A Search for CDKN2A/P16ink4a Mutations in Melanocytic Nevi from Patients with Melanoma and Spouse Controls by Use of Laser-Captured Microdissection

STUDY A Search for CDKN2A/p16INK4a Mutations in Melanocytic Nevi From Patients With Melanoma and Spouse Controls by Use of Laser-Captured Microdissection

Hao Wang, MD, PhD; Richard B. Presland, PhD; Michael Piepkorn, MD, PhD

Objective: To determine the frequency at which the CDKN2A were observed in any of the melanocytic CDKN2A coding region is mutated in the atypical nevi nevi. of persons with sporadic melanoma. Conclusions: Point mutations in CDKN2A are an un- Design: DNA samples, isolated by laser-captured mi- common event in the atypical nevi of persons with mela- crodissection of atypical nevi from 10 patients with newly noma. As such, the data may support a hypothesis of incident cases of sporadic melanoma and their spouses melanocytic nevus histogenesis, in which the melano- as matched controls, were used as templates for nested cytic nevus and malignant melanoma represent sepa- polymerase chain reaction amplification of CDKN2A rate, pleiotropic pathways resulting from common stimuli, exons 1 and 2. such as genomic damage from UV radiation.

Results: No point mutations in the coding region of Arch Dermatol. 2005;141:177-180

ONCEPTUAL MODELS OF messenger RNA are expressed at seem- melanoma development ingly normal levels in atypical as well as ba- and progression incorpo- nal nevi, but at significantly reduced lev- rate common and atypi- els in many melanomas, including the cal (dysplastic) nevi as po- earliest recognizable stage, melanoma in tentialC stages in the evolution of the situ.3-5 Moreover, the phenotype of mul- malignant phenotype in melanocytic sys- tiple and/or enlarged nevi does not geneti- tems.1 Support for this hypothesis can be cally segregate with, nor readily link by found, among other lines of evidence, in the polymorphic markers to, the CDKN2A lo- 6,7 spatial coexistence of melanoma and nevi cus. In addition, chromosomal loss, point at both the clinical and histological levels mutations, and promoter methylation vici- and in the strong statistical correlation of nal to the CDKN2A locus were not found increasing numbers and sizes of nevi with increasing relative risk for melanoma.2 CME course available at A prediction of this widely held model www.archdermatol.com system is that melanocytic nevi could share certain genetic alterations that are crucial See also pages 165, to the initiation and/or evolution of malignant melanoma. The major melanoma gene 193, and 225 thus far identified is CDKN2A, which is also known as p16INK4a. Point mutations or de- in melanocytic nevi,8 nor were homozy- letions at that 9p21 chromosomal locus are gous deletions or point mutations ob- putatively initiating events in the transfor- served in dysplastic nevi.9 On the other Author Affiliations: mation of melanocytic cells, and segregat- hand, others have presented evidence that Department of Medicine, ing p16 germline mutations account for up in atypical nevi, as in melanoma, there may Division of Dermatology to 40% of all cases of familial melanoma.2 be point mutations10 and hemizygous or ho- (Drs Wang, Presland, and At present, there is no consensus as to mozygous allelic deletions at or near Piepkorn), Department of Oral whether melanocytic nevi, atypical or oth- CDKN2A.11-14 Also, atypical nevi and mela- Biology (Dr Presland), and Department of Pathology erwise, sustain similar genetic alterations noma express DNA mismatch repair genes 15 (Dr Piepkorn), University of at a frequency sufficient to reflect a func- at a lower level and have greater micro- Washington, Seattle. tion as a significant factor in melanoma pro- satellite instability at markers near CDKN2A Financial Disclosure: None. gression. For example, p16 protein and than do common nevi.16

