DOCSLIB.ORG

Mouse Gcfc2 Conditional Knockout Project (CRISPR/Cas9)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mouse Gcfc2 Conditional Knockout Project (CRISPR/Cas9) https://www.alphaknockout.com Mouse Gcfc2 Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Gcfc2 conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Gcfc2 gene (NCBI Reference Sequence: NM_177884 ; Ensembl: ENSMUSG00000035125 ) is located on Mouse chromosome 6. 17 exons are identified, with the ATG start codon in exon 1 and the TGA stop codon in exon 17 (Transcript: ENSMUST00000043195). Exon 5 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Gcfc2 gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP23-442L23 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Exon 5 starts from about 29.69% of the coding region. The knockout of Exon 5 will result in frameshift of the gene. The size of intron 4 for 5'-loxP site insertion: 2994 bp, and the size of intron 5 for 3'-loxP site insertion: 3358 bp. The size of effective cKO region: ~616 bp. The cKO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele gRNA region 5' gRNA region 3' 1 5 17 Targeting vector Targeted allele Constitutive KO allele (After Cre recombination) Legends Exon of mouse Gcfc2 Homology arm cKO region loxP site Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats. No significant tandem repeat is found in the dot plot matrix. So this region is suitable for PCR screening or sequencing analysis. Overview of the GC Content Distribution Window size: 300 bp Sequence 12 Summary: Full Length(7116bp) | A(26.48% 1884) | C(19.83% 1411) | T(32.39% 2305) | G(21.3% 1516) Note: The sequence of homologous arms and cKO region is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Page 3 of 8 https://www.alphaknockout.com BLAT Search Results (up) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr6 + 81932657 81935656 3000 browser details YourSeq 173 1493 1667 3000 99.5% chrX - 36466504 36466678 175 browser details YourSeq 104 351 827 3000 80.0% chr5 + 147746729 147747173 445 browser details YourSeq 91 709 899 3000 88.9% chr14 - 70822160 70822354 195 browser details YourSeq 74 355 831 3000 71.7% chr17 - 48742224 48742662 439 browser details YourSeq 72 761 909 3000 87.5% chr11 + 69315796 69315949 154 browser details YourSeq 64 709 867 3000 81.4% chr5 + 117186629 117186957 329 browser details YourSeq 59 725 867 3000 87.4% chr13 - 76014115 76014257 143 browser details YourSeq 59 711 830 3000 84.8% chr1 + 166108468 166108748 281 browser details YourSeq 58 730 830 3000 82.4% chr1 - 79662300 79662391 92 browser details YourSeq 55 728 830 3000 86.6% chr6 - 82809716 82809816 101 browser details YourSeq 54 709 830 3000 92.2% chr1 - 192660416 192660570 155 browser details YourSeq 54 734 844 3000 89.8% chr1 + 87303822 87303934 113 browser details YourSeq 53 707 775 3000 85.3% chr7 + 91524710 91524777 68 browser details YourSeq 53 1145 1236 3000 79.4% chr13 + 43692395 43692487 93 browser details YourSeq 52 732 842 3000 86.2% chrX - 36032664 36032776 113 browser details YourSeq 52 698 775 3000 83.4% chr19 - 31156124 31156201 78 browser details YourSeq 52 1148 1350 3000 93.3% chr12 + 79417985 79418412 428 browser details YourSeq 50 709 780 3000 84.8% chrX - 163213165 163213236 72 browser details YourSeq 50 1201 1264 3000 89.1% chr5 - 129667498 129667561 64 Note: The 3000 bp section upstream of Exon 5 is BLAT searched against the genome. No significant similarity is found. BLAT Search Results (down) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr6 + 81936273 81939272 3000 browser details YourSeq 138 360 558 3000 86.2% chr10 - 93496906 93497078 173 browser details YourSeq 131 383 616 3000 86.6% chr16 - 24959408 24959640 233 browser details YourSeq 130 355 558 3000 81.6% chr15 - 42876589 42876759 171 