected with mutant or WT versions of ICP8 along with infectious DNA isolated from cells infected with WT HSV-1 (KOS). The FNF and FW mutants displayed a reduction in plaque formation by almost 60% and 50% respectively. According to this scenario, we also predict that a double mutant bearing mutations in both the FNF and FW motifs would be unable to form mixed oligomers with WT ICP8. To test this hypothesis we constructed an ICP8 mutant containing both FW and FNF mutations. FW-FNF was tested for trans-dominance as described above. In contrast to the single mutants, the double mutant FW-FNF had no effect on plaque formation (Figure 3.3A). We conclude
46
Table 1. Mutants that disrupt ICP8 filament formation fail to complement the growth of HD-2 virus
Plasmid Transfected % Complementation SEM ±
ICP8 100 0 FW -0.1 0.13 FNF 0.6 0.34 FW-FNF 0.02 0.20 Δ60 -0.2 0.11 Empty vector 0 0
The values in this table represent an average of 4 independent experiments.
47 > 400 nm B 60 200 - 400 nm A 120 2 < 200 nm 50 100
80 40
60 30
40 20
% of Plaque Formation Formation Plaque of % 20 10
Total filaments in 100 µm Total 0 0 WT FNF FW FW-FNF WT FNF FW FW-FNF
Figure 3.3. FNF and FW mutants exhibit a transdominant phenotype. (A) A plaque reduction assay was conducted by transfecting Vero cells with 100 ng of plasmid expressing ICP8 WT or mutant versions of ICP8 (FNF, FW or FW-FNF) and 25 ng of infectious KOS DNA. At 4 days post transfection, plaques were counted. (B) Purified ICP8 protein was incubated with FNF, FW, FW-FNF or BSA at equal concentrations (0.15 mg/mL) and incubated over o night at 4 C in a buffer containing 5 mM MgCl2. Electron microscopy was used to image the samples, and the length of filaments in a100 µm2 area on the grid were counted using Image J software analysis. Filament lengths were categorized as either < 200 nm, 200-400 nm, or > 400 nm. The height of each colored block signifies the number of filaments in that catergory.
48 that FNF and FW are trans-dominant inhibitors of infection, possibly as a result of their non-productive incorporation into ICP8 filaments. The double mutant does not inhibit the growth of WT virus presumably because it lacks the ability to form ICP8-ICP8 interactions and is therefore not able to incorporate into a growing ICP8 filament.
To test whether the presence of mutant proteins could affect the length of ICP8 filaments formed in vitro, a mixture of WT and mutant proteins in a 1:1 ratio were examined for filament formation. In order to include the double mutant protein in this analysis, FW-FNF was also introduced into a recombinant baculovirus, and purified protein was obtained from infected insect cells (Figure 3.1C). Like the single mutants, the double mutant is also incapable of filament formation (Figure 3.2). Samples were visualized by electron microscopy, and the lengths of filaments were measured using
ImageJ software analysis (Figure 3.3B). The limiting size for observing a filament is 50 nm; therefore, filaments over this size were counted and grouped into three categories: below 200 nm, between 200-400 nm or above 400 nm in length. The mixture of WT and
FW-FNF mutant proteins exhibited a similar distribution of filaments in all three categories; however, FNF exhibited few filaments above 400 nm and a higher number of smaller structures. In the mixture containing WT and FW protein, however, very few structures were observed, indicating that the presence of this mutant protein was even more deleterious to WT filament formation than the FNF mutant. It will be of interest to determine why FW has an even more dramatic effect on mixed filament formation; however, at this point we can conclude that both mutants interfere with filament formation of WT ICP8 in vitro and on productive infection in Vero cells. The observation
49 that the double mutant alleviated the trans-dominant phenotype of the single motif
mutants is consistent with the notion that the FNF motif docks at the FW region.
Mutant proteins retain ability to bind ss DNA with reduced cooperativity
The loss of filament formation may represent disruption of interaction domains
responsible for ICP8-ICP8 interactions or destabilization of mutant proteins. To rule out
global misfolding, we tested whether these mutants can still bind to ssDNA using an
electrophoretic mobility shift assay (EMSA). In this assay, WT or mutant ICP8 proteins
were incubated with a Cy3-labeled 50 nt oligomer, and the reaction products were resolved by 5% nondenaturing PAGE. Figure 3.4 shows that the WT and mutant proteins all bind to ssDNA in a concentration-dependent fashion; however, differences in the shift patterns were observed. WT ICP8 exhibited two predominant shifted bands, the slower of which may represent the ability of the WT protein to bind cooperatively to the 50 nt oligomer. All mutant proteins were able to shift ssDNA; however, none of the nucleoprotein complexes corresponded to the slowest species seen in the WT ICP8 samples. These results suggest that as reported previously for ICP8∆60 (Mapelli et al.
2000), FNF, FW and FW-FNF mutant proteins have lost their ability to bind cooperatively to ssDNA; however, the ability of all mutants to bind ssDNA indicates that the mutant proteins are not globally misfolded.
50 WT FNF FW FW-FNF Δ60 0 100 200 100 200 100 200 100 200 100 200 nM
Figure 3.4. ICP8 mutants FNF, FW, FW-FNF and Δ60 retain the ability to interact with ssDNA albeit with reduced cooperativity. ICP8 WT or Mutants (FNF, FW, FW-FNF and Δ60) were incubated at concentrations of either 100 nM and 200 nM with 100 nM of 5′ fluorescein-labeled 50 nt length ssDNA substrate for 30 min and the complexes were separated on 5% nondenaturing polyacrylamide gels. WT and mutants were able to bind DNA, although there was a difference in size of nucleoprotein complexes formed. ICP8 WT forms a supershifted complex that is absent in the mutants, suggesting a lack of cooperative binding in the mutants. The signal was detected using Bio Rad Chemi-Doc MP imaging system.
51 ICP8 mutants defective in filament formation are unable to generate replication compartments and PRS-like foci.
As described in the introduction, ICP8 is required for the formation of replication compartments (de Bruyn Kops and Knipe 1988). To test whether ICP8 mutants that fail to form filaments in vitro are able to complement an ICP8 null mutant virus for the formation of replication compartments, Vero cells were transfected with either WT or mutant versions of ICP8 followed by infection HD-2 (MOI=20 for 6 hours). The immediate early protein ICP4 was used as a marker for infection, and transfected cells were identified based on ICP8 staining. Only cells that express ICP8 and ICP4 were analyzed. WT ICP8 was able to complement HD-2 for replication compartment formation (Figure 3.5A-C); however, none of the four mutants tested were able to do so
(Figure 3.5D-O).
Replication compartment formation occurs via an ordered sequence of events, and
ICP8, helicase-primase and UL9 are present in the earliest detectable pre-replicative sites (PRS) (Kops and Knipe 1988; Liptak, Uprichard, and Knipe 1996; Lukonis,
Burkham, and Weller 1997; Livingston et al. 2008). During the course of HSV infection,
PRS foci grow and coalesce into replication compartments. A transfection-based assay has been developed that mimics PRS formation (Liptak, Uprichard, and Knipe 1996;
Lukonis and Weller 1997). In cells transfected with ICP8 alone, a diffuse pattern is observed throughout the nucleus; however, in cells transfected with ICP8 plus the three subunits of the helicase/primase (UL5, UL8, UL52) punctate foci are observed that resemble PRS and have been called PRS-like foci (Lukonis and Weller 1997; Liptak,
Uprichard, and Knipe 1996; Wilkinson and Weller 2004). We next asked whether ICP8
52 WT FNF FW FW-FNF Δ60
A B C D E
ICP8
F G H I J ICP8 & H/P
Figure 3.5. ICP8 mutants FNF, FW, FW-FNF and ICP8Δ60NLS do not form pre-replicative like structures.Vero cells were transfected with plasmids expressing (A and F) ICP8 WT, (B and G) FNF, (C and H) FW, (D and I) FW-FNF or (E and J) ICP8Δ60NLS. In panels F-J plasmids expressing UL5, UL8 and UL52 were added. At 20 hours post transfection, cells were fixed and stained with a primary ICP8 antibody and a secondary Alexa Fluor 488 antibody. Images were taken with Zeiss LSM 510 confocal microscope.
53 WT FNF FW FW-FNF Δ60
A D G J M
ICP8
B E H K N
ICP4
C F I L O
Merge
Figure 3.6. ICP8 mutants are unable to complement HD-2 for replication compartment formation.Vero cells were transfected with (A) ICP8 WT or mutants (B) FNF, (C) FW, (D) FW-FNF and ICP8Δ60NLS. At 16 hours post-transfection cells were infected with an ICP8 null virus (MOI=20). 6 hours post-infection cells were fixed and stained for ICP8 and ICP4 with secondary Alexa Fluor 488 and 594 antibodies, respectively. Cells that were both transfected and infected were selected for analysis, the viral immediate early protein ICP4 was used as a marker for infection. Images were taken with Zeiss LSM 510 confocal microscope.
54 mutants that fail to form filaments in vitro are able to form PRS-like foci in transfected
cells. Consistent with previous results, Vero cells transfected with WT or mutant
versions of ICP8 displayed diffuse nuclear staining (Figure 3.6 panels A-E); however, in
cells co-transfected with WT or mutant versions of ICP8 and helicase-primase, only
ICP8 WT was capable of forming PRS-like structures (Figure 3.6F). The four ICP8
mutants tested exhibited a diffuse distribution even in the presence of the helicase-
primase complex (Figure 3.5 G-J). Taken together these experiments suggest that the
ability to form filaments in vitro correlates with the formation of PRS-like foci and replication compartments.
HSV-1 helicase primase complex (UL5/8/52) interacts with ICP8 mutants
The ability of PRS-like foci to form in cells transfected with four viral proteins may reflect the fact that ICP8 can interact directly with the helicase-primase holoenzyme
(Hamatake, Bifano, Hurlburt, and Tenney 1997b; Falkenberg, Elias, and Lehman 1998).
The inability of mutant ICP8 to form PRS-like foci and RCs might suggest that mutant
ICP8 proteins do not interact with the helicase-primase, To test this hypothesis we used surface plasmon resonance to measure binding of purified WT or mutant (FNF, FW, and
FW-FNF) ICP8 protein to helicase primase. WT and mutant ICP8 proteins were immobilized on a biosensor chip, and UL5/8/52 was injected over the chip at various concentrations (25, 50, 100, 200, 400 nm). Figure 3.7 shows that WT and mutant forms of ICP8 both could interact with UL5/8/52. A negative control, BSA exhibited no binding
(data not shown). The binding data were analyzed at various concentrations of
UL5/8/52 and globally fitted using a 1:1 Langmuir binding model. A summary of the
55 250 250
200 WT 200 FNF
150 400 nM 150
400 nM 100 200 nM 100 100 nM 200 nM 50
Response (RU) 50 Response (RU) 50 nM 100 nM 50 nM 25 nM 25 nM 0 0
-50 -50 -50 0 50 100 150 200 250 300 350 400 -50 0 50 100 150 200 250 300 350 400 Time (Sec) Time (Sec) ka (1/Ms) kd (1/s) KD (M) ka (1/Ms) kd (1/s) KD (M) 2.1 x 104 0.0016 7.6 x 10-8 2.6 x 104 0.0047 1.8 x 10-7
250 300 200 250 FW FW-FNF 200 150 400 nM 150 100 400 nM 100 200 nM 200 nM
Response (RU) 100 nM 50 100 nM 50 50 nM 50 nM Response (RU) 25 nM 25 nM 0 0
-50 -50 -50 0 50 100 150 200 250 300 350 400 -50 0 50 100 150 200 250 300 350 400
Time (Sec) Time (Sec)
ka (1/Ms) kd (1/s) KD (M) ka (1/Ms) kd (1/s) KD (M) 1.3 x 104 0.0013 9.9 x 10-8 1.5 x 104 0.0018 1.2 x 10-7
Figure 3.7. Helicase-primase complex (UL5/8/52) interacts with wild type and FNF, FW, and FW-FNF mutant protein. SPR sensorgrams of increasing concentrations of UL5/8/52 (25, 50, 100, 200, 400 nM) were performed using a BiacoreT200 at room temperature. The colored lines represent the binding of the analyte (UL5/8/52) at different concentrations over the specified ligand. The black lines represents the data fitted using1:1 langmuir model,which was used to calculate the kinetic parameters of the reactions as summarized under each of the sensogram. binding parameters is shown under each sensogram (Figure 3.7). ICP8 WT and FW
mutant interact with UL5/8/52 with comparable affinities with dissociation constants (KD)
of 7.6 x 10-8 M and 9.9 x 10 -8 M, respectively. FNF and FW-FNF displayed slightly
-7 -7 weaker binding affinities to helicase-primase, (KD = 1.8 x 10 M and 1.2 x 10 M, respectively). The fact that all three mutants bind helicase-primase with comparableaffinities indicates that the inability of these mutant proteins to form PRS and RCs is not due to loss of interaction with helicase-primase.
DISCUSSION
In this chapter, we report that two motifs in the ICP8 protein, FNF motif 1142-1144 in
the C-terminus and the FW motif at residues 843 and 844 in the so-called hydrophobic
head region, are important for filament formation and for progression of HSV infection.
Recombinant mutant proteins bearing alanine substitutions in the FNF and FW motifs
are unable to assemble into filaments in vitro. In addition, the FNF and FW mutants
exert a dominant negative inhibitory effect on viral growth and on the ability of WT ICP8
to form filaments in vitro. On the other hand a double mutant bearing both the FNF and
FW mutations had no effect on WT growth or filament formation. These results suggest
that the single mutants are capable of creating non-productive oligomers that interfere
with the ability of WT ICP8 to form filaments; whereas, the double mutant lacks the
ability to form ICP8-ICP8 interactions and was therefore not able to incorporate into a
growing WT ICP8 filament. This result supports our hypothesis that the FNF motif is
able to dock into the hydrophobic head region containing the FW motif. Mutants that fail
to form filaments in vitro also fail to complement the growth of an ICP8 null virus or to
57 form PRS-like and replication compartments. ICP8 mutants that fail to form PRS-like
structures can still interact with the helicase-primase complex, suggesting that the
failure to form PRS is not due to the inability of mutant ICP8 protein to interact with
helicase/primase. Taken together, these results suggest that the FNF and FW motifs
define ICP8 self-interaction sites required for filament formation and for ICP8 to
reorganize the nucleus of the infected cell to form PRS and RCs.
Previously, several functions have been mapped to the C-terminus of ICP8: an NLS
was mapped to the C-terminal 28 residues (Gao and Knipe 1993) and the region between amino acid residues 1080-1135 was implicated in interactions with viral or cellular factors required for replication compartment formation (T. J. Taylor and Knipe
2003); however, a detailed biochemical analysis of mutations in this region has never been performed. In this study we extend the characterization of this region and show that in addition to affecting replication compartment formation, the FNF motif is involved in ICP8 self interactions that are required for filament formation.
ICP8 is known to form two types of filaments in vitro, double helical filaments that form in the absence of DNA (Makhov et al. 2009) and a single helical filament on ssDNA
(Makhov and Griffith 2006). A double helical filament might be expected to be stabilized by two types of interactions, longitudinal interactions between adjacent subunits in each filament and lateral interactions between adjacent filaments. The inability of the FNF and FW mutants to form filaments and the trans-dominant inhibition of filament
formation when mixed with WT ICP8 are consistent with a role for the FNF and FW
58 motifs longitudinal interactions in filament formation. The simplest explanation for these
results is that the FNF motif docks at the FW motif in an adjacent ICP8 molecule to form
a linear filament.
Spatial organization within cells is critical for the control of the diverse metabolic
activities necessary for cell survival, and subcellular compartmentalization provides
boundaries that facilitate regulation of biological processes. Some processes are
regulated by the sequestration of components away from one another, while in other
cases it is beneficial to concentrate components that catalyze essential reactions.