(REPRINTED) ARCH DERMATOL/ VOL 141, FEB 2005 WWW.ARCHDERMATOL.COM 177

©2005 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/29/2021 control pairs were randomly culled from the source database Table. Histological Classification of the Melanocytic Nevi of 87 matched pairs for the present analysis. The histological Analyzed for CDKN2A Genotype* ratings of these nevi for microscopical criteria of melanocytic dysplasia are given in the Table. Numerical Code Status Average Histological Rating† The biopsy tissues were fixed in formalin and embedded in 834 Case 0.15 paraffin. Tissue sections of 10 µm were mounted on glass slides 132 Control 0 with polyethylene naphtholate (PEN) membranes (Carl Zeiss 614 Case NA‡ Inc, Thornwood, NY). The PEN membranes were attached to 425 Control NA‡ slides wetted with 70% ethanol and were fixed in place using 853 Case 0.92 Fixogum rubber cement. Before staining, the mounted sec- 538 Control 1.0 tions were dried overnight at 40°C. The paraffin was removed 766 Case 0.15 with xylene, and the sections were stained with hematoxylin 022 Control 0.31 using standard methods in preparation for laser-captured mi- 960 Case 1.23 crodissection. 091 Control 0.54 522 Case 0.15 013 Control 0.77 LASER-CAPTURED MICRODISSECTION 259 Case 2.0 AND DNA EXTRACTION 493 Control 0.15 421 Case 0.46 The PALM (positioning and ablation with the laser mi- 761 Control 0.23 crobeam) system (PALM Microlaser AG, Bernried, Germany) 539 Case 1.1 was used for microdissection of nevus-specific tissues. The dis- 520 Control 0.46 sected tissue fragments, which consisted of approximately 500 129 Case 0.31 nuclei, were collected in 0.5-mL Eppendorf microfuge tubes. 021 Control 0.61 Then, 50 µL of 2ϫmagnesium-free polymerase chain reaction (PCR) buffer with 0.04% proteinase K was added to each tube. *The histological slides were reviewed without knowledge of clinical The samples were incubated at 37°C overnight. Heating the case-control status by a 13-member panel of dermatopathologists from the samples at 95°C for 6 minutes denatured the proteinase K. The North American Melanoma Pathology Study Group. †Each slide was independently assigned a numerical value by the 13 samples were then kept at 4°C until used for PCR analyses. dermatopathologists according to a 4-category scale, with0=nodysplasia, 1 = mild dysplasia, 2 = moderate dysplasia, 3 = severe dysplasia, and PCR ANALYSES OF p16 ALLELES 4 = melanoma. The ratings for each lesion were averaged across the 13 reviewers in this column. ‡Review by the 13-member dermatopathology panel was not available Nested PCR was used to amplify exons 1 and 2 of the p16 gene. (NA) for these slides. One of us (M.P.) rated both lesions as mildly dysplastic Primers HW1F, HW1R, HW2F, and HW2R were designed based nevi. on the published DNA sequence (GenBank Accession Nos. U12818 and U12819 for exons 1 and 2, respectively; National Center for Biotechnology Information [NCBI], Bethesda, Md). In the present study, we isolated the DNA of the most Primers X59F, X284R, X78F, and X482R were previously de- atypical nevi from a group of melanoma cases by laser- scribed.17 The following primers were used in the first and sec- captured microdissection and screened the coding re- ond round of PCR reactions to amplify exon 1: gion (exons 1 and 2) of CDKN2A for point mutations. First round: This study, which was a component of a larger case- HW1F (5Ј CTGGCTGGTCACCAGAGGGTG 3Ј) control study of melanocytic nevus attributes in pa- HW1R (5Ј CCAATTCCCCTGCAAACTTCG 3Ј) tients with melanoma, used spouses as matched con- Second round: X59F (5Ј CGGCTGCGGAGAGGGGGAGAG 3Ј) trols. In doing so, we further tested the hypothesis that Ј Ј nevi constitute proximal stages in melanocytic tumor pro- X284R (5 CTCCAGAGTCGCCCGCCATCC 3 ) gression and that CDKN2A is centrally involved in the The following primers were used in the first and second initiation of melanoma. round of PCR reactions to amplify exon 2: First round: METHODS X78F (5Ј GGGCTCTACACAAGCTTCCTT 3Ј) HW2R (5Ј TCTGTGCTGGAAAATGAATGCTC 3Ј) Second round: PREPARATION OF PARAFFIN-EMBEDDED Ј Ј TISSUE SECTIONS HW2F (5 CCACCCTGGCTCTGACCATTC 3 ) X482R (5Ј TTTGGAAGCTCTCAGGGTACA 3Ј) Melanocytic nevi were collected from a series of patients with The locations of all primers in the CDKN2A gene are shown melanoma and matched spouse controls under a protocol ap- in Figure 1. We did not analyze exon 3 because it encodes only proved by the University of Washington (Seattle) institutional 3 amino acids at the carboxyl terminus. The Expand High Fi- review board. The patient population for entry into the study delity PCR System (Roche Diagnostics, Indianapolis, Ind) was consisted of persons 18 years or older recently diagnosed as used for all PCR reactions. Using 10 µL of each sample from the having melanoma, who were referred to the University of Wash- laser-capture microdissection, the PCR reactions were carried out ington Cancer Center for treatment and who had spouses will- with 3 cycles at 95°C for 1 minute, 65°C for 1 minute, and 72°C ing to participate in the study. Complete skin examination iden- for 1 minute, followed by 40 cycles at 95°C for 30 seconds, 64°C tified the largest and most atypical nevus with a macular for 30 seconds, and 72°C for 45 seconds. The reaction mixture component for biopsy sampling from each case and control; from the first round of PCR was purified with the Microcon spin although the most atypical nevus was selected, in some in- columns (Millipore, Burlington, Mass). One tenth of the puri- stances the lesions were not especially atypical. Ten case/ fied product was used for the second round reaction.