browser details YourSeq 124 360 558 3000 84.8% chr12 + 95099058 95099236 179 browser details YourSeq 123 382 558 3000 89.0% chr16 + 88055032 88055201 170 browser details YourSeq 121 393 558 3000 88.1% chr3 - 88705253 88705420 168 browser details YourSeq 118 383 558 3000 86.1% chr18 + 27993938 27994121 184 browser details YourSeq 118 383 558 3000 82.0% chr11 + 58202233 58202391 159 browser details YourSeq 117 407 558 3000 90.6% chr1 - 171432537 171432693 157 browser details YourSeq 117 37 558 3000 78.5% chr13 + 38051846 38052032 187 browser details YourSeq 117 381 558 3000 81.8% chr13 + 29001380 29001549 170 browser details YourSeq 116 408 558 3000 89.4% chr11 - 20809404 20809559 156 browser details YourSeq 116 409 558 3000 93.4% chr5 + 122409518 122409679 162 browser details YourSeq 116 382 547 3000 83.5% chr18 + 22898691 22898838 148 browser details YourSeq 115 392 558 3000 84.6% chr6 - 51521896 51522059 164 browser details YourSeq 115 407 575 3000 88.4% chr3 + 62568991 62569169 179 browser details YourSeq 115 414 558 3000 91.0% chr15 + 79207112 79207260 149 browser details YourSeq 115 381 558 3000 85.7% chr12 + 68156597 68156766 170 browser details YourSeq 115 383 558 3000 88.3% chr10 + 38382942 38383128 187 Note: The 3000 bp section downstream of Exon 5 is BLAT searched against the genome. No significant similarity is found. Page 4 of 8 https://www.alphaknockout.com Gene and protein information: Gcfc2 GC-rich sequence DNA binding factor 2 [ Mus musculus (house mouse) ] Gene ID: 330361, updated on 12-Aug-2019 Gene summary Official Symbol Gcfc2 provided by MGI Official Full Name GC-rich sequence DNA binding factor 2 provided by MGI Primary source MGI:MGI:2141656 See related Ensembl:ENSMUSG00000035125 Gene type protein coding RefSeq status VALIDATED Organism Mus musculus Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus Also known as GCF2; Tcf9; AW146020; A130099G21 Expression Ubiquitous expression in CNS E11.5 (RPKM 5.4), limb E14.5 (RPKM 4.3) and 27 other tissues See more Orthologs human all Genomic context Location: 6; 6 C3 See Gcfc2 in Genome Data Viewer Exon count: 22 Annotation release Status Assembly Chr Location 108 current GRCm38.p6 (GCF_000001635.26) 6 NC_000072.6 (81910562..81959098) Build 37.2 previous assembly MGSCv37 (GCF_000001635.18) 6 NC_000072.5 (81873663..81909092) Chromosome 6 - NC_000072.6 Page 5 of 8 https://www.alphaknockout.com Transcript information: This gene has 8 transcripts Gene: Gcfc2 ENSMUSG00000035125 Description GC-rich sequence DNA binding factor 2 [Source:MGI Symbol;Acc:MGI:2141656] Gene Synonyms AW146020 Location Chromosome 6: 81,923,669-81,959,915 forward strand. GRCm38:CM000999.2 About this gene This gene has 8 transcripts (splice variants), 227 orthologues, 1 paralogue and is a member of 1 Ensembl protein family. Transcripts Name Transcript ID bp Protein Translation ID Biotype CCDS UniProt Flags Gcfc2- ENSMUST00000043195.10 4192 769aa ENSMUSP00000035644.4 Protein coding CCDS20260 Q8BKT3 TSL:1 201 GENCODE basic APPRIS P1 Gcfc2- ENSMUST00000203959.1 630 175aa ENSMUSP00000144868.1 Protein coding - A0A0N4SUY0 CDS 5' 207 incomplete TSL:3 Gcfc2- ENSMUST00000152996.7 3519 263aa ENSMUSP00000138136.1 Nonsense mediated - S4R198 TSL:1 206 decay Gcfc2- ENSMUST00000132301.1 2429 No - Retained intron - - TSL:1 204 protein Gcfc2- ENSMUST00000127949.1 1953 No - Retained intron - - TSL:1 202 protein Gcfc2- ENSMUST00000129678.1 641 No - Retained intron - - TSL:3 203 protein Gcfc2- ENSMUST00000147673.1 612 No - Retained intron - - TSL:3 205 protein Gcfc2- ENSMUST00000204691.1 453 No - Retained intron - - TSL:NA 208 protein Page 6 of 8 https://www.alphaknockout.com 56.25 kb Forward strand 81.92Mb 81.93Mb 81.94Mb 81.95Mb 81.96Mb Genes (Comprehensive set... Gcfc2-201 >protein coding Gcfc2-206 >nonsense mediated