Although some cellular compartments are defined by membrane enclosure, it is becoming increasingly clear that many important subcellular compartments are not membrane limited. For instance, in the nucleus, many varieties of membrane-less sub- organelles are known to play important roles in the special and temporal organization of macromolecules, including PML-nuclear bodies, speckles and nucleoli (Kevin Van
Bortle 2012). The mechanisms by which proteins and nucleic acids are recruited to form
these non-membrane-delimited microenvironments are poorly understood; however, it
appears that their formation may be caused by low-affinity, multivalent interactions
between components (Brangwynne et al. 2009; Brangwynne 2013; Hyman, Weber, and
Jülicher 2014; C. F. Lee et al. 2013). Proteins and nucleic acids in these sub-organelles
remain dynamic and mobile, facilitating rapid responses to various types of stimuli.
Viruses that replicate in the nucleus have evolved surprisingly efficient mechanisms to
form compartments within the densely crowded nuclear environment, which is critical for
59 the establishment of productive infection. The formation of viral subassemblies such as
PRS and RCs may be driven by similar biophysical principles to those that influence the
assembly of membrane-less organelles. In this chapter we have established that the ability of ICP8 protein to form filaments in solution is correlated with the formation of
PRS-like foci and RC. We propose that dynamic self-interactions between ICP8 monomers may facilitate the formation of a scaffold on which PRS and RCs can form.
The ability of ICP8 to undergo conformational changes upon binding to other HSV proteins and/or to DNA has been known for some time (Dudas, Scouten, and Ruyechan
2001; Uprichard and Knipe 2003a). Uprichard et al. showed that reactivity to a conformation specific monoclonal antibody (39S) changes during infection (Uprichard and Knipe 2003a). Our transfection experiments indicate that co-expression of ICP8 with helicase/primase leads to the formation of small punctate foci that resemble PRS, while the addition of polymerase and UL42 results in the formation large globular RCs
(Lukonis and Weller 1997). Taken together these results suggest that ICP8 is dynamic and takes on different conformations depending on the presence of other replication proteins. It will be important to determine whether the dynamic nature of ICP8 interactions with itself, with other viral and cellular proteins and with nucleic acids are similar to the weak multivalent interactions that contribute to phase separations and the formation of membrane-less globular domains.
60 Chapter 4
ICP8 Mutant Q706A-F707A Can Assemble Pre-replicative Like Sites Although
Fails to Form Replication Compartments.
Jonathan Helmus contributed to Figure 4.1; he performed the bioinformatics analysis and helped identify predicted protein interaction sites on ICP8. All other work in this chapter was done by A.S.D
61 ABSTRACT:
ICP8 is an essential multifunctional protein that interacts with both viral and cellular proteins during the course of an HSV-1 infection. However, the protein interaction sites on this protein are completely unknown. In this study we attempted to identify residues on ICP8 that might be involved in protein-protein interactions. Using the structural information of ICP8 and sequence comparison with homologous proteins, we identified a cluster of six conserved amino acids (R644, D645, N882, L883, D905 and Y909) in the head region of ICP8 and another set of conversed residues in the shoulder region
(R262, H266, D270, E271, E274, Q706 and F707) that might function as protein interaction sites. We tested these sites by constructing alanine mutations in these residues and testing pairs of mutations for complementation of an ICP8 null virus, replication compartment formation, and assemble into pre-replicative like sites. Several mutations were identified that disrupted ICP8 function; we focused on the Q706A-
F707A (QF) mutation. The QF mutant protein is able to form pre-replicative like sites and bind ssDNA but does not complement ICP8 null virus for growth and replication compartment formation. Our characterization suggests the Q706 and F707 residues are involved in an important interaction that is required for the progression to mature replication compartments.
62 INTRODUCTION
The HSV-1 replication proteins have long been identified although a full understanding of the orchestration of protein assembly through protein-protein interactions to form replication compartments and assemble the replication fork is still lacking. In this study we have chosen to focus on identifying protein interaction sites on
ICP8, the ssDNA binding protein. ICP8 is an essential protein for viral DNA replication and has multiple roles in the viral life cycle; a list of ICP8’s viral interaction partners is summarized in Table 4.1. In addition to its single strand DNA binding property, ICP8 can stimulate the helicase unwinding activities of UL9 and the helicase-primase activity of
UL5/8/52 and can regulate polymerase activity (Hamatake, Bifano, Hurlburt, and Tenney
1997b; Boehmer and Lehman 1993b; Ruyechan and Weir 1984). Mapping the interaction domains of ICP8 with the UL5/8/52 complex and with UL9 is of considerable interest, because it will improve our understanding of how proteins are assembled and released at the replication fork, and might facilitate the design of new antiviral therapies. Furthermore,
ICP8 interacts with UL12 to form a two-subunit recombinase that can mediate strand exchange reactions (Reuven et al. 2004; Reuven, Antoku, and Weller 2004). It is also of interest to map the ICP8-UL12 interaction because it will improve our understanding of
HSV-1 recombination-mediated replication.
In our previous study, we identified two motifs involved in ICP8-ICP8 self-interactions and filament formation. One interaction motif, 1142-1144FNF (FNF motif), was located
63 Table 4.1 Partial list of HSV-1 proteins reported to interact with ICP8
HSV-1 proteins that Assay used for Reference interact with ICP8 identifying this interaction
UL9 Protein affinity (Boehmer & Lehman, chromatography 1993)
UL5/8/52 SPR (Falkenberg, Elias, & Lehman, 1998)
UL12 Co-IP from infected cell (Thomas, Gao, Knipe, & lysate Powell, 1992)
UL 42 Co-IP from infected cell (Taylor & Knipe, 2004) lysate
ICP4 Co-IP from infected cell (Taylor & Knipe, 2004) lysate
ICP27 Co-IP from infected cell (Zhou & Knipe, 2002) lysate
64 in the C-terminal 60 amino acids and the other was located in a hydrophobic pocket formed by residues F843 and W844 (FW motif). Our data supports the hypothesis that the FNF motif docks in the FW motif of an adjacent ICP8 molecule to form the longitudinal interactions of a linear ICP8 filament (Darwish et al. 2016). ICP8 is likely to
have additional motifs involved in horizontal self-interactions that stabilize the bilateral
double filament.
We are interested in uncovering more ICP8-ICP8 interaction sites and mapping
residues on ICP8 involved in interactions with the other essential replication proteins. In
addition to viral replication proteins, ICP8 interacts either directly or indirectly with at
least 50 cellular proteins (T. J. Taylor and Knipe 2004), however no residues on ICP8
have been identified as specific interaction sites with any of its partners. In this study,
we used a bioinformatic approach to search for potential protein interaction sites on
ICP8 and identified a cluster of six conserved amino acids (R644, D645, N882, L883,
D905 and Y909) in the head region of ICP8 and another set of conversed residues in
the shoulder region (R262, H266, D270, E271, E274, Q706 and F707). We discovered
that Q706 and F707 amino acid residues are essential for viral growth and are required
for the formation of mature replication compartments. However, the Q706A-F707A
mutant did not disrupt ICP8 ability to from pre-replicative like structures. Further
experimentation is required to identify the functional role of Q706 and F707 residues in
the formation of replication compartments and to identify proteins that are interacting
with ICP8 through those residues to mediate this process.
65 RESULTS
Identifying potential protein interaction sites on ICP8
Mapelli et al. suggested several possible protein interaction sites on ICP8 based on the
protein structure including two conserved pockets (Y20, F61, Y90) and (C116, R120),
as potential protein interaction sites (Mapelli, Panjikar, and Tucker 2005). We
incorporated their suggestions and also conducted a further in-depth sequence analysis
to generate additional potential protein interaction sites.
We conducted a sequence alignment of ICP8 orthologues from representatives of three sub families of Herpesviridae, listed in table 4.2, using the t-coffee multiple sequence alignment program developed by (Notredame, Higgins, and Heringa 2000). This analysis revealed 227 conserved residues in ICP8. We then selected residues that were exposed within 10 Ų from the surface using Pymol and excluded residues that have known functions or are predicted to be involved in ssDNA binding. At the end of our selection, our criteria resulted in 50 candidate residues for potential protein interaction sites. We chose to initially focus on residues that were in close proximity to other conserved residues and formed a small cluster on the surface of the protein, which could potentially act as a protein interaction site (Figure 4.1).
Using this analysis we identified a group of six conserved amino acid residues (R644,
D645, N882, L883, D905 and Y909) in the head region of ICP8, shown in green in Figure
66
Table 4.2 ICP8 orthologues from the following Herpesviridae viruses were used in a sequence alignment for identifying conserved residues in ICP8.
Alphaherpes viruses
Herpes Simplex Virus-1 (Strain KOS) Herpes Simplex Virus-1 (Strain 17) Herpes Simplex Virus-2 Varicella Zoster Virus Mareks Virus Bovine Herpesvirus 1
Betaherpes viruses
Roseolovirus HHV-7 Muromegalovirus MCMV Cytomegalovirus HCMV
Gamma viruses
KSHV Kaposi’s Sarcoma Associated Herpesvirus EBV Epstein-Barr Virus Alcelaphine herpesvirus 1
67 Figure 4.1 Predicted protein interaction sites annotated on ICP8. (A) Bottom and (B) side view of ICP8 (PDB ID 1URJ). The following residues are suggested to be involved in protein interaction; Magenta (Y20, F61, Y90), Cyan (C116, R120), Red (F827, F843, W844, L857, I865), Dark Blue (R262, H266, D270, Q706, F707, V710) and Green (R644, D645, N882, L883, D905, Y909). Amino acid residues predicted to be involved in the DNA binding activity and the zinc binding motif are represented in yellow and orange respectively.
68 4.1, these residues are situated on the side of the head region that is opposite to the FW
motif (shown in red). We also identified another group of seven-conserved amino acid residues (R262, H266, D270, E271, E274, Q706 and F707) located in the shoulder region of ICP8, as shown in dark blue Figure 4.1. These residues might appear to be distant from one another based on the primary sequence however the tertiary structural folds of ICP8 bring these residues in close proximity to one another.
To screen if these predicted protein interaction residues are significant targets that warrant further investigation, we paired up the conserved residues by proximity to one another and introduced alanine substitution mutations in the ICP8 mammalian expression vector, as detailed in the materials and methods. The mutants were screened for their ability to perform characteristic ICP8 functions such as; nuclear localization, formation of pre-replicative like structures, viral growth and formation of replication compartments.
Characterization of ICP8 head region mutants: (R644A-D645A), (N882A- L883A) and (D905A -Y909A)
The six conserved amino acids (R644, D645, N882, L883, D905 and Y909) in the head region of ICP8 were paired into three mutant constructs, R644A-D645A,
N882A-L883A, and D905A-Y909A. We then introduced double alanine mutations in the paired residue sites mentioned above and tested them for complementation with the ICP8 null virus to determine if these sites are significant for ICP8 function and
69 100
80
60
40
% Complementation
20
0
WT
C116A_R120A R262A_H266A R644A_D645A Q706A_F707A N882A_L883A
Y20A_F61A_Y90A
Figure 4.2 Transient complementation of ICP8 null virus by mutant expression plasmids ICP8 mutants Y20A-F61A-Y90A and Q706A-F707A completely fail to complement viral growth, whereas the remaining mutants exhibit varying degrees of complementation. Results are from 3 independent experiments.
70 viral growth. The R644A-D645A and N882A-L883A mutants both partially
complemented viral growth at values of 54% and 14% respectively (Figure 4.2). The
D905A-Y909A mutant failed to express a detectable level of protein and was
excluded from this study (data not shown).
As discussed previously in Chapters 1 and 3, ICP8 is essential for the formation of
the earliest detectable pre-replicative sites and can assemble into pre-replicative like
structures when transfected along with plasmids that express the UL5/8/52 complex.
ICP8 undergoes a specific change in conformation to form these pre-replicative sites
(Uprichard and Knipe 2003a). Furthermore, the ability to form these structures is correlated with ICP8 filament formation (Darwish et al. 2016). Therefore, testing the newly constructed ICP8 mutants for pre-replicative like structure formation can help identify mutants of potential interest.
We found that the R644A-D645A and N882A-L883A mutants were able to localize to the nucleus (Figure 4.3) and could still assemble pre-replicative like sites (Figure 4.4).
Furthermore, both mutants could also complement replication compartment formation in the context of a viral infection (Figure 4.5). These mutants appear to have a normal phenotype and will not be explored any further in this study; the decrease they exhibited in viral growth might be due to loss of an ICP8 function that is not involved in replication compartment formation.
71 WT Y20A_F61A_Y90A C116A_R120A R262A_H266A WT
R644A_D645A Q706A_F707A N882A_L883A
Figure 4.3 ICP8 mutant Y20A-F61A-Y90A failed to localize to the nucleus. Vero cells were transfected with the indicated ICP8 plasmid, after 20 hours post transfection cells were xed and stained with a primary ICP8 antibody and a secondary Alexa Fluor 488 antibody. Images were taken with Zeiss LSM 510 confocal microscope.
FNF FW_FNF
72 WT Y20A_F61A_Y90A C116A_R120A R262A_H266A
WT
R644A_D645A Q706A_F707A N882A_L883A
Figure 4.4 ICP8 Q706A-F707A forms pre-replicative like structures although it is unable to complement viral growth. Vero cells were transfected with the indicated ICP8 plasmid and (UL5/8/52). At 20 hours post transfection, cells were xed and stained with a primary ICP8 antibody and a secondary Alexa Fluor 488 antibody. Images were taken with Zeiss LSM 510 confocal microscope. FNF FW_FNF FNF
73 R644A-D645A Q706A-F707A Wild Type Y20A-F61A-Y90A R262A-H266A N882A-L883A
ICP8
ICP4
Merge
Figure 4.5 ICP8-QF was unable to complement replication compartment formation. Vero cells were transfected with ICP8 WT or the indicated mutant plasmid. At 16 hours post-transfection cells were infected with an ICP8 null virus (MOI=20). At 6 hours post-infection cells were xed and stained for ICP8 and ICP4 with secondary Alexa Fluor 488 and 594 antibodies, respectively. The immediate early protein ICP4 was used as a marker for infection. Only cells that contained both ICP4 and ICP8 were selected for analysis. Images were taken with Zeiss LSM 510 confocal microscope.
74 Characterization of shoulder region mutants: (Y20A-F61A-Y90A), (C116A-R120A),
(R262A-H266A), (D270A, E271A, and E274) and (Q706A-F707A).
Several protein interaction sites have been proposed in the shoulder region of ICP8;
Mapelli et al. predicted two interaction pockets Y20-F61-Y90 and C116-R120, and our analysis predicted a set of conserved residues (R262, H266, D270, E271, E274,
Q706 and F707). We again used the strategy of pairing residues and constructing alanine substitution mutations in these sites. Given the close proximity of (D270,
E271, and E274) to the other conserved residues in this region we choose to postpone studying them to minimize the size of the screen. We initially focued our efforts on R262A-H266A, Q706A-F707A and the pockets predicted by Mapelli et.al
2005.
The four mutant constructs made in the shoulder region were tested for complementation of an ICP8 null virus. Two of the mutants, Y20A-F61A-Y90A and
Q706A-F707A, completely failed to complement viral growth, whereas the other two mutants C116A-R120A and R262A-H266A complemented viral growth at 70% and
14%, respectively (Figure 4.2). To further characterize the mutants that did not complement, we tested if these mutants were correctly localized in the nucleus. We found that all of the mutants except for Y20A-F61A-Y90A localized to the nucleus; the
Y20A-F61A-Y90A mutant was predominantly detected in the cytoplasm (Figure 4.3).