(REPRINTED) ARCH DERMATOL/ VOL 141, FEB 2005 WWW.ARCHDERMATOL.COM 178

©2005 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/29/2021 SEQUENCING OF PCR PRODUCTS genes other than CDKN2A are more centrally involved in the genesis of common nevi and their atypical variants. The reaction mixtures were purified with the Microcon col- Although atypical (dysplastic) nevi are much more preva- umns and examined by 2% agarose gel electrophoresis prior lent than melanomas, and they are in most instances stable to the sequencing reactions. Once the presence of the PCR prod- lesions, it is nevertheless thought that they may occasion- ucts was confirmed by gel electrophoresis, the PCR products ally progress to melanoma.1,2,18 This hypothesis derives from were labeled using the Big Dye Sequencing Kit (Applied Bio- systems, Foster City, Calif) for sequencing. The PCR prod- such evidence as serial photographic examination of indi- ucts were sequenced from both 5Ј and 3Ј ends to ensure the vidual nevi and from the frequent spatial proximity of ne- fidelity of the sequence data. vus remnants and melanoma within histological sections.1,19 Remnants of nevi in sections of melanoma are reportedly found at a frequency of approximately 10% to RESULTS greater than 30%, and the association is not a random event, suggesting a precursor-product relationship.20 In a study The nuclei for mutational analysis of the p16 gene were of thin melanomas, histological evidence of an associated obtained from the cells of melanocytic nevi by laser- nevus was found in 51% of cases, and of these, 56% were captured microdissection, as described in the “Meth- atypical nevi and 41% were banal nevi.21 ods” section. Figure 2 depicts the histological appear- The hypothesis that atypical nevi are potential precur- ance of a nevus before and after microdissection of its sors to melanoma predicts that nevi could incur genetic nuclei. Exons 1 and 2 and neighboring intronic regions alterations essential to the initiation and/or progression of of the amplified gene from each case and control sample melanoma. In some studies of DNA ploidy, the atypical were amplified using pairs of forward and reverse prim- nevus cells more frequently contained hyperdiploid DNA ers via a nested approach (Figure 1). An example of one content than did banal nevi,22,23 but they were not char- experiment using laser-captured nevi is shown in acterized by the aneuploidy that is typical of melanoma.23 Figure 3. All PCR pairs used for first and second (nested) Other studies have failed to find abnormal DNA content PCR studies gave amplification products of the pre- in atypical nevi.24,25 In another experimental strategy, the dicted size (data not shown). tumor antigen profile of atypical nevus cells was deter- The sequences for exons 1 and 2 obtained from nested mined to be intermediate between that of common nevus PCR amplification of the 10 pairs of melanoma cases and cells and melanoma, such that the expression levels of the spouse controls were aligned with the published genomic tumor-related antigens, epidermal growth factor and nerve sequences of p16 (see “Methods” section) by use of the NCBI growth factor receptors, increased progressively from me- Blast program. No sequence mutations were identified in any of the atypical nevi or normal control tissue samples. ATG 5´ 3´ COMMENT E1 E2 E3 HW1F HW1R X59F X284R The failure to find any CDKN2A coding sequence muta- X78F HW2R tions within this series of 20 atypical nevi indicates that HW2F X482R point mutations or small deletions must be quite uncom- 274F mon in the melanocytic cells of those lesions (ie,Ͻ5% 343R prevalence). A caveat is that the study design would not Coding Regions have detected large hemizygous deletions involving one of the CDKN2A alleles, if such genetic alterations had been Figure 1. Forward and reverse primers for amplification of exonic 1 and 2 present. Nonetheless, our data suggest that mutations in sequences of the CDKN2A gene from the melanoma case and control nevi.

A B

Figure 2. Histological appearance of a nevus before (A) and after (B) microdissection of its nuclei.