decay Gcfc2-204 >retained intron Gcfc2-207 >protein coding Gcfc2-208 >retained intron Gcfc2-202 >retained intronGcfc2-203 >retained intron Gcfc2-205 >retained intron Contigs < AC129024.4 Genes < Mrpl19-201protein coding (Comprehensive set... < Mrpl19-202retained intron < Mrpl19-203lncRNA Regulatory Build 81.92Mb 81.93Mb 81.94Mb 81.95Mb 81.96Mb Reverse strand 56.25 kb Regulation Legend CTCF Open Chromatin Promoter Promoter Flank Transcription Factor Binding Site Gene Legend Protein Coding merged Ensembl/Havana Ensembl protein coding Non-Protein Coding RNA gene processed transcript Page 7 of 8 https://www.alphaknockout.com Transcript: ENSMUST00000043195 36.25 kb Forward strand Gcfc2-201 >protein coding ENSMUSP00000035... MobiDB lite Low complexity (Seg) Coiled-coils (Ncoils) Pfam GC-rich sequence DNA-binding factor-like domain PANTHER GC-rich sequence DNA-binding factor PTHR12214:SF3 All sequence SNPs/i... Sequence variants (dbSNP and all other sources) Variant Legend inframe deletion missense variant synonymous variant Scale bar 0 80 160 240 320 400 480 560 640 769 We wish to acknowledge the following valuable scientific information resources: Ensembl, MGI, NCBI, UCSC. Page 8 of 8.
Load more

Recommended publications
  • C2orf3 (GCFC2) (NM 001201334) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG234563 C2orf3 (GCFC2) (NM_001201334) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: C2orf3 (GCFC2) (NM_001201334) Human Tagged ORF Clone Tag: TurboGFP Symbol: GCFC2 Synonyms: C2orf3; DNABF; GCF; TCF9 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 C2orf3 (GCFC2) (NM_001201334) Human Tagged ORF Clone – RG234563 ORF Nucleotide >RG234563 representing NM_001201334 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAAGAGAGAGAGCGAAGATGACCCTGAGAGTGAGCCTGATGACCATGAAAAGAGAATACCATTTACTC TAAGACCTCAAACACTTAGACAAAGGATGGCTGAGGAATCAATAAGCAGAAATGAAGAAACAAGTGAAGA AAGTCAGGAAGATGAAAAGCAAGATACTTGGGAACAACAGCAAATGAGGAAAGCAGTTAAAATCATAGAG GAAAGAGACATAGATCTTTCCTGTGGCAATGGATCTTCAAAAGTGAAGAAATTTGATACTTCCATTTCAT TTCCGCCAGTAAATTTAGAAATTATAAAGAAGCAATTAAATACTAGATTAACATTACTACAGGAAACTCA CCGCTCACACCTGAGGGAGTATGAAAAATACGTACAAGATGTCAAAAGCTCAAAGAGTACCATCCAGAAC CTAGAGAGTTCATCAAATCAAGCTCTAAATTGTAAATTCTATAAAAGCATGAAAATTTATGTGGAAAATT TAATTGACTGCCTTAATGAAAAGATTATCAACATCCAAGAAATAGAATCATCCATGCATGCACTCCTTTT
    [Show full text]
  • Table SI. Genes Upregulated ≥ 2-Fold by MIH 2.4Bl Treatment Affymetrix ID
    Table SI. Genes upregulated 2-fold by MIH 2.4Bl treatment Fold UniGene ID Description Affymetrix ID Entrez Gene Change 1558048_x_at 28.84 Hs.551290 231597_x_at 17.02 Hs.720692 238825_at 10.19 93953 Hs.135167 acidic repeat containing (ACRC) 203821_at 9.82 1839 Hs.799 heparin binding EGF like growth factor (HBEGF) 1559509_at 9.41 Hs.656636 202957_at 9.06 3059 Hs.14601 hematopoietic cell-specific Lyn substrate 1 (HCLS1) 202388_at 8.11 5997 Hs.78944 regulator of G-protein signaling 2 (RGS2) 213649_at 7.9 6432 Hs.309090 serine and arginine rich splicing factor 7 (SRSF7) 228262_at 7.83 256714 Hs.127951 MAP7 domain containing 2 (MAP7D2) 38037_at 7.75 1839 Hs.799 heparin binding EGF like growth factor (HBEGF) 224549_x_at 7.6 202672_s_at 7.53 467 Hs.460 activating transcription factor 3 (ATF3) 243581_at 6.94 Hs.659284 239203_at 6.9 286006 Hs.396189 leucine rich single-pass membrane protein 1 (LSMEM1) 210800_at 6.7 1678 translocase of inner mitochondrial membrane 8 homolog A (yeast) (TIMM8A) 238956_at 6.48 1943 Hs.741510 ephrin A2 (EFNA2) 242918_at 6.22 4678 Hs.319334 nuclear autoantigenic sperm protein (NASP) 224254_x_at 6.06 243509_at 6 236832_at 5.89 221442 Hs.374076 adenylate cyclase 10, soluble pseudogene 1 (ADCY10P1) 234562_x_at 5.89 Hs.675414 214093_s_at 5.88 8880 Hs.567380; far upstream element binding protein 1 (FUBP1) Hs.707742 223774_at 5.59 677825 Hs.632377 small nucleolar RNA, H/ACA box 44 (SNORA44) 234723_x_at 5.48 Hs.677287 226419_s_at 5.41 6426 Hs.710026; serine and arginine rich splicing factor 1 (SRSF1) Hs.744140 228967_at 5.37