The nuclear localization signal (NLS) of ICP8 is in the 28 C-terminal residues of the protein. However, removal of residues between 17-600 has been shown to affect nuclear localization, perhaps by affecting protein conformation or the global folding of
75 the protein (Gao and Knipe 1992a). The Y20-F61-Y90 pocket might be a distal site involved in nuclear localization, or perhaps mutating these residues caused global misfolding of the protein and it could not be transported to the nucleus; therefore, this mutant was excluded from further analysis.
We next asked if the remaining ICP8 mutants could assemble into pre-replicative like structures when transfected along with the helicase-primase complex. We found that
(C116A-R120A) and (R262A-H266A) mutants, which were also capable of partially
complementing an ICP8 null virus, could assemble into pre-replicative like structures.
However, the Q706A-F707A mutant that failed to complement viral growth was still able
to assemble into pre-replicative like structures as shown in Figure 4.4. This indicates
that the Q706A-F707A mutation did not affect the structural integrity of ICP8 or its ability
to form pre-replicative like structures.
We then tested the mutant constructs for their ability to form replication compartments in
the context of a viral infection. We found that all of the mutants analyzed were able to
form replication compartments except for Q706A-F707A, as shown in Figure 4.5. The
Q706A-F707A mutant may have lost a critical protein interaction partner or a functional
property of ICP8 required for progression into mature replication compartments.
Given the unique phenotype of Q706A-F707A we revisited the shoulder region of ICP8
and made additional alanine substitution mutations in the conserved neighboring
residues D270, E271 and E274. The new mutants were then tested for their ability to
76 complement the growth of an ICP8 null virus (Figure 4.6). The E274A mutant had the
most significant effect on viral growth and completely failed to complement; whereas,
D270A and E271A could both partially complement viral growth. However, a double mutant D270A-E271A or triple mutant D270A-E271A-E274A that combines these mutated residues together resulted in complete inhibition of viral growth (Figure 4.6).
These three residues warrant further investigation, they might be part of the same motif as Q706A-F707A or they might have an independent function. It appears that E274 is the more significant residue and D270 and E271 might have more of a supporting role.
More experiments need to be conducted to further characterize the phenotype of these mutants and to understand their role in the HSV-1 life cycle.
ICP8 Q706A- F707A mutant can still bind to ssDNA
ICP8 is an efficient ssDNA binding protein, and probably interacts with other viral and cellular proteins while bound to or in close proximity to DNA. It is possible that the
Q706A-F707A phenotype observed might be caused by the loss of ssDNA binding.
Therefore, before attempting to identify a viral or cellular partner that might be binding
ICP8 at this site, it was important to test the mutant for ssDNA binding.
77 100
80
60
40
% Complementation % Complementation 20
0
WT
D270A E271A E274A
D270A_E271A
D270A_E271A_E274A
Figure 4.6 Transient complementation of ICP8 null virus by D270A, E271A and E274A mutant expression plasmids. ICP8 mutant E274A is unable to complement viral growth, but ICP8 mutants D270A and E271A can partially complement. Combinations of D270A, E271A and E274A can result in a drastic reduction in viral growth.
78 The Q706A-F707A mutant was purified from insect cells infected with a recombinant
baculovirus as previously described (Darwish et al. 2016). The mutant was stable and
behaved similarly to wild type ICP8 during the purification. A Coomassie stained gel of
the Q706A-F707A mutant and wild type ICP8 is shown in (Figure 4.7A).
We then used an electrophoretic mobility shift assay (EMSA) to test whether the mutant could still bind to ssDNA. In this assay, wild type or mutant ICP8 protein was incubated with a Cy3-labeled 50-nt oligomer, and the reaction products were resolved by 5% nondenaturing PAGE (Figure 4.7B). Similar to the wild type, Q706A-F707A bound ssDNA in a concentration dependent manner and displayed a faster and slower migrating band pattern, which is characteristic of cooperative binding.
At the higher concentration of 400 nM Q706A-F707A is almost exclusively found in the slower migrating band, perhaps this mutant has higher DNA binding affinity or a stronger tendency to bind cooperatively. This observation requires further investigation and more quantitative experiments.
DISCUSSION
In this study, we conducted a small mutational screen of ICP8 with the aim of identifying residues that might be involved in protein interactions. We embarked on this study without a specific protein interaction target of ICP8 in mind; hence we used broad based functional assays of ICP8 such as complementation of viral growth of an ICP8 null virus, assemble of pre-replicative like structures and formation of replication compartments to
79 ICP8 Q706A_F707A Ladder 250 150 100 75
50
37
ICP8 Q706A_F707A
0 50 100 200 400 50 100 200 400 nM
Figure 4.7 ICP8 QF mutant retains the ability to interact with ssDNA (A) ICP8 wild type and the Q706A_F707A mutant were expressed and puri ed from Sf9 insect cells infected with recombinant baculoviruses and puri ed as described in Materials and Methods. Puri ed proteins were resolved by 8% SDS-PAGE and stained with coomassie blue. (B) ICP8 wild type or Q706A_F707A were incubated at the following concentrations (0, 50, 100, 200, or 400nM) with 100 nM of 5’ uorescein-labeled 50 nt length ssDNA substrate for 30 min and the complexes were separated on 5% nondenaturing polyacrylamide gels. ICP8-QF was able to bind DNA cooperatively and was comparable to WT. The signal was detected using Bio Rad Chemi-Doc MP imaging system.
80 screen mutants for anomalies that might indicate loss of an important protein-protein interaction. We generated a list of potential protein interaction residues by following a mutational design strategy that focused on conservation of residues and their proximity to the surface. This selection criterion resulted in 50 potential residues; we focused our initial efforts on six residues in the shoulder region and four residues in the head region of ICP8 because those residues were in close proximity to one another and formed small clusters. Furthermore, we tested two protein interaction pockets (Y20A-F61A-
Y90A) and (C116A-R120A) predicted by Mapelli et. al (Mapelli, Panjikar, and Tucker
2005). The phenotypes of all the mutants tested in this study are summarized in Table
4.3; we were particularly interested with the phenotype displayed by the Q706A-F707A
ICP8 mutant. This mutant was not able to complement viral growth of an ICP8 null virus or form replication compartments, although the Q706A-F707A mutant retained the ability to bind ssDNA and could still assemble into pre-replicative like structures when co-transfected with the helicase-primase complex. Q706A-F707A is the first ICP8 mutant identified that is able to form pre-replicative like structures but not complement the growth of the virus and progress into mature replication compartments. ICP8 is thought to undergo a conformational change that coincides with the assembly of pre- replicative sites (Uprichard and Knipe 2003b). It appears that the Q706A-F707A mutant has maintained the ability to commence this conformational change, although further investigation with ICP8 specific conformation antibody 39S is required to confirm this.
Our work has also correlated pre-replicative site formation with ICP8 filament formation, as discussed in chapter 3. It would be of interest to determine if recombinant purified
Q706A-F707A mutant protein could interact with itself to assemble filaments.
81 Table 4.3 Characterization of ICP8 mutants
ICP8 Mutant Transient %Viral Nuclear Formation Formation of Protein Growth localization of Pre- Replication expression replicative compartments in Vero Cells like sites as detected by Western Blot
ICP8 wild type Yes 100 Yes Yes Yes
Y20A-F61A- Yes 0 No No No Y90A
C116A- R120A Yes 70 Yes Yes Yes
R262A-H266A Yes 14 Yes Yes Yes
R644A-D645A Yes 54 Yes Yes Yes
Q706A-F707A Yes 0 Yes Yes No
N882A-L883A Yes 14 Yes Yes Yes
D905A-Y909A No N/A N/A N/A N/A
82 Although evidence is preliminary, Q706A-F707A might be binding ssDNA with higher
affinity than wild type ICP8. It would be of interest to further quantify the ssDNA binding
affinity of this mutant, an increase in binding affinity might explain why Q706A-F707A is
unable to complement viral growth. It is possible that Q706A-F707A binds DNA too
strongly to be easily removed from DNA during the progression of the replication fork.
This mutation might also cause ICP8 to be stuck in a conformation that can bind DNA
but is unable to interact with UL9 to form the co-complex that is involved in unwinding
the origin of replication or to stimulate the helicase –primase activity of the UL5/8/52
complex. Furthermore, the tight DNA binding exhibited by this mutant might also
interfere with ICP8 annealing activity. All of these suggestions are still highly
speculative and require much further investigation into the DNA binding affinity of
Q706A-F707A and conducting the proper functional biochemical assays.
It would be of interest to explore proteins that are known to both interact with ICP8 and are involved in the early steps of pre-replicative site assembly. Such candidates include the immediate early proteins ICP4 and ICP27 as well as early proteins UL9 and
UL/5/8/52. This study was successful in identifying residues of potential interest in ICP8, although much further investigation into the phenotype of Q706A-F707A is required to provide an understanding of the exact role of these residues. Furthermore, the D270,
E271 and E274 residues are promising candidates for further investigation. Our initial analysis has shown that mutations in these sites drastically effect the complementation of an ICP8 null virus. The close proximity of these residues to Q706A-F707A might indicate that they are either a part of this motif or they might have a supporting
83 functional role. More work is needed in characterizing the phenotype of these mutants and understanding their involvement in the HSV-1 life cycle.
84 Chapter 5
Summary and Perspectives
The HSV-1 ssDNA binding protein, ICP8, has numerous roles during HSV-1
replication and is a central component of replication compartment formation. ICP8 and
the other viral replication proteins have been studied for several decades and much
progress has been made; although, a full understanding of the DNA replication
mechanism is still lacking. Moreover, a complete picture of how proteins are recruited to
assemble the prereplicative scaffolds that mature into replication compartments is also
not clear. To address some of these gaps in our knowledge we focused our efforts on
understanding the protein interaction interface of the ssDNA binding protein. We were
particularly interested in exploring ICP8 self-interactions that are involved in filament
formation. ICP8 double helical protein filaments are expected to have both lateral and
linear self-interactions that are involved in stabilizing the filament.
The work presented in this thesis addressed the biological role of DNA independent
ICP8 filaments and successfully mapped the linear protein interaction sites between two
adjacent ICP8 molecules. Our findings established a correlation between ICP8
filamentation and the formation of replication compartments. Furthermore, we were able to make predictions about ICP8’s interaction surface and identified several potential protein interaction sites. The mutants identified in this work have potentially opened the door to expanding our understanding of ICP8’s protein interactions and functions.
85
ICP8 filament formation is required for replication compartment formation in HSV
Most viruses reorganize the cellular space to maximize their own productive efficiency,
usurp cellular recourses and evade the host defense response. Viruses have evolved to
form complex molecular assembles in either the cellular or nuclear space referred to as
either replication compartments/ centers/ complexes, virus factories or viroplasms.
These macromolecular assemblies create a space in which viral replication proteins can
be concentrated with viral genomes, host proteins required for replication while also
being physical separated from the cellular antiviral defenses.
Viruses that replicate their genomes in the cytoplasmic space form replication
compartments that require changes in the distribution and dynamics of the cytoskeleton
along with reorganization of organelles such as the Golgi apparatus, endoplasmic
reticulum, endosomes, lysosomes and mitochondria (Schmid et al. 2014). Some
positive-strand RNA viruses for instance, create single or double membranous
replication compartments in the cytoplasm (Paul and Bartenschlager 2013). On the
other hand, DNA viruses that replicate in the nucleus do not form membrane bound
compartments although they require reorganization of the nucleus in several different
ways such as redistribution of chromatin, nuclear domains (ND-10), Cajal bodies (CB) and the nucleolus (Schmid et al. 2014).
86 As discussed in Chapters 1 and 3, HSV-1 causes dramatic reorganization of the nuclear
space and forms membrane-less replication compartments. The first aim of this thesis
was focused on understanding the involvement of ICP8 filaments in the formation of
replication compartments. ICP8 is known to form at least two types of filaments; it can
form single helical filaments on ssDNA and it can also form double helical filaments in
the absence of DNA. We were interested in exploring the biological significance of
ICP8’s self-interactions that are involved in filament formation. Our work established a correlation between ICP8 filament formation and replication compartment formation.
ICP8 filaments might be involved in acting as a scaffold that stores and recruits factors
that are important for DNA replication. It is important to note that our cell-based
experiments could not discriminate between the two different types of ICP8 filaments.
More work is still needed in this area and both types of filaments are likely to be
involved in replication compartment formation.
ICP8 filament formation is not unique among ssDNA binding proteins in the
Herpesviridae family. ICP8 homologs BALF2 and ORF6, Epstein-Barr virus (EBV) and
Kaposi’s sarcoma-associated herpesvirus (KSHV) ssDNA binding proteins, respectively,
also form DNA-free helical protein filaments (Ozgur, Damania, and Griffith 2011;
Mumtsidu, Makhov, and Konarev 2008). BALF2 and ORF6 are also important components of replication compartment formation (Daikoku et al. 2005; F. Y. Wu et al.
2001). These systems have not been studied as well as HSV-1; therefore, our observations about ICP8 filament formation may lead the path to understanding filamentation in other members of the Herpesviridae family as well.
87 Moreover, the possible involvement of protein filaments or fiber like structures in manipulating the nuclear space is not only observable in HSV-1. Other viruses such as
Adenoviruses have been reported to employ nuclear fiber-like structures, formed by
E1B-55K and E4-ORF3 proteins, to create a multivalent scaffold that disrupts and usurps SUMO2/3 interactions thereby transforming the nucleus and forming compartmentalized viral genome domains (Ou et al. 2012).
There are still many unanswered questions regarding the role of filamentation in HSV-1 replication compartment formation. We were only able to correlate filaments with replication compartment formation; however, we do not know if DNA independent filaments of ICP8 can be visualized within these structures. We also do not understand all the elements that are driving the formation of replication compartments within the nucleus. We demonstrated that ICP8 self-interactions are important but have not shown that these are sufficient. It will be of considerable interest to determine whether additional factors are required for ICP8 to adopt the conformations that are observed in pre-replicative sites and replication compartments. In vitro experiments using purified
ICP8 protein showed that ICP8 could assemble into filaments without the assistance of any other proteins. However, pre-replicative-like sites in a cell are efficiently generated when the helicase-primase complex accompanies ICP8. In chapter 3 we showed that mutants in the FNF and FW motifs of ICP8 can still interact with the helicase-primase complex but failed to generate pre-replicative like sites, suggesting that both ICP8 self interactions and ICP8’s interaction with the helicase-primase complex are required simultaneously for the generation of pre-replicative-like sites.
88 The earliest detectable viral structures in a cell after infection are small foci containing the immediate early proteins ICP4 and ICP27. The earliest detectable ICP8 containing pre-replicative sites form adjacent to the ICP4/ICP27 foci and the formation of ICP8 pre- replicative sites is severely reduced in the presence of an ICP4 mutant that fails to oligomerize on viral DNA (Livingston et al. 2008). It would be of interest to further explore the relationship between ICP4 and ICP8 during these early stages. Is there a connection between ICP4 oligomerization and ICP8 filamentation? ICP8 is also known to physical interact with both ICP4 and ICP27; it would be of interest to test if the FNF and FW motifs are somehow involved in this interaction.
Identification of potential protein interaction sites on ICP8
The second aim of this thesis focused on identifying protein interaction sites on ICP8.
The HSV-1 ssDNA binding protein has been studied for several decades but no protein interaction motifs have been mapped on ICP8. This is mostly attributed to ICP8’s noncontiguous structure, residues in ICP8 that are seemingly distant in the linear sequence can be close to each other in the tertiary structure, thus past efforts at making deletions and truncations in this protein have not been very informative. In order to map residues involved in protein –protein interactions, we decided to make predictions based on identifying conserved residues on the surface of the protein. In chapter 4, we reported a cluster of six conserved amino acids (R644, D645, N882, L883, D905 and
Y909) in the head region of ICP8 and another set of conversed residues in the shoulder region (R262, H266, D270, E271, E274, Q706 and F707). The Q706-F707 (QF)
89 residues displayed the most striking phenotype of all of the mutants tested. This mutant
was able to assemble into pre-replicative-like sites and could still bind ssDNA but was
unable to complement the growth of an ICP8 null virus.