(REPRINTED) ARCH DERMATOL/ VOL 141, FEB 2005 WWW.ARCHDERMATOL.COM 179

1. Clark WH Jr, Elder DE, Guerry D, Epstein MN, Greene MH, van Horn M. A study of tumor progression: the precursor lesions of superficial spreading and nodu- lar melanoma. Hum Pathol. 1984;15:1147-1165. 1 and 8: MW Markers 2. Piepkorn M. Melanoma genetics: an update with focus on the CDKN2A(p16)/ ARF tumor suppressors. J Am Acad Dermatol. 2000;42:705-722. 2 and 5: Control DNA 3. Keller-Melchior R, Schmidt R, Piepkorn M. Expression of the tumor suppressor 3 and 6: 2498493 gene product p16INK4 in benign and malignant melanocytic lesions. J Invest Dermatol. 1998;110:932-938. 4 and 7: 2598404 4. Grover R, Chana JS, Wilson GD, Richman PI, Samders R. An analysis of p16 protein expression in sporadic malignant melanoma. Melanoma Res. 1998; 8:267-272. 5. Sparrow LE, Eldon MJ, English DR, Heenan PJ. p16 and p21 WAF1 protein expression in melanocytic tumors by immunohistochemistry. Am J Dermatopathol. 1998;20:255-261. E1 E2 6. Puig S, Ruiz A, Castel T, et al. Inherited susceptibility to several cancers but ab- sence of linkage between dysplastic nevus syndrome and CDKN2A in a melanoma family with a mutation in the CDKN2A (P16INK4A) gene. Hum Genet. 1997; Figure 3. Exonic 1 and 2 (E1 and E2) fragments from the nested polymerase 101:359-364. chain reactions. MW indicates molecular weight. Code numbers 2498493 7. Barrett JH, Gaut R, Wachsmuth R, Newton Bishop JA, Bishop T. Linkage and and 2598404 corresponding to lanes 3, 6 and 4, 7, respectively, refer to the association analysis of nevus density and the region containing the melanoma amplified exonic fragments obtained from samples of 2 separate nevus gene CDKN2A in UK twins. Br J Cancer. 2003;88:1920-1924. specimens. 8. Welch J, Millar D, Goldman A, et al. Lack of genetic and epigenetic changes in CDKN2A in melanocytic nevi. J Invest Dermatol. 2001;117:383-384. 9. Papp T, Pemsel H, Rollwitz I, et al. Mutational analysis of N-ras, p53, CDKN2A lanocytes, banal nevus cells, atypical nevus cells, radial (p16INK4a), p14ARF, CDK4, and MC1R genes in human dysplastic melanocytic nevi. growth phase melanoma, vertical growth phase mela- J Med Genet. 2003;40:e14. 26 10. Park WS, Vortmeyer AO, Pack S, et al. Allelic deletion at chromosome 9p21 noma, and metastatic melanoma. (p16) and 17p13(p53) in microdissected sporadic dysplastic nevus. Hum Pathol. Taken together with other lines of evidence,3,6-9 the 1998;29:127-130. 11. Boni R, Zhuang Z, Albuquergue A, Vortmeyer A, Duray P. Loss of heterozygos- present data support the hypothesis that acquired or germ- ity detected on 1p and 9qin microdissected atypical nevi. Arch Dermatol. 1998; line sequence variations in the coding or enhancing/ 134:882-883. promoting regions of the CDKN2A (p16) gene are not the 12. Birindelli S, Tragni G, Bartoli C, et al. Detection of microsatellite alterations in the spectrum of melanocytic nevi in patients with or without individual or family major genetic determinants of the atypical nevus phe- history of melanoma. Int J Cancer. 2000;86:255-261. notype. This is not to say, however, that nevi do not share 13. Tran TP, Titus-Ernstoff L, Perry AE, Ernstoff MS, Newsham IF. Alteration of chromosome 9p21 and/or p16 in benign and dysplastic nevi suggests a role in early mela- in genetic lesions at loci involved more distally in tumor noma progression (United States). Cancer Causes Control. 2002;13:675-682. progression. In this regard, recent interest has come to 14. Bogdan I, Smolle J, Kerl H, Burg G, Boni R. Melanoma ex naevo: a study of the be focused on BRAF, a proto-oncogene functioning in the associated naevus. Melanoma Res. 2003;13:213-217. 