    [Show full text]
  • Structural Variant Calling by Assembly in Whole Human Genomes: Applications in Hypoplastic Left Heart Syndrome by Matthew Kendzi
    STRUCTURAL VARIANT CALLING BY ASSEMBLY IN WHOLE HUMAN GENOMES: APPLICATIONS IN HYPOPLASTIC LEFT HEART SYNDROME BY MATTHEW KENDZIOR THESIS Submitted in partial FulFillment oF tHe requirements for the degree of Master of Science in BioinFormatics witH a concentration in Crop Sciences in the Graduate College of the University oF Illinois at Urbana-Champaign, 2019 Urbana, Illinois Master’s Committee: ProFessor MattHew Hudson, CHair ResearcH Assistant ProFessor Liudmila Mainzer ProFessor SaurabH SinHa ABSTRACT Variant discovery in medical researcH typically involves alignment oF sHort sequencing reads to the human reference genome. SNPs and small indels (variants less than 50 nucleotides) are the most common types oF variants detected From alignments. Structural variation can be more diFFicult to detect From short-read alignments, and thus many software applications aimed at detecting structural variants From short read alignments have been developed. However, these almost all detect the presence of variation in a sample using expected mate-pair distances From read data, making them unable to determine the precise sequence of the variant genome at the speciFied locus. Also, reads from a structural variant allele migHt not even map to the reference, and will thus be lost during variant discovery From read alignment. A variant calling by assembly approacH was used witH tHe soFtware Cortex-var for variant discovery in Hypoplastic Left Heart Syndrome (HLHS). THis method circumvents many of the limitations oF variants called From a reFerence alignment: unmapped reads will be included in a sample’s assembly, and variants up to thousands of nucleotides can be detected, with the Full sample variant allele sequence predicted.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • GCF (H-87): Sc-366876
    SAN TA C RUZ BI OTEC HNOL OG Y, INC . GCF (H-87): sc-366876 BACKGROUND APPLICATIONS GCF (GC-rich sequence DNA-binding factor), also known as C2orf3 (chro - GCF (H-87) is recommended for detection of GCF of mouse, rat and human mosome 2 open reading frame 3), transcription factor 9 (TCF-9) or DNABF, origin by Western Blotting (starting dilution 1:200, dilution range 1:100- is a 781 amino acid nuclear protein that belongs to the GCF family. Widely 1:1000), immunoprecipitation [1-2 µg per 100-500 µg of total protein (1 ml expressed, GCF binds the GC-rich sequences of β-Actin, EGFR and calcium- of cell lysate)], immunofluorescence (starting dilution 1:50, dilution range dependent protease (CANP) promoters. GCF contains multiple phosphoser - 1:50-1:500) and solid phase ELISA (starting dilution 1:30, dilution range ine and phosphothreonine residues, and two GCF isoforms are produced 1:30- 1:3000). due to alternative splicing events. GCF is considered a candidate for sus - GCF (H-87) is also recommended for detection of GCF in additional species, ceptibility to dyslexia (DYX3) as both genes reside in close proximity on including equine, canine and porcine. human chromosome 2. Chromosome 2 is the second largest human chro - mosome and consists of 237 million bases, encodes over 1,400 genes and Suitable for use as control antibody for GCF siRNA (h): sc-94282, GCF siRNA makes up approximately 8% of the human genome. (m): sc-141404, GCF shRNA Plasmid (h): sc-94282-SH, GCF shRNA Plasmid (m): sc-141404-SH, GCF shRNA (h) Lentiviral Particles: sc-94282-V and GCF REFERENCES shRNA (m) Lentiviral Particles: sc-141404-V.