The QF mutant is the first isolated mutant of ICP8 that preserves the ability to assemble
into pre-replicative-like structures while also failing to complement HSV-1 growth. This
suggests a partially functional ICP8 mutant that has maintained some critical functions
of the protein while also losing a vital property. There are several possibilities that could
explain this phenotype; perhaps QF is unable to interact with or stimulate the function of
a critical viral protein partner or an unknown cellular partner. This mutant may have also
lost an intrinsic functional property of ICP8 required for the progression of viral DNA
synthesis and full replication compartment formation.
ICP8 is known to be involved in many aspects retaining to HSV-1 replication. It is
involved in unwinding the origin of replication with UL9 and it is also required to
stimulate the helicase-primase activity of UL5/8/52. Furthermore, ICP8 is involved in
stimulating the polymerase activity of UL30 and is required for the elongation of newly
synthesized DNA. Additionally, ICP8 has annealing activity and functions as a two-
subunit recombinase with the virally encoded exonuclease, UL12 (Reuven et al. 2003;
Reuven et al. 2004; Dutch and Lehman 1993). All of the functions of ICP8 listed above are very important but no residues on ICP8 have been specifically mapped as responsible for these functions. The QF mutant might provide an opportunity for us to map an important ICP8 functional domain.
90 Since the completion of the work described in Chapter 4, additional studies from the
Weller lab have shown that the QF mutant preserved the ability to assemble into DNA
independent filaments (Weerasooriya, unpublished). This result suggests that the QF
mutant is not involved in ICP8 self-interactions required to form filaments in the absence
of DNA. Additionally, the functional relationship between QF and the other viral
replication proteins was explored. WT ICP8 has been shown to stimulate ssDNA
dependent ATPase activity of UL9, the origin unwinding protein (Boehmer 1998).
Interestingly QF resembled WT in its ability to stimulate UL9 (DiScipio, unpublished).
This finding indicates that the QF mutant protein is probably capable of interacting with
UL9, although the interaction between these two proteins was not tested directly.
Furthermore, the QF mutant retained the ability to function as a ssDNA binding protein and could cooperatively bind to a ssDNA template. This mutant could also stimulate in
vitro DNA synthesis of a mini circle DNA template in a reaction along with the viral
helicase-primase complex and the polymerase complex. The levels of DNA synthesis
observed in this assay were similar to those of wild type ICP8 (Weerasooriya,
unpublished). Interestingly, HSV-1 infected cells showed that this mutant does not have
any traces of viral DNA synthesis (Weerasooriya, unpublished). It is important to note
that the mini circle assay does not require UL9 and the DNA template used in this
reaction do not have a viral origin of replication. Origin dependent DNA replication of
HSV-1 has never been recapitulated in vitro. The mini circle assay is the best available option for testing HSV-1 replication proteins for in vitro DNA synthesis. QF’s ability to
stimulate DNA synthesis with the mini circle assay indicates that this mutant has
91 retained the ability to stimulate both the helicase-primase complex and the polymerase
complex. Although, the possible involvement of QF during the early initiation steps of origin unwinding has not been tested. As discussed in chapter 1, ICP8 plays an important role during origin unwinding with UL9. Electron microscopy experiments have reported that UL9 and ICP8 can unwind a plasmid containing an HSV-1 origin
(OriS)(Makhov et al. 2003). It may be of interest to test if QF and UL9 could unwind an
OriS containing plasmid. A deficiency during this step might explain the failure of the QF mutant to complement an ICP8 null virus and it’s inability to produce viral DNA in the context of an infection. However, QF’s ability to successfully stimulate UL9’s ATPase activity is a promising indicator that it might be able to unwind an OriS containing plasmid.
As mentioned earlier, ICP8 is also known to function as an annealase and is thought to form a two-subunit recombinase with UL12, the viral exonuclease (Reuven et al. 2003;
Reuven et al. 2004; Dutch and Lehman 1993). Recombination is thought to play a role during HSV-1 replication because the DNA product is a highly branched and longer than
unit length concatemer (reviewed in ((Wilkinson and Weller 2003; Weller and Sawitzke
2014)). The annealing property of QF was tested and the mutant failed to stimulate an
annealing reaction between two complementary strands of DNA (Weerasooriya,
unpublished). It would be of interest to determine the mechanism by which the QF motif
is involved in the annealing reaction.
Furthermore, the FNF and FW mutants are also deficient in annealing activity (Grady,
unpublished). The inability of FNF and FW mutants to anneal may be attributed to their
92 lack of cooperative binding on ssDNA or due to the involvement of these motifs in filament formation. However, we only explored FNF and FW mutants for filament formation in the absence of DNA. It would be of interest to test FNF and FW for filament formation on ssDNA and to monitor the annealing reaction under electron microscopy because ICP8 filament formation on ssDNA has been shown to be an intermediate in the annealing reaction (Makhov and Griffith 2006).
We have identified three ICP8 mutants that completely fail to complement viral growth and also fail to stimulate an annealing reaction. Are all three of these ICP8 motifs involved in annealing? A further in depth analysis is required to understand the steps involved in ICP8 annealing reaction. It is possible that the FNF and FW motifs are not effecting annealing directly but only as a byproduct of other deficiencies. The QF motif might have more of a direct involvement in the annealing reaction but more mechanism studies are still needed.
Concluding thoughts and future direction:
The work presented in this thesis has enhanced our understanding of the role of ICP8 in replication compartment formation. The isolation of the FW and FNF mutants described in Chapter 3 has provided insight into requirements for the ICP8-ICP8 interaction needed for the formation of helical ICP8 filaments in the absence of DNA. The QF mutant described in Chapter 4 was able to form filaments both in the absence and presence of DNA and yet exhibited an interesting defect in annealing complementary
93 strands. ICP8 plays many roles in the HSV life cycle, and is believed to be important for initiation of DNA synthesis and elongation. ICP8 has also been shown to play a role in recombination. It has never been possible to separate residues involved in replication from those needed for recombination. The QF mutant is of particular interest because it provides a potential opportunity to separate the roles of ICP8 in replication and recombination.
Future work is required to map additional ICP8 self-interactions that are involved in filament formation and to understand the mechanism by which ICP8 filaments are involved in the formation of replication compartments. As mentioned earlier, ICP8 double helical filaments are expected to have both lateral and linear interaction sites.
The work presented in this thesis focused on mapping the linear ICP8 self-interactions.
It would be of interest to also map the lateral interaction sites that occur between ICP8 molecules. A more detailed understanding of ICP8 self-interactions may contribute to understanding how filamentation is involved in replication compartment formation. It would also be of interest to understand the conformational changes that are occurring with ICP8 during the formation of pre-replicative sites. It is also suggested to test FNF and FW mutants for their interactions and involvement with other replication proteins.
For instance, it would be of interest to determine if the FNF and FW mutants can stimulate the elongation of DNA synthesis via the mini-circle assay. If these mutants can sustain in vitro DNA synthesis, it might support the hypothesis that ICP8-ICP8 interactions are involved in acting as a scaffold independently of ICP8 DNA synthesis activity.
94 Studying the ICP8-UL9 physical interaction is also of interest because it would
contribute to our understanding or viral origin unwinding. Preliminary findings suggest
that UL9 interacts with ICP8 through the FW motif in the head region of ICP8 (DiScipio,
unpublished). It is interesting that the UL9-ICP8 interaction and the ICP8-ICP8
interaction occur through a shared motif and are possibly competing for the same
interaction site. This fits with a model proposed by Mapelli et al, in which the ICP8-UL9 interaction is necessary to successfully unwind the origin but is then exchanged for
ICP8-ICP8 intermolecular interactions for the commencement of replication and the release of UL9 from the origin (Mapelli, Panjikar, and Tucker 2005). Furthermore, given the complex interaction and interplay between ICP8- UL9 during origin unwinding; it is possible that there are also other interaction motifs between these two proteins.
A comprehensive mapping of the ssDNA binding sites on ICP8 would also supplement our understanding of this proteins activity. Detailed predictions about the residues involved in ssDNA binding have been suggested based on the protein structure
(Mapelli, Panjikar, and Tucker 2005). It would be advisable to test the validity of these predictions and to also search for secondary DNA binding sites on ICP8.
The QF mutant was initially made in an attempt to understand protein interaction motifs in ICP8; it was an unanticipated finding that this mutant was defective in annealing activity. It might still be of interest to test the QF mutant for protein interactions with other critical viral factors. There are also residues in the vicinity of the
QF motif such as D270, E271 and E274 that might be involved in protein interactions.
95 Preliminary studies with these mutants have shown a drastic deficit in complementation
of an ICP8 null virus; these residues warrant further investigation. It would be of interest to characterize the phenotype of these mutants and to test them for their ability to form pre-replicative-like structures, bind ssDNA and assemble filaments. Given the proximity of D270, E271 and E274 to the QF motif it might also be of interest to test if these residues are part of the motif involved in annealing activity. It’s possible that these residues might be involved in the physical interaction between ICP8 and UL12- enabling them to function as a two-subunit recombinase.
The work presented in this thesis has enriched our understanding of replication compartment formation and has narrowed the search for potential protein interaction sites on ICP8. Much work is still needed in the coming years to provide explanations for the mechanistic functions of ICP8 filaments in the formation of replication compartments. Furthermore, this work has made contributions to our understanding of
ICP8 annealing functions and has opened the door to improving our understanding of the mechanisms involved in HSV-1 recombination-mediated replication. ICP8 has been a fascinating protein to study. Hopefully continued research in this area will prove to be very valuable to the HSV-1 field.
96 Chapter 6
References
Abbotts, A P, and N D Stow. 1995. “The Origin-Binding Domain of the Herpes Simplex Virus Type 1 UL9 Protein Is Not Required for DNA Helicase Activity..” The Journal of General Virology 76 ( Pt 12) (12). Microbiology Society: 3125–30. doi:10.1099/0022-1317-76-12-3125.
Albright, Brandon S, Jacob Nellissery, Renata Szczepaniak, and Sandra K Weller. 2011. “Disulfide Bond Formation in the Herpes Simplex Virus 1 UL6 Protein Is Required for Portal Ring Formation and Genome Encapsidation..” Journal of Virology 85 (17). American Society for Microbiology: 8616–24. doi:10.1128/JVI.00123-11.
Alwine, James C, William L Steinhart, and C W Hill. 1974. “Transcription of Herpes Simplex Type 1 DNA in Nuclei Isolated From Infected HEp-2 and KB Cells.” Virology 60 (1): 302–7. doi:10.1016/0042-6822(74)90390-0.
Arii, Jun, and Yasushi Kawaguchi. 2018. “The Role of HSV Glycoproteins in Mediating Cell Entry.” In Human Herpesviruses, 6 ed., 1045:3–21. Advances in Experimental Medicine and Biology. Singapore: Springer, Singapore. doi:10.1007/978-981-10- 7230-7_1.
Arvin, Ann, Gabriella Campadelli-Fiume, Edward Mocarski, Patrick S Moore, Bernard Roizman, Richard Whitley, Koichi Yamanishi, and Rozanne M Sandri-Goldin. 2007. “Initiation of Transcription and RNA Synthesis, Processing and Transport in HSV and VZV Infected Cells.” Human Herpesviruses: Biology, Therapy, and Immunoprophylaxis, Human Herpesviruses: Biology, Therapy, and Immunoprophylaxis. Cambridge: Cambridge University Press.
Arvin, Ann, Gabriella Campadelli-Fiume, Edward Mocarski, Patrick S Moore, Bernard Roizman, Richard Whitley, Koichi Yamanishi, Anna Wald, and Lawrence Corey. 2007. “Persistence in the Population: Epidemiology, Transmission.” Cambridge: Cambridge University Press.
Aslani, Alireza, Monica Olsson, and Per Elias. 2002. “ATP-Dependent Unwinding of a Minimal Origin of DNA Replication by the Origin-Binding Protein and the Single- Strand DNA-Binding Protein ICP8 From Herpes Simplex Virus Type I.” The Journal of Biological Chemistry 277 (43). American Society for Biochemistry and Molecular Biology: 41204–12. doi:10.1074/jbc.M208270200.
Baines, Joel D, and Sandra K Weller. 2005. “Cleavage and Packaging of Herpes Simplex Virus 1 DNA.” In Viral Genome Packaging Machines: Genetics, Structure, and Mechanism, 135–50. Molecular Biology Intelligence Unit. Boston, MA: Springer, Boston, MA. doi:10.1007/0-387-28521-0_9.
97
Barnard, E C, G Brown, and N D Stow. 1997. “Deletion Mutants of the Herpes Simplex Virus Type 1 UL8 Protein: Effect on DNA Synthesis and Ability to Interact with and Influence the Intracellular Localization of the UL5 and UL52 Proteins..” Virology 237 (1): 97–106. doi:10.1006/viro.1997.8763.
Basavarajappa, Santhosh, Ravikumar Ramakrishnaiah, Bangalore Durgesh, Abdulaziz A Al Kheraif, and Darshan Devang Divakar. 2015. “Oral Infections of Herpes Simplex Virus: Symptoms, Diagnosis, Treatment and Pathophysiology in Periodontal Disease.” Reviews in Medical Microbiology 26 (4): 138–42. doi:10.1097/MRM.0000000000000042.
Bayliss, Gary J, Howard S Marsden, and John Hay. 1975. “Herpes Simplex Virus Proteins: DNA-Binding Proteins in Infected Cells and in the Virus Structure.” Virology 68 (1). Academic Press: 124–34. doi:10.1016/0042-6822(75)90154-3.
Benson, F E, A Stasiak, and S C West. 1994. “Purification and Characterization of the Human Rad51 Protein, an Analogue of E. Coli RecA.” The EMBO Journal 13 (23). European Molecular Biology Organization: 5764–71.
Bermek, Oya, Sandra K Weller, and Jack D Griffith. 2017. “The UL8 Subunit of the Helicase/Primase Complex of Herpes Simplex Virus Promotes DNA Annealing and Has a High Affinity for Replication Forks.” The Journal of Biological Chemistry, July. American Society for Biochemistry and Molecular Biology, jbc.M117.799064. doi:10.1074/jbc.M117.799064.
Blümel, Johannes, and Bertfried Matz. 1995. “Thermosensitive UL9 Gene Function Is Required for Early Stages of Herpes Simplex Virus Type 1 DNA Synthesis.” Journal of General Virology 76 (12). Microbiology Society: 3119–24. doi:10.1099/0022- 1317-76-12-3119.
Boehmer, P E. 1998. “The Herpes Simplex Virus Type-1 Single-Strand DNA-Binding Protein, ICP8, Increases the Processivity of the UL9 Protein DNA Helicase.” Journal of Biological Chemistry. 273( 5):2676-83.
Boehmer, P E, and I R Lehman. 1993a. “Herpes Simplex Virus Type 1 ICP8: Helix- Destabilizing Properties.” Journal of Virology 67 (2): 711–15.
Boehmer, P E, and I R Lehman. 1993b. “Physical Interaction Between the Herpes Simplex Virus 1 Origin-Binding Protein and Single-Stranded DNA-Binding Protein ICP8.” Proceedings of the National Academy of Sciences of the United States of America 90 (18): 8444–48.