15. Korabiowska M, Brinck U, Ruschenburg I, Dengler H, Droese M, Berger H. ras pathway of cell proliferation control. Initial and con- Expression of DNA mismatch repair genes in naevi. In Vivo. 1999;13:251-254. firmatory reports have described activating mutations in 16. Hussein MR, Sun M, Tuthill RJ, et al. Comprehensive analysis of 112 melano- the coding region of that gene within melanocytic nevi, cytic skin lesions demonstrates microsatellite instability in melanomas and dysplastic nevi, but not in benign nevi. J Cutan Pathol. 2001;28:343-350. as well as within melanoma cells, at a sufficiently high 17. Kumar R, Lundh Rozell B, Louhelainen J, Hemminki K. Mutations in the CDKN2A frequency to indicate a common role in melanocytic tu- (p16INK4a) gene in microdissected sporadic primary melanomas. Int J Cancer. 1998; 27-30 30 75:193-198. mor progression. Kumar et al also reported activat- 18. Seykora J, Elder D. Dysplastic nevi and other risk markers for melanoma. Semin ing ras mutations in several nevi, some in association with Oncol. 1996;23:682-687. BRAF mutations, further implicating the ras/BRAF path- 19. Greene MH, Clark WH Jr, Tucker MA, et al. Acquired precursors of cutaneous malignant melanoma: the familial dysplastic nevus syndrome. N Engl J Med. 1985; way in early genetic events that lead to melanoma. It is 312:91-97. reasonable to expect that future molecular studies will 20. Smolle J, Kaddu S, Kerl H. Non-random spatial association of melanoma and nevi—a morphometric analysis. Melanoma Res. 1999;9:407-412. identify additional genetic elements targeted for activat- 21. Skender-Kalnenas TM, English DR, Heenan PJ. Benign melanocytic lesions: risk ing or deactivating mutations in both nevus and mela- markers or precursors of cutaneous melanoma. J Am Acad Dermatol. 1995; noma cells that could reflect shared pathways in onco- 33:1000-1007. 22. Bergman W, Ruiter DJ, Scheffer E, van Vloten WA. Melanocytic atypia in dys- genic development, thus providing further insight into plastic nevi: immunohistochemical and cytophotometrical analysis. Cancer. 1988; the molecular mechanisms of transformation and pro- 61:1660-1666. 23. Fleming MG, Wied GL, Dytch HE. Image analysis cytometry of dysplastic nevi. gression in melanocytes. J Invest Dermatol. 1990;95:287-291. 24. Sangueza OP, Hyder DM, Bakke AC, White CR Jr. DNA determination in dysplas- Accepted for Publication: November 7, 2004. tic nevi: a comparative study between flow cytometry and image analysis. Am J Dermatopathol. 1993;15:99-105. Correspondence: Michael Piepkorn, MD, PhD, Divi- 25. Bjornhagen V, Bonfoco E, Brahme EM, Lindholm J, Auer G. Morphometric, DNA, sion of Dermatology, Box 356524, University of Wash- and proliferating cell nuclear antigen measurements in benign melanocytic lesions and cutaneous malignant melanoma. Am J Dermatopathol. 1994;16: ington, Seattle, WA 98195 ([email protected] 615-623. .edu). 26. Elder DE, Rodeck U, Thurin J, et al. Antigenic profile of tumor progression stages Funding/Support: Dr Wang was supported by Derma- in human melanocytic nevi and melanomas. Cancer Res. 1989;49:5091-5096. 27. Yazdi AS, Palmedo G, Flaig MJ, et al. Mutations of the BRAF gene in benign and tology Training Grant T32 AR07019 from the National malignant melanocytic lesions. J Invest Dermatol. 2003;121:1160-1162. Institutes of Health, Bethesda, Md, and by the Carl J. Her- 28. Arbiser JL. Activation of B-raf in non-malignant nevi predicts a novel tumor suppressor gene in melanoma (MAP kinase phosphatase). J Invest Dermatol. 2003; zog Foundation, Stamford, Conn. 121:xiv. Acknowledgment: We acknowledge the members of the 29. Uribe P, Wistuba II, Gonzalez S. BRAF mutation: a frequent event in benign, atypi- North American Melanoma Pathology Study Group for cal, and malignant melanocytic lesions of the skin. Am J Dermatopathol. 2003; 25:365-370. their review and classification of the melanocytic nevi used 30. Kumar R, Angelini S, Snellman E, Hemminki K. BRAF mutations are common in the analyses. somatic events in melanocytic nevi. J Invest Dermatol. 2004;122:342-348.

(REPRINTED) ARCH DERMATOL/ VOL 141, FEB 2005 WWW.ARCHDERMATOL.COM 180