    [Show full text]
  • Genome-Wide Association Scan Identifies New Variants Associated
    Gialluisi et al. Translational Psychiatry (2019) 9:77 https://doi.org/10.1038/s41398-019-0402-0 Translational Psychiatry ARTICLE Open Access Genome-wide association scan identifies new variants associated with a cognitive predictor of dyslexia Alessandro Gialluisi 1,2,3, Till F. M. Andlauer 1,2, Nazanin Mirza-Schreiber1,KristinaMoll4, Jessica Becker5,6, Per Hoffmann 5,6, Kerstin U. Ludwig 5,6,DarinaCzamara 1,BeateStPourcain 7,8,9, William Brandler10, Ferenc Honbolygó11,DénesTóth11,ValériaCsépe11, Guillaume Huguet12,13, Andrew P. Morris14,15, Jacqueline Hulslander16, Erik G. Willcutt16, John C. DeFries16,RichardK.Olson16, Shelley D. Smith17, Bruce F. Pennington18, Anniek Vaessen19,UrsMaurer20, Heikki Lyytinen21, Myriam Peyrard-Janvid22, Paavo H. T. Leppänen21, Daniel Brandeis23,24,25,26, Milene Bonte19,JohnF.Stein 27,JoelB.Talcott 28, Fabien Fauchereau12,13, Arndt Wilcke29,ClydeFrancks7,8, Thomas Bourgeron12,13, Anthony P. Monaco15,30, Franck Ramus 31, Karin Landerl32,JuhaKere 22,33,34,ThomasS.Scerri15,35, Silvia Paracchini 36,SimonE.Fisher 7,8, Johannes Schumacher5,6,MarkusM.Nöthen5,6, Bertram Müller-Myhsok1,2,37 and Gerd Schulte-Körne4 Abstract Developmental dyslexia (DD) is one of the most prevalent learning disorders, with high impact on school and psychosocial development and high comorbidity with conditions like attention-deficit hyperactivity disorder (ADHD), depression, and anxiety. DD is characterized by deficits in different cognitive skills, including word reading, spelling, 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; rapid naming, and phonology. To investigate the genetic basis of DD, we conducted a genome-wide association study (GWAS) of these skills within one of the largest studies available, including nine cohorts of reading-impaired and typically developing children of European ancestry (N = 2562–3468).
    [Show full text]
  • LILRB1 Intron 1 Has a Polymorphic Regulatory Region That Enhances Transcription in NK Cells and Recruits YY1
    LILRB1 Intron 1 Has a Polymorphic Regulatory Region That Enhances Transcription in NK Cells and Recruits YY1 This information is current as Kang Yu, Chelsea E. Davidson and Deborah N. Burshtyn of October 1, 2021. J Immunol published online 22 April 2020 http://www.jimmunol.org/content/early/2020/04/21/jimmun ol.2000164 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2020/04/21/jimmunol.200016 Material 4.DCSupplemental Why The JI? Submit online. http://www.jimmunol.org/ • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average by guest on October 1, 2021 Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2020 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published April 22, 2020, doi:10.4049/jimmunol.2000164 The Journal of Immunology LILRB1 Intron 1 Has a Polymorphic Regulatory Region That Enhances Transcription in NK Cells and Recruits YY1 Kang Yu,* Chelsea E. Davidson,*,1 and Deborah N. Burshtyn*,†,‡ LILRB1 is a highly polymorphic receptor expressed by subsets of innate and adaptive immune cells associated with viral and autoimmune diseases and targeted by pathogens for immune evasion.