Boehmer, P E, M C Craigie, and N D Stow. 1994. “Association of Origin Binding Protein and Single Strand DNA-Binding Protein, ICP8, During Herpes Simplex Virus Type 1 DNA Replication in Vivo.” Journal of Biological Chemistry. 269(46): 29329-34.
98
Bogani, Federica, and Paul E Boehmer. 2008. “The Replicative DNA Polymerase of Herpes Simplex Virus 1 Exhibits Apurinic/Apyrimidinic and 5'-Deoxyribose Phosphate Lyase Activities.” Proceedings of the National Academy of Sciences of the United States of America 105 (33). National Acad Sciences: 11709–14. doi:10.1073/pnas.0806375105.
Bortner, C, T R Hernandez, I R Lehman, and J Griffith. 1993. “Herpes Simplex Virus 1 Single-Strand DNA-Binding Protein (ICP8) Will Promote Homologous Pairing and Strand Transfer.” Journal of Molecular Biology 231 (2): 241–50. doi:10.1006/jmbi.1993.1279.
Boutell, Chris, and Roger D Everett. 2013. “Regulation of Alphaherpesvirus Infections by the ICP0 Family of Proteins.” Journal of General Virology 94 (Pt 3). Microbiology Society: 465–81. doi:10.1099/vir.0.048900-0.
Brangwynne, Clifford P. 2013. “Phase Transitions and Size Scaling of Membrane-Less Organelles.” The Journal of Cell Biology 203 (6). Rockefeller Univ Press: 875–81. doi:10.1083/jcb.201308087.
Brangwynne, Clifford P, Christian R Eckmann, David S Courson, Agata Rybarska, Carsten Hoege, Jöbin Gharakhani, Frank Jülicher, and Anthony A Hyman. 2009. “Germline P Granules Are Liquid Droplets That Localize by Controlled Dissolution/Condensation.” Science 324 (5935). American Association for the Advancement of Science: 1729–32. doi:10.1126/science.1172046.
Bruckner, R C, J J Crute, M S Dodson, and I R Lehman. 1991. “The Herpes Simplex Virus 1 Origin Binding Protein: a DNA Helicase.” The Journal of Biological Chemistry 266 (4). American Society for Biochemistry and Molecular Biology: 2669– 74.
Bush, M, D R Yager, M Gao, K Weisshart, A I Marcy, D M Coen, and D M Knipe. 1991. “Correct Intranuclear Localization of Herpes Simplex Virus DNA Polymerase Requires the Viral ICP8 DNA-Binding Protein.” Journal of Virology 65 (3). American Society for Microbiology: 1082–89.
Calder, J M, and N D Stow. 1990. “Herpes Simplex Virus Helicase-Primase: the UL8 Protein Is Not Required for DNA-Dependent ATPase and DNA Helicase Activities..” Nucleic Acids Research 18 (12). Oxford University Press: 3573–78.
Carmichael, E P, and S K Weller. 1989. “Herpes Simplex Virus Type 1 DNA Synthesis Requires the Product of the UL8 Gene: Isolation and Characterization of an ICP6::lacZ Insertion Mutation.” Journal of Virology 63 (2). American Society for Microbiology: 591–99.
99 Carmichael, E P, M J Kosovsky, and S K Weller. 1988. “Isolation and Characterization of Herpes Simplex Virus Type 1 Host Range Mutants Defective in Viral DNA Synthesis.” Journal of Virology 62 (1). American Society for Microbiology: 91–99.
Carrington-Lawrence, Stacy D, and Sandra K Weller. 2003. “Recruitment of Polymerase to Herpes Simplex Virus Type 1 Replication Foci in Cells Expressing Mutant Primase (UL52) Proteins.” Journal of Virology 77 (7): 4237–47.
Challberg, M D. 1986. “A Method for Identifying the Viral Genes Required for Herpesvirus DNA Replication.” Proceedings of the National Academy of Sciences 83 (23). National Acad Sciences: 9094–98.
Chang, Lynne, William J Godinez, Il-Han Kim, Marco Tektonidis, Primal de Lanerolle, Roland Eils, Karl Rohr, and David M Knipe. 2011. “Herpesviral Replication Compartments Move and Coalesce at Nuclear Speckles to Enhance Export of Viral Late mRNA.” Proceedings of the National Academy of Sciences of the United States of America 108 (21). National Acad Sciences: E136–44. doi:10.1073/pnas.1103411108.
Chayavichitsilp, Pamela, Joseph V Buckwalter, Andrew C Krakowski, and Sheila F Friedlander. 2009. “Herpes Simplex.” Pediatrics in Review 30 (4). American Academy of Pediatrics: 119–29–quiz130. doi:10.1542/pir.30-4-119.
Chen, Yan, Christine M Livingston, Stacy D Carrington-Lawrence, Ping Bai, and Sandra K Weller. 2007. “A Mutation in the Human Herpes Simplex Virus Type 1 UL52 Zinc Finger Motif Results in Defective Primase Activity but Can Recruit Viral Polymerase and Support Viral Replication Efficiently.” Journal of Virology 81 (16). American Society for Microbiology: 8742–51. doi:10.1128/JVI.00174-07.
Chen, Yan, Ping Bai, Shannon Mackay, George Korza, John H Carson, Robert D Kuchta, and Sandra K Weller. 2011. “Herpes Simplex Virus Type 1 Helicase- Primase: DNA Binding and Consequent Protein Oligomerization and Primase Activation.” Journal of Virology 85 (2). American Society for Microbiology: 968–78. doi:10.1128/JVI.01690-10.
Chen, Yan, Stacy D Carrington-Lawrence, Ping Bai, and Sandra K Weller. 2005. “Mutations in the Putative Zinc-Binding Motif of UL52 Demonstrate a Complex Interdependence Between the UL5 and UL52 Subunits of the Human Herpes Simplex Virus Type 1 Helicase/Primase Complex.” Journal of Virology 79 (14). American Society for Microbiology: 9088–96. doi:10.1128/JVI.79.14.9088- 9096.2005.
Conley, A J, D M Knipe, P C Jones, and B Roizman. 1981. “Molecular Genetics of Herpes Simplex Virus. VII. Characterization of a Temperature-Sensitive Mutant Produced by in Vitro Mutagenesis and Defective in DNA Synthesis and Accumulation of Gamma Polypeptides.” Journal of Virology 37 (1): 191–206.
100
Conway, James F, and Fred L Homa. 2011. “Nucleocapsid Structure, Assembly and DNA Packaging of Herpes Simplex Virus.” In Alphaherpesviruses, edited by Sandra K Weller, 175–93.
Corey, Lawrence, Anna Wald, Connie L Celum, and Thomas C Quinn. 2004. “The Effects of Herpes Simplex Virus-2 on HIV-1 Acquisition and Transmission: a Review of Two Overlapping Epidemics.” JAIDS Journal of Acquired Immune Deficiency Syndromes 35 (5): 435.
Crute, J J, T TsURUMI, L A Zhu, S K Weller, P D Olivo, M D Challberg, E S Mocarski, and I R Lehman. 1989. “Herpes Simplex Virus 1 Helicase-Primase: a Complex of Three Herpes-Encoded Gene Products.” Proceedings of the National Academy of Sciences 86 (7). National Acad Sciences: 2186–89.
Dai, Xinghong, and Z Hong Zhou. 2018. “Structure of the Herpes Simplex Virus 1 Capsid with Associated Tegument Protein Complexes.” Science 360 (6384). American Association for the Advancement of Science: eaao7298. doi:10.1126/science.aao7298.
Daikoku, Tohru, Ayumi Kudoh, Masatoshi Fujita, Yutaka Sugaya, Hiroki Isomura, Noriko Shirata, and Tatsuya Tsurumi. 2005. “Architecture of Replication Compartments Formed During Epstein-Barr Virus Lytic Replication.” Journal of Virology 79 (6). American Society for Microbiology: 3409–18. doi:10.1128/JVI.79.6.3409-3418.2005.
Damania, Blossom, and Ethel Cesarman. 2013. “Kaposi's Sarcoma-Associated Herpesvirus.” In Feild's Virology, edited by Knipe DM and Howley PM, 6 ed., 2081– 2128. Philadelphia: Lippincott, Williams and Wilkins.
Damato, Elizabeth G, and Caitlin W Winnen. 2002. “Cytomegalovirus Infection: Perinatal Implications.” Journal of Obstetric, Gynecologic, & Neonatal Nursing 31 (1). Blackwell Publishing Ltd: 86–92. doi:10.1111/j.1552-6909.2002.tb00026.x.
Darwish, Anthar S, Lorry M Grady, Ping Bai, and Sandra K Weller. 2016. “ICP8 Filament Formation Is Essential for Replication Compartment Formation During Herpes Simplex Virus Infection.” Edited by R M Sandri-Goldin. Journal of Virology 90 (5). American Society for Microbiology: 2561–70. doi:10.1128/JVI.02854-15.
de Bruyn Kops, A, and D M Knipe. 1988. “Formation of DNA Replication Structures in Herpes Virus-Infected Cells Requires a Viral DNA Binding Protein.” Cell 55 (5): 857– 68.
Deiss, L P, and N Frenkel. 1986. “Herpes Simplex Virus Amplicon: Cleavage of Concatemeric DNA Is Linked to Packaging and Involves Amplification of the Terminally Reiterated a Sequence.” Journal of Virology 57 (3). American Society for Microbiology: 933–41.
101
Deshmane, S L, B Raengsakulrach, J F Berson, and N W Fraser. 1995. “The Replicating Intermediates of Herpes Simplex Virus Type 1 DNA Are Relatively Short..” Journal of Neurovirology 1 (2): 165–76.
Dodson, M S, and I R Lehman. 1991. “Association of DNA Helicase and Primase Activities with a Subassembly of the Herpes Simplex Virus 1 Helicase-Primase Composed of the UL5 and UL52 Gene Products.” Proceedings of the National Academy of Sciences 88 (4). National Academy of Sciences: 1105–9.
Dodson, M S, and I R Lehman. 1993. “The Herpes Simplex Virus Type I Origin Binding Protein. DNA-Dependent Nucleoside Triphosphatase Activity.” The Journal of Biological Chemistry 268 (2). American Society for Biochemistry and Molecular Biology: 1213–19.
Dodson, M S, J J Crute, R C Bruckner, and I R Lehman. 1989. “Overexpression and Assembly of the Herpes Simplex Virus Type 1 Helicase-Primase in Insect Cells.” The Journal of Biological Chemistry 264 (35): 20835–38.
Dracheva, S, E V Koonin, and J J Crute. 1995. “Identification of the Primase Active Site of the Herpes Simplex Virus Type 1 Helicase-Primase.” The Journal of Biological Chemistry 270 (23): 14148–53.
Dudas, K C, and W T Ruyechan. 1998. “Identification of a Region of the Herpes Simplex Virus Single-Stranded DNA-Binding Protein Involved in Cooperative Binding.” Journal of Virology 72 (1). American Society for Microbiology (ASM): 257– 65.
Dudas, K C, S K Scouten, and W T Ruyechan. 2001. “Conformational Change in the Herpes Simplex Single-Strand Binding Protein Induced by DNA.” Biochemical and Biophysical Research Communications 288 (1): 184–90. doi:10.1006/bbrc.2001.5766.
Dutch, R E, and I R Lehman. 1993. “Renaturation of Complementary DNA Strands by Herpes Simplex Virus Type 1 ICP8..” Journal of Virology 67 (12): 6945–49.
Dutch, R E, V Bianchi, and I R Lehman. 1995. “Herpes Simplex Virus Type 1 DNA Replication Is Specifically Required for High-Frequency Homologous Recombination Between Repeated Sequences.” Journal of Virology 69 (5). American Society for Microbiology (ASM): 3084–89.
Eisenberg, Roselyn J, Doina Atanasiu, Tina M Cairns, John R Gallagher, Claude Krummenacher, and Gary H Cohen. 2012. “Herpes Virus Fusion and Entry: a Story with Many Characters.” Viruses 4 (5). Molecular Diversity Preservation International: 800–832. doi:10.3390/v4050800.
102 Elias, P, C M Gustafsson, and O Hammarsten. 1990. “The Origin Binding Protein of Herpes Simplex Virus 1 Binds Cooperatively to the Viral Origin of Replication Oris.” The Journal of Biological Chemistry 265 (28). American Society for Biochemistry and Molecular Biology: 17167–73.
Elias, P, C M Gustafsson, O Hammarsten, and N D Stow. 1992. “Structural Elements Required for the Cooperative Binding of the Herpes Simplex Virus Origin Binding Protein to oriS Reside in the N-Terminal Part of the Protein.” The Journal of Biological Chemistry 267 (24). American Society for Biochemistry and Molecular Biology: 17424–29.
Everett, R D. 2001. “DNA Viruses and Viral Proteins That Interact with PML Nuclear Bodies.” Oncogene 20 (49). Nature Publishing Group: 7266–73. doi:10.1038/sj.onc.1204759.
Everett, R D, G Sourvinos, C Leiper, J B Clements, and A Orr. 2004. “Formation of Nuclear Foci of the Herpes Simplex Virus Type 1 Regulatory Protein ICP4 at Early Times of Infection: Localization, Dynamics, Recruitment of ICP27, and Evidence for the De Novo Induction of ND10-Like Complexes.” Journal of Virology 78 (4). American Society for Microbiology: 1903–17. doi:10.1128/JVI.78.4.1903-1917.2004.
Everett, Roger D. 2000. “ICP0, a Regulator of Herpes Simplex Virus During Lytic and Latent Infection.” BioEssays 22 (8). Wiley-Blackwell: 761–70. doi:10.1002/1521- 1878(200008)22:8<761::AID-BIES10>3.0.CO;2-A.
Everett, Roger D, and Jill Murray. 2005. “ND10 Components Relocate to Sites Associated with Herpes Simplex Virus Type 1 Nucleoprotein Complexes During Virus Infection.” Journal of Virology 79 (8). American Society for Microbiology: 5078–89. doi:10.1128/JVI.79.8.5078-5089.2005.
Falkenberg, M, I R Lehman, and P Elias. 2000. “Leading and Lagging Strand DNA Synthesis in Vitro by a Reconstituted Herpes Simplex Virus Type 1 Replisome.” Proceedings of the National Academy of Sciences 97 (8). National Acad Sciences: 3896–3900. doi:10.1073/pnas.97.8.3896.
Falkenberg, M, P Elias, and I R Lehman. 1998. “The Herpes Simplex Virus Type 1 Helicase-Primase. Analysis of Helicase Activity.” The Journal of Biological Chemistry 273 (48): 32154–57.
Fierer, D S, and M D Challberg. 1992. “Purification and Characterization of UL9, the Herpes Simplex Virus Type 1 Origin-Binding Protein.” Journal of Virology 66 (7): 3986–95.
Flory, J, and C M Radding. 1982. “Visualization of recA Protein and Its Association with DNA: a Priming Effect of Single-Strand-Binding Protein.” Cell 28 (4): 747–56.
103 Fu, Xinping, Hua Wang, and Xiaoliu Zhang. 2002. “High-Frequency Intermolecular Homologous Recombination During Herpes Simplex Virus-Mediated Plasmid DNA Replication..” Journal of Virology 76 (12). American Society for Microbiology (ASM): 5866–74.
Gao, M, and D M Knipe. 1989. “Genetic Evidence for Multiple Nuclear Functions of the Herpes Simplex Virus ICP8 DNA-Binding Protein.” Journal of Virology 63 (12): 5258–67.
Gao, M, and D M Knipe. 1992a. “Distal Protein Sequences Can Affect the Function of a Nuclear Localization Signal..” Molecular and Cellular Biology 12 (3): 1330–39.
Gao, M, and D M Knipe. 1992b. “Distal Protein Sequences Can Affect the Function of a Nuclear Localization Signal..” Molecular and Cellular Biology 12 (3). American Society for Microbiology: 1330–39. doi:10.1128/MCB.12.3.1330.
Gao, M, and D M Knipe. 1993. “Intragenic Complementation of Herpes Simplex Virus ICP8 DNA-Binding Protein Mutants.” Journal of Virology 67 (2): 876–85.
Gao, Min, John Bouchey, Kathryn Curtin, and David M Knipe. 1988. “Genetic Identification of a Portion of the Herpes Simplex Virus ICP8 Protein Required for DNA-Binding.” Virology 163 (2): 319–29. doi:10.1016/0042-6822(88)90272-3.
Garber, D A, S M Beverley, and D M Coen. 1993. “Demonstration of Circularization of Herpes Simplex Virus DNA Following Infection Using Pulsed Field Gel Electrophoresis.” Virology 197 (1): 459–62. doi:10.1006/viro.1993.1612.
Gibbs, J S, H C Chiou, K F Bastow, Y C Cheng, and D M Coen. 1988. “Identification of Amino Acids in Herpes Simplex Virus DNA Polymerase Involved in Substrate and Drug Recognition.” Proceedings of the National Academy of Sciences 85 (18). National Acad Sciences: 6672–76.
Goldstein, D J, and S K Weller. 1988. “An ICP6::lacZ Insertional Mutagen Is Used to Demonstrate That the UL52 Gene of Herpes Simplex Virus Type 1 Is Required for Virus Growth and DNA Synthesis.” Journal of Virology 62 (8). American Society for Microbiology: 2970–77.
Gorbalenya, Alexander E, and Eugene V Koonin. 1993. “Helicases: Amino Acid Sequence Comparisons and Structure-Function Relationships.” Current Opinion in Structural Biology 3 (3): 419–29. doi:10.1016/S0959-440X(05)80116-2.
Gottlieb, J, A I Marcy, D M Coen, and M D Challberg. 1990. “The Herpes Simplex Virus Type 1 UL42 Gene Product: a Subunit of DNA Polymerase That Functions to Increase Processivity.” Journal of Virology 64 (12). American Society for Microbiology (ASM): 5976–87.
104 Gottlieb, J, and M D Challberg. 1994. “Interaction of Herpes Simplex Virus Type 1 DNA Polymerase and the UL42 Accessory Protein with a Model Primer Template.” Journal of Virology 68 (8). American Society for Microbiology: 4937–45.
Grady, Lorry M, Ping Bai, and Sandra K Weller. 2014. “HSV-1 Protein Expression Using Recombinant Baculoviruses.” Methods in Molecular Biology (Clifton, N.J.) 1144 (Chapter 20). New York, NY: Springer New York: 293–304. doi:10.1007/978-1- 4939-0428-0_20.
Gupte, S S, J W Olson, and W T Ruyechan. 1991. “The Major Herpes Simplex Virus Type-1 DNA-Binding Protein Is a Zinc Metalloprotein.” The Journal of Biological Chemistry 266 (18): 11413–16.
Gustafsson, C M, M Falkenberg, S Simonsson, H Valadi, and P Elias. 1995. “The DNA Ligands Influence the Interactions Between the Herpes Simplex Virus 1 Origin Binding Protein and the Single Strand DNA-Binding Protein, ICP8.” The Journal of Biological Chemistry 270 (32): 19028–34.
Hamatake, R K, M Bifano, W W Hurlburt, and D J Tenney. 1997a. “A Functional Interaction of ICP8, the Herpes Simplex Virus Single-Stranded DNA-Binding Protein, and the Helicase-Primase Complex That Is Dependent on the Presence of the UL8 Subunit.” The Journal of General Virology 78 ( Pt 4) (4). Society for General Microbiology: 857–65.
Hamatake, R K, M Bifano, W W Hurlburt, and D J Tenney. 1997b. “A Functional Interaction of ICP8, the Herpes Simplex Virus Single-Stranded DNA-Binding Protein, and the Helicase-Primase Complex That Is Dependent on the Presence of the UL8 Subunit.” The Journal of General Virology 78 ( Pt 4) (April): 857–65.
Hayward, G S, R J Jacob, S C Wadsworth, and B Roizman. 1975. “Anatomy of Herpes Simplex Virus DNA: Evidence for Four Populations of Molecules That Differ in the Relative Orientations of Their Long and Short Components.” Proceedings of the National Academy of Sciences 72 (11). National Acad Sciences: 4243–47.
Hazuda, D J, H C Perry, and W L McClements. 1992. “Cooperative Interactions Between Replication Origin-Bound Molecules of Herpes Simplex Virus Origin- Binding Protein Are Mediated via the Amino Terminus of the Protein..” The Journal of Biological Chemistry 267 (20). American Society for Biochemistry and Molecular Biology: 14309–15.
He, X, and I R Lehman. 2000. “Unwinding of a Herpes Simplex Virus Type 1 Origin of Replication (Ori(S)) by a Complex of the Viral Origin Binding Protein and the Single- Stranded DNA Binding Protein.” Journal of Virology 74 (12). American Society for Microbiology (ASM): 5726–28.
He, X, and I R Lehman. 2001. “An Initial ATP-Independent Step in the Unwinding of a
105 Herpes Simplex Virus Type I Origin of Replication by a Complex of the Viral Origin- Binding Protein and Single-Strand DNA-Binding Protein.” Proceedings of the National Academy of Sciences 98 (6). National Academy of Sciences: 3024–28. doi:10.1073/pnas.061028298.
Heilbronn, R, and H zur Hausen. 1989. “A Subset of Herpes Simplex Virus Replication Genes Induces DNA Amplification Within the Host Cell Genome.” Journal of Virology 63 (9). American Society for Microbiology (ASM): 3683–92.
Hernandez, T R, and I R Lehman. 1990. “Functional Interaction Between the Herpes Simplex-1 DNA Polymerase and UL42 Protein.” The Journal of Biological Chemistry 265 (19). American Society for Biochemistry and Molecular Biology: 11227–32.
Herold, B C, D WuDunn, N Soltys, and P G Spear. 1991. “Glycoprotein C of Herpes Simplex Virus Type 1 Plays a Principal Role in the Adsorption of Virus to Cells and in Infectivity.” Journal of Virology 65 (3). American Society for Microbiology (ASM): 1090–98.
Honess, R W, and B Roizman. 1974. “Regulation of Herpesvirus Macromolecular Synthesis. I. Cascade Regulation of the Synthesis of Three Groups of Viral Proteins.” Journal of Virology 14 (1). American Society for Microbiology: 8–19.
Hwang, Y T, B Y Liu, D M Coen, and C B Hwang. 1997. “Effects of Mutations in the Exo III Motif of the Herpes Simplex Virus DNA Polymerase Gene on Enzyme Activities, Viral Replication, and Replication Fidelity.” Journal of Virology 71 (10). American Society for Microbiology: 7791–98.
Hyman, Anthony A, Christoph A Weber, and Frank Jülicher. 2014. “Liquid-Liquid Phase Separation in Biology.” Dx.Doi.org 30 (1). Annual Reviews: 39–58. doi:10.1146/annurev-cellbio-100913-013325.
Igarashi, K, R Fawl, R J Roller, and B Roizman. 1993. “Construction and Properties of a Recombinant Herpes Simplex Virus 1 Lacking Both S-Component Origins of DNA Synthesis.” Journal of Virology 67 (4). American Society for Microbiology (ASM): 2123–32.
Jacob, R J, and B Roizman. 1977. “Anatomy of Herpes Simplex Virus DNA VIII. Properties of the Replicating DNA..” Journal of Virology 23 (2). American Society for Microbiology: 394–411.
Jiang, Changying, Ying T Hwang, John C W Randell, Donald M Coen, and Charles B C Hwang. 2007. “Mutations That Decrease DNA Binding of the Processivity Factor of the Herpes Simplex Virus DNA Polymerase Reduce Viral Yield, Alter the Kinetics of Viral DNA Replication, and Decrease the Fidelity of DNA Replication..” Journal of Virology 81 (7). American Society for Microbiology: 3495–3502. doi:10.1128/JVI.02359-06.
106
Jogger, Cheryl R, Rebecca I Montgomery, and Patricia G Spear. 2004. “Effects of Linker-Insertion Mutations in Herpes Simplex Virus 1 gD on Glycoprotein-Induced Fusion with Cells Expressing HVEM or Nectin-1.” Virology 318 (1): 318–26. doi:10.1016/j.virol.2003.10.004.
Johnson, David C, and Joel D Baines. 2011. “Herpesviruses Remodel Host Membranes for Virus Egress.” Nature Reviews Microbiology 9 (5). Nature Publishing Group: 382–94. doi:10.1038/nrmicro2559.
Kelly, Barbara J, Cornel Fraefel, Anthony L Cunningham, and Russell J Diefenbach. 2009. “Functional Roles of the Tegument Proteins of Herpes Simplex Virus Type 1.” Virus Research 145 (2): 173–86. doi:10.1016/j.virusres.2009.07.007.
Kevin Van Bortle, Victor G Corces. 2012. “Nuclear Organization and Genome Function.” Annual Review of Cell and Developmental Biology 28 (1). NIH Public Access: 163– 87. doi:10.1146/annurev-cellbio-101011-155824.
Kieff, E D, S L Bachenheimer, and B Roizman. 1971. “Size, Composition, and Structure of the Deoxyribonucleic Acid of Herpes Simplex Virus Subtypes 1 and 2.” Journal of Virology 8 (2). American Society for Microbiology (ASM): 125–32.
Klinedinst, D K, and M D Challberg. 1994. “Helicase-Primase Complex of Herpes Simplex Virus Type 1: a Mutation in the UL52 Subunit Abolishes Primase Activity.” Journal of Virology 68 (6). American Society for Microbiology: 3693–3701.
Kops, Anne de Bruyn, and David M Knipe. 1988. “Formation of DNA Replication Structures in Herpes Virus-Infected Cells Requires a Viral DNA Binding Protein.” Cell 55 (5): 857–68. doi:10.1016/0092-8674(88)90141-9.
Kukhanova, M K, A N Korovina, and S N Kochetkov. 2015. “Human Herpes Simplex Virus: Life Cycle and Development of Inhibitors.” Biochemistry (Moscow) 79 (13). Pleiades Publishing: 1635–52. doi:10.1134/S0006297914130124.
Lamberti, C, and S K Weller. 1996. “The Herpes Simplex Virus Type 1 UL6 Protein Is Essential for Cleavage and Packaging but Not for Genomic Inversion.” Virology 226 (2): 403–7. doi:10.1006/viro.1996.0668.
Lanfranca, Mirna Perusina, Heba Mostafa, and David Davido. 2014. “HSV-1 ICP0: an E3 Ubiquitin Ligase That Counteracts Host Intrinsic and Innate Immunity.” Cells 3 (2). Multidisciplinary Digital Publishing Institute: 438–54. doi:10.3390/cells3020438.
Lee, C K, and D M Knipe. 1985. “An Immunoassay for the Study of DNA-Binding Activities of Herpes Simplex Virus Protein ICP8.” Journal of Virology 54 (3). American Society for Microbiology: 731–38.
107 Lee, Chiu Fan, Clifford P Brangwynne, Jöbin Gharakhani, Anthony A Hyman, and Frank Jülicher. 2013. “Spatial Organization of the Cell Cytoplasm by Position-Dependent Phase Separation.” Physical Review Letters 111 (8): 088101. doi:10.1103/PhysRevLett.111.088101.
Leibovitch, Emily C, and Steven Jacobson. 2014. “Evidence Linking HHV-6 with Multiple Sclerosis: an Update.” Current Opinion in Virology 9 (December). Elsevier: 127–33. doi:10.1016/j.coviro.2014.09.016.
Leinbach, S S, and L S Heath. 1988. “A Carboxyl-Terminal Peptide of the DNA-Binding Protein ICP8 of Herpes Simplex Virus Contains a Single-Stranded DNA-Binding Site..” Virology 166 (1): 10–16.
Liptak, L M, S L Uprichard, and D M Knipe. 1996. “Functional Order of Assembly of Herpes Simplex Virus DNA Replication Proteins Into Prereplicative Site Structures..” Journal of Virology 70 (3). American Society for Microbiology: 1759–67.
Liu, Shenping, John D Knafels, Jeanne S Chang, Gregory A Waszak, Eric T Baldwin, Martin R Deibel, Darrell R Thomsen, et al. 2006. “Crystal Structure of the Herpes Simplex Virus 1 DNA Polymerase.” The Journal of Biological Chemistry 281 (26). American Society for Biochemistry and Molecular Biology: 18193–200. doi:10.1074/jbc.M602414200.
Livingston, Christine M, Neal A DeLuca, Dianna E Wilkinson, and Sandra K Weller. 2008. “Oligomerization of ICP4 and Rearrangement of Heat Shock Proteins May Be Important for Herpes Simplex Virus Type 1 Prereplicative Site Formation..” Journal of Virology 82 (13). American Society for Microbiology: 6324–36. doi:10.1128/JVI.00455-08.
Longnecker, Richard M, Elliott Kieff, and Jeffrey I Cohen. 2013. “Epstein-Barr Virus.” In Feild's Virology, edited by Knipe DM and Howley PM, 6 ed., 2:1898–1959. Philadelphia: Lippincott, Williams and Wilkins.
Looker, Katharine J, Amalia S Magaret, Katherine M E Turner, Peter Vickerman, Sami L Gottlieb, and Lori M Newman. 2015. “Global Estimates of Prevalent and Incident Herpes Simplex Virus Type 2 Infections in 2012.” Edited by William P Halford. PLoS ONE 10 (1). Public Library of Science: e114989. doi:10.1371/journal.pone.0114989.
Loret, Sandra, Ginette Guay, and Roger Lippé. 2008. “Comprehensive Characterization of Extracellular Herpes Simplex Virus Type 1 Virions.” Journal of Virology 82 (17). American Society for Microbiology: 8605–18. doi:10.1128/JVI.00904-08.
Lukonis, C J, and S K Weller. 1996. “Characterization of Nuclear Structures in Cells Infected with Herpes Simplex Virus Type 1 in the Absence of Viral DNA Replication.” Journal of Virology 70 (3). American Society for Microbiology: 1751– 58.
108 Lukonis, C J, and S K Weller. 1997. “Formation of Herpes Simplex Virus Type 1 Replication Compartments by Transfection: Requirements and Localization to Nuclear Domain 10.” Journal of Virology 71 (3). American Society for Microbiology: 2390–99.
Lukonis, C J, J Burkham, and S K Weller. 1997. “Herpes Simplex Virus Type 1 Prereplicative Sites Are a Heterogeneous Population: Only a Subset Are Likely to Be Precursors to Replication Compartments.” Journal of Virology 71 (6): 4771–81.
Macao, Bertil, Monica Olsson, and Per Elias. 2004. “Functional Properties of the Herpes Simplex Virus Type I Origin-Binding Protein Are Controlled by Precise Interactions with the Activated Form of the Origin of DNA Replication.” The Journal of Biological Chemistry 279 (28). American Society for Biochemistry and Molecular Biology: 29211–17. doi:10.1074/jbc.M400371200.
Makhov, A M, P E Boehmer, and R I Lehman. 1996. “Visualization of the Unwinding of Long DNA Chains by the Herpes Simplex Virus Type 1 UL9 Protein and ICP8.” Journal of Molecular Biology. 258(5): 789-99.
Makhov, Alexander M, and Jack D Griffith. 2006. “Visualization of the Annealing of Complementary Single-Stranded DNA Catalyzed by the Herpes Simplex Virus Type 1 ICP8 SSB/Recombinase.” Journal of Molecular Biology 355 (5): 911–22. doi:10.1016/j.jmb.2005.11.022.