    [Show full text]
  • Genome-Wide Association Scan Identifies
    Gialluisi et al. Translational Psychiatry (2019) 9:77 https://doi.org/10.1038/s41398-019-0402-0 Translational Psychiatry ARTICLE Open Access Genome-wide association scan identifies new variants associated with a cognitive predictor of dyslexia Alessandro Gialluisi 1,2,3, Till F. M. Andlauer 1,2, Nazanin Mirza-Schreiber1,KristinaMoll4, Jessica Becker5,6, Per Hoffmann 5,6, Kerstin U. Ludwig 5,6,DarinaCzamara 1,BeateStPourcain 7,8,9, William Brandler10, Ferenc Honbolygó11,DénesTóth11,ValériaCsépe11, Guillaume Huguet12,13, Andrew P. Morris14,15, Jacqueline Hulslander16, Erik G. Willcutt16, John C. DeFries16,RichardK.Olson16, Shelley D. Smith17, Bruce F. Pennington18, Anniek Vaessen19,UrsMaurer20, Heikki Lyytinen21, Myriam Peyrard-Janvid22, Paavo H. T. Leppänen21, Daniel Brandeis23,24,25,26, Milene Bonte19,JohnF.Stein 27,JoelB.Talcott 28, Fabien Fauchereau12,13, Arndt Wilcke29,ClydeFrancks7,8, Thomas Bourgeron12,13, Anthony P. Monaco15,30, Franck Ramus 31, Karin Landerl32,JuhaKere 22,33,34,ThomasS.Scerri15,35, Silvia Paracchini 36,SimonE.Fisher 7,8, Johannes Schumacher5,6,MarkusM.Nöthen5,6, Bertram Müller-Myhsok1,2,37 and Gerd Schulte-Körne4 Abstract Developmental dyslexia (DD) is one of the most prevalent learning disorders, with high impact on school and psychosocial development and high comorbidity with conditions like attention-deficit hyperactivity disorder (ADHD), depression, and anxiety. DD is characterized by deficits in different cognitive skills, including word reading, spelling, 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; rapid naming, and phonology. To investigate the genetic basis of DD, we conducted a genome-wide association study (GWAS) of these skills within one of the largest studies available, including nine cohorts of reading-impaired and typically developing children of European ancestry (N = 2562–3468).
    [Show full text]
  • Identifying Genetic Signatures of Recent Local Adaptations in People from Ibiza
    Master Thesis UPPSALA UNIVERSITET Identifying genetic signatures of recent local adaptations in people from Ibiza Submitted for the degree of Master of Science Diego Alejandro Londoño Correa Supervised by Elena Bosch (Institute of Evolutionary Biology, CSIC-UPF, Barcelona) Carina Schlebusch (internal supervisor at Uppsala University) March 2021 1 Table of Contents ABSTRACT .................................................................................................................................................. 4 INTRODUCTION ......................................................................................................................................... 5 MATERIALS AND METHODS ....................................................................................................................... 8 Data ....................................................................................................................................................... 8 Quality control ....................................................................................................................................... 8 Pruning linked variants, PCA and Admixture ......................................................................................... 9 Selection Tests ....................................................................................................................................... 9 Control for iHS signals in Iberia ...........................................................................................................