Makhov, Alexander M, Anindito Sen, Xiong Yu, Martha N Simon, Jack D Griffith, and Edward H Egelman. 2009. “The Bipolar Filaments Formed by Herpes Simplex Virus Type 1 SSB/Recombination Protein (ICP8) Suggest a Mechanism for DNA Annealing.” Journal of Molecular Biology 386 (2): 273–79. doi:10.1016/j.jmb.2008.12.059.
Makhov, Alexander M, Dianne W Taylor, and Jack D Griffith. 2004. “Two-Dimensional Crystallization of Herpes Simplex Virus Type 1 Single-Stranded DNA-Binding Protein, ICP8, on a Lipid Monolayer.” Biochimica Et Biophysica Acta 1701 (1-2): 101–8. doi:10.1016/j.bbapap.2004.06.006.
Makhov, Alexander M, Sam S-K Lee, I Robert Lehman, and Jack D Griffith. 2003. “Origin-Specific Unwinding of Herpes Simplex Virus 1 DNA by the Viral UL9 and ICP8 Proteins: Visualization of a Specific Preunwinding Complex.” Proceedings of the National Academy of Sciences of the United States of America 100 (3). National Acad Sciences: 898–903. doi:10.1073/pnas.0237171100.
Mapelli, M, M Mühleisen, G Persico, H van Der Zandt, and P A Tucker. 2000. “The 60- Residue C-Terminal Region of the Single-Stranded DNA Binding Protein of Herpes Simplex Virus Type 1 Is Required for Cooperative DNA Binding.” Journal of Virology 74 (19): 8812–22.
109 Mapelli, Marina, and Paul A Tucker. 1999. “Crystallization and Preliminary X-Ray Crystallographic Studies on the Herpes Simplex Virus 1 Single-Stranded DNA Binding Protein.” Journal of Structural Biology 128 (2): 219–22. doi:10.1006/jsbi.1999.4192.
Mapelli, Marina, Santosh Panjikar, and Paul A Tucker. 2005. “The Crystal Structure of the Herpes Simplex Virus 1 ssDNA-Binding Protein Suggests the Structural Basis for Flexible, Cooperative Single-Stranded DNA Binding.” The Journal of Biological Chemistry 280 (4). American Society for Biochemistry and Molecular Biology: 2990– 97. doi:10.1074/jbc.M406780200.
Marchetti, M E, C A Smith, and P A Schaffer. 1988. “A Temperature-Sensitive Mutation in a Herpes Simplex Virus Type 1 Gene Required for Viral DNA Synthesis Maps to Coordinates 0.609 Through 0.614 in UL.” Journal of Virology 62 (3). American Society for Microbiology: 715–21.
Marsden, H S, A M Cross, G J Francis, A H Patel, K MacEachran, M Murphy, G McVey, D Haydon, A Abbotts, and N D Stow. 1996. “The Herpes Simplex Virus Type 1 UL8 Protein Influences the Intracellular Localization of the UL52 but Not the ICP8 or POL Replication Proteins in Virus-Infected Cells.” Journal of General Virology 77 (9). Microbiology Society: 2241–49. doi:10.1099/0022-1317-77-9-2241.
Martinez, R, L Shao, and S K Weller. 1992. “The Conserved Helicase Motifs of the Herpes Simplex Virus Type 1 Origin-Binding Protein UL9 Are Important for Function.” Journal of Virology 66 (11). American Society for Microbiology (ASM): 6735–46.
McGeoch, D J, M A Dalrymple, A J Davison, A Dolan, M C Frame, D McNab, L J Perry, J E Scott, and P Taylor. 1988. “The Complete DNA Sequence of the Long Unique Region in the Genome of Herpes Simplex Virus Type 1..” The Journal of General Virology 69 ( Pt 7) (7). Microbiology Society: 1531–74. doi:10.1099/0022-1317-69-7- 1531.
McLean, G W, A P Abbotts, M E Parry, H S Marsden, and N D Stow. 1994. “The Herpes Simplex Virus Type 1 Origin-Binding Protein Interacts Specifically with the Viral UL8 Protein..” The Journal of General Virology 75 ( Pt 10) (10). Microbiology Society: 2699–2706. doi:10.1099/0022-1317-75-10-2699.
McNamee, E E, T J Taylor, and D M Knipe. 2000. “A Dominant-Negative Herpesvirus Protein Inhibits Intranuclear Targeting of Viral Proteins: Effects on DNA Replication and Late Gene Expression.” Journal of Virology 74 (21): 10122–31.
Mettenleiter, Thomas C, Barbara G Klupp, and Harald Granzow. 2009. “Herpesvirus Assembly: an Update.” Virus Research 143 (2). Elsevier: 222–34. doi:10.1016/j.virusres.2009.03.018.
110
Mohni, Kareem N, Adam S Mastrocola, Ping Bai, Sandra K Weller, and Christopher D Heinen. 2011. “DNA Mismatch Repair Proteins Are Required for Efficient Herpes Simplex Virus 1 Replication..” Journal of Virology 85 (23). American Society for Microbiology: 12241–53. doi:10.1128/JVI.05487-11.
Mohni, Kareem N, Christine M Livingston, David Cortez, and Sandra K Weller. 2010. “ATR and ATRIP Are Recruited to Herpes Simplex Virus Type 1 Replication Compartments Even Though ATR Signaling Is Disabled.” Journal of Virology 84 (23). American Society for Microbiology: 12152–64. doi:10.1128/JVI.01643-10.
Morgan, C, H M Rose, and B Mednis. 1968. “Electron Microscopy of Herpes Simplex Virus. I. Entry.” Journal of Virology 2 (5). American Society for Microbiology: 507– 16.
Mumtsidu, E, A M Makhov, and P V Konarev. 2008. “Structural Features of the Single- Stranded DNA-Binding Protein of Epstein–Barr Virus.” Journal of Structural Biology 161(2):172-87.
Murata, L B, and M S Dodson. 1999. “The Herpes Simplex Virus Type 1 Origin-Binding Protein. Sequence-Specific Activation of Adenosine Triphosphatase Activity by a Double-Stranded DNA Containing Box I.” The Journal of Biological Chemistry 274 (52): 37079–86.
Naldinho-Souto, Raquel, Helena Browne, and Tony Minson. 2006. “Herpes Simplex Virus Tegument Protein VP16 Is a Component of Primary Enveloped Virions..” Journal of Virology 80 (5). American Society for Microbiology: 2582–84. doi:10.1128/JVI.80.5.2582-2584.2006.
Nellissery, Jacob K, Renata Szczepaniak, Carmela Lamberti, and Sandra K Weller. 2007. “A Putative Leucine Zipper Within the Herpes Simplex Virus Type 1 UL6 Protein Is Required for Portal Ring Formation.” Journal of Virology 81 (17). American Society for Microbiology: 8868–77. doi:10.1128/JVI.00739-07.
Notredame, Cédric, Desmond G Higgins, and Jaap Heringa. 2000. “T-Coffee: a Novel Method for Fast and Accurate Multiple Sequence Alignment.” Journal of Molecular Biology 302 (1): 205–17.
O'Donnell, M E, P Elias, B E Funnell, and I R Lehman. 1987. “Interaction Between the DNA Polymerase and Single-Stranded DNA-Binding Protein (Infected Cell Protein 8) of Herpes Simplex Virus 1.” The Journal of Biological Chemistry 262 (9): 4260– 66.
Ojala, P M, B Sodeik, M W Ebersold, U Kutay, and A Helenius. 2000. “Herpes Simplex Virus Type 1 Entry Into Host Cells: Reconstitution of Capsid Binding and Uncoating at the Nuclear Pore Complex in Vitro.” Molecular and Cellular Biology 20 (13).
111 American Society for Microbiology: 4922–31. doi:10.1128/MCB.20.13.4922- 4931.2000.
Olivo, P D, N J Nelson, and M D Challberg. 1989. “Herpes Simplex Virus Type 1 Gene Products Required for DNA Replication: Identification and Overexpression.” Journal of Virology 63 (1). American Society for Microbiology: 196–204.
Olsson, Monica, Ka-Wei Tang, Cecilia Persson, L Marcus Wilhelmsson, Martin Billeter, and Per Elias. 2009. “Stepwise Evolution of the Herpes Simplex Virus Origin Binding Protein and Origin of Replication.” The Journal of Biological Chemistry 284 (24). American Society for Biochemistry and Molecular Biology: 16246–55. doi:10.1074/jbc.M807551200.
Ou, Horng D, Witek Kwiatkowski, Thomas J Deerinck, Andrew Noske, Katie Y Blain, Hannah S Land, Conrado Soria, et al. 2012. “A Structural Basis for the Assembly and Functions of a Viral Polymer That Inactivates Multiple Tumor Suppressors.” Cell 151 (2): 304–19. doi:10.1016/j.cell.2012.08.035.
Ozgur, Sezgin, and Jack Griffith. 2014. “Interaction of Kaposi's Sarcoma-Associated Herpesvirus ORF6 Protein with Single-Stranded DNA..” Journal of Virology 88 (15). American Society for Microbiology: 8687–95. doi:10.1128/JVI.03652-13.
Ozgur, Sezgin, Blossom Damania, and Jack Griffith. 2011. “The Kaposi's Sarcoma- Associated Herpesvirus ORF6 DNA Binding Protein Forms Long DNA-Free Helical Protein Filaments.” Journal of Structural Biology 174 (1): 37–43. doi:10.1016/j.jsb.2010.10.015.
Parris, D S, A Cross, L Haarr, A Orr, M C Frame, M Murphy, D J McGeoch, and H S Marsden. 1988. “Identification of the Gene Encoding the 65-Kilodalton DNA-Binding Protein of Herpes Simplex Virus Type 1.” Journal of Virology 62 (3). American Society for Microbiology: 818–25.
Paul, David, and Ralf Bartenschlager. 2013. “Architecture and Biogenesis of Plus- Strand RNA Virus Replication Factories.” World Journal of Virology 2 (2). Baishideng Publishing Group Inc.: 32–48. doi:10.5501/wjv.v2.i2.32.
Pellett, Philip E, and Bernard Roizman. 2013. “Herpesviridae.” In Feild's Virology, edited by Knipe DM and Howley PM, 6 ed., 2:1802–22. Philadelphia.
Phelan, A, J Dunlop, A H Patel, N D Stow, and J B Clements. 1997. “Nuclear Sites of Herpes Simplex Virus Type 1 DNA Replication and Transcription Colocalize at Early Times Postinfection and Are Largely Distinct From RNA Processing Factors.” Journal of Virology 71 (2). American Society for Microbiology: 1124–32.
Poffenberger, K L, and B Roizman. 1985. “A Noninverting Genome of a Viable Herpes Simplex Virus 1: Presence of Head-to-Tail Linkages in Packaged Genomes and
112 Requirements for Circularization After Infection.” Journal of Virology 53 (2). American Society for Microbiology (ASM): 587–95.
Polvino-Bodnar, M, P K Orberg, and P A Schaffer. 1987. “Herpes Simplex Virus Type 1 oriL Is Not Required for Virus Replication or for the Establishment and Reactivation of Latent Infection in Mice.” Journal of Virology 61 (11). American Society for Microbiology (ASM): 3528–35.
Powell, Kenneth L, and Dorothy J M Purifoy. 1976. “DNA-Binding Proteins of Cells Infected by Herpes Simplex Virus Type 1 and Type 2.” Intervirology 7 (4-5). Karger Publishers: 225–39. doi:10.1159/000149955.
Purifoy, D J, and K L Powell. 1976. “DNA-Binding Proteins Induced by Herpes Simplex Virus Type 2 in HEp-2 Cells.” Journal of Virology 19 (2). American Society for Microbiology: 717–31.
Quinlan, M P, L B Chen, and D M Knipe. 1984. “The Intranuclear Location of a Herpes Simplex Virus DNA-Binding Protein Is Determined by the Status of Viral DNA Replication.” Cell 36 (4): 857–68.
Randell, John C W, and Donald M Coen. 2004. “The Herpes Simplex Virus Processivity Factor, UL42, Binds DNA as a Monomer.” Journal of Molecular Biology 335 (2): 409–13.
Randell, John C W, Gloria Komazin, Changying Jiang, Charles B C Hwang, and Donald M Coen. 2005. “Effects of Substitutions of Arginine Residues on the Basic Surface of Herpes Simplex Virus UL42 Support a Role for DNA Binding in Processive DNA Synthesis.” Journal of Virology 79 (18). American Society for Microbiology: 12025– 34. doi:10.1128/JVI.79.18.12025-12034.2005.
Randell, John C, and Donald M Coen. 2001. “Linear Diffusion on DNA Despite High- Affinity Binding by a DNA Polymerase Processivity Factor.” Molecular Cell 8 (4): 911–20.
Reske, Adi, Gabriele Pollara, Claude Krummenacher, Benjamin M Chain, and David R Katz. 2007. “Understanding HSV‐1 Entry Glycoproteins.” Reviews in Medical Virology 17 (3). Wiley-Blackwell: 205–15. doi:10.1002/rmv.531.
Reuven, Nina B, Smaranda Willcox, Jack D Griffith, and Sandra K Weller. 2004. “Catalysis of Strand Exchange by the HSV-1 UL12 and ICP8 Proteins: Potent ICP8 Recombinase Activity Is Revealed Upon Resection of dsDNA Substrate by Nuclease.” Journal of Molecular Biology 342 (1): 57–71. doi:10.1016/j.jmb.2004.07.012.
Reuven, Nina Bacher, Amy E Staire, Richard S Myers, and Sandra K Weller. 2003. “The Herpes Simplex Virus Type 1 Alkaline Nuclease and Single-Stranded DNA
113 Binding Protein Mediate Strand Exchange in Vitro.” Journal of Virology 77 (13): 7425–33.
Reuven, Nina Bacher, and Sandra K Weller. 2005. “Herpes Simplex Virus Type 1 Single-Strand DNA Binding Protein ICP8 Enhances the Nuclease Activity of the UL12 Alkaline Nuclease by Increasing Its Processivity.” Journal of Virology 79 (14). American Society for Microbiology: 9356–58. doi:10.1128/JVI.79.14.9356- 9358.2005.
Reuven, Nina Bacher, Susumu Antoku, and Sandra K Weller. 2004. “The UL12.5 Gene Product of Herpes Simplex Virus Type 1 Exhibits Nuclease and Strand Exchange Activities but Does Not Localize to the Nucleus..” Journal of Virology 78 (9): 4599– 4608.
Roizman, Bernard, David M Knipe, and Richard J Whitley. 2013. “Herpes Simplex Virus.” In Feild's Virology, edited by Knipe DM and Howley PM, 6 ed., 2:1823–97. Philadelphia.
Ruyechan, W T. 1983. “The Major Herpes Simplex Virus DNA-Binding Protein Holds Single-Stranded DNA in an Extended Configuration.” Journal of Virology 46 (2). American Society for Microbiology (ASM): 661–66.
Ruyechan, W T, and A C Weir. 1984. “Interaction with Nucleic Acids and Stimulation of the Viral DNA Polymerase by the Herpes Simplex Virus Type 1 Major DNA-Binding Protein.” Journal of Virology 52 (3): 727–33.
Schaffer, P A, M J Tevethia, and M Benyesh-Melnick. 1974. “Recombination Between Temperature-Sensitive Mutants of Herpes Simplex Virus Type 1..” Virology 58 (1): 219–28.
Schildgen, Oliver, Sascha Gräper, Johannes Blümel, and Bertfried Matz. 2005. “Genome Replication and Progeny Virion Production of Herpes Simplex Virus Type 1 Mutants with Temperature-Sensitive Lesions in the Origin-Binding Protein.” Journal of Virology 79 (11): 7273–78. doi:10.1128/JVI.79.11.7273-7278.2005.