    [Show full text]
  • Dissecting the Genetics of Human Communication
    DISSECTING THE GENETICS OF HUMAN COMMUNICATION: INSIGHTS INTO SPEECH, LANGUAGE, AND READING by HEATHER ASHLEY VOSS-HOYNES Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Epidemiology and Biostatistics CASE WESTERN RESERVE UNIVERSITY January 2017 CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES We herby approve the dissertation of Heather Ashely Voss-Hoynes Candidate for the degree of Doctor of Philosophy*. Committee Chair Sudha K. Iyengar Committee Member William Bush Committee Member Barbara Lewis Committee Member Catherine Stein Date of Defense July 13, 2016 *We also certify that written approval has been obtained for any proprietary material contained therein Table of Contents List of Tables 3 List of Figures 5 Acknowledgements 7 List of Abbreviations 9 Abstract 10 CHAPTER 1: Introduction and Specific Aims 12 CHAPTER 2: Review of speech sound disorders: epidemiology, quantitative components, and genetics 15 1. Basic Epidemiology 15 2. Endophenotypes of Speech Sound Disorders 17 3. Evidence for Genetic Basis Of Speech Sound Disorders 22 4. Genetic Studies of Speech Sound Disorders 23 5. Limitations of Previous Studies 32 CHAPTER 3: Methods 33 1. Phenotype Data 33 2. Tests For Quantitative Traits 36 4. Analytical Methods 42 CHAPTER 4: Aim I- Genome Wide Association Study 49 1. Introduction 49 2. Methods 49 3. Sample 50 5. Statistical Procedures 53 6. Results 53 8. Discussion 71 CHAPTER 5: Accounting for comorbid conditions 84 1. Introduction 84 2. Methods 86 3. Results 87 4. Discussion 105 CHAPTER 6: Hypothesis driven pathway analysis 111 1. Introduction 111 2. Methods 112 3. Results 116 4.
    [Show full text]
  • Dyslexia and Language Impairment Associated Genetic Markers Influence Cortical Thickness and White Matter in Typically Developing Children
    Dyslexia and language impairment associated genetic markers influence cortical thickness and white matter in typically developing children The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Eicher, J. D., A. M. Montgomery, N. Akshoomoff, D. G. Amaral, C. S. Bloss, O. Libiger, N. J. Schork, et al. 2015. “Dyslexia and language impairment associated genetic markers influence cortical thickness and white matter in typically developing children.” Brain imaging and behavior 10 (1): 272-282. doi:10.1007/s11682-015-9392-6. http:// dx.doi.org/10.1007/s11682-015-9392-6. Published Version doi:10.1007/s11682-015-9392-6 Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:26318527 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA HHS Public Access Author manuscript Author Manuscript Author ManuscriptBrain Imaging Author Manuscript Behav. Author Author Manuscript manuscript; available in PMC 2016 March 08. Published in final edited form as: Brain Imaging Behav. 2016 March ; 10(1): 272–282. doi:10.1007/s11682-015-9392-6. Dyslexia and language impairment associated genetic markers influence cortical thickness and white matter in typically developing children John D. Eicher1, Angela M. Montgomery2, Natacha Akshoomoff3,4, David G. Amaral5, Cinnamon S. Bloss6, Ondrej Libiger6, Nicholas J. Schork6, Burcu F. Darst6, B. J. Casey7, Linda Chang8, Thomas Ernst8, Jean Frazier9, Walter E.
    [Show full text]
  • Chromosome Walking: a Novel Approach to Analyse Amino Acid Content of Human Proteins Ordered by Gene Position
    applied sciences Article Chromosome Walking: A Novel Approach to Analyse Amino Acid Content of Human Proteins Ordered by Gene Position Annamaria Vernone , Chiara Ricca, Gianpiero Pescarmona and Francesca Silvagno * Department of Oncology, University of Torino, Via Santena 5 bis, 10126 Torino, Italy; [email protected] (A.V.); [email protected] (C.R.); [email protected] (G.P.) * Correspondence: [email protected] Featured Application: In this work, we designed a new method of data mining, implemented as a free web application, and a novel protein analysis called chromosome walking, which together enhance the information retrieved from protein databases and ensure better exploitation of the huge amount of data collected in protein and genome databases for new potential translational and clinical applications. Abstract: Notwithstanding the huge amount of detailed information available in protein databases, it is not possible to automatically download a list of proteins ordered by the position of their codifying gene. This order becomes crucial when analyzing common features of proteins produced by loci or other specific regions of human chromosomes. In this study, we developed a new procedure that interrogates two human databases (genomic and protein) and produces a novel dataset of ordered proteins following the mapping of the corresponding genes. We validated and implemented the procedure to create a user-friendly web application. This novel data mining was used to evaluate the distribution of critical amino acid content in proteins codified by a human chromosome. For this purpose, we designed a new methodological approach called chromosome walking, which scanned Citation: Vernone, A.; Ricca, C.; the whole chromosome and found the regions producing proteins enriched in a selected amino acid.
    [Show full text]