Schmid, Melanie, Thomas Speiseder, Thomas Dobner, and Ramon A Gonzalez. 2014. “DNA Virus Replication Compartments..” Journal of Virology 88 (3). American Society for Microbiology: 1404–20. doi:10.1128/JVI.02046-13.
Schumacher, April J, Kareem N Mohni, Yinan Kan, Eric A Hendrickson, Jeremy M Stark, and Sandra K Weller. 2012. “The HSV-1 Exonuclease, UL12, Stimulates Recombination by a Single Strand Annealing Mechanism.” Edited by Roger D Everett. PLoS Pathogens 8 (8). Public Library of Science: e1002862. doi:10.1371/journal.ppat.1002862.
114 Severini, A, A R Morgan, D R Tovell, and D L Tyrrell. 1994. “Study of the Structure of Replicative Intermediates of HSV-1 DNA by Pulsed-Field Gel Electrophoresis..” Virology 200 (2): 428–35. doi:10.1006/viro.1994.1206.
Severini, A, D G Scraba, and D L Tyrrell. 1996. “Branched Structures in the Intracellular DNA of Herpes Simplex Virus Type 1..” Journal of Virology 70 (5). American Society for Microbiology: 3169–75.
Sheldrick, P, and N Berthelot. 1975. “Inverted Repetitions in the Chromosome of Herpes Simplex Virus..” Cold Spring Harbor Symposia on Quantitative Biology 39 Pt 2: 667–78.
Shelton, L S, A G Albright, W T Ruyechan, and F J Jenkins. 1994. “Retention of the Herpes Simplex Virus Type 1 (HSV-1) UL37 Protein on Single-Stranded DNA Columns Requires the HSV-1 ICP8 Protein..” Journal of Virology 68 (1). American Society for Microbiology (ASM): 521–25.
Sherman, G, J Gottlieb, and M D Challberg. 1992. “The UL8 Subunit of the Herpes Simplex Virus Helicase-Primase Complex Is Required for Efficient Primer Utilization.” Journal of Virology 66 (8): 4884–92.
Smith, Samantha, Nina Reuven, Kareem N Mohni, April J Schumacher, and Sandra K Weller. 2014. “Structure of the Herpes Simplex Virus 1 Genome: Manipulation of Nicks and Gaps Can Abrogate Infectivity and Alter the Cellular DNA Damage Response.” Journal of Virology 88 (17). American Society for Microbiology: 10146– 56. doi:10.1128/JVI.01723-14.
Sodeik, Beate, Melanie W Ebersold, and Ari Helenius. 1997. “Microtubule-Mediated Transport of Incoming Herpes Simplex Virus 1 Capsids to the Nucleus.” The Journal of Cell Biology 136 (5). Rockefeller University Press: 1007–21. doi:10.1083/jcb.136.5.1007.
Spear, P G, R J Eisenberg, and G H Cohen. 2000. “Three Classes of Cell Surface Receptors for Alphaherpesvirus Entry.” Virology 275 (1): 1–8. doi:10.1006/viro.2000.0529.
Spivack, J G, and N W Fraser. 1987. “Detection of Herpes Simplex Virus Type 1 Transcripts During Latent Infection in Mice.” Journal of Virology 61 (12). American Society for Microbiology (ASM): 3841–47.
Stengel, Gudrun, and Robert D Kuchta. 2011. “Coordinated Leading and Lagging Strand DNA Synthesis by Using the Herpes Simplex Virus 1 Replication Complex and Minicircle DNA Templates.” Journal of Virology 85 (2). American Society for Microbiology: 957–67. doi:10.1128/JVI.01688-10.
115 Stevens, J G, E K Wagner, G B Devi-Rao, M L Cook, and L T Feldman. 1987. “RNA Complementary to a Herpesvirus Alpha Gene mRNA Is Prominent in Latently Infected Neurons.” Science 235 (4792): 1056–59.
Stow, N D. 1985. “Mutagenesis of a Herpes Simplex Virus Origin of DNA Replication and Its Effect on Viral Interference.” The Journal of General Virology 66 (Pt 1) (1). Microbiology Society: 31–42. doi:10.1099/0022-1317-66-1-31.
Strelow, L I, and D A Leib. 1995. “Role of the Virion Host Shutoff (Vhs) of Herpes Simplex Virus Type 1 in Latency and Pathogenesis.” Journal of Virology 69 (11). American Society for Microbiology: 6779–86.
Szczepaniak, Renata, Jacob Nellissery, Joshua A Jadwin, Alexander M Makhov, Athena Kosinski, James F Conway, and Sandra K Weller. 2011. “Disulfide Bond Formation Contributes to Herpes Simplex Virus Capsid Stability and Retention of Pentons.” Journal of Virology 85 (17). American Society for Microbiology: 8625–34. doi:10.1128/JVI.00214-11.
Szostek, S, B Zawilinska, and J Kopec. 2009. “Herpesviruses as Possible Cofactors in HPV-16-Related Oncogenesis.” Acta Biochimica Polonica 56(2):337-42.
Taylor, Travis J, and David M Knipe. 2003. “C-Terminal Region of Herpes Simplex Virus ICP8 Protein Needed for Intranuclear Localization.” Virology 309 (2): 219–31.
Taylor, Travis J, and David M Knipe. 2004. “Proteomics of Herpes Simplex Virus Replication Compartments: Association of Cellular DNA Replication, Repair, Recombination, and Chromatin Remodeling Proteins with ICP8.” Journal of Virology 78 (11). American Society for Microbiology: 5856–66. doi:10.1128/JVI.78.11.5856- 5866.2004.
Taylor, Travis J, Elizabeth E McNamee, Cheryl Day, and David M Knipe. 2003. “Herpes Simplex Virus Replication Compartments Can Form by Coalescence of Smaller Compartments.” Virology 309 (2): 232–47.
Tenney, D J, W W Hurlburt, P A Micheletti, M Bifano, and R K Hamatake. 1994. “The UL8 Component of the Herpes Simplex Virus Helicase-Primase Complex Stimulates Primer Synthesis by a Subassembly of the UL5 and UL52 Components..” The Journal of Biological Chemistry 269 (7): 5030–35.
Tolun, Gökhan, Alexander M Makhov, Steven J Ludtke, and Jack D Griffith. 2013. “Details of ssDNA Annealing Revealed by an HSV-1 ICP8–ssDNA Binary Complex.” Nucleic Acids Research 41 (11). Oxford University Press: 5927–37. doi:10.1093/nar/gkt266.
116 Trego, Kelly S, and Deborah S Parris. 2003. “Functional Interaction Between the Herpes Simplex Virus Type 1 Polymerase Processivity Factor and Origin-Binding Proteins: Enhancement of UL9 Helicase Activity.” Journal of Virology 77 (23): 12646–59.
Umbach, Jennifer L, Maria A Nagel, Randall J Cohrs, Donald H Gilden, and Bryan R Cullen. 2009. “Analysis of Human Alphaherpesvirus microRNA Expression in Latently Infected Human Trigeminal Ganglia.” Journal of Virology 83 (20). American Society for Microbiology: 10677–83. doi:10.1128/JVI.01185-09.
Uprichard, Susan L, and David M Knipe. 2003a. “Conformational Changes in the Herpes Simplex Virus ICP8 DNA-Binding Protein Coincident with Assembly in Viral Replication Structures.” Journal of Virology 77 (13): 7467–76.
Uprichard, Susan L, and David M Knipe. 2003b. “Conformational Changes in the Herpes Simplex Virus ICP8 DNA-Binding Protein Coincident with Assembly in Viral Replication Structures.” Journal of Virology 77 (13). American Society for Microbiology: 7467–76. doi:10.1128/JVI.77.13.7467-7476.2003. van Genderen, I L, R Brandimarti, M R Torrisi, G Campadelli, and G van Meer. 1994. “The Phospholipid Composition of Extracellular Herpes Simplex Virions Differs From That of Host Cell Nuclei.” Virology 200 (2): 831–36. doi:10.1006/viro.1994.1252.
Wadsworth, S, R J Jacob, and B Roizman. 1975. “Anatomy of Herpes Simplex Virus DNA. II. Size, Composition, and Arrangement of Inverted Terminal Repetitions.” Journal of Virology 15 (6). American Society for Microbiology (ASM): 1487–97.
Wagner, Lauren M, and Neal A DeLuca. 2013. “Temporal Association of Herpes Simplex Virus ICP4 with Cellular Complexes Functioning at Multiple Steps in PolII Transcription..” Edited by David A Leib. PLoS ONE 8 (10). Public Library of Science: e78242. doi:10.1371/journal.pone.0078242.
Wang, Y S, and J D Hall. 1990. “Characterization of a Major DNA-Binding Domain in the Herpes Simplex Virus Type 1 DNA-Binding Protein (ICP8).” Journal of Virology 64 (5): 2082–89.
Weir, Hazel M, Janice M Calder, and Nigel D Stow. 1989. “Binding of the Herpes Simplex Virus Type 1 UL9 Gene Product to an Origin of Viral DNA Replication.” Nucleic Acids Research 17 (4). Oxford University Press: 1409–25. doi:10.1093/nar/17.4.1409.
Weller, S K, A Spadaro, J E Schaffer, A W Murray, A M Maxam, and P A Schaffer. 1985. “Cloning, Sequencing, and Functional Analysis of oriL, a Herpes Simplex Virus Type 1 Origin of DNA Synthesis.” Molecular and Cellular Biology 5 (5). American Society for Microbiology (ASM): 930–42.
117 Weller, Sandra K, and Donald M Coen. 2012a. “Herpes Simplex Viruses: Mechanisms of DNA Replication..” Cold Spring Harbor Perspectives in Biology 4 (9). Cold Spring Harbor Lab: a013011–11. doi:10.1101/cshperspect.a013011.
Weller, Sandra K, and Donald M Coen. 2012b. “Herpes Simplex Viruses: Mechanisms of DNA Replication.” Cold Spring Harbor Perspectives in Biology 4 (9). Cold Spring Harbor Lab: a013011–11. doi:10.1101/cshperspect.a013011.
Weller, Sandra K, and James A Sawitzke. 2014. “Recombination Promoted by DNA Viruses: Phage Λ to Herpes Simplex Virus.” Annual Review of Microbiology 68 (1). Annual Reviews: 237–58. doi:10.1146/annurev-micro-091313-103424.
Weller, Sandra K, Doris P Aschman, Wendy R Sacks, Donald M Coen, and Priscilla A Schaffer. 1983. “Genetic Analysis of Temperature-Sensitive Mutants of HSV-1: the Combined Use of Complementation and Physical Mapping for Cistron Assignment.” Virology 130 (2): 290–305.
White, Eric J, and Paul E Boehmer. 1999. “Photoaffinity Labeling of the Herpes Simplex Virus Type-1 Single-Strand DNA-Binding Protein (ICP8) with Oligodeoxyribonucleotides.” Biochemical and Biophysical Research Communications 264 (2): 493–97. doi:10.1006/bbrc.1999.1566.
Whitlow, Zackary, and Thomas M Kristie. 2009. “Recruitment of the Transcriptional Coactivator HCF-1 to Viral Immediate-Early Promoters During Initiation of Reactivation From Latency of Herpes Simplex Virus Type 1.” Journal of Virology 83 (18). American Society for Microbiology: 9591–95. doi:10.1128/JVI.01115-09.
Wilcock, D, and D P Lane. 1991. “Localization of P53, Retinoblastoma and Host Replication Proteins at Sites of Viral Replication in Herpes-Infected Cells..” Nature 349 (6308): 429–31. doi:10.1038/349429a0.
Wilkinson, Dianna E, and Sandra K Weller. 2003. “The Role of DNA Recombination in Herpes Simplex Virus DNA Replication..” IUBMB Life 55 (8). Informa Healthcare: 451–58. doi:10.1080/15216540310001612237.
Wilkinson, Dianna E, and Sandra K Weller. 2004. “Recruitment of Cellular Recombination and Repair Proteins to Sites of Herpes Simplex Virus Type 1 DNA Replication Is Dependent on the Composition of Viral Proteins Within Prereplicative Sites and Correlates with the Induction of the DNA Damage Response.” Journal of Virology 78 (9): 4783–96.
Wilson, Angus C, and Ian Mohr. 2012. “A Cultured Affair: HSV Latency and Reactivation in Neurons.” Trends in Microbiology 20 (12). Elsevier Current Trends: 604–11. doi:10.1016/j.tim.2012.08.005.
118 Wu, C A, N J Nelson, D J McGeoch, and M D Challberg. 1988. “Identification of Herpes Simplex Virus Type 1 Genes Required for Origin-Dependent DNA Synthesis.” Journal of Virology 62 (2): 435–43.
Wu, F Y, J H Ahn, D J Alcendor, W J Jang, J Xiao, S D Hayward, and G S Hayward. 2001. “Origin-Independent Assembly of Kaposi's Sarcoma-Associated Herpesvirus DNA Replication Compartments in Transient Cotransfection Assays and Association with the ORF-K8 Protein and Cellular PML.” Journal of Virology 75 (3). American Society for Microbiology: 1487–1506. doi:10.1128/JVI.75.3.1487-1506.2001.
Xu, Xingli, Yanchun Che, and Qihan Li. 2016. “HSV-1 Tegument Protein and the Development of Its Genome Editing Technology.” Virology Journal 13 (1). BioMed Central: 108. doi:10.1186/s12985-016-0563-x.
Yamanishi, Koichi, and Yasuko Mori. 2009. “Human Herpesvirus 6 and Human Herpesvirus 7.” In Clinical Virology, Third Edition, 507–19. American Society of Microbiology. doi:10.1128/9781555815981.ch23.
Yamanishi, Koichi, Y Mori, and P E Pellett. 2013. “Herpesviruses 6 and 7.” In Feild's Virology, edited by B N Fields, D M Knipe, P M Howley, and J I Cohen, Sixth, 2058– 79. Philadelphia: Lippincott, Williams and Wilkins.
Yao, F, and R J Courtney. 1989. “A Major Transcriptional Regulatory Protein (ICP4) of Herpes Simplex Virus Type 1 Is Associated with Purified Virions.” Journal of Virology 63 (8). American Society for Microbiology: 3338–44.
Yu, X, and E H Egelman. 1993. “DNA Conformation Induced by the Bacteriophage T4 UvsX Protein Appears Identical to the Conformation Induced by the Escherichia Coli RecA Protein.” Journal of Molecular Biology 232 (1): 1–4. doi:10.1006/jmbi.1993.1363.
Zhang, X, S Efstathiou, and A Simmons. 1994. “Identification of Novel Herpes Simplex Virus Replicative Intermediates by Field Inversion Gel Electrophoresis: Implications for Viral DNA Amplification Strategies.” Virology 202 (2): 530–39. doi:10.1006/viro.1994.1375.
Zhu, L A, and S K Weller. 1992a. “The Six Conserved Helicase Motifs of the UL5 Gene Product, a Component of the Herpes Simplex Virus Type 1 Helicase-Primase, Are Essential for Its Function.” Journal of Virology 66 (1). American Society for Microbiology: 469–79.
Zhu, L A, and S K Weller. 1992b. “The UL5 Gene of Herpes Simplex Virus Type 1: Isolation of a lacZ Insertion Mutant and Association of the UL5 Gene Product with Other Members of the Helicase-Primase Complex.” Journal of Virology 66 (1). American Society for Microbiology: 458–68.
119 Zuccola, Harmon J, David J Filman, Donald M Coen, and James M Hogle. 2000. “The Crystal Structure of an Unusual Processivity Factor, Herpes Simplex Virus UL42, Bound to the C Terminus of Its Cognate Polymerase.” Molecular Cell 5 (2): 267–78. doi:10.1016/S1097-2765(00)80422-0.
120